From ctenophores to scyphozoans: a parasitic spillover of the burrowing sea anemone Edwardsiella (Cnidaria: Actinaria)

From ctenophores to scyphozoans: a parasitic spillover of the burrowing sea anemone Edwardsiella (Cnidaria: Actinaria) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article From ctenophores to scyphozoans: a parasitic spillover of the burrowing sea anemone Edwardsiella (Cnidaria: Actinaria) Anastasiia Iakovleva, Arseniy R. Morov, Dror Angel, Tamar Guy-Haim This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4679529/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Most host-parasite associations are explained by phylogenetically conservative capabilities for host utilization, and therefore parasite switches between distantly related hosts are rare. Here we report the first evidence of a parasitic spillover of the burrowing sea anemone Edwardsiella from the invasive ctenophore Mnemiopsis leidyi to two scyphozoan hosts: the native Mediterranean barrel jellyfish Rhizostoma pulmo and the invasive Indo-Pacific nomad jellyfish Rhopilema nomadica , collected from the Eastern Mediterranean Sea. The Edwardsiella planulae found in these jellyfish were identified using molecular analyses of the mitochondrial 16S and nuclear 18S rRNA genes. Overall, 93 planulae were found on tentacles, oral arms, and inside of the gastrovascular canals of the scyphomedusae, whereas no infection was observed in co-occurring ctenophores. DNA metabarcoding approach indicated seasonal presence of Edwardsiella in the Eastern Mediterranean mesozooplankton, coinciding with jellyfish blooms in the region. Our findings suggest a non-specific parasitic relationship between Edwardsiella and various gelatinous hosts based on shared functionality rather than evolutionary history, potentially driven by shifts in host availability due to jellyfish blooms. This spillover raises questions about the ecological impacts of parasitism on native and invasive scyphozoan hosts and the potential role of Edwardsiella in controlling their populations. Biological sciences/Ecology Biological sciences/Ecology/Biodiversity Biological sciences/Ecology/Invasive species Earth and environmental sciences/Ocean sciences/Marine biology parasite host switching bioinvasion jellyfish larvae Mnemiopsis leidyi Rhopilema nomadica Rhizostoma pulmo Mediterranean Sea Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Many marine sedentary organisms face significant challenges when dispersing in the ocean, especially if their pelagic stage is too short or lacks sufficient mobility 1 , 2 . Among these creatures are sea anemones (Actiniaria), globally distributed members of the class Anthozoa in the phylum Cnidaria. Unlike other classes in the phylum, anthozoans form polyps but lack the pelagic medusa stage. The only freely motile stage in their life cycle is a ciliated planula larva, which plays a crucial role in the dispersal of anthozoan populations 3 . The anemone planula is ephemerous—it exists for a short time, from a few days in the starlet sea anemone 4 to two months in table corals 5 . Together with a restricted gamete dispersion due to fertilization dynamics 6 , the short life span of the planula limits the anthozoan dispersal potential and settlement in areas distant from the parental polyps. Several species of burrowing anemones from the family Edwardsiidae (genus Edwardsiella ) cope with restricted dispersal by parasitizing planktonic ctenophores 7 – 10 . This interaction was previously described as facultative 3 , 8 . As in other Anthozoa, polyps of edwardsiids release gametes into the water, where fertilization occurs, and the zygotes develop into planulae. The free-swimming planula of Edwardsiella is pre-parasitic 8 and can infect ctenophores either by burrowing through the epidermis 7 or through the gastrodermal wall, after being ingested by the host 11 . Inside the host mesoglea, the parasitic planula grows and becomes elongated (vermiform). Its body is not differentiated into distinct regions, but a planula possesses a mouth and a pharynx 8 . The vermiform parasitic stage undergoes a body remodeling and generates a post-parasitic planula. This stage leaves the host and can re-infect other hosts, in which case it returns to the parasitic body plan, or can develop into a polyp and settle on the seafloor 12 . One host can harbor one or numerous parasitic edwardsiids 7 – 10 . Ctenophore infection of Edwardsiella was first recorded in the warty comb jelly Mnemiopsis leidyi in the Northwest Atlantic in 1898 by Verrill 13 . However, he described the parasitic planula and adult polyp as different species: the polyp stage was assigned to Edwardsia lineata 14 and the parasitic stage – to Edwardsiella lineata 13 . Later, Crowell showed that these two stages belong to one anemone species by rearing the larvae to the adult polyps 7 . Reitzel et al. 12 sampled three ctenophore species in the Northwest Atlantic and found E. lineata in two— M. leidyi and Beroe ovata . Edwardsiella parasites were excised from both ctenophore species and exposed to uninfected ctenophores. Reitzel et al. 12 found a strong preference of Edwardsiella to M. leidyi and concluded that M. leidyi is likely the only natural host. The presence of Edwardsiella inside B. ovata was explained by the predation of M. leidyi by B. ovata 12 . The comb jelly M. leidyi is native to the western Atlantic and has spread over the past four decades to the Black, Azov, Caspian, Baltic and North seas 15 – 18 . In the Mediterranean Sea, M. leidyi was first recorded in the western Aegean Sea in 1990 19 , and by 2009, it had spread throughout the entire Mediterranean Sea 20 . Thus, it was not before 2007, one year after the first documentation of M. leidyi in the North Sea 21 , when Edwardsiella was recorded in M. leidyi in the North Sea 9 . Parasitic spillover happens when a parasite endemic to one host species infects a new host 22 , 23 . Such host switches can occur from invasive to native species in the invaded ecosystem 24 . As most host-parasite associations are explained by phylogenetically conservative capabilities for host utilization 25 , parasite switches between distantly related hosts were found to be infrequent 26 , 27 . Here, we report for the first time a parasitic spillover of Edwardsiella from the ctenophore M. leidyi to two scyphozoan hosts—the native Mediterranean barrel jellyfish Rhizostoma pulmo , and the invasive Indo-Pacific nomad jellyfish Rhopilema nomadica . We applied molecular identification of Edwardsiella planulae and described their morphology at successive developmental stages. In addition, we used DNA metabarcoding approach of bulk mesozooplankton samples to indicate the seasonality of the parasitic infection and discussed the potential implications of this spillover. Results In total, 93 planulae of Edwardsiella sp. were found in four R. nomadica and one R. pulmo (Fig. 1 a, b). In both species of medusa, the parasitic planulae were located on the tentacles, oral arms, and in the subumbrella (Fig. 1 c), and two individuals of R. nomadica contained planulae inside gastro-vascular canals. The first observations of planulae in R. nomadica were at the end of March 2024 (temperature 19.4 ºC, salinity 38.7 ppt). Later, in the middle of April 2024 (temperature 22.2 ºC, salinity 39.1 ppt), planulae were found in R. pulmo , when these medusae began to appear off the coast of Israel. In total, 86 planulae were found in R. nomadica and 7 planulae in R. pulmo . None of the ctenophore specimens examined was infected with Edwardsiella parasites. Morphology of planulae Most planulae had slightly flattened spherical bodies, were semi-transparent, and were greyish/yellow (Fig. 1 d, e). Diameter of the planulae ranged between 400–600 µm. All individuals had a mouth opening in the center of the body (Fig. 1 e). In the planulae, two epithelial layers (epidermal and gastrodermal) and a thin layer of mesoglea were distinguishable. Epidermis and gastrodermis were extensively ciliated (Fig. 1 g, h; Supplementary video1). Two larger specimens (750 µm and 600 µm) had eight developing mesenteries (Fig. 1 d). The gastrovascular cavity was filled with vacuolated spheres that resembled lipid droplets. Several planulae were found to have vermiform (worm-like) bodies ≥ 1.5 mm length and ≥ 360 µm diameter (Fig. 1 f). Vermiform planulae had distinguishable oral end, and aboral end. In the lab, once excised from the medusae, the planulae swam freely in the seawater (Supplementary Material Video 2). Molecular analyses We compared the 16S rRNA and 18S rRNA gene sequences amplified from the DNA of the planulae collected in this study with available sequences of other Anthozoa in the NCBI. BLASTn search showed the highest identity of the 16S rRNA and 18S rRNA gene sequences with the family Edwardsiidae ( Nematostella, Edwardsia, Edwardsiella, Scolanthus , and Edwardsianthus ). The ML trees based on the 16S (Fig. 2 ) and 18S (Fig. 3 ) rRNA gene sequences confirmed that the planulae from both medusae form a cluster within Edwardsiidae and belong to the genus Edwardsiella . Two 18S rRNA ASVs classified as Edwardsiidae (100% identity, Blastn, deposited in GenBank as accession numbers PP955977 and PP955978) were found in the High-Throughput Sequences of the mesozooplankton samples collected from Hadera (0–26 m) in July 2020, and from Haifa Section stations H01 (0–50 m), H02 (150 − 100 m), and H04 (800 − 500 m) in August 2022. All duplicates (subsamples) fully corresponded, thus providing the same indication of the presence/absence of edwardsiid anemones. These sampling events co-occurred with blooms of R. nomadica . Discussion Our results show, for the first time, a spillover of the parasitic anemone Edwardsiella from the ctenophore Mnemiopsis leidyi to two scyphozoan medusae, the Mediterranean-native barrel jellyfish Rhizostoma pulmo , and the invasive, Indo-Pacific nomad jellyfish Rhopilema nomadica (Fig. 4 ). The Edwardsiella planulae that we found in these medusae were in early successive stages, including pre-parasitic and parasitic planulae, described here for the first time. The pre-parasitic stage included spherical planulae and planulae with developing septa, and the parasitic stage consisted of vermiform planulae. The developmental stage determination was based on the following morphological characters: extensive ciliation, as described by Reitzel et al. 8 ; lack of body region differentiation and no differentiated siphonoglyph; and eight planula mesenteries. Crowell 7 determined that the penetration of the planulae into the host is oral and forward through the epidermis and mesoglea, while Reitzel et al. 11 found that the planulae infect the host via ingestion, through the gastrodermal wall. Here, we found Edwardsiella planulae on the epithelium covering tentacles, on the oral arms, in the subumbrella and in the gastrovascular canals. Since the mesoglea in scyphozoans is thicker and denser than in ctenophores, we propose that Edwardsiella could not penetrate the medusa epithelium and mesoglea as burrowing through these structures is harder and requires more time. Hence, planulae were found on the epithelial surface and inside the gastrovascular canals of the medusae. Three species of Edwardsiella are known in the Mediterranean Sea: E. carnea , E. janthina and E. loveni . Of them, only E. carnea was described as parasitic in Bolinopsis 37 , a high latitude distributed ctenophore, and later in M. leidyi 9 in the Northeast Atlantic. To date, Edwardsiella parasites were not reported in the Mediterranean Sea. Here we suggest that Edwardsiella was introduced with its original host M. leidyi from the East Atlantic waters to the Mediterranean Sea 20 , 38 , reaching the Southeastern Mediterranean. In our study, we found Edwardsiella planulae exclusively in scyphomedusae but not in the ctenophores examined. Parasite host-switch is not a rare phenomenon, yet it is often conservative within phylogenetically related taxa 26 , 27 . Both ctenophores and scyphozoans provide an ample pelagic substrate due to their relatively large size and frequency of appearance in blooms. Thus, it can be inferred that the choice of host by Edwardsiella is non-specific and based on function rather than evolutionary history. Over the past decades, the Eastern Mediterranean waters experienced an intensification of medusan blooms, mostly caused by the scyphozoan R. nomadica 39 – 41 . R. nomadica was first recorded in Israel in 1977 and considered a Lessepsian invader, introduced via the Suez Canal 42 . Since then, it has expanded its distribution westwards and was recorded in Lebanon, Syria, Turkey, Greece, Malta, Tunisia, Egypt, Sardinia, and Sicily 39 , 43 – 47 . This venomous species affects human health, fisheries, nutrient dynamics, coastal recreation and tourism, and pose a threat to coastal installations by clogging intake pipes 48 – 52 .The barrel-jellyfish R. pulmo is the most widespread scyphomedusa in the Mediterranean Sea, with prominent blooms from the western to the eastern basins 53 . In the Eastern Mediterranean, individuals of R. pulmo co-occurr with early summer swarms of R. nomadica 39 . During 2024, the Southeastern Mediterranean experienced consecutive blooms of the scyphomedusae R. nomadica and R. pulmo , while M. leidyi were less frequent and abundant. Therefore, it is possible that due to the shift in host availability, Edwardsiella “spilled over” from ctenophores to scyphomedusae. In laboratory experiments, Edwardsiella planulae excised from its ctenophore host quickly developed into a free-swimming planula larva, that could re-infect another host and assume the parasitic body plan 11 , 12 , or undergo settlement and develop into a free-living polyp 11 , 12 , 54 , 55 . The experimental manipulation was hypothesized to mimic the process that would occur in nature when the host dies, or when the parasite leaves the living host. Following these findings, it was concluded that the interaction between Edwardsiella and M. leidyi is facultative 8 . Nonetheless, there is no evidence of direct development from planulae to polyps of Edwardsiella in nature, without infecting a planktonic host. Our finding of a host-switch from ctenophores to scyphomedusae rather supports an obligate, yet non-specific interaction between Edwardsiella and its diverse gelatinous hosts. Parasites can have adverse impacts on their hosts, affecting their growth, reproduction, behavior, survival, and population dynamics 56 , 57 . Bumann & Puls 58 studied the impacts of the burrowing parasitic anemone E. lineata on the host by comparing infested and non-infested M. leidyi . Non-infested ctenophores had higher growth rates than infested individuals, which had zero or negative growth rates, however no impact on egg production was found. They concluded that E. lineata could be partly responsible for the sharp decline of M. leidyi populations in autumn in US coastal waters, and recommended considering E. lineata as a biological control agent of the introduced M. leidyi populations. Chiaverano et al. 59 reported edwardsiid-like organisms inside Aurelia sp. in Croatia. They concluded that parasitized medusae were significantly smaller and produced fewer but larger oocytes. Nonetheless, neither morphological nor molecular identification of the parasites was provided, thus this finding should be treated with caution. Climate change can impact parasitic stages either directly or indirectly, by affecting the host 60 . The effects of temperature and salinity on the survival and development of vermiform parasitic E. lineata were experimentally tested 61 . Survival was impaired at temperatures above 30 ºC and salinity below 6 ppt. These thresholds do not appear to impede the colonization of the Edwardsiella parasites in the Eastern Mediterranean Sea. Our metabarcoding data from mesozooplankton samples indicated the presence of Edwardsiella in the water column of the Eastern Mediterranean Sea during summer months, when sea surface temperatures exceeded 31 ºC, and salinity was > 40 ppt. R. nomadica medusae are able to endure summer maxima beyond 31 ºC 39 , while R. pulmo medusae prevail in regions with winter minima below 15 ºC 62 , ensuring a widespread distribution of Edwardsiella via these native and invasive scyphomedusan hosts. Further research is required to understand the geographical and taxonomic extent of the parasitic infection of scyphomedusae by Edwardsiella anemone and underpin its host-switch dynamics. Experiments are needed to assess the potential impact of this interaction on scyphozoan growth, reproduction, behavior, and survival. Future climate change may contribute to additional spillover of Edwardsiella among scyphozoans, while potentially controlling their populations. Methods Sample collection and examination The scyphomedusae Rhizostoma pulmo and Rhopilema nomadica and the ctenophores Mnemiopsis leidyi and Beroe ovata were sampled in the Israeli Southeastern Mediterranean Sea at the following sites: Hadera (32.46527 °N, 34.861567°E), Mikhmoret (32.424963°N, 34.848131°E and 32.411922°N, 34.835943 °E), and Shikmona (32.826474°N, 34.956926°E). Animals were sampled intact at 0-1m depths using scoop nets and buckets. Samplings were performed from December 2023 till May 2024. After collection, the medusae and ctenophores were brought to the lab at the National Institute of Oceanography, Israel Oceanographic and Limnological Research (IOLR), for morphometric analysis. For each medusa/ctenophore individual, weight and umbrella diameter/oral-aboral length were measured. A total of 53 medusae (36 individuals of R. nomadica and 17 of R. pulmo ) and 59 ctenophores (16 M. leidyi and 43 B. ovata ) were collected and analyzed alive for the presence of parasites. Whole animals were inspected visually and later dissected into smaller parts for investigation under a stereomicroscope (SZX16, Olympus, Japan). Detected planulae were counted and subsequently studied using a microscope (BX43, Olympus, Japan). Mesozooplankton samples were collected monthly in Hadera and biannually offshore Haifa (Haifa Section) in the framework of the Israeli National Monitoring Program by IOLR. The samples were collected by vertical hauls of WP2 net (Ø=57 cm, Hydro-Bios, Germany) in the coastal stations (depth 15–60 m), and by MultiNet Midi (50x50 cm, Hydro-Bios, Germany) in the offshore stations (100–1500 m depth). The samples were kept at − 20°C pending molecular analysis. DNA extraction, amplification and sequencing After removing anemone planulae from the medusae, the planulae were individually preserved in absolute ethanol for molecular analysis. Total genomic DNA was extracted from five planulae using InviSorb Spin Tissue Mini Kit (Invitek Diagnostics, Germany) according to the manufacturer’s specifications. The amplifications of the following ribosomal RNA genes were performed: nuclear 18S rRNA gene with primers #3F (5’ GYGGTGCATGGCCGTTSKTRGTT 3’) 28 and 9R (5’ GATCCTTCCGCAGGTTCACCTAC 3’) 29 , mitochondrial 16S rRNA gene with primers 16S-L (5' GACTGTTTACCAAAAACATA 3') 30 and Aa_H16S_1541H (5' AGATTTTAATGGTCGAACAGAC 3') 31 . Reaction conditions for 18S rRNA gene amplification were as follows: 94°C for 2 min, followed by 34 cycles of 94°C for 15 s, 49°C for 30 s, and 72°C for 1 min, and a final elongation step of 72°C for 7 min. Reaction conditions for 16S rRNA gene amplification were as follows: 95°C for 5 min followed by 35 cycles of 95°C for 1 min, 45°C for 1 min, and 72°C for 1 min, and a final elongation step of 72°C for 10 min. Obtained PCR products were separated on 1.5% agarose gel and stained with GelRed (Biotium Inc., USA). Purification and Sanger sequencing of the PCR products were performed by Hy Laboratories Ltd. (Rehovot, Israel). Frozen mesozooplankton samples were thawed and processed in duplicates following the protocol described in Guy-Haim et al. 32 . The 18S rRNA gene V9 region (ca. 192 bp) was amplified using 1391F-EukBr primer set 33 amended with CS1/CS2 tags. Library preparation from the PCR products and Next Generation Sequencing (NGS) of 2x150 bp Illumina MiniSeq reads were performed by Hy Laboratories Ltd. (Israel). Bioinformatic and phylogenetic analyses A total of twelve 16S rRNA gene sequences of Hexacorallia were analysed, including two sequences of Edwardsiella sp. planulae obtained in this study, and nine sequences of Edwardsiidae from NCBI GenBank ( https://www.ncbi.nlm.nih.gov/genbank/ ). A sequence of Zoanthus kuroshiro (AB219189) was used as an outgroup. A total of fourteen 18S rRNA gene sequences of Actinaria were analysed, including two sequences of Edwardsiella sp. planula obtained in this study, and twelve sequences of Edwardsiidae from NCBI GenBank. A sequence of Actinia equina (AJ133552) was used as an outgroup. The sequences generated in this study were deposited in GenBank under the accession numbers PP874669 and PP958816 (18S), and PP955979-PP955980 (16S). Sequence alignments were conducted using ClustalW embedded in MEGA v11.0 34 . The best-fitting substitution model was selected according to the Bayesian information criterion using maximum-likelihood (ML) model selection in MEGA. ML analyses were performed using the T92 + G model with 1000 bootstrapping replicates. The NGS demultiplexed paired-end reads were processed in the QIIME2 V2022.2 environment 35 . Reads were truncated based on quality plots, checked for chimeras, merged, and grouped into amplicon sequence variants (ASVs) with DADA2 36 , as implemented in QIIME2. The 18S rRNA amplicons were classified with a scikit-learn classifier that was trained on the Silva 138 database or BLAST against the Silva 138 and PR2 databases (0.9 minimum identity cutoff). Declarations Data Availability Sequence data that support the findings of this study have been deposited in the NCBI GenBank with the accession numbers: PP874669 and PP958816 (18S), PP955979-PP955980 (16S), PP955977- PP955978 (18S v9). Acknowledgements This study was funded by ISF grant no. 1655/21 to T.G.-H and the IOLR National Monitoring Program of the Israeli Mediterranean Sea. A.I. thanks the Bloom Scholarship for Doctoral Studies from the Bloom Graduate School, University of Haifa, Israel. We express our gratitude to Shai Mienis for providing underwater jellyfish photos. We thank Meduzot Ba’am jellyfish observation initiative ( https://www.meduzot.co.il ) and its Facebook group participants for providing up-to-date information on the location of jellyfish. We thank Dr. Jacob Douek for providing 16S primers. Finally, we thank the IOLR sea-going team for their help in sampling. Author contribution statement A.I. and T.G.-H conceived the study, A.I. and A.R.M. collected and analysed the data, A.I. and T.G.-H interpret the findings and wrote original draft. T.G.-H. and D.A. supervised the research. All coauthors reviewed and edited the manuscript. Competing interests The authors declare no competing interests. References Shanks, A. L. Pelagic larval duration and dispersal distance revisited. Biological Bulletin 216, 373–385 (2009). Guy-Haim, T., Hyams-Kaphzan, O., Yeruham, E., Almogi-Labin, A. & Carlton, J. T. A novel marine bioinvasion vector: Ichthyochory, live passage through fish. Limnol Oceanogr Lett 2, 81–90 (2017). Dnyansagar, R. et al. Dispersal and speciation: The cross Atlantic relationship of two parasitic cnidarians. Mol Phylogenet Evol 126, 346–355 (2018). Technau, U. & Steele, R. E. Evolutionary crossroads in developmental biology: Cnidaria. Development 138, 1447–1458 (2011). Nishikawa, A. & Sakai, K. Settlement-competency period of planulae and genetic differentiation of the scleractinian coral Acropora digitifera . Zoolog Sci 22, 391–399 (2005). Marshall, D. J., Semmens, D. & Cook, C. Consequences of spawning at low tide: Limited gamete dispersal for a rockpool anemone. Mar Ecol Prog Ser 266, 135–142 (2004). Crowell, S. An edwardsiid larva parasitic in Mnemiopsis . in Coelenterate ecology and behavior (ed. Mackie, G. O.) 247–250 (Plenum Press, New York, New York, 1976). Reitzel, A. M., Daly, M., Sullivan, J. C. & Finnerty, J. R. Comparative anatomy and histology of developmental and parasitic stages in the life cycle of the lined sea anemone Edwardsiella lineata . Journal of Parasitology 95, 100–112 (2009). Selander, E., Møller, L. F., Sundberg, P. & Tiselius, P. Parasitic anemone infects the invasive ctenophore Mnemiopsis leidyi in the North East Atlantic. Biol Invasions 12, 1003–1009 (2009). Östman, S. C. & Friis Møller, L. Gross morphology and cnidae of edwardsiella anemones and larvae (Anthozoa, Edwardsiidae) from the Swedish West Coast. Acta Zoologica 102, 467–482 (2021). Reitzel, A. M., Sullivan, J. C. & Finnerty, J. R. Qualitative shift to indirect development in the parasitic sea anemone Edwardsiella lineata . Integr Comp Biol 46, 827–837 (2006). Reitzel, A. M. et al. Ecological and developmental dynamics of a host-parasite system involving a sea anemone and two ctenophores. Journal of Parasitology 93, 1392–1402 (2007). Verrill, A. E. Descriptions of new American actinians, with critical notes on other species. Am J Sci 6, 493–498 (1898). Verrill, A. E. Report upon the Invertebrate Animals of Vineyard Sound and Adjacent Waters , with an Account of the Physical Features of the Region. (1873). Harbison, G. R. & Volovik, S. P. The ctenophore, Mnemiopsis leidyi , in the Black Sea: a holoplanktonic organism transported in the ballast water of ships. Nonindigenous Estuarine and Marine Organisms (NEMO) 25–36 (1994). Shiganova, T. A. et al. The invader into the Caspian Sea ctenophore and its initial effect on the pelagic ecosystem. Oceanology (Wash D C) 41, 517–524 (2001). Javidpour, J., Sommer, U. & Shiganova, T. First record of Mnemiopsis leidyi A. Agassiz 1865 in the Baltic Sea. Aquat Invasions 1, 299–302 (2006). Faasse, M. A. & Bayha, K. M. The ctenophore Mnemiopsis leidyi A. Agassiz 1865 in coastal waters of the Netherlands: An unrecognized invasion? Aquat Invasions 1, 270–277 (2006). Shiganova, T. A. et al. Population development of the invader ctenophore Mnemiopsis leidyi , in the Black Sea and in other seas of the Mediterranean basin. Mar Biol 139, 431–445 (2001). Ghabooli, S. et al. Invasion pathway of the ctenophore Mnemiopsis leidyi in the Mediterranean Sea. PLoS One 8, 1–9 (2013). Boersma, M., Malzahn, A. M., Greve, W. & Javidpour, J. The first occurrence of the ctenophore Mnemiopsis leidyi in the North Sea. Helgol Mar Res 61, 153–155 (2007). Daszak, P., Cunningham, A. A. & Hyatt, A. D. Emerging infectious diseases of wildlife - Threats to biodiversity and human health. Science (1979) 287, 443–449 (2000). Goedknegt, M. A. et al. Parasites and marine invasions: Ecological and evolutionary perspectives. Journal of Sea Research vol. 113 11–27 Preprint at https://doi.org/10.1016/j.seares.2015.12.003 (2016). Chalkowski, K., Lepczyk, C. A. & Zohdy, S. Parasite Ecology of Invasive Species: Conceptual Framework and New Hypotheses. Trends Parasitol 34, 655–663 (2018). Hoberg, E. P. & Brooks, D. R. A macroevolutionary mosaic: Episodic host-switching, geographical colonization and diversification in complex host-parasite systems. J Biogeogr 35, 1533–1550 (2008). Gómez, J. M., Verdú, M. & Perfectti, F. Ecological interactions are evolutionarily conserved across the entire tree of life. Nature 465, 918–921 (2010). Horká, I., De Grave, S., Fransen, C. H. J. M., Petrusek, A. & Duriš, Z. Multiple host switching events shape the evolution of symbiotic palaemonid shrimps (Crustacea: Decapoda). Sci Rep 6, 1–13 (2016). Machida, R. J. & Knowlton, N. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences. PLoS One 7, (2012). Giribet, G., Carranza, S., Baguñà, J., Riutort, M. & Ribera, C. First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Mol Biol Evol 13, 76–84 (1996). Ender, A. & Schierwater, B. Placozoa are not derived cnidarians: Evidence from molecular morphology. Mol Biol Evol 20, 130–134 (2003). Bayha, K. M., Dawson, M. N., Collins, A. G., Barbeitos, M. S. & Haddock, S. H. D. Evolutionary relationships among scyphozoan jellyfish families based on complete taxon sampling and phylogenetic analyses of 18S and 28S ribosomal DNA. Integr Comp Biol 50, 436–455 (2010). Guy-Haim, T. et al. A new record of the rapidly spreading calanoid copepod Pseudodiaptomus marinus (Sato, 1913) in the Levantine Sea using multi-marker metabarcoding. Bioinvasions Rec 11, 964–976 (2022). Amaral-Zettler, L. A., McCliment, E. A., Ducklow, H. W. & Huse, S. M. A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA Genes. PLoS One 4, 1–9 (2009). Tamura, K., Stecher, G. & Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38, 3022–3027 (2021). Bolyen, E. et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol 37, 852–857 (2019). Callahan, B. J. et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13, 581–583 (2016). Stephenson, T. A. British Sea Anemones . (The Ray Society, London, 1935). Bolte, S. et al. Population genetics of the invasive ctenophore Mnemiopsis leidyi in Europe reveal source-sink dynamics and secondary dispersal to the Mediterranean Sea. Mar Ecol Prog Ser 485, 25–36 (2013). Edelist, D. et al. Phenological shift in swarming patterns of Rhopilema nomadica in the Eastern Mediterranean Sea. J Plankton Res 42, 211–219 (2020). Edelist, D. et al. Tracking Jellyfish Swarm Origins Using a Combined Oceanographic-Genetic-Citizen Science Approach. Front Mar Sci 9, 1–15 (2022). Katsanevakis, S. et al. Impacts of invasive alien marine species on ecosystem services and biodiversity: A pan-European review. Aquat Invasions 9, 391–423 (2014). Galil, B., Spanier, E. & Ferguson, W. The Scyphomedusae of the Mediterranean coast of Israel, including two Lessepsian migrants new to the Mediterranean. Zoologische Mededelingen 64, 95–105 (1990). Lotan, A., Fine, M. & Benhillel, R. Synchronization of the life cycle and dispersal pattern of the tropical invader Scyphomedusan Rhopilema nomadica is temperature dependent. Mar Ecol Prog Ser 109, 59–66 (1994). Brotz, L. & Pauly, D. Jellyfish populations in the Mediterranean Sea. Acta Adriat 53, 213–231 (2012). Yahia, M. N. D. et al. The invasive tropical scyphozoan Rhopilema nomadica Galil, 1990 reaches the Tunisian coast of the Mediterranean Sea. Bioinvasions Rec 2, 319–323 (2013). El-regal, M. A. & Temraz, T. Blooming of nomad jelly fish Rhopilema nomadica along the Egyptian Mediterranean coasts. Rapport Commission International Mer Mediterrane 41, 490 (2016). Madkour, F. F., Safwat, W. & Hanafy, M. H. Record of Aggregation of Alien Tropical Schyphozoan Rhopilema nomadica Galil, 1990 in the Mediterranean Coast of Egypt. International Marine Science Journal 1, 1–7 (2019). Angel, D. L., Edelist, D. & Freeman, S. Local perspectives on regional challenges: jellyfish proliferation and fish stock management along the Israeli Mediterranean coast. Reg Environ Change 16, 315–323 (2016). Galil, B. Poisonous and Venomous: Marine Alien Species in the Mediterranean Sea and Human Health. in CAB International 2018. Invasive species and human health (eds. Mazza, G. & Tricarico, E.) (2018). doi: 10.1079/9781786390981.0000 . Ghermandi, A., Galil, B., Gowdy, J. & Nunes, P. A. L. D. Jellyfish outbreak impacts on recreation in the Mediterranean Sea: Welfare estimates from a socioeconomic pilot survey in Israel. Ecosyst Serv 11, 140–147 (2015). Guy-Haim, T. et al. The effects of decomposing invasive jellyfish on biogeochemical fluxes and microbial dynamics in an ultra-oligotrophic sea. Biogeosciences 17, 5489–5511 (2020). Rahav, E. et al. Jellyfish swarm impair the pretreatment efficiency and membrane performance of seawater reverse osmosis desalination. Water Res 215, 118231 (2022). Fuentes, V. et al. Life cycle of the jellyfish Rhizostoma pulmo (Scyphozoa: Rhizostomeae) and its distribution, seasonality and inter-annual variability along the Catalan coast and the Mar Menor (Spain, NW Mediterranean). Mar Biol 158, 2247–2266 (2011). Crowell, S. & Oates, S. Metamorphosis and reproduction by transverse fission in an edwardsiid anemone. in Developmental and cellular biology of coelenterates Proceedings of the 4th International Coelenterate Conference (eds. Tardent, P. & Tardent, R.) 139–142 (Elsevier, Amsterdam, 1980). Daly, M. Taxonomy, anatomy, and histology of the lined sea anemone, Edwardsiella lineata (Verrill, 1873) (Cnidaria: Anthozoa: Edwardsiidae). Proceedings of the Biological Society of Washington 115, 868–877 (2002). Dobson, A. P. The population biology of parasite-induced changes in host behavior. Quarterly Review of Biology 63, 139–165 (1988). Lafferty, K. D. & Kuris, A. M. How environmental stress affects the impacts of parasites. Limnol Oceanogr 44, 925–931 (1999). Bumann, D. & Puls, G. Infestation with larvae of the sea anemone Edwardsia lineata affects nutrition and growth of the ctenophore Mnemiopsis leidyi . Parasitology 113, 123–128 (1996). Chiaverano, L. M., Graham, W. M. & Costello, J. H. Parasites alter behavior, reproductive output, and growth patterns of Aurelia medusae in a marine lake. Mar Ecol Prog Ser 540, 87–98 (2015). Byers, J. E. Marine Parasites and Disease in the Era of Global Climate Change. Ann Rev Mar Sci 13, 397–420 (2021). Lee, J. et al. Temperature and Salinity Affect Development of the Parasitic Sea Anemone Edwardsiella lineata Potentially Limiting Its Impact As a Biological Control on the Ctenophore Mnemiopsis leidyi . J Parasitol 109, 574–579 (2023). Leoni, V., Bonnet, D., Ramírez-Romero, E. & Molinero, J. C. Biogeography and phenology of the jellyfish Rhizostoma pulmo (Cnidaria: Scyphozoa) in southern European seas. Global Ecology and Biogeography 30, 622–639 (2021). Additional Declarations No competing interests reported. Supplementary Files SupplementaryVideo1.mp4 SupplementaryVideo2.mp4 Cite Share Download PDF Status: Published Journal Publication published 06 Sep, 2024 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 06 Aug, 2024 Reviews received at journal 26 Jul, 2024 Reviews received at journal 21 Jul, 2024 Reviewers agreed at journal 13 Jul, 2024 Reviewers agreed at journal 11 Jul, 2024 Reviewers invited by journal 11 Jul, 2024 Editor assigned by journal 11 Jul, 2024 Editor invited by journal 11 Jul, 2024 Submission checks completed at journal 08 Jul, 2024 First submitted to journal 03 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4679529","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":325787708,"identity":"7bc480e1-1fdb-4efc-8f07-3c78f6c95c6d","order_by":0,"name":"Anastasiia Iakovleva","email":"","orcid":"","institution":"Israel Oceanographic and Limnological Research","correspondingAuthor":false,"prefix":"","firstName":"Anastasiia","middleName":"","lastName":"Iakovleva","suffix":""},{"id":325787711,"identity":"7c544402-83cc-4a92-a52d-10fab6e458a1","order_by":1,"name":"Arseniy R. Morov","email":"","orcid":"","institution":"Israel Oceanographic and Limnological Research","correspondingAuthor":false,"prefix":"","firstName":"Arseniy","middleName":"R.","lastName":"Morov","suffix":""},{"id":325787713,"identity":"8e9c8223-01d9-44ac-b4aa-b311f95634e7","order_by":2,"name":"Dror Angel","email":"","orcid":"","institution":"University of Haifa","correspondingAuthor":false,"prefix":"","firstName":"Dror","middleName":"","lastName":"Angel","suffix":""},{"id":325787716,"identity":"e5d53f52-36e7-4ec3-92ce-c7dfd9062a5c","order_by":3,"name":"Tamar Guy-Haim","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABD0lEQVRIiWNgGAWjYHADHgaGBAYbJAFm5gYc6lC0pCFrYSRCCwPDYWRJ7Frs2U8nfq5gqE3ccID34IeHOefl+Nubnz1gqLhn18COwxae3M2SZxiOA7XwJUskbrttLHHmmLkBw5ni5AacDsvdINnAcCxxw/03BiAtiRskEswkGNsSknH6hf/t5p9gLQd4jH8kbjuXuEH++Tf8WiRytwFtqQFpMQPacgBoCw/YFjucWm683WbZYHDAeCZQi0XitmSgX3LKJBLOJCSw4dDC3p+7+WZDRZ1sH9BhN39uswOG2PFtEh8qEuz5+Q8fwKYFAgwOMyigSCcwMCS24VYPAnUM8uiOsMevYxSMglEwCkYQAAClnGBfKBDPpAAAAABJRU5ErkJggg==","orcid":"","institution":"Israel Oceanographic and Limnological Research","correspondingAuthor":true,"prefix":"","firstName":"Tamar","middleName":"","lastName":"Guy-Haim","suffix":""}],"badges":[],"createdAt":"2024-07-03 10:06:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4679529/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4679529/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-72168-7","type":"published","date":"2024-09-06T16:06:10+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60098573,"identity":"007eee0c-db8a-4a84-a58f-959704ebf572","added_by":"auto","created_at":"2024-07-11 18:19:02","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1001344,"visible":true,"origin":"","legend":"\u003cp\u003eGeneral view of scyphomedusa hosts \u003cem\u003eRhizostoma pulmo\u003c/em\u003e (\u003cstrong\u003ea\u003c/strong\u003e) and \u003cem\u003eRhopilema nomadica\u003c/em\u003e (\u003cstrong\u003eb\u003c/strong\u003e) and early stages of the \u003cem\u003eEdwardsiella\u003c/em\u003e parasitic planulae (\u003cstrong\u003ec\u003c/strong\u003e-\u003cstrong\u003eg\u003c/strong\u003e) that were found in them. \u003cstrong\u003ec\u003c/strong\u003e. planula (black arrowhead) on the oral arm of \u003cem\u003eR. nomadica\u003c/em\u003e. \u003cstrong\u003ed\u003c/strong\u003e. planulae (pl) with developing septa (se) and vacuolated spheres that resembled lipid droplets (v). \u003cstrong\u003ee\u003c/strong\u003e. spherical planula with mouth (mo). \u003cstrong\u003ef\u003c/strong\u003e. vermiform planula with distinguishable mouth (mo) and aboral end (ab). \u003cstrong\u003eg\u003c/strong\u003e. extensively ciliated (ci) epidermis of spherical planulae. \u003cstrong\u003eh\u003c/strong\u003e. extensively ciliated (ci) epidermis of vermiform planula. um – umbrella (bell), oa – oral arms, tn – tentacles. Scale bar: 1 mm (c), 300 µm (d, e, f), 25 µm (g, h).\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4679529/v1/2d2ed655dd173f5afd2ac7c4.jpeg"},{"id":60098569,"identity":"6b4286a2-d07e-474d-99d7-68033d80a9a4","added_by":"auto","created_at":"2024-07-11 18:19:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":53525,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum-likelihood phylogenetic tree of Edwardsiidae family based on the 16S rRNA gene, using the T92 + G substitution model. The outgroup \u003cem\u003eZoanthus kuroshiro\u003c/em\u003e was used as a root. The numbers near branches indicate the percentage of ML bootstrap support (1000 replicates) for nodes that received at least 60% support. The scale bar denotes the estimated number of nucleotide substitutions per site.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4679529/v1/660066132ef9e995c9776d0b.png"},{"id":60098570,"identity":"00d5316c-f384-48d8-a426-b1f66e2e70aa","added_by":"auto","created_at":"2024-07-11 18:19:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":65388,"visible":true,"origin":"","legend":"\u003cp\u003eMaximum-likelihood phylogenetic tree of Edwardsiidae family based on the 18S rRNA gene, using the T92 + G substitution model. The outgroup \u003cem\u003eActinia equina\u003c/em\u003e was used as a root. The numbers near the branches indicate the percentage of ML bootstrap support (1000 replicates) for nodes that received at least 60% support. The scale bar denotes the estimated number of nucleotide substitutions per site.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4679529/v1/508ff513daf01823a26588e8.png"},{"id":60098572,"identity":"3f0095cf-f65e-4244-85d6-1945319482ba","added_by":"auto","created_at":"2024-07-11 18:19:02","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":243191,"visible":true,"origin":"","legend":"\u003cp\u003eLife cycle of the burrowing sea anemone \u003cem\u003eEdwardsiella\u003c/em\u003e. \u003cstrong\u003ea\u003c/strong\u003e. adult female and male polyps release gametes to the water column. \u003cstrong\u003eb\u003c/strong\u003e. a free-swimming pre-parasitic planula is formed following fertilization. \u003cstrong\u003ec\u003c/strong\u003e. the planula infects the ctenophore host \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e and develops into vermiform parasitic stage. \u003cstrong\u003ed\u003c/strong\u003e. a post-parasitic planula leaves the ctenophore host into the water column (\u003cstrong\u003ee\u003c/strong\u003e) where it can either settle in the seabed (\u003cstrong\u003ef\u003c/strong\u003e) and develop into a polyp (\u003cstrong\u003ea\u003c/strong\u003e) or reinfect another ctenophore or infect schyphozoan host \u003cem\u003eRhopilema nomadica\u003c/em\u003e or \u003cem\u003eRhizostoma pulmo\u003c/em\u003e(\u003cstrong\u003eg-h\u003c/strong\u003e). a post-parasitic planula may leave the schyphozoan host, traveling in the water column (\u003cstrong\u003ei\u003c/strong\u003e) where it can settle on the seabed (\u003cstrong\u003ef\u003c/strong\u003e) and develop into a polyp. The dashed line represents an alternate pathway.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4679529/v1/d3c69dbcf9a1ecd6bd51c12e.jpeg"},{"id":64186106,"identity":"b55c8bde-e4bf-4ec1-bd1b-86818c203a05","added_by":"auto","created_at":"2024-09-09 16:24:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1823333,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4679529/v1/4920b5b7-81b0-494f-b6eb-b403b43d7c47.pdf"},{"id":60098574,"identity":"ab0fe6e0-6db2-46ec-b1b9-57f910756d1d","added_by":"auto","created_at":"2024-07-11 18:19:02","extension":"mp4","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":21043675,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryVideo1.mp4","url":"https://assets-eu.researchsquare.com/files/rs-4679529/v1/db9f0ba6eb27080fc144b06f.mp4"},{"id":60098927,"identity":"50667157-4779-4e77-b24b-744d4413c10c","added_by":"auto","created_at":"2024-07-11 18:27:02","extension":"mp4","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2847139,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryVideo2.mp4","url":"https://assets-eu.researchsquare.com/files/rs-4679529/v1/5d2ee95212ad3c4bfbe7d387.mp4"}],"financialInterests":"No competing interests reported.","formattedTitle":"From ctenophores to scyphozoans: a parasitic spillover of the burrowing sea anemone Edwardsiella (Cnidaria: Actinaria)","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMany marine sedentary organisms face significant challenges when dispersing in the ocean, especially if their pelagic stage is too short or lacks sufficient mobility\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Among these creatures are sea anemones (Actiniaria), globally distributed members of the class Anthozoa in the phylum Cnidaria. Unlike other classes in the phylum, anthozoans form polyps but lack the pelagic medusa stage. The only freely motile stage in their life cycle is a ciliated planula larva, which plays a crucial role in the dispersal of anthozoan populations\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. The anemone planula is ephemerous\u0026mdash;it exists for a short time, from a few days in the starlet sea anemone\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e to two months in table corals\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Together with a restricted gamete dispersion due to fertilization dynamics\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e, the short life span of the planula limits the anthozoan dispersal potential and settlement in areas distant from the parental polyps.\u003c/p\u003e \u003cp\u003eSeveral species of burrowing anemones from the family Edwardsiidae (genus \u003cem\u003eEdwardsiella\u003c/em\u003e) cope with restricted dispersal by parasitizing planktonic ctenophores\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. This interaction was previously described as facultative\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. As in other Anthozoa, polyps of edwardsiids release gametes into the water, where fertilization occurs, and the zygotes develop into planulae. The free-swimming planula of \u003cem\u003eEdwardsiella\u003c/em\u003e is pre-parasitic\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e and can infect ctenophores either by burrowing through the epidermis\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e or through the gastrodermal wall, after being ingested by the host\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Inside the host mesoglea, the parasitic planula grows and becomes elongated (vermiform). Its body is not differentiated into distinct regions, but a planula possesses a mouth and a pharynx\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. The vermiform parasitic stage undergoes a body remodeling and generates a post-parasitic planula. This stage leaves the host and can re-infect other hosts, in which case it returns to the parasitic body plan, or can develop into a polyp and settle on the seafloor\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. One host can harbor one or numerous parasitic edwardsiids\u003csup\u003e\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eCtenophore infection of \u003cem\u003eEdwardsiella\u003c/em\u003e was first recorded in the warty comb jelly \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e in the Northwest Atlantic in 1898 by Verrill\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. However, he described the parasitic planula and adult polyp as different species: the polyp stage was assigned to \u003cem\u003eEdwardsia lineata\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e and the parasitic stage \u0026ndash; to \u003cem\u003eEdwardsiella lineata\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Later, Crowell showed that these two stages belong to one anemone species by rearing the larvae to the adult polyps\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Reitzel et al.\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e sampled three ctenophore species in the Northwest Atlantic and found \u003cem\u003eE. lineata\u003c/em\u003e in two\u0026mdash;\u003cem\u003eM. leidyi\u003c/em\u003e and \u003cem\u003eBeroe ovata\u003c/em\u003e. \u003cem\u003eEdwardsiella\u003c/em\u003e parasites were excised from both ctenophore species and exposed to uninfected ctenophores. Reitzel et al.\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e found a strong preference of \u003cem\u003eEdwardsiella\u003c/em\u003e to \u003cem\u003eM. leidyi\u003c/em\u003e and concluded that \u003cem\u003eM. leidyi\u003c/em\u003e is likely the only natural host. The presence of \u003cem\u003eEdwardsiella\u003c/em\u003e inside \u003cem\u003eB. ovata\u003c/em\u003e was explained by the predation of \u003cem\u003eM. leidyi\u003c/em\u003e by \u003cem\u003eB. ovata\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe comb jelly \u003cem\u003eM. leidyi\u003c/em\u003e is native to the western Atlantic and has spread over the past four decades to the Black, Azov, Caspian, Baltic and North seas\u003csup\u003e\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In the Mediterranean Sea, \u003cem\u003eM. leidyi\u003c/em\u003e was first recorded in the western Aegean Sea in 1990\u003csup\u003e19\u003c/sup\u003e, and by 2009, it had spread throughout the entire Mediterranean Sea\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Thus, it was not before 2007, one year after the first documentation of \u003cem\u003eM. leidyi\u003c/em\u003e in the North Sea\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, when \u003cem\u003eEdwardsiella\u003c/em\u003e was recorded in \u003cem\u003eM. leidyi\u003c/em\u003e in the North Sea\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eParasitic spillover happens when a parasite endemic to one host species infects a new host\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Such host switches can occur from invasive to native species in the invaded ecosystem\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. As most host-parasite associations are explained by phylogenetically conservative capabilities for host utilization\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, parasite switches between distantly related hosts were found to be infrequent\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Here, we report for the first time a parasitic spillover of \u003cem\u003eEdwardsiella\u003c/em\u003e from the ctenophore \u003cem\u003eM. leidyi\u003c/em\u003e to two scyphozoan hosts\u0026mdash;the native Mediterranean barrel jellyfish \u003cem\u003eRhizostoma pulmo\u003c/em\u003e, and the invasive Indo-Pacific nomad jellyfish \u003cem\u003eRhopilema nomadica\u003c/em\u003e. We applied molecular identification of \u003cem\u003eEdwardsiella\u003c/em\u003e planulae and described their morphology at successive developmental stages. In addition, we used DNA metabarcoding approach of bulk mesozooplankton samples to indicate the seasonality of the parasitic infection and discussed the potential implications of this spillover.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eIn total, 93 planulae of \u003cem\u003eEdwardsiella\u003c/em\u003e sp. were found in four \u003cem\u003eR. nomadica\u003c/em\u003e and one \u003cem\u003eR. pulmo\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). In both species of medusa, the parasitic planulae were located on the tentacles, oral arms, and in the subumbrella (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec), and two individuals of \u003cem\u003eR. nomadica\u003c/em\u003e contained planulae inside gastro-vascular canals. The first observations of planulae in \u003cem\u003eR. nomadica\u003c/em\u003e were at the end of March 2024 (temperature 19.4 \u0026ordm;C, salinity 38.7 ppt). Later, in the middle of April 2024 (temperature 22.2 \u0026ordm;C, salinity 39.1 ppt), planulae were found in \u003cem\u003eR. pulmo\u003c/em\u003e, when these medusae began to appear off the coast of Israel. In total, 86 planulae were found in \u003cem\u003eR. nomadica\u003c/em\u003e and 7 planulae in \u003cem\u003eR. pulmo\u003c/em\u003e. None of the ctenophore specimens examined was infected with \u003cem\u003eEdwardsiella\u003c/em\u003e parasites.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMorphology of planulae\u003c/h2\u003e \u003cp\u003eMost planulae had slightly flattened spherical bodies, were semi-transparent, and were greyish/yellow (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed, e). Diameter of the planulae ranged between 400\u0026ndash;600 \u0026micro;m. All individuals had a mouth opening in the center of the body (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). In the planulae, two epithelial layers (epidermal and gastrodermal) and a thin layer of mesoglea were distinguishable. Epidermis and gastrodermis were extensively ciliated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg, h; Supplementary video1). Two larger specimens (750 \u0026micro;m and 600 \u0026micro;m) had eight developing mesenteries (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). The gastrovascular cavity was filled with vacuolated spheres that resembled lipid droplets. Several planulae were found to have vermiform (worm-like) bodies\u0026thinsp;\u0026ge;\u0026thinsp;1.5 mm length and \u0026ge;\u0026thinsp;360 \u0026micro;m diameter (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). Vermiform planulae had distinguishable oral end, and aboral end. In the lab, once excised from the medusae, the planulae swam freely in the seawater (Supplementary Material Video 2).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMolecular analyses\u003c/h2\u003e \u003cp\u003eWe compared the 16S rRNA and 18S rRNA gene sequences amplified from the DNA of the planulae collected in this study with available sequences of other Anthozoa in the NCBI. BLASTn search showed the highest identity of the 16S rRNA and 18S rRNA gene sequences with the family Edwardsiidae (\u003cem\u003eNematostella, Edwardsia, Edwardsiella, Scolanthus\u003c/em\u003e, and \u003cem\u003eEdwardsianthus\u003c/em\u003e). The ML trees based on the 16S (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and 18S (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) rRNA gene sequences confirmed that the planulae from both medusae form a cluster within Edwardsiidae and belong to the genus \u003cem\u003eEdwardsiella\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eTwo 18S rRNA ASVs classified as Edwardsiidae (100% identity, Blastn, deposited in GenBank as accession numbers PP955977 and PP955978) were found in the High-Throughput Sequences of the mesozooplankton samples collected from Hadera (0\u0026ndash;26 m) in July 2020, and from Haifa Section stations H01 (0\u0026ndash;50 m), H02 (150\u0026thinsp;\u0026minus;\u0026thinsp;100 m), and H04 (800\u0026thinsp;\u0026minus;\u0026thinsp;500 m) in August 2022. All duplicates (subsamples) fully corresponded, thus providing the same indication of the presence/absence of edwardsiid anemones. These sampling events co-occurred with blooms of \u003cem\u003eR. nomadica\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur results show, for the first time, a spillover of the parasitic anemone \u003cem\u003eEdwardsiella\u003c/em\u003e from the ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e to two scyphozoan medusae, the Mediterranean-native barrel jellyfish \u003cem\u003eRhizostoma pulmo\u003c/em\u003e, and the invasive, Indo-Pacific nomad jellyfish \u003cem\u003eRhopilema nomadica\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eEdwardsiella\u003c/em\u003e planulae that we found in these medusae were in early successive stages, including pre-parasitic and parasitic planulae, described here for the first time. The pre-parasitic stage included spherical planulae and planulae with developing septa, and the parasitic stage consisted of vermiform planulae. The developmental stage determination was based on the following morphological characters: extensive ciliation, as described by Reitzel et al.\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e; lack of body region differentiation and no differentiated siphonoglyph; and eight planula mesenteries. Crowell\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e determined that the penetration of the planulae into the host is oral and forward through the epidermis and mesoglea, while Reitzel et al.\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e found that the planulae infect the host via ingestion, through the gastrodermal wall. Here, we found \u003cem\u003eEdwardsiella\u003c/em\u003e planulae on the epithelium covering tentacles, on the oral arms, in the subumbrella and in the gastrovascular canals. Since the mesoglea in scyphozoans is thicker and denser than in ctenophores, we propose that \u003cem\u003eEdwardsiella\u003c/em\u003e could not penetrate the medusa epithelium and mesoglea as burrowing through these structures is harder and requires more time. Hence, planulae were found on the epithelial surface and inside the gastrovascular canals of the medusae.\u003c/p\u003e \u003cp\u003eThree species of \u003cem\u003eEdwardsiella\u003c/em\u003e are known in the Mediterranean Sea: \u003cem\u003eE. carnea\u003c/em\u003e, \u003cem\u003eE. janthina\u003c/em\u003e and \u003cem\u003eE. loveni\u003c/em\u003e. Of them, only \u003cem\u003eE. carnea\u003c/em\u003e was described as parasitic in \u003cem\u003eBolinopsis\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e, a high latitude distributed ctenophore, and later in \u003cem\u003eM. leidyi\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e in the Northeast Atlantic. To date, \u003cem\u003eEdwardsiella\u003c/em\u003e parasites were not reported in the Mediterranean Sea. Here we suggest that \u003cem\u003eEdwardsiella\u003c/em\u003e was introduced with its original host \u003cem\u003eM. leidyi\u003c/em\u003e from the East Atlantic waters to the Mediterranean Sea\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e, reaching the Southeastern Mediterranean. In our study, we found \u003cem\u003eEdwardsiella\u003c/em\u003e planulae exclusively in scyphomedusae but not in the ctenophores examined. Parasite host-switch is not a rare phenomenon, yet it is often conservative within phylogenetically related taxa\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e,\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Both ctenophores and scyphozoans provide an ample pelagic substrate due to their relatively large size and frequency of appearance in blooms. Thus, it can be inferred that the choice of host by \u003cem\u003eEdwardsiella\u003c/em\u003e is non-specific and based on function rather than evolutionary history.\u003c/p\u003e \u003cp\u003eOver the past decades, the Eastern Mediterranean waters experienced an intensification of medusan blooms, mostly caused by the scyphozoan \u003cem\u003eR. nomadica\u003c/em\u003e\u003csup\u003e\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eR. nomadica\u003c/em\u003e was first recorded in Israel in 1977 and considered a Lessepsian invader, introduced via the Suez Canal\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Since then, it has expanded its distribution westwards and was recorded in Lebanon, Syria, Turkey, Greece, Malta, Tunisia, Egypt, Sardinia, and Sicily\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan additionalcitationids=\"CR44 CR45 CR46\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. This venomous species affects human health, fisheries, nutrient dynamics, coastal recreation and tourism, and pose a threat to coastal installations by clogging intake pipes\u003csup\u003e\u003cspan additionalcitationids=\"CR49 CR50 CR51\" citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e.The barrel-jellyfish \u003cem\u003eR. pulmo\u003c/em\u003e is the most widespread scyphomedusa in the Mediterranean Sea, with prominent blooms from the western to the eastern basins\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. In the Eastern Mediterranean, individuals of \u003cem\u003eR. pulmo\u003c/em\u003e co-occurr with early summer swarms of \u003cem\u003eR. nomadica\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. During 2024, the Southeastern Mediterranean experienced consecutive blooms of the scyphomedusae \u003cem\u003eR. nomadica\u003c/em\u003e and \u003cem\u003eR. pulmo\u003c/em\u003e, while \u003cem\u003eM. leidyi\u003c/em\u003e were less frequent and abundant. Therefore, it is possible that due to the shift in host availability, \u003cem\u003eEdwardsiella\u003c/em\u003e \u0026ldquo;spilled over\u0026rdquo; from ctenophores to scyphomedusae.\u003c/p\u003e \u003cp\u003eIn laboratory experiments, \u003cem\u003eEdwardsiella\u003c/em\u003e planulae excised from its ctenophore host quickly developed into a free-swimming planula larva, that could re-infect another host and assume the parasitic body plan\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e, or undergo settlement and develop into a free-living polyp\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. The experimental manipulation was hypothesized to mimic the process that would occur in nature when the host dies, or when the parasite leaves the living host. Following these findings, it was concluded that the interaction between \u003cem\u003eEdwardsiella\u003c/em\u003e and \u003cem\u003eM. leidyi\u003c/em\u003e is facultative\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Nonetheless, there is no evidence of direct development from planulae to polyps of \u003cem\u003eEdwardsiella\u003c/em\u003e in nature, without infecting a planktonic host. Our finding of a host-switch from ctenophores to scyphomedusae rather supports an obligate, yet non-specific interaction between \u003cem\u003eEdwardsiella\u003c/em\u003e and its diverse gelatinous hosts.\u003c/p\u003e \u003cp\u003eParasites can have adverse impacts on their hosts, affecting their growth, reproduction, behavior, survival, and population dynamics\u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e,\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Bumann \u0026amp; Puls\u003csup\u003e\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e studied the impacts of the burrowing parasitic anemone \u003cem\u003eE. lineata\u003c/em\u003e on the host by comparing infested and non-infested \u003cem\u003eM. leidyi\u003c/em\u003e. Non-infested ctenophores had higher growth rates than infested individuals, which had zero or negative growth rates, however no impact on egg production was found. They concluded that \u003cem\u003eE. lineata\u003c/em\u003e could be partly responsible for the sharp decline of \u003cem\u003eM. leidyi\u003c/em\u003e populations in autumn in US coastal waters, and recommended considering \u003cem\u003eE. lineata\u003c/em\u003e as a biological control agent of the introduced \u003cem\u003eM. leidyi\u003c/em\u003e populations. Chiaverano et al.\u003csup\u003e\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e reported edwardsiid-like organisms inside \u003cem\u003eAurelia\u003c/em\u003e sp. in Croatia. They concluded that parasitized medusae were significantly smaller and produced fewer but larger oocytes. Nonetheless, neither morphological nor molecular identification of the parasites was provided, thus this finding should be treated with caution.\u003c/p\u003e \u003cp\u003eClimate change can impact parasitic stages either directly or indirectly, by affecting the host\u003csup\u003e\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e. The effects of temperature and salinity on the survival and development of vermiform parasitic \u003cem\u003eE. lineata\u003c/em\u003e were experimentally tested\u003csup\u003e\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. Survival was impaired at temperatures above 30 \u0026ordm;C and salinity below 6 ppt. These thresholds do not appear to impede the colonization of the \u003cem\u003eEdwardsiella\u003c/em\u003e parasites in the Eastern Mediterranean Sea. Our metabarcoding data from mesozooplankton samples indicated the presence of \u003cem\u003eEdwardsiella\u003c/em\u003e in the water column of the Eastern Mediterranean Sea during summer months, when sea surface temperatures exceeded 31 \u0026ordm;C, and salinity was \u0026gt;\u0026thinsp;40 ppt. \u003cem\u003eR. nomadica\u003c/em\u003e medusae are able to endure summer maxima beyond 31 \u0026ordm;C\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e, while \u003cem\u003eR. pulmo\u003c/em\u003e medusae prevail in regions with winter minima below 15 \u0026ordm;C\u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e, ensuring a widespread distribution of \u003cem\u003eEdwardsiella\u003c/em\u003e via these native and invasive scyphomedusan hosts.\u003c/p\u003e \u003cp\u003eFurther research is required to understand the geographical and taxonomic extent of the parasitic infection of scyphomedusae by \u003cem\u003eEdwardsiella\u003c/em\u003e anemone and underpin its host-switch dynamics. Experiments are needed to assess the potential impact of this interaction on scyphozoan growth, reproduction, behavior, and survival. Future climate change may contribute to additional spillover of \u003cem\u003eEdwardsiella\u003c/em\u003e among scyphozoans, while potentially controlling their populations.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eSample collection and examination\u003c/h2\u003e \u003cp\u003eThe scyphomedusae \u003cem\u003eRhizostoma pulmo\u003c/em\u003e and \u003cem\u003eRhopilema nomadica\u003c/em\u003e and the ctenophores \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e and \u003cem\u003eBeroe ovata\u003c/em\u003e were sampled in the Israeli Southeastern Mediterranean Sea at the following sites: Hadera (32.46527 \u0026deg;N, 34.861567\u0026deg;E), Mikhmoret (32.424963\u0026deg;N, 34.848131\u0026deg;E and 32.411922\u0026deg;N, 34.835943 \u0026deg;E), and Shikmona (32.826474\u0026deg;N, 34.956926\u0026deg;E). Animals were sampled intact at 0-1m depths using scoop nets and buckets. Samplings were performed from December 2023 till May 2024. After collection, the medusae and ctenophores were brought to the lab at the National Institute of Oceanography, Israel Oceanographic and Limnological Research (IOLR), for morphometric analysis. For each medusa/ctenophore individual, weight and umbrella diameter/oral-aboral length were measured.\u003c/p\u003e \u003cp\u003eA total of 53 medusae (36 individuals of \u003cem\u003eR. nomadica\u003c/em\u003e and 17 of \u003cem\u003eR. pulmo\u003c/em\u003e) and 59 ctenophores (16 \u003cem\u003eM. leidyi\u003c/em\u003e and 43 \u003cem\u003eB. ovata\u003c/em\u003e) were collected and analyzed alive for the presence of parasites. Whole animals were inspected visually and later dissected into smaller parts for investigation under a stereomicroscope (SZX16, Olympus, Japan). Detected planulae were counted and subsequently studied using a microscope (BX43, Olympus, Japan).\u003c/p\u003e \u003cp\u003eMesozooplankton samples were collected monthly in Hadera and biannually offshore Haifa (Haifa Section) in the framework of the Israeli National Monitoring Program by IOLR. The samples were collected by vertical hauls of WP2 net (\u0026Oslash;=57 cm, Hydro-Bios, Germany) in the coastal stations (depth 15\u0026ndash;60 m), and by MultiNet Midi (50x50 cm, Hydro-Bios, Germany) in the offshore stations (100\u0026ndash;1500 m depth). The samples were kept at \u0026minus;\u0026thinsp;20\u0026deg;C pending molecular analysis.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDNA extraction, amplification and sequencing\u003c/h3\u003e\n\u003cp\u003eAfter removing anemone planulae from the medusae, the planulae were individually preserved in absolute ethanol for molecular analysis. Total genomic DNA was extracted from five planulae using InviSorb Spin Tissue Mini Kit (Invitek Diagnostics, Germany) according to the manufacturer\u0026rsquo;s specifications. The amplifications of the following ribosomal RNA genes were performed: nuclear 18S rRNA gene with primers #3F (5\u0026rsquo; GYGGTGCATGGCCGTTSKTRGTT 3\u0026rsquo;)\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e and 9R (5\u0026rsquo; GATCCTTCCGCAGGTTCACCTAC 3\u0026rsquo;)\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e, mitochondrial 16S rRNA gene with primers 16S-L (5' GACTGTTTACCAAAAACATA 3')\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e and Aa_H16S_1541H (5' AGATTTTAATGGTCGAACAGAC 3')\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Reaction conditions for 18S rRNA gene amplification were as follows: 94\u0026deg;C for 2 min, followed by 34 cycles of 94\u0026deg;C for 15 s, 49\u0026deg;C for 30 s, and 72\u0026deg;C for 1 min, and a final elongation step of 72\u0026deg;C for 7 min. Reaction conditions for 16S rRNA gene amplification were as follows: 95\u0026deg;C for 5 min followed by 35 cycles of 95\u0026deg;C for 1 min, 45\u0026deg;C for 1 min, and 72\u0026deg;C for 1 min, and a final elongation step of 72\u0026deg;C for 10 min. Obtained PCR products were separated on 1.5% agarose gel and stained with GelRed (Biotium Inc., USA). Purification and Sanger sequencing of the PCR products were performed by Hy Laboratories Ltd. (Rehovot, Israel).\u003c/p\u003e \u003cp\u003eFrozen mesozooplankton samples were thawed and processed in duplicates following the protocol described in Guy-Haim et al.\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. The 18S rRNA gene V9 region (ca. 192 bp) was amplified using 1391F-EukBr primer set\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e amended with CS1/CS2 tags. Library preparation from the PCR products and Next Generation Sequencing (NGS) of 2x150 bp Illumina MiniSeq reads were performed by Hy Laboratories Ltd. (Israel).\u003c/p\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic and phylogenetic analyses\u003c/h2\u003e \u003cp\u003eA total of twelve 16S rRNA gene sequences of Hexacorallia were analysed, including two sequences of \u003cem\u003eEdwardsiella\u003c/em\u003e sp. planulae obtained in this study, and nine sequences of Edwardsiidae from NCBI GenBank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/genbank/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/genbank/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). A sequence of \u003cem\u003eZoanthus kuroshiro\u003c/em\u003e (AB219189) was used as an outgroup. A total of fourteen 18S rRNA gene sequences of Actinaria were analysed, including two sequences of \u003cem\u003eEdwardsiella\u003c/em\u003e sp. planula obtained in this study, and twelve sequences of Edwardsiidae from NCBI GenBank. A sequence of \u003cem\u003eActinia equina\u003c/em\u003e (AJ133552) was used as an outgroup. The sequences generated in this study were deposited in GenBank under the accession numbers PP874669 and PP958816 (18S), and PP955979-PP955980 (16S).\u003c/p\u003e \u003cp\u003eSequence alignments were conducted using ClustalW embedded in MEGA v11.0\u003csup\u003e34\u003c/sup\u003e. The best-fitting substitution model was selected according to the Bayesian information criterion using maximum-likelihood (ML) model selection in MEGA. ML analyses were performed using the T92\u0026thinsp;+\u0026thinsp;G model with 1000 bootstrapping replicates.\u003c/p\u003e \u003cp\u003eThe NGS demultiplexed paired-end reads were processed in the QIIME2 V2022.2 environment\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Reads were truncated based on quality plots, checked for chimeras, merged, and grouped into amplicon sequence variants (ASVs) with DADA2\u003csup\u003e36\u003c/sup\u003e, as implemented in QIIME2. The 18S rRNA amplicons were classified with a scikit-learn classifier that was trained on the Silva 138 database or BLAST against the Silva 138 and PR2 databases (0.9 minimum identity cutoff).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSequence data that support the findings of this study have been deposited in the NCBI GenBank with the accession numbers: PP874669 and PP958816 (18S), \u0026nbsp;PP955979-PP955980 (16S), PP955977- PP955978 (18S v9).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by ISF grant no. 1655/21 to T.G.-H and the IOLR National Monitoring Program of the Israeli Mediterranean Sea. A.I. thanks the Bloom Scholarship for Doctoral Studies from the Bloom Graduate School, University of Haifa, Israel. We express our gratitude to Shai Mienis for providing underwater jellyfish photos. We thank Meduzot Ba\u0026rsquo;am jellyfish observation initiative (\u003ca href=\"https://www.meduzot.co.il\"\u003ehttps://www.meduzot.co.il\u003c/a\u003e) and its Facebook group participants for providing up-to-date information on the location of jellyfish. We thank Dr. Jacob Douek for providing 16S primers. Finally, we thank the IOLR sea-going team for their help in sampling.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA.I. and T.G.-H conceived the study, A.I. and A.R.M. collected and analysed the data, A.I. and T.G.-H interpret the findings and wrote original draft. T.G.-H. and D.A. supervised the research. All coauthors reviewed and edited the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eShanks, A. L. Pelagic larval duration and dispersal distance revisited. Biological Bulletin 216, 373\u0026ndash;385 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuy-Haim, T., Hyams-Kaphzan, O., Yeruham, E., Almogi-Labin, A. \u0026amp; Carlton, J. T. A novel marine bioinvasion vector: Ichthyochory, live passage through fish. Limnol Oceanogr Lett 2, 81\u0026ndash;90 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDnyansagar, R. \u003cem\u003eet al.\u003c/em\u003e Dispersal and speciation: The cross Atlantic relationship of two parasitic cnidarians. Mol Phylogenet Evol 126, 346\u0026ndash;355 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTechnau, U. \u0026amp; Steele, R. E. Evolutionary crossroads in developmental biology: Cnidaria. Development 138, 1447\u0026ndash;1458 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNishikawa, A. \u0026amp; Sakai, K. Settlement-competency period of planulae and genetic differentiation of the scleractinian coral \u003cem\u003eAcropora digitifera\u003c/em\u003e. Zoolog Sci 22, 391\u0026ndash;399 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarshall, D. J., Semmens, D. \u0026amp; Cook, C. Consequences of spawning at low tide: Limited gamete dispersal for a rockpool anemone. Mar Ecol Prog Ser 266, 135\u0026ndash;142 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrowell, S. An edwardsiid larva parasitic in \u003cem\u003eMnemiopsis\u003c/em\u003e. in \u003cem\u003eCoelenterate ecology and behavior\u003c/em\u003e (ed. Mackie, G. O.) 247\u0026ndash;250 (Plenum Press, New York, New York, 1976).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReitzel, A. M., Daly, M., Sullivan, J. C. \u0026amp; Finnerty, J. R. Comparative anatomy and histology of developmental and parasitic stages in the life cycle of the lined sea anemone \u003cem\u003eEdwardsiella lineata\u003c/em\u003e. Journal of Parasitology 95, 100\u0026ndash;112 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelander, E., M\u0026oslash;ller, L. F., Sundberg, P. \u0026amp; Tiselius, P. Parasitic anemone infects the invasive ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e in the North East Atlantic. Biol Invasions 12, 1003\u0026ndash;1009 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u0026Ouml;stman, S. C. \u0026amp; Friis M\u0026oslash;ller, L. Gross morphology and cnidae of \u003cem\u003eedwardsiella\u003c/em\u003e anemones and larvae (Anthozoa, Edwardsiidae) from the Swedish West Coast. Acta Zoologica 102, 467\u0026ndash;482 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReitzel, A. M., Sullivan, J. C. \u0026amp; Finnerty, J. R. Qualitative shift to indirect development in the parasitic sea anemone \u003cem\u003eEdwardsiella lineata\u003c/em\u003e. Integr Comp Biol 46, 827\u0026ndash;837 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReitzel, A. M. \u003cem\u003eet al.\u003c/em\u003e Ecological and developmental dynamics of a host-parasite system involving a sea anemone and two ctenophores. Journal of Parasitology 93, 1392\u0026ndash;1402 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerrill, A. E. Descriptions of new American actinians, with critical notes on other species. Am J Sci 6, 493\u0026ndash;498 (1898).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerrill, A. E. \u003cem\u003eReport upon the Invertebrate Animals of Vineyard Sound and Adjacent Waters\u003c/em\u003e, with an Account of the Physical Features of the Region. (1873).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarbison, G. R. \u0026amp; Volovik, S. P. The ctenophore, \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e, in the Black Sea: a holoplanktonic organism transported in the ballast water of ships. Nonindigenous Estuarine and Marine Organisms (NEMO) 25\u0026ndash;36 (1994).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShiganova, T. A. \u003cem\u003eet al.\u003c/em\u003e The invader into the Caspian Sea ctenophore and its initial effect on the pelagic ecosystem. Oceanology (Wash D C) 41, 517\u0026ndash;524 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJavidpour, J., Sommer, U. \u0026amp; Shiganova, T. First record of \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e A. Agassiz 1865 in the Baltic Sea. Aquat Invasions 1, 299\u0026ndash;302 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaasse, M. A. \u0026amp; Bayha, K. M. The ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e A. Agassiz 1865 in coastal waters of the Netherlands: An unrecognized invasion? Aquat Invasions 1, 270\u0026ndash;277 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShiganova, T. A. \u003cem\u003eet al.\u003c/em\u003e Population development of the invader ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e, in the Black Sea and in other seas of the Mediterranean basin. Mar Biol 139, 431\u0026ndash;445 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhabooli, S. \u003cem\u003eet al.\u003c/em\u003e Invasion pathway of the ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e in the Mediterranean Sea. PLoS One 8, 1\u0026ndash;9 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoersma, M., Malzahn, A. M., Greve, W. \u0026amp; Javidpour, J. The first occurrence of the ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e in the North Sea. Helgol Mar Res 61, 153\u0026ndash;155 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaszak, P., Cunningham, A. A. \u0026amp; Hyatt, A. D. Emerging infectious diseases of wildlife - Threats to biodiversity and human health. Science (1979) 287, 443\u0026ndash;449 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoedknegt, M. A. \u003cem\u003eet al.\u003c/em\u003e Parasites and marine invasions: Ecological and evolutionary perspectives. \u003cem\u003eJournal of Sea Research\u003c/em\u003e vol. 113 11\u0026ndash;27 Preprint at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.seares.2015.12.003\u003c/span\u003e\u003cspan address=\"10.1016/j.seares.2015.12.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChalkowski, K., Lepczyk, C. A. \u0026amp; Zohdy, S. Parasite Ecology of Invasive Species: Conceptual Framework and New Hypotheses. Trends Parasitol 34, 655\u0026ndash;663 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoberg, E. P. \u0026amp; Brooks, D. R. A macroevolutionary mosaic: Episodic host-switching, geographical colonization and diversification in complex host-parasite systems. J Biogeogr 35, 1533\u0026ndash;1550 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026oacute;mez, J. M., Verd\u0026uacute;, M. \u0026amp; Perfectti, F. Ecological interactions are evolutionarily conserved across the entire tree of life. Nature 465, 918\u0026ndash;921 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHork\u0026aacute;, I., De Grave, S., Fransen, C. H. J. M., Petrusek, A. \u0026amp; Duriš, Z. Multiple host switching events shape the evolution of symbiotic palaemonid shrimps (Crustacea: Decapoda). Sci Rep 6, 1\u0026ndash;13 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMachida, R. J. \u0026amp; Knowlton, N. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences. PLoS One 7, (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiribet, G., Carranza, S., Bagu\u0026ntilde;\u0026agrave;, J., Riutort, M. \u0026amp; Ribera, C. First molecular evidence for the existence of a Tardigrada\u0026thinsp;+\u0026thinsp;Arthropoda clade. Mol Biol Evol 13, 76\u0026ndash;84 (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEnder, A. \u0026amp; Schierwater, B. Placozoa are not derived cnidarians: Evidence from molecular morphology. Mol Biol Evol 20, 130\u0026ndash;134 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBayha, K. M., Dawson, M. N., Collins, A. G., Barbeitos, M. S. \u0026amp; Haddock, S. H. D. Evolutionary relationships among scyphozoan jellyfish families based on complete taxon sampling and phylogenetic analyses of 18S and 28S ribosomal DNA. Integr Comp Biol 50, 436\u0026ndash;455 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuy-Haim, T. \u003cem\u003eet al.\u003c/em\u003e A new record of the rapidly spreading calanoid copepod \u003cem\u003ePseudodiaptomus marinus\u003c/em\u003e (Sato, 1913) in the Levantine Sea using multi-marker metabarcoding. Bioinvasions Rec 11, 964\u0026ndash;976 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmaral-Zettler, L. A., McCliment, E. A., Ducklow, H. W. \u0026amp; Huse, S. M. A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA Genes. PLoS One 4, 1\u0026ndash;9 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura, K., Stecher, G. \u0026amp; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38, 3022\u0026ndash;3027 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolyen, E. \u003cem\u003eet al.\u003c/em\u003e Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol 37, 852\u0026ndash;857 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCallahan, B. J. \u003cem\u003eet al.\u003c/em\u003e DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13, 581\u0026ndash;583 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStephenson, T. A. \u003cem\u003eBritish Sea Anemones\u003c/em\u003e. (The Ray Society, London, 1935).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolte, S. \u003cem\u003eet al.\u003c/em\u003e Population genetics of the invasive ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e in Europe reveal source-sink dynamics and secondary dispersal to the Mediterranean Sea. Mar Ecol Prog Ser 485, 25\u0026ndash;36 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdelist, D. \u003cem\u003eet al.\u003c/em\u003e Phenological shift in swarming patterns of \u003cem\u003eRhopilema nomadica\u003c/em\u003e in the Eastern Mediterranean Sea. J Plankton Res 42, 211\u0026ndash;219 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdelist, D. \u003cem\u003eet al.\u003c/em\u003e Tracking Jellyfish Swarm Origins Using a Combined Oceanographic-Genetic-Citizen Science Approach. Front Mar Sci 9, 1\u0026ndash;15 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatsanevakis, S. \u003cem\u003eet al.\u003c/em\u003e Impacts of invasive alien marine species on ecosystem services and biodiversity: A pan-European review. Aquat Invasions 9, 391\u0026ndash;423 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalil, B., Spanier, E. \u0026amp; Ferguson, W. The Scyphomedusae of the Mediterranean coast of Israel, including two Lessepsian migrants new to the Mediterranean. Zoologische Mededelingen 64, 95\u0026ndash;105 (1990).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLotan, A., Fine, M. \u0026amp; Benhillel, R. Synchronization of the life cycle and dispersal pattern of the tropical invader Scyphomedusan \u003cem\u003eRhopilema nomadica\u003c/em\u003e is temperature dependent. Mar Ecol Prog Ser 109, 59\u0026ndash;66 (1994).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrotz, L. \u0026amp; Pauly, D. Jellyfish populations in the Mediterranean Sea. Acta Adriat 53, 213\u0026ndash;231 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYahia, M. N. D. \u003cem\u003eet al.\u003c/em\u003e The invasive tropical scyphozoan \u003cem\u003eRhopilema nomadica\u003c/em\u003e Galil, 1990 reaches the Tunisian coast of the Mediterranean Sea. Bioinvasions Rec 2, 319\u0026ndash;323 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-regal, M. A. \u0026amp; Temraz, T. Blooming of nomad jelly fish \u003cem\u003eRhopilema nomadica\u003c/em\u003e along the Egyptian Mediterranean coasts. Rapport Commission International Mer Mediterrane 41, 490 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMadkour, F. F., Safwat, W. \u0026amp; Hanafy, M. H. Record of Aggregation of Alien Tropical Schyphozoan Rhopilema nomadica Galil, 1990 in the Mediterranean Coast of Egypt. International Marine Science Journal 1, 1\u0026ndash;7 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAngel, D. L., Edelist, D. \u0026amp; Freeman, S. Local perspectives on regional challenges: jellyfish proliferation and fish stock management along the Israeli Mediterranean coast. Reg Environ Change 16, 315\u0026ndash;323 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGalil, B. Poisonous and Venomous: Marine Alien Species in the Mediterranean Sea and Human Health. in \u003cem\u003eCAB International 2018. Invasive species and human health\u003c/em\u003e (eds. Mazza, G. \u0026amp; Tricarico, E.) (2018). doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1079/9781786390981.0000\u003c/span\u003e\u003cspan address=\"10.1079/9781786390981.0000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhermandi, A., Galil, B., Gowdy, J. \u0026amp; Nunes, P. A. L. D. Jellyfish outbreak impacts on recreation in the Mediterranean Sea: Welfare estimates from a socioeconomic pilot survey in Israel. Ecosyst Serv 11, 140\u0026ndash;147 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuy-Haim, T. \u003cem\u003eet al.\u003c/em\u003e The effects of decomposing invasive jellyfish on biogeochemical fluxes and microbial dynamics in an ultra-oligotrophic sea. Biogeosciences 17, 5489\u0026ndash;5511 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahav, E. \u003cem\u003eet al.\u003c/em\u003e Jellyfish swarm impair the pretreatment efficiency and membrane performance of seawater reverse osmosis desalination. Water Res 215, 118231 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFuentes, V. \u003cem\u003eet al.\u003c/em\u003e Life cycle of the jellyfish \u003cem\u003eRhizostoma pulmo\u003c/em\u003e (Scyphozoa: Rhizostomeae) and its distribution, seasonality and inter-annual variability along the Catalan coast and the Mar Menor (Spain, NW Mediterranean). Mar Biol 158, 2247\u0026ndash;2266 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrowell, S. \u0026amp; Oates, S. Metamorphosis and reproduction by transverse fission in an edwardsiid anemone. in \u003cem\u003eDevelopmental and cellular biology of coelenterates Proceedings of the 4th International Coelenterate Conference\u003c/em\u003e (eds. Tardent, P. \u0026amp; Tardent, R.) 139\u0026ndash;142 (Elsevier, Amsterdam, 1980).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaly, M. Taxonomy, anatomy, and histology of the lined sea anemone, \u003cem\u003eEdwardsiella lineata\u003c/em\u003e (Verrill, 1873) (Cnidaria: Anthozoa: Edwardsiidae). \u003cem\u003eProceedings of the Biological Society of Washington\u003c/em\u003e 115, 868\u0026ndash;877 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDobson, A. P. The population biology of parasite-induced changes in host behavior. Quarterly Review of Biology 63, 139\u0026ndash;165 (1988).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLafferty, K. D. \u0026amp; Kuris, A. M. How environmental stress affects the impacts of parasites. Limnol Oceanogr 44, 925\u0026ndash;931 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBumann, D. \u0026amp; Puls, G. Infestation with larvae of the sea anemone \u003cem\u003eEdwardsia lineata\u003c/em\u003e affects nutrition and growth of the ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e. Parasitology 113, 123\u0026ndash;128 (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChiaverano, L. M., Graham, W. M. \u0026amp; Costello, J. H. Parasites alter behavior, reproductive output, and growth patterns of \u003cem\u003eAurelia\u003c/em\u003e medusae in a marine lake. Mar Ecol Prog Ser 540, 87\u0026ndash;98 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eByers, J. E. Marine Parasites and Disease in the Era of Global Climate Change. Ann Rev Mar Sci 13, 397\u0026ndash;420 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, J. \u003cem\u003eet al.\u003c/em\u003e Temperature and Salinity Affect Development of the Parasitic Sea Anemone \u003cem\u003eEdwardsiella lineata\u003c/em\u003e Potentially Limiting Its Impact As a Biological Control on the Ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e. J Parasitol 109, 574\u0026ndash;579 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeoni, V., Bonnet, D., Ram\u0026iacute;rez-Romero, E. \u0026amp; Molinero, J. C. Biogeography and phenology of the jellyfish \u003cem\u003eRhizostoma pulmo\u003c/em\u003e (Cnidaria: Scyphozoa) in southern European seas. Global Ecology and Biogeography 30, 622\u0026ndash;639 (2021).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"parasite, host switching, bioinvasion, jellyfish, larvae, Mnemiopsis leidyi, Rhopilema nomadica, Rhizostoma pulmo, Mediterranean Sea","lastPublishedDoi":"10.21203/rs.3.rs-4679529/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4679529/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMost host-parasite associations are explained by phylogenetically conservative capabilities for host utilization, and therefore parasite switches between distantly related hosts are rare. Here we report the first evidence of a parasitic spillover of the burrowing sea anemone \u003cem\u003eEdwardsiella\u003c/em\u003e from the invasive ctenophore \u003cem\u003eMnemiopsis leidyi\u003c/em\u003e to two scyphozoan hosts: the native Mediterranean barrel jellyfish \u003cem\u003eRhizostoma pulmo\u003c/em\u003e and the invasive Indo-Pacific nomad jellyfish \u003cem\u003eRhopilema nomadica\u003c/em\u003e, collected from the Eastern Mediterranean Sea. The Edwardsiella planulae found in these jellyfish were identified using molecular analyses of the mitochondrial 16S and nuclear 18S rRNA genes. Overall, 93 planulae were found on tentacles, oral arms, and inside of the gastrovascular canals of the scyphomedusae, whereas no infection was observed in co-occurring ctenophores. DNA metabarcoding approach indicated seasonal presence of \u003cem\u003eEdwardsiella\u003c/em\u003e in the Eastern Mediterranean mesozooplankton, coinciding with jellyfish blooms in the region. Our findings suggest a non-specific parasitic relationship between \u003cem\u003eEdwardsiella\u003c/em\u003e and various gelatinous hosts based on shared functionality rather than evolutionary history, potentially driven by shifts in host availability due to jellyfish blooms. This spillover raises questions about the ecological impacts of parasitism on native and invasive scyphozoan hosts and the potential role of \u003cem\u003eEdwardsiella\u003c/em\u003e in controlling their populations.\u003c/p\u003e","manuscriptTitle":"From ctenophores to scyphozoans: a parasitic spillover of the burrowing sea anemone Edwardsiella (Cnidaria: Actinaria)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-11 18:18:57","doi":"10.21203/rs.3.rs-4679529/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-06T12:47:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-26T20:54:26+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-21T21:35:55+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"277479203012078981726832389233468849836","date":"2024-07-13T15:09:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"149912582391620196379189973635382689494","date":"2024-07-11T17:00:56+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-11T15:01:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-11T14:49:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-07-11T13:30:10+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-08T08:24:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-07-03T10:03:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2b44566e-2797-403b-aeed-c2de5514d92c","owner":[],"postedDate":"July 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":34470794,"name":"Biological sciences/Ecology"},{"id":34470795,"name":"Biological sciences/Ecology/Biodiversity"},{"id":34470796,"name":"Biological sciences/Ecology/Invasive species"},{"id":34470797,"name":"Earth and environmental sciences/Ocean sciences/Marine biology"}],"tags":[],"updatedAt":"2024-09-09T16:16:27+00:00","versionOfRecord":{"articleIdentity":"rs-4679529","link":"https://doi.org/10.1038/s41598-024-72168-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2024-09-06 16:06:10","publishedOnDateReadable":"September 6th, 2024"},"versionCreatedAt":"2024-07-11 18:18:57","video":"","vorDoi":"10.1038/s41598-024-72168-7","vorDoiUrl":"https://doi.org/10.1038/s41598-024-72168-7","workflowStages":[]},"version":"v1","identity":"rs-4679529","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4679529","identity":"rs-4679529","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}