Bobcat339, a specific TET family inhibitor, impaired oocyte maturation and early embryogenesis in pig

Bobcat339, a specific TET family inhibitor, impaired oocyte maturation and early embryogenesis in pig | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Bobcat339, a specific TET family inhibitor, impaired oocyte maturation and early embryogenesis in pig Fan Chen, Mingguo Li, Zaidong Hua, Hongyan Ren, Anfeng Luo, Hao Gu, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2906860/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Ten-eleven translocation (TET) enzyme family, which includes TET1/2/3, participates in active DNA demethylation in the eukaryotic genome; however, TET1/2/3 are functionally redundant. The effect of TET1/2/3 triple-gene knockdown or knockout on the porcine oocytes and embryos is unclear. In this study, using Bobcat339, a specific small-molecule inhibitor of the TET family, we explored the combined effects of TET enzymes on oocyte maturation and early embryogenesis in pigs. Method: First, porcine cumulus oocyte complexes were cultured in the IVM medium with various concentrations of Bobcat339, and the effects on the expansion of cumulus cells and oocyte maturation were investigated. Further, the apoptotic level of oocytes was assessed using RT-PCR and Annexin-V staining. The spindle architecture and chromosomal alignment were investigated using immunofluorescence staining. Furthermore, the fluorescent signals of 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) were quantified. Subsequently, the effect of Bobcat339 on porcine parthenogenetic embryos was assessed. We recorded the blastocyst formation and developmental rates. Furthermore, the mRNA levels of zygotic gene activation (ZGA)- and pluripotency-related and imprinted genes were assessed using RT-PCR. Finally, RNA sequencing analysis was performed in the embryos at the 4-cell stage to identify differentially expressed genes. Result: Our results revealed that Bobcat339 treatment blocked porcine oocyte maturation and triggered early apoptosis. Furthermore, in the Bobcat339-treated oocytes, spindle architecture and chromosome alignment were disrupted, probably due to huge loss of 5hmC and concurrent increase in 5mC. Furthermore, after Bobcat339 treatment, early parthenogenetic embryos exhibited abnormal 5mC and 5hmC levels, which resulted in compromised cleavage and blastocyst rate. The mRNA levels of EIF1A and DPPA2 (ZGA marker genes) were significantly decreased, which may explain why the embryos were arrested at the 4-cell stage after Bobcat339 treatment. In addition, the mRNA levels of pluripotency-related genes OCT4 and NANOG were declined after Bobcat339 treatment. RNA sequencing analysis revealed differentially expressed genes in Bobcat339-treated embryos at the 4-cell stage, which were significantly enriched in cell proliferation, cell component related to mitochondrion, and cell adhesion molecule binding. Conclusion : Our results indicated that TET proteins are essential for porcine oocyte maturation and early embryogenesis, and they act by mediating 5mC/5hmC levels and gene transcription. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background In DNA, methylation of cytosine at the C5 position (5-methylcytosine, 5mC) is an inhibitory epigenetic mechanism, which can block the expression of various genes [ 1 ]. The formation of 5mC is a dynamic process; ten-eleven translocation (TET) methylcytosine dioxygenase can successively oxidize 5-mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) [ 2 ]. The 5fC and 5caC can be replaced with unmodified cytosine via base excision repair [ 3 ]. Therefore, TET can eliminate DNA methylation imprinting and promote active demethylation processes. TET-mediated DNA demethylation is implicated in diverse biological processes, including embryotic development and stem cell pluripotency and differentiation [ 4 ]. Importantly, 5hmc serves not only as the first and important intermediate in demethylation processes but also an independent and stable epigenetic marker vital for stem cell pluripotency [ 5 ]. Global DNA demethylation occurs during two different stages of mammalian development, the migration of primordial germ cells (PGCs) and pronuclear stage of zygotes [ 6 , 7 ]. It seems that TET1, TET2, and TET3 act at different stages during embryo development. TET1 and TET2 predominantly participate in DNA demethylation in PGCs and post-implantation embryos [ 8 , 9 ]. TET3 mediates demethylation of both paternal and maternal genomes in zygotes and directly participates in active DNA demethylation in preimplantation embryos [ 10 – 12 ]. Moreover, 5hmC is present in fully grown oocytes but not at nongrowing stage, which is accompanied by noticeable TET3 increase; this implies that 5mC/5hmC conversion in oocytes is the initial step of embryotic demethylation [ 13 ]. Unexpectedly, even TET3 plays important roles in methylation reprogramming of early embryos; TET3 is dispensable for oocyte maturation and early embryonic development, as viable mice pups could still be recovered after genetic ablation of TET3[ 14 ]. TET1 or TET2 null mice or those with combined loss of two developed relatively normally [ 15 ], whereas TET1/2/3 triple-knockout was lethal for mouse embryos [ 16 ]. Therefore, TET1, TET2, and TET3 are functionally redundant in embryo development [ 17 ]. DNA methylation inhibits gene transcription; therefore, it is believed that global demethylation in preimplantation embryo contributes to general transcriptional change. Indeed, after fertilization, the zygote is transcriptionally dormant, and molecules essential for development (such as proteins and RNAs) are provided from the maternal oocyte. Subsequently, throughout epigenetic reprogramming, the maternal factors are degraded, and zygotic genome is activated. This developmental switch is termed as zygotic gene activation (ZGA). In mice, ZGA is initiated during the late 1-cell stage, followed by major gene activation (major ZGA) at the 2-cell stage [ 18 ]. In pigs, major ZGA occurs at the 4-cell stage [ 19 ]. In humans, major ZGA occurs at the 8-cell stage [ 20 ]. In embryos of various species, TET-mediated DNA demethylation is crucial to initiate and complete ZGA [ 21 , 22 ]. Moreover, compared with fertilized embryos, cloned embryos exhibit abnormal 5hmC level and insufficient ZGA initiation, which are partially caused by the deficiency of TET protein [ 23 , 24 ]. As TET proteins have dynamic and overlapping roles in embryos, it is a challenge to characterize the function of individual TET protein. The effect of TET1/2/3 knockdown or knockout is not studied in porcine embryo [ 25 , 26 ]. Bobcat339, a promising and novel cytosine-based selective TET enzyme inhibitor, can reduce 5hmC levels in DNA [ 27 ]. Therefore, in the present study, Bobcat339 was used to explore how the combined suppression of these three enzymes affects oocyte maturation and embryo development in pig. Our results indicated that Bobcat339, as a special TET family inhibitor, compromised porcine oocyte maturation and early embryotic development. Methods Antibodies and chemicals Rabbit anti-5hmC monoclonal antibody (Cat# 91309) was obtained from Active Motif Company (California, CA); Rabbit anti-5mC monoclonal antibody (Cat# ab214727) was purchased from Abcam Company (Boston, MA); mouse anti-α-tubulin-FITC antibody (Cat# F2168) was obtained from Sigma Chemical Company (St Louis, MO); DyLight 549-conjugated goat anti-rabbit IgG (H + L) was purchased from Abbkine Biotechnology (California, CA); FITC-conjugated goat anti-rabbit IgG (H + L) was purchased from Boster (Wuhan, China); Bobcat339 (> 99.9%) (Cat# S6682) was obtained from Selleck Chemical Company (Pennsylvania, PA). All other chemicals and culture media were purchased from Sigma Chemical Company (St Louis, MO) unless otherwise stated. Porcine oocyte collection and in vitro maturation (IVM) The porcine ovaries were obtained from a local slaughterhouse in Wuhan and transported to the laboratory while maintained at 38.5°C in 0.9% saline. Follicular fluid was prepared from 3 to 6 mm antral follicles using a 10 mL syringe with a 16-gauge needle. Cumulus oocyte complexes (COCs) with uniform cytoplasm and several layers of cumulus cells were selected and rinsed three times in TCM-199 medium with 10% porcine follicular fluid (pFF), 5 µg/mL insulin-transferrin-sodium, 10 ng/mL EGF, 0.6 mM L-cysteine, 0.2 mM pyruvate, 25 µg/mL kanamycin. Approximately 40 COCs per well were cultured in 4-well plates containing in 500 µL TCM-199 medium with 10% pFF, 5 µg/mL insulin-transferrin-sodium, 10 ng/mL EGF, 0.6 mM L-cysteine, 0.2 mM pyruvate, 25 µg/mL kanamycin and 5 IU/mL of each eCG and hCG, covered with 300 µL mineral oil. Parthenogenetic activation and in vitro culture (IVC) Cumulus cells were removed by exposure to 0.2% hyaluronidase for 3 mins. Oocytes with the first polar body and an intact cytoplasm were subjected to Parthenogenetic Activation (PA ) using two DC pulses of 1.2 kV/cm for 30 ms in fusion medium (0.3 M D-mannitol supplemented with 0.175 mM CaCl 2 ·2H 2 0 and 0.05 mM MgCl 2 ·6H 2 0). The electro-activated oocytes were incubated in PZM-3 containing 7.5 µg/mL cytochalasin B for 3 h. Next, they were washed and cultured in a 4-well dish containing 500 µL PZM-3 with 0.4% bovine serum albumin (BSA) at 38.5°C under 5% CO2. The developmental rates were evaluated at 80 h (Day3) and 124 h (Day6) of IVC after activation. Chemical treatment Bobcat339 was dissolved in DMSO (400 mM) and then diluted with maturation medium to the final concentrations of 0 µM, 50 µM, 100 µM, 200 µM and 400 µM, with the concentration of DMSO < 0.1% in the culture medium. In addition, to arrest the porcine oocytes at the meiotic germinal vesicle (GV) stages, culture medium was supplemented with 1 mM IBMX (Sigma, 15879, St Louis, MO). AnnexinV-FITC staining Early apoptosis of the porcine oocytes was detected using the AnnexinV-FITC Apoptosis Detection Kit (Beyotime, C1062S, Shanghai, China). Briefly, 20–30 oocytes were washed in PBS containing 0.01% PVA (w/v), and then incubated in 100 µl binding buffer containing 5 µl of AnnexinV-FITC for 15 min at room temperature. After sufficient washing, the oocytes were checked immediately with inverted fluorescence microscopy. RNA isolation and RT-PCR Total RNA was obtained from 200 oocytes or 50 4-cell stage embryos using RNAqueous Microkit (Thermo Fisher Scientific, Massachusetts, MA) and was treated with DNase I (Thermo Fisher Scientific, Massachusetts, MA) to prevent genomic DNA contamination. Reverse transcription was performed using the RETROscript kit (Thermo Fisher Scientific, Massachusetts, MA). The real-time PCR was carried out in an iCycler (Bio-Rad Laboratories, California, CA). Each of 25 µl reaction system contained 12.5 µl of SYBR Green supermix (BioRad Laboratories, California, CA), 0.5 µl of each primer, and 11.5 µl of cDNA. The 2 −ΔΔCT method was used to calculate relative expression levels. The primers used for real-time PCR reactions were included in Table 1 . Table 1 Primer sequences used for real-time PCR Gene Accession Primer Sequences ((5'to3') Product Size(bp) BCL-2 XM_021077298.1 F: CAGGGACAGCGTATCAGAGC R: TTGCGATCCGACTCACCAAT 156 BAX XM_013998624.2 F: CCAGGATCGAGCAGGGCGAAT R: CACAGGGCCTTGAGCACCAGTTT 285 DPPA2 XM_003358822.4 F: CCGTTCCTGCTTCTGTTGAGACC R: GGCGAACCCAACCTTCTGTATCTG 105 EIF1A NM_001243218.1 F: GGTGTTCAAAGAAGATGGGCAAGAG R: TTTCCCTCTGATGTGACATAACCTC 115 H19 AY044827.1 F: TCAAACGACAAGAGATGGTGCTA R: GACGTCTGTTCCTTTGGCTC 118 NANOG XM_021092390.1 F: AGGACAGCCCTGATTCTTCCACAA R: AAAGTTCTTGCATCTGCTGGAGGC 198 OCT4 XM_021097869.1 F: AAGCAGTGACTATTCGCAAC R: CAGGGTGGTGAAGTGAGG 136 RPLP0 NM_001129964.2 F: GCTAAGGTGCTCGGTTCTTC R: GTGCGGACCAATGCTAGG 112 SOX2 NM_001123197.1 F: CGCAGACCTACATGAACG R: TCGGACTTGACCACTGAG 103 TET1 NM_001315772.1 F: AGCACAGGACAAAATGAAGG R: TGGTTAGTTGGAGAGGAGG 171 TET2 XM_013978993.2 F: GCCAACCCTGTGAACCTCT R: GGGCTGGTAAAGTGTATGG 270 TET3 XM_021087365.1 F: TCAAGGCAAAGACCCGAAC R: AGACGGCAGTCAATCGCTATT 261 ZSCAN4 XM_021097584.1 F: GCCCAGAAAGTCTTCCCATGTGAG R: GCCTCTCATCATTGTGTCTCCTCTG 94 Immunofluorescent staining Oocytes and embryos were first fixed with 4% paraformaldehyde for 30 min and then permeabilized with 1% Triton X-100 at room temperature for at least 8 h. For 5mC and 5hmC immunostainings, fixed embryos were incubated in 4N HCl solution at RT for 15 min. Following neutralization (10 min, 100 mM Tris–HCl, pH 8.0) and the second fixation. Then blocking with 2% BSA supplemented washing buffer (0.1% Tween 20 and 0.01% Triton X-100 in PBS) for 1 h, oocytes or embryos were stained with 5mC or 5hmC primary antibodies at 4°C overnight. After three washes in washing buffer, oocytes were stained with Cy3 or FITC-conjugated goat anti-rabbit immunoglobulin G (IgG) (H + L) (1:100) for 1 h at room temperature. For the α-tubulin-FITC staining, permeabilized oocytes were directly incubated for 1 h at room temperature after sufficient washing. Finally, oocytes or embryos were mounted on glass slides and examined with inverted fluorescence microscopy (Nikon Eclipse TE2000-U, Tokyo, Japan). Each experiment was repeated at least three times and no less than 30 oocytes or embryos were examined for each. RNA sequencing and data Analysis The total RNA of each sample was extracted using TRIzol® Reagent (Invitrogen, California, CA), and the smart-seq2 library was constructed using a previously published protocol [ 28 ]. Briefly, the full-length cDNA was synthesized from the RNA using template switch oligo and SuperScript II reverse transcriptase (Invitrogen, California, CA). The PCR protocol was as follows: incubation at 42°C for 90 min, followed by 10 cycles of 50°C for 2 min and 42°C for 2 min. The reverse transcriptase was inactivated by heating at 70°C for 15 min. The single-stranded cDNA was subsequently amplified using Kapa HiFi HotStart Readymix (Roche, Basel, Switzerland). The amplified cDNA was purified using AMpure XP beads (Beckman, California, CA) and used for library construction. All libraries were assessed using the High DNA Sensitivity Bioanalyzer 2100 (Agilent, California, CA) and real-time quantitative PCR (qRT-PCR). All libraries were sequenced using 150-bp paired-end on the Illumina Novaseq platform (California, CA). Raw RNA was filtered using Trimmomatic, and the sus scrofa reference genome (NCBI.Sscrofa10.2) was obtained. Index of the reference genome was built using Hisat2 v2.0.5, and paired-end clean reads were aligned to the reference genome. Htseq-count was used to count the read numbers mapped to each gene. Differential expression analysis of Bobcat339-treated and control groups was performed using the DESeq2 R package. Differentially expressed genes (DEGs) were determined with the criteria of P value 2. Cluster analyses were performed using the K-means clustering algorithm with R. Gene Ontology (GO) enrichment analysis was performed using the topGO R package. Results Bobcat339 treatment obstructed the first polar body extrusion in porcine oocytes To investigate the influence of TET on porcine cumulus cell expansion and oocyte maturation, cumulus oocyte complexes (COCs) were cultured with increasing concentrations of Bobcat339 (0, 100, 200, and 400 µM), and the responses of COCs were recorded at 24, 36, and 44 h. Bobcat339 treatment could block the expansion of cumulus cells in time- and concentration-dependent manners (Figure. 1A). Furthermore, the first polar body extrusion (PBE) was remarkably impaired in Bobcat339-treated oocytes in a concentration-dependent manner (71.75 ± 3.56%, n = 163, control vs 57.00 ± 4.06%, n = 171, 100 µM, P < 0.01 vs 32.50 ± 2.18%, n = 185, 200 µM, P < 0.001; vs 13.00 ± 2.12%, n = 201, 400 µM, P < 0.001; Figure. 1B). These results implied that oocyte maturation was hampered after the inhibition of TET by certain concentrations of Bobcat339. Since 200 µM Bobcat339 could significantly hamper the PBE but allowed escaping of some oocytes, this concentration was used for subsequent studies on the oocytes. Bobcat339 treatment triggered apoptosis of porcine oocytes With the weakened expansion of cumulus cells and PBE rate in Bobcat339-treated oocytes, we speculated that the apoptotic level of oocytes may be elevated after Bobcat339 treatment. Annexin-V-FITC staining and quantitative analysis revealed that the amount of early apoptotic oocytes was significantly increased after Bobcat339 treatment (4.35 ± 0.88%, n = 76, control vs 16.70 ± 3.83%, n = 91, 200 µM, P < 0.05; Figs. 1 C and 1 D). Moreover, the mRNA levels of the apoptosis-related gene BAX and anti-apoptosis gene BCL-2 were examined using qRT-PCR in control and Bobcat339-treated oocytes. The mRNA levels of BAX and BCL-2 were significantly higher in the Bobcat339-treated oocytes; however, the BAX / BCL-2 ratios were remarkably elevated (Figure. 1E). Therefore, we concluded that inhibition of TET proteins triggered early apoptosis in porcine oocytes. Effect of Bobcat339 on spindle architecture and chromosomes alignment in oocytes Bobcat339-treated oocytes exhibited defects in maturation and early apoptosis. Therefore, we speculated that the spindle architecture could be disrupted after Bobcat339 treatment. Therefore, the spindle morphology was assessed at metaphase I (MI) stage in control and Bobcat339-treated oocytes using α-tubulin staining. Our results revealed that the control oocytes had a typical barrel spindle, whereas the spindles were disorganized in the Bobcat339-treated oocytes. Moreover, unlike the control oocytes, in which the chromosomes were well aligned at the spindle plate, Bobcat339-treated oocytes exhibited dispersed chromosomes (Figure. 2A). The percentage of aberrant spindles in Bobcat339-treated oocytes was significantly elevated compared with that in the control oocytes (30.01 ± 4.97% vs. 14.33 ± 3.40%, n = 123, P < 0.05; Figure. 2B). In addition, the proportion of misaligned chromosomes was increased in Bobcat339-treated oocytes (66.32 ± 7.36% vs. 17.67 ± 1.70%, n = 145, P < 0.001; Figure. 2C). These results indicated that TET family is implicated in spindle architecture and chromosome alignment in porcine oocytes. Bobcat339 treatment altered 5mC/5hmC levels in porcine oocytes To assess whether the above defects depend on the enzymatic activity of TET proteins, we examined the 5mC and 5hmC levels in the control and Bobcat339-treated oocytes. The results demonstrated that the fluorescent signal of 5hmC was significantly decreased in the Bobcat339-treated oocytes (Figure. 3A). Further quantitative fluorescence analysis confirmed that 5hmC signal intensity was significantly decreased in Bobcat339-treated oocytes (1.00 ± 0.12, n = 32 vs 0.67 ± 0.10, n = 37, P < 0.001; Figure. 3B). On the contrary, the 5mC signal was significantly increased in the Bobcat339-treated oocytes (Figure. 3C). Quantitative analysis further verified that the mean 5mC intensity was significantly elevated in Bobcat339-treated oocytes (1.00 ± 0.28, n = 39 vs 1.31 ± 0.34, n = 46, P < 0.01; Figure. 3D). These results suggested that TET family mediates the levels of both 5mC and 5hmC in porcine oocytes. Effect of Bobcat339 on preimplantation embryo development To assess the impact of TET on early embryonic development, porcine parthenogenetic embryos were cultured in a PZM-3 medium supplemented with increasing concentrations of Bobcat339 (0, 25, 50, and 100 µM). We recorded the blastocyst rates on day 6 (Figs. 4 A and B). The proportion of activated oocytes that developed to the blastocyst stage was significantly lower after Bobcat339 treatment (33.67 ± 3.01%, n = 178, control vs 31.33 ± 0.02%, n = 164, 25 µM, P > 0.05 vs 11.02 ± 3.07%, n = 215, 50 µM, P < 0.01; vs 2.34 ± 2.00%, n = 237, 100 µM, P < 0.001). In addition, we calculated the developmental rate of embryos on day 3 after activation and observed that no significant difference was observed between the two groups at the 2-cell stage (7.76 ± ± 3.16%, n = 204, control vs 10.82 ± 2.48%, n = 234, 25 µM, P > 0.05 vs 13.73 ± 4.00%, n = 219, 50 µM, P > 0.05; vs 11.75 ± 2.37%, n = 194, 100 µM, P < 0.001; Figure. 4C); however, the developmental rate of embryos was significantly increased at the 4-cell stage (9.59 ± 1.50% control vs 19.85 ± 3.22%, 25 µM, P < 0.05 vs 29.36 ± 3.77%, 50 µM, P < 0.001; vs 42.82 ± 5.06%, 100 µM, P < 0.01; Figure. 4C) and decreased at 8-cell stage (76.68 ± 3.67% control vs 63.88 ± 3.60%, 25 µM, P < 0.05 vs 53.93 ± 4.87%, 50 µM, P < 0.05; vs 37.90 ± 7.05%, 100 µM, P < 0.001) after Bobcat339 treatment. Therefore, Bobcat339 treatment arrested embryo growth at the 4-cell stage. Bobcat339 treatment decreased the expression of ZGA and pluripotency-related genes Bobcat treatment arrested embryo growth at the 4-cell stage. However, porcine ZGA occurs during the 4-cell stage. Therefore, the effect of Bobcat339 treatment on the expression of porcine ZGA marker genes ( EIF1A , DPPA2 , and ZSCAN4 ) was evaluated using qRT-PCR. The results indicated that the mRNA levels of EIF1A and DPPA2 at the 4-cell stage were significantly lower after Bobcat339 treatment (Figure. 4D). As pluripotency-related and imprinted genes are crucial for embryotic development, we assessed the mRNA levels of the pluripotency-related genes SOX2 , OCT4 , and NANOG and imprinted gene H19 . The mRNA levels of OCT4 and NANOG significantly decreased after Bobcat339 treatment (Figure. 4E), whereas those of SOX2 and H19 exhibited no significant difference (Figure. 4F). These findings verified that Bobcat339 treatment could disrupt ZGA in porcine embryos. Bobcat339 treatment disrupted 5mC/5hmC levels in porcine embryos To investigate whether the embryonic developmental arrest after Bobcat339 treatment occurred via the enzymatic activity of TET, we examined the 5mC/5hmC levels in control and Bobcat339-treated preimplantation embryos. The fluorescence intensity of 5hmC in 2- and 4-cell embryos was lower in Bobcat339-treated oocytes (Figure. 5A and B). Further quantitative fluorescence analysis confirmed that the fluorescence intensity of 5hmC was significantly decreased after Bobcat339 treatment (2-cell stage: 1.00 ± 0.16, n = 39 vs 0.52 ± 0.20 n = 36; 4-cell stage: 1.00 ± 0.21, n = 42 vs 0.70 ± 0.14, n = 48; P < 0.001 for both; Figs. 5 E and F). On the contrary, the fluorescence signal of 5mC in 2- and 4-cell embryos was higher in Bobcat339-treated oocytes (Figs. 5 C and D). The fluorescence intensity of 5mC was significantly elevated in the Bobcat339-treated oocytes (2-cell stage: 1.00 ± 0.23, n = 41 vs 1.47 ± 0.28, n = 36, P < 0.001; 4-cell stage: 1.00 ± 0.19, n = 36 vs 1.44 ± 0.27, n = 37, P < 0.0001; Figs. 5 G and H). These results suggested that TET enzymes regulated both 5mC and 5hmC levels in porcine preimplantation embryos. Comparative analyses of transcriptomic data To delineate the affected genes and pathways after Bobcat339 treatment, RNA sequencing analysis was performed in 4-cell embryos derived from control and Bobcat339-treated groups. In our results, principal component analysis (PCA) met the requirement of mRNA expression analysis (Figure. 6A). Violin plot was not significantly different between control and Bobcat339-treated embryos (Figure. 6B). Hierarchical clustering of the DEGs in control and Bobcat339-treated groups is shown in Figure. 6C. Furthermore, we identified 203 significantly DEGs (75 up- and 128 downregulated genes) between the two groups, (Fig. 7D). The GO analysis revealed that the DEGs were significantly enriched in biological processes including regulation of cell population proliferation (GO:0042127), in molecular functions related to cell adhesion molecule binding (GO:0050839), and cellular components related to mitochondrion (GO:0005739) and organelle envelope (GO:0031967) (Fig. 7E). Therefore, Bobcat339 treatment significantly altered the transcriptome in the embryos at the 4-cell stage. Discussion It is reported that TET1 and TET2 are mainly responsible for DNA demethylation in PGCs and post-implantation embryos, and TET3 is implicated in active demethylation of DNA in the zygote. However, several studies have reported that TET1, TET2, and TET3 probably have overlapping expressions and role in embryo development [ 29 ]. TET1/TET2 double deficiency embryos could survive normally and develop into fertile adult mice, likely because TET3 compensates for TET1/TET2 mutation; however, TET1/2/3 triple deficient embryos were arrested at the 2-cell stage [ 15 , 30 ]. These data highlighted that compensatory mechanism exists among TET1, TET and TET3. Therefore, in this study, we used Bobcat339, a novel and specific small-molecular inhibitor of the TET proteins, to explore the combined role of TET proteins in porcine oocytes and preimplantation embryos. In this study, the levels of 5mC and 5hmC were abnormal after Bobcat339 treatment, with elevated 5mC and declined 5hmC levels in porcine oocytes. This phenotype is different from that of mice oocytes with only TET3 deficiency, in which the reduction in the 5hmC levels or increase in the 5mC levels was not apparent compared with the control oocytes [ 14 ]. Assessment of apoptotic signal and apoptosis-related genes revealed early apoptosis after Bobcat339 treatment; correspondingly, the PBE rates decreased. Moreover, Bobcat339-treated oocytes exhibited remarkably abnormal spindle architecture and chromosome alignment. These phenotypes resembled those of mice oocytes with TET2 deficiency, in which the defects of spindle morphology and chromosome distribution, delayed meiotic progression, and accelerated aging were observed [ 31 ]. In this study, we observed that after Bobcat339 treatment, the levels of 5mC and 5hmC in parthenogenetic embryo were altered. These results are consistent with previous studies on mice, bovine, and human embryos with TET1/2/3 triple-knockout [ 30 , 32 – 33 ]. 5hmC is not only an intermediate between demethylated 5mC and cytosine but also an independent epigenetic marker vital for the pluripotency [ 5 ]. Pluripotency-associated genes such as OCT4 , SOX2 , and NANOG are methylated during germ cell development, and their demethylation occurs in the early embryo. In normal zygotes, pluripotency-associated genes undergo substantial demethylation till the PN3–4 pronuclear stages [ 34 ]. The impacts of individual TET family member on the pluripotency of embryos are not consistent in previous studies [ 35 – 37 ]. This could be due to the compensatory role played by TET family members. Our results indicated that the inhibition of TET resulted in noticeably downregulated expression of OCT4 and NANOG . Imprinted region is referred to the alleles expressed only from paternal or maternal origin. They are distinguished by the differences in DNA methylation. Unlike pluripotency-associated genes, imprinted genes are resistant to demethylation in the early embryo stage and are protected by maternal factors including Dnmt1, Dppa3, ZFP57, and TRIM28 [ 38 ]. It is well known that parthenogenetic embryos naturally exhibit abnormal expression of imprinted genes, in which paternal imprinted genes are highly expressed, and maternal imprinted genes are either lowly or not expressed [ 39 ]. Therefore, parthenogenetic embryo is the most appropriate model for exploring the methylation modifications. In parthenogenetic embryos, H19 is an important paternal imprinted gene whose expression level depends on methylation regulation [ 40 ]. In our study, the mRNA level of H19 was not affected in the Bobcat339-treated embryos. This is consistent with a study on bovine parthenogenetic embryo [ 32 ]. In pigs, the major ZGA occurs during the 4-cell stage [ 19 ]. In our study, the growth of Bobcat339-treated embryos was arrested at the 4-cell stage. Moreover, transcriptome data of early embryos at the 4-cell stage revealed 203 significant DEGs between Bobcat339-treated and control groups, with 75 up- and 128 downregulated genes. Therefore, after Bobcat339 treatment, abnormal 5mC/5hmC levels may lead to altered ZGA, finally blocking embryotic development. Therefore, we assessed the mRNA levels of porcine ZGA marker genes EIF1A , DPPA2 , and ZSCAN4 [ 41 ]. The significantly decreased expression of EIF1A and DPPA2 confirmed our hypothesis. Conclusion In this study, we demonstrated that TET family is essential for porcine oocyte maturation and participated in oocyte spindle architecture and chromosome alignment by regulating 5mC and 5hmC levels. Our results indicated that TET family is essential for the development of parthenogenetic preimplantation embryos, mediating the mRNA level of ZGA marker genes and pluripotency-related genes and the global transcriptome of embryos at the 4-cell stage through adjusting 5mC and 5hmC levels. Declarations Ethics approval The porcine ovaries were from a local slaughterhouse. All experimentation in this study conferred the guidelines set by the Animal Care and Use Committee of Hubei Academy of Agricultural Sciences (HBAAS-2023-014). Funding This study was supported by the China Postdoctoral Science Foundation (2022M711095); Shuguang Plan of Wuhan Knowledge Innovation Project (NK2022010207); Key Research and Development Program of Hubei Province (2021BBA221). Authors’ contributions Project administration, F.C. and Y.Z.B.; Methodology, M.G.L., Z.D.H and H.Y.R.; Data curation, G.H., C.F.Z. and A.F.L; Resources, Z.Z. and T.H; Supervision, B.Y.Z.; Writing - original draft, F.C.; Writing - review & editing, F.C and B.Y.Z. All authors contributed to the article and approved the submitted version. Conflicts of Interest Authors declare that no competing interests exist. All authors have read and agreed to the published version of the manuscript. Data Availability Statement The data that support the findings of this study are available from the corresponding author upon reasonable request. References Kennedy AJ, Sweatt JD. Drugging the methylome: DNA methylation and memory. Crit Rev Biochem Mol Biol . 2016;51(3):185-94. Ito S, Shen L, Dai Q, et al. Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. Science. 2011;333(6047):1300-3. He YF, Li BZ, Li Z, Liu P, et al. Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science. 2011;333(6047):1303-7. Wu X, Zhang Y. TET-mediated active DNA demethylation: mechanism, function and beyond. Nat Rev Genet. 2017;18(9):517-34. Shi DQ, Ali I, Tang J, et al. New Insights into 5hmC DNA Modification: Generation, Distribution and Function. Front Genet. 2017;8:100. Guo F, Yan L, Guo H, et al. The Transcriptome and DNA Methylome Landscapes of Human Primordial Germ Cells. Cell. 2015;161(6):1437-52. Xu R, Li C, Liu X, et al. Insights into epigenetic patterns in mammalian early embryos. Protein Cell . 2021;12(1):7-28. Vincent JJ, Huang Y, Chen PY, et al. Stage-specific roles for tet1 and tet2 in DNA demethylation in primordial germ cells. Cell Stem Cell. 2013;12(4):470-8. Khoueiry R, Sohni A, Thienpont B, et al. Lineage-specific functions of TET1 in the postimplantation mouse embryo. Nat Genet. 2017;49(7):1061-72. Gu TP, Guo F, Yang H, et al. The role of Tet3 DNA dioxygenase in epigenetic reprogramming by oocytes. Nature. 2011;477(7366):606-10. Iqbal K, Jin SG, Pfeifer GP, et al. Reprogramming of the paternal genome upon fertilization involves genome-wide oxidation of 5-methylcytosine. Proc Natl Acad Sci U S A. 2011;108(9):3642-7. Shen L, Inoue A, He J, et al. Tet3 and DNA replication mediate demethylation of both the maternal and paternal genomes in mouse zygotes. Cell Stem Cell. 2014;15(4):459-71. Sakashita A, Kobayashi H, Wakai T, et al. Dynamics of genomic 5-hydroxymethylcytosine during mouse oocyte growth. Genes Cells. 2014;19(8):629-36. Tsukada Y, Akiyama T, Nakayama KI. Maternal TET3 is dispensable for embryonic development but is required for neonatal growth. Sci Rep. 2015;5:15876. Dawlaty MM, Breiling A, Le T, et al. Combined deficiency of Tet1 and Tet2 causes epigenetic abnormalities but is compatible with postnatal development. Dev Cell. 2013;24(3):310-23. Dawlaty MM, Breiling A, Le T, et al. Loss of Tet enzymes compromises proper differentiation of embryonic stem cells. Dev Cell. 2014;29(1):102-11. Li C, Lan Y, Schwartz-Orbach L, et al. Overlapping Requirements for Tet2 and Tet3 in Normal Development and Hematopoietic Stem Cell Emergence. Cell Rep. 2015;12(7):1133-43. Xue Z, Huang K, Cai C, et al. Genetic programs in human and mouse early embryos revealed by single-cell RNA sequencing. Nature. 2013;500(7464):593-7. Zhai Y, Yu H, An X, et al. Profiling the transcriptomic signatures and identifying the patterns of zygotic genome activation - a comparative analysis between early porcine embryos and their counterparts in other three mammalian species. BMC Genomics. 2022;23(1):772. Braude P, Bolton V, Moore S. Human gene expression first occurs between the four- and eight-cell stages of preimplantation development. Nature. 1988;332(6163):459-61. Lee K, Hamm J, Whitworth K, et al. Dynamics of TET family expression in porcine preimplantation embryos is related to zygotic genome activation and required for the maintenance of NANOG. Dev Biol. 2014;386(1):86-95. Wossidlo M, Nakamura T, Lepikhov K, et al. 5-Hydroxymethylcytosine in the mammalian zygote is linked with epigenetic reprogramming. Nat Commun. 2011;2:241. Cao Z, Zhou N, Zhang Y, et al. Dynamic reprogramming of 5-hydroxymethylcytosine during early porcine embryogenesis. Theriogenology. 2014;81(3):496-508. Zhang J, Hao L, Wei Q, et al. TET3 overexpression facilitates DNA reprogramming and early development of bovine SCNT embryos. Reproduction. 2020;160(3):379-91. Uh K, Ryu J, Farrell K, et al. TET family regulates the embryonic pluripotency of porcine preimplantation embryos by maintaining the DNA methylation level of NANOG. Epigenetics. 2020;15(11):1228-42. Uh K, Lee K. Ten-Eleven Translocation-3 CXXC domain is critical for postfertilization demethylation and expression of pluripotency genes in pig embryos. Biol Reprod. 2022;107(5):1205-16. Chua GNL, Wassarman KL, Sun H, et al. Cytosine-Based TET Enzyme Inhibitors. ACS Med Chem Lett. 2019;10(2):180-5. Picelli S, Faridani OR, Björklund AK, et al. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 2014;9(1):171-81. Kang J, Lienhard M, Pastor WA, et al. Simultaneous deletion of the methylcytosine oxidases Tet1 and Tet3 increases transcriptome variability in early embryogenesis. Proc Natl Acad Sci U S A. 2015;112(31):E4236-45. Arand J, Chiang HR, Martin D, et al. Tet enzymes are essential for early embryogenesis and completion of embryonic genome activation. EMBO Rep. 2022;23(2):e53968. Wang H, Liu L, Gou M, et al. Roles of Tet2 in meiosis, fertility and reproductive aging. Protein Cell. 2021;12(7):578-85. Zhang J, Zhang S, Wang Y, et al. Effect of TET inhibitor on bovine parthenogenetic embryo development. PLoS One. 2017;12(12):e0189542. Verma N, Pan H, Doré LC, et al. TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. Nat Genet. 2018;50(1):83-95. Farthing CR, Ficz G, Ng RK, et al. Global mapping of DNA methylation in mouse promoters reveals epigenetic reprogramming of pluripotency genes. PLoS Genet. 2008;4(6):e1000116. Ito S, D'Alessio AC, Taranova OV, et al. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature. 2010;466(7310):1129-33. Fan A, Ma K, An X, et al. Effects of TET1 knockdown on gene expression and DNA methylation in porcine induced pluripotent stem cells. Reproduction. 2013;146(6):569-79. Costa Y, Ding J, Theunissen TW, et al. NANOG-dependent function of TET1 and TET2 in establishment of pluripotency. Nature. 2013;495(7441):370-4. Kelsey G, Feil R. New insights into establishment and maintenance of DNA methylation imprints in mammals. Philos Trans R Soc Lond B Biol Sci. 2013;368(1609):20110336. Wu Q, Kumagai T, Kawahara M, et al. Regulated expression of two sets of paternally imprinted genes is necessary for mouse parthenogenetic development to term. Reproduction. 2006;131(3):481-8. Park CH, Kim HS, Lee SG, et al. Methylation status of differentially methylated regions at Igf2/H19 locus in porcine gametes and preimplantation embryos. Genomics. 2009;93(2):179-86. Zhang T, Zheng Y, Han R, et al. Effects of pyruvate on early embryonic development and zygotic genome activation in pigs. Theriogenology. 2022;189:77-85. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2906860","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":198495506,"identity":"a07048ea-fb37-45d6-8b21-8495e52f3086","order_by":0,"name":"Fan Chen","email":"","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Chen","suffix":""},{"id":198495507,"identity":"2b1d9bbe-7e9e-4164-8592-d87b63a3e613","order_by":1,"name":"Mingguo Li","email":"","orcid":"","institution":"Shihezi University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mingguo","middleName":"","lastName":"Li","suffix":""},{"id":198495508,"identity":"3b57f316-abff-448a-a483-1c4caec81221","order_by":2,"name":"Zaidong Hua","email":"","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zaidong","middleName":"","lastName":"Hua","suffix":""},{"id":198495509,"identity":"d4b06913-3509-4357-be9b-fc0446308dc6","order_by":3,"name":"Hongyan Ren","email":"","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongyan","middleName":"","lastName":"Ren","suffix":""},{"id":198495510,"identity":"838a0206-11aa-4619-ad1e-2f4140e7d58a","order_by":4,"name":"Anfeng Luo","email":"","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Anfeng","middleName":"","lastName":"Luo","suffix":""},{"id":198495511,"identity":"56aafa32-3d99-40b9-a653-e7a29d826a7b","order_by":5,"name":"Hao Gu","email":"","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Gu","suffix":""},{"id":198495512,"identity":"2f661a2c-0167-4639-be25-00f540d48a56","order_by":6,"name":"Changfan Zhou","email":"","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Changfan","middleName":"","lastName":"Zhou","suffix":""},{"id":198495513,"identity":"b49012ef-1c28-4556-b4b5-a44807f8dbda","order_by":7,"name":"Zhe Zhu","email":"","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zhe","middleName":"","lastName":"Zhu","suffix":""},{"id":198495514,"identity":"123d834f-d83f-45e9-a5e9-f9d60a330bcd","order_by":8,"name":"Tao Huang","email":"","orcid":"","institution":"Shihezi University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Huang","suffix":""},{"id":198495515,"identity":"ff48a758-f654-4d8a-8883-15a46657b841","order_by":9,"name":"Yanzhen Bi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAw0lEQVRIiWNgGAWjYFACNgYGxgYGBn5m5oMPSNMi2c6WbECaFoPzPGYCRGmQn5GW+Lhyx2F748MMZgwMNTbRBLUY3Eg7bHj2zGFms8MMaQ8YjqXlNhDUIpHeJtnYdpgNqOW4AWPDYcJa5Gekt/8EauExbmZskyBKC8ONtGOMQC0SBszMbMRpMTjzLFmy8Uy6gcRhNmaDBGL8It+eZvixcYe1PX//+Y8PPtTYEOEwCGiGUAlEKgeBOhLUjoJRMApGwYgDAM99PksvkBDAAAAAAElFTkSuQmCC","orcid":"","institution":"Hubei Academy of Agricultural Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yanzhen","middleName":"","lastName":"Bi","suffix":""}],"badges":[],"createdAt":"2023-05-08 08:59:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2906860/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2906860/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":36928279,"identity":"aa55e8cb-02eb-4c99-a5d2-7ee6984c2fe2","added_by":"auto","created_at":"2023-05-12 03:20:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5831818,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBobcat339 treatment impaired porcine oocyte maturation. (A) \u003c/strong\u003eRepresentative\u003cstrong\u003e \u003c/strong\u003eimages of cumulus oocyte complexes (COCs) in control and Bobcat339-treated (0, 100, 200, and 400 μM) oocytes after culturing in vitro for 27, 36, and 44 h. Good expansion of cumulus cells was observed in control COCs, whereas they exhibited less expansion and were more adhesive in Bobcat339-treated group. \u003cstrong\u003e(B) \u003c/strong\u003eThe percentage of the PBE was significantly decreased after treatment with 100 (**\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01), 200 (***\u003cem\u003eP \u0026lt; \u003c/em\u003e0.001), and 400 μM (***\u003cem\u003eP \u0026lt; \u003c/em\u003e0.001) Bobcat339. \u003cstrong\u003e(C) \u003c/strong\u003eEarly apoptotic fluorescent signals in control and Bobcat339-treated oocytes. Annexin-V, green; Scale Bar = 100 μm. \u003cstrong\u003e(D) \u003c/strong\u003eThe proportion of the oocytes with Annexin-V signal was calculated in control and Bobcat339-treated oocytes. \u003cstrong\u003e(E)\u003c/strong\u003eqRT-PCR revealed the mRNA levels of \u003cem\u003eBAX\u003c/em\u003e, \u003cem\u003eBCL-2\u003c/em\u003e and \u003cem\u003eBAX\u003c/em\u003e/\u003cem\u003eBCL\u003c/em\u003e-2 in control and Bobcat339-treated oocytes. The results are shown as the mean ± SEM from at least three independent experiments. *\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; **\u003cem\u003eP \u0026lt;\u003c/em\u003e0.01; ***\u003cem\u003eP \u0026lt; \u003c/em\u003e0.001.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-2906860/v1/c5c23ddc79129c02651d997c.png"},{"id":36928704,"identity":"7a93b9d3-7d41-44fe-93ba-cf4f83e6d2c0","added_by":"auto","created_at":"2023-05-12 03:22:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":209719,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInfluence of Bobcat339 on spindle morphology and chromosome alignment. (A) \u003c/strong\u003eImages delineating spindle morphology and chromosome alignment in control and Bobcat339-treated oocytes (200 μM Bobcat339). Blue, chromosomes; Green, α-tubulin;\u003cstrong\u003e \u003c/strong\u003eScale Bar = 20 μm. \u003cstrong\u003e(B) \u003c/strong\u003eThe percentage of aberrant spindle was significantly increased in Bobcat339-treated oocytes. \u003cstrong\u003e(C) \u003c/strong\u003eThe proportion of misaligned chromosome was significantly elevated in Bobcat339-treated oocytes. The results are shown as the mean ± SEM from at least three independent experiments. *\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; ***\u003cem\u003eP \u0026lt; \u003c/em\u003e0.001.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-2906860/v1/797d77788d9aeb70e69f2631.png"},{"id":36926536,"identity":"774abe40-9e04-49cf-bfc2-b7c10df46a92","added_by":"auto","created_at":"2023-05-12 03:14:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1979404,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBobcat339 treatment altered 5mC and 5hmC levels in porcine oocytes. \u003c/strong\u003eThe COCs in control and Bobcat339-treated groups were cultured in the IVM medium supplemented with 1 mM IBMX, to maintain the meiotic GV arrest.\u003cstrong\u003e (A) \u003c/strong\u003eThe immunofluorescent staining of 5mC in porcine oocytes. Green, 5mC; Scale Bar = 20 μm. \u003cstrong\u003e(B)\u003c/strong\u003e The fluorescence intensity of 5mC in control and Bobcat339-treated oocytes.\u003cstrong\u003e (C)\u003c/strong\u003e Immunofluorescent staining of 5hmC in control and Bobcat339-treated oocytes. Red, 5hmC; Scale Bar = 20 μm. \u003cstrong\u003e(D)\u003c/strong\u003e Average fluorescence intensity of 5hmC in control and Bobcat339-treated oocytes. The results are shown as the mean ± SEM from at least three independent experiments. **\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01; ***\u003cem\u003eP \u0026lt; \u003c/em\u003e0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-2906860/v1/3a3161c121c975ab42422e71.png"},{"id":36927196,"identity":"76b1c861-9992-4454-ae9a-6d62583ac97b","added_by":"auto","created_at":"2023-05-12 03:17:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1453364,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBobcat339 treatment hampered early embryo development in pigs. (A) \u003c/strong\u003eImages delineating blastocyst formation on day 6 of parthenogenetically activated porcine embryos in control and Bobcat339-treated (25, 50, and 100 μM ) groups. Scale Bar = 100 μm. \u003cstrong\u003e(B) \u003c/strong\u003eThe proportions of activated oocytes that developed to the blastocyst stage were calculated between control and Bobcat339-treated groups. \u003cstrong\u003e(C)\u003c/strong\u003e The proportions of embryos at various stages were calculated on day 3 in control and Bobcat339-treated (25, 50, and 100 μM Bobcat339) groups. \u003cstrong\u003e(D) \u003c/strong\u003eThe mRNA levels of \u003cem\u003eEIF1A\u003c/em\u003e, and \u003cem\u003eDPPA2\u003c/em\u003e were significantly decreased in Bobcat339-treated embryos. \u003cstrong\u003e(E) \u003c/strong\u003eThe mRNA levels of \u003cem\u003eOCT4 \u003c/em\u003eand \u003cem\u003eNANOG \u003c/em\u003ewere reduced in Bobcat339-treated embryos; the mRNA levels of \u003cem\u003eSOX2\u003c/em\u003e exhibited no change. \u003cstrong\u003e(F) \u003c/strong\u003eThe mRNA levels of \u003cem\u003eH19\u003c/em\u003e were not affected after Bobcat339 treatment. *\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.05; **\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01; ***\u003cem\u003eP \u0026lt; \u003c/em\u003e0.001.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-2906860/v1/955e553e8745c0a3b9de68d2.png"},{"id":36927197,"identity":"3b7f8706-0dcb-4942-a770-e6ecdf5f1bfb","added_by":"auto","created_at":"2023-05-12 03:17:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2288031,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBobcat339 treatment affected 5mC and 5hmC levels in porcine embryos. (A and B) \u003c/strong\u003eThe immunofluorescence staining of 5hmC in embryos at the 2- and 4-cell stages in control and Bobcat339-treated groups. Red, 5hmC; Scale Bar = 20 μm.\u003cstrong\u003e (C and D) \u003c/strong\u003eThe immunofluorescence staining of 5mC in embryos at the 2- and 4-cell stages in control and Bobcat339-treated groups. Green, 5mC; Scale Bar = 20 μm.\u003cstrong\u003e (E and F)\u003c/strong\u003eThe fluorescence intensity of 5hmC was calculated in embryos at the 2- and 4-cell stages in control and Bobcat339-treated groups.\u003cstrong\u003e (G, H)\u003c/strong\u003e Average fluorescence intensity of 5mC was recorded in embryos in control and Bobcat339-treated groups at the 2- and 4-cell stages.\u003cstrong\u003e \u003c/strong\u003eThe results are shown as the mean ± SEM from at least three independent experiments. ***\u003cem\u003eP \u0026lt; \u003c/em\u003e0.001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-2906860/v1/de5b66c790bb7cdf455e11b9.png"},{"id":36925463,"identity":"81557977-5448-43f5-a4ce-504ee0849cf3","added_by":"auto","created_at":"2023-05-12 03:11:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":330034,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe different gene expression patterns between control and Bobcat339-treated embryos. (A)\u003c/strong\u003e Principal component analysis of mRNA level between control and Bobcat339-treated embryos at the 4-cell stage.\u003cstrong\u003e (B)\u003c/strong\u003e Violin plot of gene expression and distribution between control and Bobcat339-treated groups\u003cstrong\u003e. (C)\u003c/strong\u003e Hierarchical cluster of differentially expressed genes (DEGs; \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05 and |log2 fold change| \u0026gt; 1) between control and Bobcat339-treated embryos at the 4-cell stage. The color scale of the heatmap represents the expression levels. \u003cstrong\u003e(D) \u003c/strong\u003eVolcano plot of DEGs between control and Bobcat339-treated embryos at the 4-cell stage. Red and green dots represent up- and down regulated genes, respectively. \u003cstrong\u003e(E) \u003c/strong\u003eGene Ontology analysis revealed that the DEGs were enriched in certain biological processes, molecular functions, and cellular components.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-2906860/v1/339f7c203d9a0c5a6eb28c98.png"},{"id":38136930,"identity":"b17c0067-0664-4366-9b3f-90bdf9ceb30c","added_by":"auto","created_at":"2023-06-07 05:59:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4767088,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2906860/v1/0e4ab4b6-94ee-4653-9f61-2773cf923011.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Bobcat339, a specific TET family inhibitor, impaired oocyte maturation and early embryogenesis in pig","fulltext":[{"header":"Background","content":"\u003cp\u003eIn DNA, methylation of cytosine at the C5 position (5-methylcytosine, 5mC) is an inhibitory epigenetic mechanism, which can block the expression of various genes [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The formation of 5mC is a dynamic process; ten-eleven translocation (TET) methylcytosine dioxygenase can successively oxidize 5-mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The 5fC and 5caC can be replaced with unmodified cytosine via base excision repair [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, TET can eliminate DNA methylation imprinting and promote active demethylation processes. TET-mediated DNA demethylation is implicated in diverse biological processes, including embryotic development and stem cell pluripotency and differentiation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Importantly, 5hmc serves not only as the first and important intermediate in demethylation processes but also an independent and stable epigenetic marker vital for stem cell pluripotency [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGlobal DNA demethylation occurs during two different stages of mammalian development, the migration of primordial germ cells (PGCs) and pronuclear stage of zygotes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It seems that TET1, TET2, and TET3 act at different stages during embryo development. TET1 and TET2 predominantly participate in DNA demethylation in PGCs and post-implantation embryos [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. TET3 mediates demethylation of both paternal and maternal genomes in zygotes and directly participates in active DNA demethylation in preimplantation embryos [\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e–\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Moreover, 5hmC is present in fully grown oocytes but not at nongrowing stage, which is accompanied by noticeable TET3 increase; this implies that 5mC/5hmC conversion in oocytes is the initial step of embryotic demethylation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Unexpectedly, even TET3 plays important roles in methylation reprogramming of early embryos; TET3 is dispensable for oocyte maturation and early embryonic development, as viable mice pups could still be recovered after genetic ablation of TET3[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. TET1 or TET2 null mice or those with combined loss of two developed relatively normally [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], whereas TET1/2/3 triple-knockout was lethal for mouse embryos [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Therefore, TET1, TET2, and TET3 are functionally redundant in embryo development [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDNA methylation inhibits gene transcription; therefore, it is believed that global demethylation in preimplantation embryo contributes to general transcriptional change. Indeed, after fertilization, the zygote is transcriptionally dormant, and molecules essential for development (such as proteins and RNAs) are provided from the maternal oocyte. Subsequently, throughout epigenetic reprogramming, the maternal factors are degraded, and zygotic genome is activated. This developmental switch is termed as zygotic gene activation (ZGA). In mice, ZGA is initiated during the late 1-cell stage, followed by major gene activation (major ZGA) at the 2-cell stage [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In pigs, major ZGA occurs at the 4-cell stage [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In humans, major ZGA occurs at the 8-cell stage [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In embryos of various species, TET-mediated DNA demethylation is crucial to initiate and complete ZGA [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Moreover, compared with fertilized embryos, cloned embryos exhibit abnormal 5hmC level and insufficient ZGA initiation, which are partially caused by the deficiency of TET protein [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs TET proteins have dynamic and overlapping roles in embryos, it is a challenge to characterize the function of individual TET protein. The effect of TET1/2/3 knockdown or knockout is not studied in porcine embryo [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Bobcat339, a promising and novel cytosine-based selective TET enzyme inhibitor, can reduce 5hmC levels in DNA [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Therefore, in the present study, Bobcat339 was used to explore how the combined suppression of these three enzymes affects oocyte maturation and embryo development in pig. Our results indicated that Bobcat339, as a special TET family inhibitor, compromised porcine oocyte maturation and early embryotic development.\u003c/p\u003e"},{"header":"Methods","content":"\u003ch2\u003eAntibodies and chemicals\u003c/h2\u003e\u003cp\u003eRabbit anti-5hmC monoclonal antibody (Cat# 91309) was obtained from Active Motif Company (California, CA); Rabbit anti-5mC monoclonal antibody (Cat# ab214727) was purchased from Abcam Company (Boston, MA); mouse anti-α-tubulin-FITC antibody (Cat# F2168) was obtained from Sigma Chemical Company (St Louis, MO); DyLight 549-conjugated goat anti-rabbit IgG (H + L) was purchased from Abbkine Biotechnology (California, CA); FITC-conjugated goat anti-rabbit IgG (H + L) was purchased from Boster (Wuhan, China); Bobcat339 (\u0026gt; 99.9%) (Cat# S6682) was obtained from Selleck Chemical Company (Pennsylvania, PA). All other chemicals and culture media were purchased from Sigma Chemical Company (St Louis, MO) unless otherwise stated.\u003c/p\u003e\u003ch2\u003ePorcine oocyte collection and in vitro maturation (IVM)\u003c/h2\u003e\u003cp\u003eThe porcine ovaries were obtained from a local slaughterhouse in Wuhan and transported to the laboratory while maintained at 38.5°C in 0.9% saline. Follicular fluid was prepared from 3 to 6 mm antral follicles using a 10 mL syringe with a 16-gauge needle. Cumulus oocyte complexes (COCs) with uniform cytoplasm and several layers of cumulus cells were selected and rinsed three times in TCM-199 medium with 10% porcine follicular fluid (pFF), 5 µg/mL insulin-transferrin-sodium, 10 ng/mL EGF, 0.6 mM L-cysteine, 0.2 mM pyruvate, 25 µg/mL kanamycin. Approximately 40 COCs per well were cultured in 4-well plates containing in 500 µL TCM-199 medium with 10% pFF, 5 µg/mL insulin-transferrin-sodium, 10 ng/mL EGF, 0.6 mM L-cysteine, 0.2 mM pyruvate, 25 µg/mL kanamycin and 5 IU/mL of each eCG and hCG, covered with 300 µL mineral oil.\u003c/p\u003e\u003ch2\u003eParthenogenetic activation and in vitro culture (IVC)\u003c/h2\u003e\u003cp\u003eCumulus cells were removed by exposure to 0.2% hyaluronidase for 3 mins. Oocytes with the first polar body and an intact cytoplasm were subjected to Parthenogenetic Activation (PA ) using two DC pulses of 1.2 kV/cm for 30 ms in fusion medium (0.3 M D-mannitol supplemented with 0.175 mM CaCl\u003csub\u003e2\u003c/sub\u003e·2H\u003csub\u003e2\u003c/sub\u003e0 and 0.05 mM MgCl\u003csub\u003e2\u003c/sub\u003e·6H\u003csub\u003e2\u003c/sub\u003e0). The electro-activated oocytes were incubated in PZM-3 containing 7.5 µg/mL cytochalasin B for 3 h. Next, they were washed and cultured in a 4-well dish containing 500 µL PZM-3 with 0.4% bovine serum albumin (BSA) at 38.5°C under 5% CO2. The developmental rates were evaluated at 80 h (Day3) and 124 h (Day6) of IVC after activation.\u003c/p\u003e\u003ch2\u003eChemical treatment\u003c/h2\u003e\u003cp\u003eBobcat339 was dissolved in DMSO (400 mM) and then diluted with maturation medium to the final concentrations of 0 µM, 50 µM, 100 µM, 200 µM and 400 µM, with the concentration of DMSO \u0026lt; 0.1% in the culture medium. In addition, to arrest the porcine oocytes at the meiotic germinal vesicle (GV) stages, culture medium was supplemented with 1 mM IBMX (Sigma, 15879, St Louis, MO).\u003c/p\u003e\u003ch2\u003eAnnexinV-FITC staining\u003c/h2\u003e\u003cp\u003eEarly apoptosis of the porcine oocytes was detected using the AnnexinV-FITC Apoptosis Detection Kit (Beyotime, C1062S, Shanghai, China). Briefly, 20–30 oocytes were washed in PBS containing 0.01% PVA (w/v), and then incubated in 100 µl binding buffer containing 5 µl of AnnexinV-FITC for 15 min at room temperature. After sufficient washing, the oocytes were checked immediately with inverted fluorescence microscopy.\u003c/p\u003e\u003ch2\u003eRNA isolation and RT-PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was obtained from 200 oocytes or 50 4-cell stage embryos using RNAqueous Microkit (Thermo Fisher Scientific, Massachusetts, MA) and was treated with DNase I (Thermo Fisher Scientific, Massachusetts, MA) to prevent genomic DNA contamination. Reverse transcription was performed using the RETROscript kit (Thermo Fisher Scientific, Massachusetts, MA). The real-time PCR was carried out in an iCycler (Bio-Rad Laboratories, California, CA). Each of 25 µl reaction system contained 12.5 µl of SYBR Green supermix (BioRad Laboratories, California, CA), 0.5 µl of each primer, and 11.5 µl of cDNA. The 2\u003csup\u003e−ΔΔCT\u003c/sup\u003e method was used to calculate relative expression levels. The primers used for real-time PCR reactions were included in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAccession\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer Sequences ((5'to3')\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct Size(bp)\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBCL-2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_021077298.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CAGGGACAGCGTATCAGAGC\u003c/p\u003e \u003cp\u003eR: TTGCGATCCGACTCACCAAT\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e156\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBAX\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_013998624.2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CCAGGATCGAGCAGGGCGAAT\u003c/p\u003e \u003cp\u003eR: CACAGGGCCTTGAGCACCAGTTT\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e285\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDPPA2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_003358822.4\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CCGTTCCTGCTTCTGTTGAGACC\u003c/p\u003e \u003cp\u003eR: GGCGAACCCAACCTTCTGTATCTG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e105\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEIF1A\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001243218.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GGTGTTCAAAGAAGATGGGCAAGAG\u003c/p\u003e \u003cp\u003eR: TTTCCCTCTGATGTGACATAACCTC\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e115\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH19\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAY044827.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TCAAACGACAAGAGATGGTGCTA\u003c/p\u003e \u003cp\u003eR: GACGTCTGTTCCTTTGGCTC\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e118\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNANOG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_021092390.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AGGACAGCCCTGATTCTTCCACAA\u003c/p\u003e \u003cp\u003eR: AAAGTTCTTGCATCTGCTGGAGGC\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e198\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOCT4\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_021097869.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AAGCAGTGACTATTCGCAAC\u003c/p\u003e \u003cp\u003eR: CAGGGTGGTGAAGTGAGG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPLP0\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001129964.2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GCTAAGGTGCTCGGTTCTTC\u003c/p\u003e \u003cp\u003eR: GTGCGGACCAATGCTAGG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSOX2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001123197.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CGCAGACCTACATGAACG\u003c/p\u003e \u003cp\u003eR: TCGGACTTGACCACTGAG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTET1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001315772.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AGCACAGGACAAAATGAAGG\u003c/p\u003e \u003cp\u003eR: TGGTTAGTTGGAGAGGAGG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTET2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_013978993.2\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GCCAACCCTGTGAACCTCT\u003c/p\u003e \u003cp\u003eR: GGGCTGGTAAAGTGTATGG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e270\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTET3\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_021087365.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TCAAGGCAAAGACCCGAAC\u003c/p\u003e \u003cp\u003eR: AGACGGCAGTCAATCGCTATT\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e261\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZSCAN4\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXM_021097584.1\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GCCCAGAAAGTCTTCCCATGTGAG\u003c/p\u003e \u003cp\u003eR: GCCTCTCATCATTGTGTCTCCTCTG\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e94\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003ch2\u003eImmunofluorescent staining\u003c/h2\u003e\u003cp\u003eOocytes and embryos were first fixed with 4% paraformaldehyde for 30 min and then permeabilized with 1% Triton X-100 at room temperature for at least 8 h. For 5mC and 5hmC immunostainings, fixed embryos were incubated in 4N HCl solution at RT for 15 min. Following neutralization (10 min, 100 mM Tris–HCl, pH 8.0) and the second fixation. Then blocking with 2% BSA supplemented washing buffer (0.1% Tween 20 and 0.01% Triton X-100 in PBS) for 1 h, oocytes or embryos were stained with 5mC or 5hmC primary antibodies at 4°C overnight. After three washes in washing buffer, oocytes were stained with Cy3 or FITC-conjugated goat anti-rabbit immunoglobulin G (IgG) (H + L) (1:100) for 1 h at room temperature. For the α-tubulin-FITC staining, permeabilized oocytes were directly incubated for 1 h at room temperature after sufficient washing. Finally, oocytes or embryos were mounted on glass slides and examined with inverted fluorescence microscopy (Nikon Eclipse TE2000-U, Tokyo, Japan). Each experiment was repeated at least three times and no less than 30 oocytes or embryos were examined for each.\u003c/p\u003e\u003ch2\u003eRNA sequencing and data Analysis\u003c/h2\u003e\u003cp\u003eThe total RNA of each sample was extracted using TRIzol® Reagent (Invitrogen, California, CA), and the smart-seq2 library was constructed using a previously published protocol [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Briefly, the full-length cDNA was synthesized from the RNA using template switch oligo and SuperScript II reverse transcriptase (Invitrogen, California, CA). The PCR protocol was as follows: incubation at 42°C for 90 min, followed by 10 cycles of 50°C for 2 min and 42°C for 2 min. The reverse transcriptase was inactivated by heating at 70°C for 15 min. The single-stranded cDNA was subsequently amplified using Kapa HiFi HotStart Readymix (Roche, Basel, Switzerland). The amplified cDNA was purified using AMpure XP beads (Beckman, California, CA) and used for library construction. All libraries were assessed using the High DNA Sensitivity Bioanalyzer 2100 (Agilent, California, CA) and real-time quantitative PCR (qRT-PCR). All libraries were sequenced using 150-bp paired-end on the Illumina Novaseq platform (California, CA).\u003c/p\u003e\u003cp\u003eRaw RNA was filtered using Trimmomatic, and the sus scrofa reference genome (NCBI.Sscrofa10.2) was obtained. Index of the reference genome was built using Hisat2 v2.0.5, and paired-end clean reads were aligned to the reference genome. Htseq-count was used to count the read numbers mapped to each gene. Differential expression analysis of Bobcat339-treated and control groups was performed using the DESeq2 R package. Differentially expressed genes (DEGs) were determined with the criteria of \u003cem\u003eP\u003c/em\u003e value \u0026lt; 0.05 and FoldChange \u0026gt; 2. Cluster analyses were performed using the K-means clustering algorithm with R. Gene Ontology (GO) enrichment analysis was performed using the topGO R package.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eBobcat339 treatment obstructed the first polar body extrusion in porcine oocytes\u003c/h2\u003e \u003cp\u003eTo investigate the influence of TET on porcine cumulus cell expansion and oocyte maturation, cumulus oocyte complexes (COCs) were cultured with increasing concentrations of Bobcat339 (0, 100, 200, and 400 \u0026micro;M), and the responses of COCs were recorded at 24, 36, and 44 h. Bobcat339 treatment could block the expansion of cumulus cells in time- and concentration-dependent manners (Figure. 1A). Furthermore, the first polar body extrusion (PBE) was remarkably impaired in Bobcat339-treated oocytes in a concentration-dependent manner (71.75\u0026thinsp;\u0026plusmn;\u0026thinsp;3.56%, n\u0026thinsp;=\u0026thinsp;163, control vs 57.00\u0026thinsp;\u0026plusmn;\u0026thinsp;4.06%, n\u0026thinsp;=\u0026thinsp;171, 100 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs 32.50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.18%, n\u0026thinsp;=\u0026thinsp;185, 200 \u0026micro;M, \u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001; vs 13.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.12%, n\u0026thinsp;=\u0026thinsp;201, 400 \u0026micro;M, \u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.001; Figure. 1B). These results implied that oocyte maturation was hampered after the inhibition of TET by certain concentrations of Bobcat339. Since 200 \u0026micro;M Bobcat339 could significantly hamper the PBE but allowed escaping of some oocytes, this concentration was used for subsequent studies on the oocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eBobcat339 treatment triggered apoptosis of porcine oocytes\u003c/h2\u003e \u003cp\u003eWith the weakened expansion of cumulus cells and PBE rate in Bobcat339-treated oocytes, we speculated that the apoptotic level of oocytes may be elevated after Bobcat339 treatment. Annexin-V-FITC staining and quantitative analysis revealed that the amount of early apoptotic oocytes was significantly increased after Bobcat339 treatment (4.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.88%, n\u0026thinsp;=\u0026thinsp;76, control vs 16.70\u0026thinsp;\u0026plusmn;\u0026thinsp;3.83%, n\u0026thinsp;=\u0026thinsp;91, 200 \u0026micro;M, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Moreover, the mRNA levels of the apoptosis-related gene \u003cem\u003eBAX\u003c/em\u003e and anti-apoptosis gene \u003cem\u003eBCL-2\u003c/em\u003e were examined using qRT-PCR in control and Bobcat339-treated oocytes. The mRNA levels of \u003cem\u003eBAX\u003c/em\u003e and \u003cem\u003eBCL-2\u003c/em\u003e were significantly higher in the Bobcat339-treated oocytes; however, the \u003cem\u003eBAX\u003c/em\u003e/\u003cem\u003eBCL-2\u003c/em\u003e ratios were remarkably elevated (Figure. 1E). Therefore, we concluded that inhibition of TET proteins triggered early apoptosis in porcine oocytes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eEffect of Bobcat339 on spindle architecture and chromosomes alignment in oocytes\u003c/h2\u003e \u003cp\u003eBobcat339-treated oocytes exhibited defects in maturation and early apoptosis. Therefore, we speculated that the spindle architecture could be disrupted after Bobcat339 treatment. Therefore, the spindle morphology was assessed at metaphase I (MI) stage in control and Bobcat339-treated oocytes using α-tubulin staining. Our results revealed that the control oocytes had a typical barrel spindle, whereas the spindles were disorganized in the Bobcat339-treated oocytes. Moreover, unlike the control oocytes, in which the chromosomes were well aligned at the spindle plate, Bobcat339-treated oocytes exhibited dispersed chromosomes (Figure. 2A). The percentage of aberrant spindles in Bobcat339-treated oocytes was significantly elevated compared with that in the control oocytes (30.01\u0026thinsp;\u0026plusmn;\u0026thinsp;4.97% vs. 14.33\u0026thinsp;\u0026plusmn;\u0026thinsp;3.40%, n\u0026thinsp;=\u0026thinsp;123, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Figure. 2B). In addition, the proportion of misaligned chromosomes was increased in Bobcat339-treated oocytes (66.32\u0026thinsp;\u0026plusmn;\u0026thinsp;7.36% vs. 17.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.70%, n\u0026thinsp;=\u0026thinsp;145, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Figure. 2C). These results indicated that TET family is implicated in spindle architecture and chromosome alignment in porcine oocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBobcat339 treatment altered 5mC/5hmC levels in porcine oocytes\u003c/h2\u003e \u003cp\u003eTo assess whether the above defects depend on the enzymatic activity of TET proteins, we examined the 5mC and 5hmC levels in the control and Bobcat339-treated oocytes. The results demonstrated that the fluorescent signal of 5hmC was significantly decreased in the Bobcat339-treated oocytes (Figure. 3A). Further quantitative fluorescence analysis confirmed that 5hmC signal intensity was significantly decreased in Bobcat339-treated oocytes (1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12, n\u0026thinsp;=\u0026thinsp;32 vs 0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10, n\u0026thinsp;=\u0026thinsp;37, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Figure. 3B). On the contrary, the 5mC signal was significantly increased in the Bobcat339-treated oocytes (Figure. 3C). Quantitative analysis further verified that the mean 5mC intensity was significantly elevated in Bobcat339-treated oocytes (1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28, n\u0026thinsp;=\u0026thinsp;39 vs 1.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34, n\u0026thinsp;=\u0026thinsp;46, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Figure. 3D). These results suggested that TET family mediates the levels of both 5mC and 5hmC in porcine oocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffect of Bobcat339 on preimplantation embryo development\u003c/h2\u003e \u003cp\u003eTo assess the impact of TET on early embryonic development, porcine parthenogenetic embryos were cultured in a PZM-3 medium supplemented with increasing concentrations of Bobcat339 (0, 25, 50, and 100 \u0026micro;M). We recorded the blastocyst rates on day 6 (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). The proportion of activated oocytes that developed to the blastocyst stage was significantly lower after Bobcat339 treatment (33.67\u0026thinsp;\u0026plusmn;\u0026thinsp;3.01%, n\u0026thinsp;=\u0026thinsp;178, control vs 31.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02%, n\u0026thinsp;=\u0026thinsp;164, 25 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05 vs 11.02\u0026thinsp;\u0026plusmn;\u0026thinsp;3.07%, n\u0026thinsp;=\u0026thinsp;215, 50 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; vs 2.34\u0026thinsp;\u0026plusmn;\u0026thinsp;2.00%, n\u0026thinsp;=\u0026thinsp;237, 100 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). In addition, we calculated the developmental rate of embryos on day 3 after activation and observed that no significant difference was observed between the two groups at the 2-cell stage (7.76\u0026thinsp;\u0026plusmn;\u0026thinsp;\u0026plusmn;\u0026thinsp;3.16%, n\u0026thinsp;=\u0026thinsp;204, control vs 10.82\u0026thinsp;\u0026plusmn;\u0026thinsp;2.48%, n\u0026thinsp;=\u0026thinsp;234, 25 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05 vs 13.73\u0026thinsp;\u0026plusmn;\u0026thinsp;4.00%, n\u0026thinsp;=\u0026thinsp;219, 50 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05; vs 11.75\u0026thinsp;\u0026plusmn;\u0026thinsp;2.37%, n\u0026thinsp;=\u0026thinsp;194, 100 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Figure. 4C); however, the developmental rate of embryos was significantly increased at the 4-cell stage (9.59\u0026thinsp;\u0026plusmn;\u0026thinsp;1.50% control vs 19.85\u0026thinsp;\u0026plusmn;\u0026thinsp;3.22%, 25 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs 29.36\u0026thinsp;\u0026plusmn;\u0026thinsp;3.77%, 50 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; vs 42.82\u0026thinsp;\u0026plusmn;\u0026thinsp;5.06%, 100 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Figure. 4C) and decreased at 8-cell stage (76.68\u0026thinsp;\u0026plusmn;\u0026thinsp;3.67% control vs 63.88\u0026thinsp;\u0026plusmn;\u0026thinsp;3.60%, 25 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 vs 53.93\u0026thinsp;\u0026plusmn;\u0026thinsp;4.87%, 50 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; vs 37.90\u0026thinsp;\u0026plusmn;\u0026thinsp;7.05%, 100 \u0026micro;M, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) after Bobcat339 treatment. Therefore, Bobcat339 treatment arrested embryo growth at the 4-cell stage.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eBobcat339 treatment decreased the expression of ZGA and pluripotency-related genes\u003c/h2\u003e \u003cp\u003eBobcat treatment arrested embryo growth at the 4-cell stage. However, porcine ZGA occurs during the 4-cell stage. Therefore, the effect of Bobcat339 treatment on the expression of porcine ZGA marker genes (\u003cem\u003eEIF1A\u003c/em\u003e, \u003cem\u003eDPPA2\u003c/em\u003e, and \u003cem\u003eZSCAN4\u003c/em\u003e) was evaluated using qRT-PCR. The results indicated that the mRNA levels of \u003cem\u003eEIF1A\u003c/em\u003e and \u003cem\u003eDPPA2\u003c/em\u003e at the 4-cell stage were significantly lower after Bobcat339 treatment (Figure. 4D). As pluripotency-related and imprinted genes are crucial for embryotic development, we assessed the mRNA levels of the pluripotency-related genes \u003cem\u003eSOX2\u003c/em\u003e, \u003cem\u003eOCT4\u003c/em\u003e, and \u003cem\u003eNANOG\u003c/em\u003e and imprinted gene \u003cem\u003eH19\u003c/em\u003e. The mRNA levels of \u003cem\u003eOCT4\u003c/em\u003e and \u003cem\u003eNANOG\u003c/em\u003e significantly decreased after Bobcat339 treatment (Figure. 4E), whereas those of \u003cem\u003eSOX2\u003c/em\u003e and \u003cem\u003eH19\u003c/em\u003e exhibited no significant difference (Figure. 4F). These findings verified that Bobcat339 treatment could disrupt ZGA in porcine embryos.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eBobcat339 treatment disrupted 5mC/5hmC levels in porcine embryos\u003c/h2\u003e \u003cp\u003eTo investigate whether the embryonic developmental arrest after Bobcat339 treatment occurred via the enzymatic activity of TET, we examined the 5mC/5hmC levels in control and Bobcat339-treated preimplantation embryos. The fluorescence intensity of 5hmC in 2- and 4-cell embryos was lower in Bobcat339-treated oocytes (Figure. 5A and B). Further quantitative fluorescence analysis confirmed that the fluorescence intensity of 5hmC was significantly decreased after Bobcat339 treatment (2-cell stage: 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16, n\u0026thinsp;=\u0026thinsp;39 vs 0.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20 n\u0026thinsp;=\u0026thinsp;36; 4-cell stage: 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21, n\u0026thinsp;=\u0026thinsp;42 vs 0.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14, n\u0026thinsp;=\u0026thinsp;48; \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 for both; Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and F). On the contrary, the fluorescence signal of 5mC in 2- and 4-cell embryos was higher in Bobcat339-treated oocytes (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and D). The fluorescence intensity of 5mC was significantly elevated in the Bobcat339-treated oocytes (2-cell stage: 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23, n\u0026thinsp;=\u0026thinsp;41 vs 1.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28, n\u0026thinsp;=\u0026thinsp;36, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; 4-cell stage: 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19, n\u0026thinsp;=\u0026thinsp;36 vs 1.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27, n\u0026thinsp;=\u0026thinsp;37, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG and H). These results suggested that TET enzymes regulated both 5mC and 5hmC levels in porcine preimplantation embryos.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eComparative analyses of transcriptomic data\u003c/h2\u003e \u003cp\u003eTo delineate the affected genes and pathways after Bobcat339 treatment, RNA sequencing analysis was performed in 4-cell embryos derived from control and Bobcat339-treated groups. In our results, principal component analysis (PCA) met the requirement of mRNA expression analysis (Figure. 6A). Violin plot was not significantly different between control and Bobcat339-treated embryos (Figure. 6B). Hierarchical clustering of the DEGs in control and Bobcat339-treated groups is shown in Figure. 6C. Furthermore, we identified 203 significantly DEGs (75 up- and 128 downregulated genes) between the two groups, (Fig.\u0026nbsp;7D). The GO analysis revealed that the DEGs were significantly enriched in biological processes including regulation of cell population proliferation (GO:0042127), in molecular functions related to cell adhesion molecule binding (GO:0050839), and cellular components related to mitochondrion (GO:0005739) and organelle envelope (GO:0031967) (Fig.\u0026nbsp;7E). Therefore, Bobcat339 treatment significantly altered the transcriptome in the embryos at the 4-cell stage.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIt is reported that TET1 and TET2 are mainly responsible for DNA demethylation in PGCs and post-implantation embryos, and TET3 is implicated in active demethylation of DNA in the zygote. However, several studies have reported that TET1, TET2, and TET3 probably have overlapping expressions and role in embryo development [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. TET1/TET2 double deficiency embryos could survive normally and develop into fertile adult mice, likely because TET3 compensates for TET1/TET2 mutation; however, TET1/2/3 triple deficient embryos were arrested at the 2-cell stage [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. These data highlighted that compensatory mechanism exists among TET1, TET and TET3. Therefore, in this study, we used Bobcat339, a novel and specific small-molecular inhibitor of the TET proteins, to explore the combined role of TET proteins in porcine oocytes and preimplantation embryos.\u003c/p\u003e \u003cp\u003eIn this study, the levels of 5mC and 5hmC were abnormal after Bobcat339 treatment, with elevated 5mC and declined 5hmC levels in porcine oocytes. This phenotype is different from that of mice oocytes with only TET3 deficiency, in which the reduction in the 5hmC levels or increase in the 5mC levels was not apparent compared with the control oocytes [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Assessment of apoptotic signal and apoptosis-related genes revealed early apoptosis after Bobcat339 treatment; correspondingly, the PBE rates decreased. Moreover, Bobcat339-treated oocytes exhibited remarkably abnormal spindle architecture and chromosome alignment. These phenotypes resembled those of mice oocytes with TET2 deficiency, in which the defects of spindle morphology and chromosome distribution, delayed meiotic progression, and accelerated aging were observed [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we observed that after Bobcat339 treatment, the levels of 5mC and 5hmC in parthenogenetic embryo were altered. These results are consistent with previous studies on mice, bovine, and human embryos with TET1/2/3 triple-knockout [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. 5hmC is not only an intermediate between demethylated 5mC and cytosine but also an independent epigenetic marker vital for the pluripotency [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Pluripotency-associated genes such as \u003cem\u003eOCT4\u003c/em\u003e, \u003cem\u003eSOX2\u003c/em\u003e, and \u003cem\u003eNANOG\u003c/em\u003e are methylated during germ cell development, and their demethylation occurs in the early embryo. In normal zygotes, pluripotency-associated genes undergo substantial demethylation till the PN3\u0026ndash;4 pronuclear stages [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The impacts of individual TET family member on the pluripotency of embryos are not consistent in previous studies [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. This could be due to the compensatory role played by TET family members. Our results indicated that the inhibition of TET resulted in noticeably downregulated expression of \u003cem\u003eOCT4\u003c/em\u003e and \u003cem\u003eNANOG\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eImprinted region is referred to the alleles expressed only from paternal or maternal origin. They are distinguished by the differences in DNA methylation. Unlike pluripotency-associated genes, imprinted genes are resistant to demethylation in the early embryo stage and are protected by maternal factors including Dnmt1, Dppa3, ZFP57, and TRIM28 [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. It is well known that parthenogenetic embryos naturally exhibit abnormal expression of imprinted genes, in which paternal imprinted genes are highly expressed, and maternal imprinted genes are either lowly or not expressed [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Therefore, parthenogenetic embryo is the most appropriate model for exploring the methylation modifications. In parthenogenetic embryos, \u003cem\u003eH19\u003c/em\u003e is an important paternal imprinted gene whose expression level depends on methylation regulation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In our study, the mRNA level of \u003cem\u003eH19\u003c/em\u003e was not affected in the Bobcat339-treated embryos. This is consistent with a study on bovine parthenogenetic embryo [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn pigs, the major ZGA occurs during the 4-cell stage [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In our study, the growth of Bobcat339-treated embryos was arrested at the 4-cell stage. Moreover, transcriptome data of early embryos at the 4-cell stage revealed 203 significant DEGs between Bobcat339-treated and control groups, with 75 up- and 128 downregulated genes. Therefore, after Bobcat339 treatment, abnormal 5mC/5hmC levels may lead to altered ZGA, finally blocking embryotic development. Therefore, we assessed the mRNA levels of porcine ZGA marker genes \u003cem\u003eEIF1A\u003c/em\u003e, \u003cem\u003eDPPA2\u003c/em\u003e, and \u003cem\u003eZSCAN4\u003c/em\u003e [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The significantly decreased expression of \u003cem\u003eEIF1A and DPPA2\u003c/em\u003e confirmed our hypothesis.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, we demonstrated that TET family is essential for porcine oocyte maturation and participated in oocyte spindle architecture and chromosome alignment by regulating 5mC and 5hmC levels. Our results indicated that TET family is essential for the development of parthenogenetic preimplantation embryos, mediating the mRNA level of ZGA marker genes and pluripotency-related genes and the global transcriptome of embryos at the 4-cell stage through adjusting 5mC and 5hmC levels.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe porcine ovaries were from a local slaughterhouse. All experimentation in this study conferred the guidelines set by the Animal Care and Use Committee of\u0026nbsp;Hubei Academy of Agricultural Sciences\u0026nbsp;(HBAAS-2023-014).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the China Postdoctoral Science Foundation (2022M711095); Shuguang Plan of Wuhan Knowledge Innovation Project (NK2022010207); Key Research and Development Program of Hubei Province (2021BBA221).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProject administration, F.C. and Y.Z.B.; Methodology, M.G.L., Z.D.H and H.Y.R.; Data curation, G.H., C.F.Z. and A.F.L; Resources, Z.Z. and T.H; Supervision, B.Y.Z.; Writing - original draft, F.C.; Writing - review \u0026amp; editing, F.C and B.Y.Z. All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors declare that no competing interests exist. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKennedy AJ, Sweatt JD. Drugging the methylome: DNA methylation and memory. \u003cem\u003eCrit Rev Biochem Mol Biol\u003c/em\u003e. 2016;51(3):185-94.\u003c/li\u003e\n\u003cli\u003eIto S, Shen L, Dai Q, et al. Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. \u003cem\u003eScience.\u003c/em\u003e 2011;333(6047):1300-3.\u003c/li\u003e\n\u003cli\u003eHe YF, Li BZ, Li Z, Liu P, et al. Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. \u003cem\u003eScience.\u003c/em\u003e 2011;333(6047):1303-7.\u003c/li\u003e\n\u003cli\u003eWu X, Zhang Y. TET-mediated active DNA demethylation: mechanism, function and beyond. \u003cem\u003eNat Rev Genet.\u003c/em\u003e 2017;18(9):517-34.\u003c/li\u003e\n\u003cli\u003eShi DQ, Ali I, Tang J, et al. New Insights into 5hmC DNA Modification: Generation, Distribution and Function. \u003cem\u003eFront Genet.\u003c/em\u003e 2017;8:100.\u003c/li\u003e\n\u003cli\u003eGuo F, Yan L, Guo H, et al. The Transcriptome and DNA Methylome Landscapes of Human Primordial Germ Cells. \u003cem\u003eCell.\u003c/em\u003e 2015;161(6):1437-52. \u003c/li\u003e\n\u003cli\u003eXu R, Li C, Liu X, et al. Insights into epigenetic patterns in mammalian early embryos. \u003cem\u003eProtein Cell\u003c/em\u003e. 2021;12(1):7-28.\u003c/li\u003e\n\u003cli\u003eVincent JJ, Huang Y, Chen PY, et al. Stage-specific roles for tet1 and tet2 in DNA demethylation in primordial germ cells. \u003cem\u003eCell Stem Cell.\u003c/em\u003e 2013;12(4):470-8.\u003c/li\u003e\n\u003cli\u003eKhoueiry R, Sohni A, Thienpont B, et al. Lineage-specific functions of TET1 in the postimplantation mouse embryo. \u003cem\u003eNat Genet.\u003c/em\u003e 2017;49(7):1061-72.\u003c/li\u003e\n\u003cli\u003eGu TP, Guo F, Yang H, et al. The role of Tet3 DNA dioxygenase in epigenetic reprogramming by oocytes. \u003cem\u003eNature.\u003c/em\u003e 2011;477(7366):606-10.\u003c/li\u003e\n\u003cli\u003eIqbal K, Jin SG, Pfeifer GP, et al. Reprogramming of the paternal genome upon fertilization involves genome-wide oxidation of 5-methylcytosine. \u003cem\u003eProc Natl Acad Sci U S A.\u003c/em\u003e 2011;108(9):3642-7.\u003c/li\u003e\n\u003cli\u003eShen L, Inoue A, He J, et al. Tet3 and DNA replication mediate demethylation of both the maternal and paternal genomes in mouse zygotes. \u003cem\u003eCell Stem Cell.\u003c/em\u003e 2014;15(4):459-71. \u003c/li\u003e\n\u003cli\u003eSakashita A, Kobayashi H, Wakai T, et al. Dynamics of genomic 5-hydroxymethylcytosine during mouse oocyte growth. \u003cem\u003eGenes Cells.\u003c/em\u003e 2014;19(8):629-36.\u003c/li\u003e\n\u003cli\u003eTsukada Y, Akiyama T, Nakayama KI. Maternal TET3 is dispensable for embryonic development but is required for neonatal growth. \u003cem\u003eSci Rep.\u003c/em\u003e 2015;5:15876.\u003c/li\u003e\n\u003cli\u003eDawlaty MM, Breiling A, Le T, et al. Combined deficiency of Tet1 and Tet2 causes epigenetic abnormalities but is compatible with postnatal development. \u003cem\u003eDev Cell.\u003c/em\u003e 2013;24(3):310-23.\u003c/li\u003e\n\u003cli\u003eDawlaty MM, Breiling A, Le T, et al. Loss of Tet enzymes compromises proper differentiation of embryonic stem cells. \u003cem\u003eDev Cell.\u003c/em\u003e 2014;29(1):102-11.\u003c/li\u003e\n\u003cli\u003eLi C, Lan Y, Schwartz-Orbach L, et al. Overlapping Requirements for Tet2 and Tet3 in Normal Development and Hematopoietic Stem\u003cem\u003e \u003c/em\u003eCell Emergence. \u003cem\u003eCell Rep.\u003c/em\u003e 2015;12(7):1133-43.\u003c/li\u003e\n\u003cli\u003eXue Z, Huang K, Cai C, et al. Genetic programs in human and mouse early embryos revealed by single-cell RNA sequencing. \u003cem\u003eNature.\u003c/em\u003e 2013;500(7464):593-7.\u003c/li\u003e\n\u003cli\u003eZhai Y, Yu H, An X, et al. Profiling the transcriptomic signatures and identifying the patterns of zygotic genome activation - a comparative analysis between early porcine embryos and their counterparts in other three mammalian species. \u003cem\u003eBMC Genomics.\u003c/em\u003e 2022;23(1):772. \u003c/li\u003e\n\u003cli\u003eBraude P, Bolton V, Moore S. Human gene expression first occurs between the four- and eight-cell stages of preimplantation development. \u003cem\u003eNature.\u003c/em\u003e 1988;332(6163):459-61.\u003c/li\u003e\n\u003cli\u003eLee K, Hamm J, Whitworth K, et al. Dynamics of TET family expression in porcine preimplantation embryos is related to zygotic genome activation and required for the maintenance of NANOG. \u003cem\u003eDev Biol.\u003c/em\u003e 2014;386(1):86-95.\u003c/li\u003e\n\u003cli\u003eWossidlo M, Nakamura T, Lepikhov K, et al. 5-Hydroxymethylcytosine in the mammalian zygote is linked with epigenetic reprogramming. \u003cem\u003eNat Commun.\u003c/em\u003e 2011;2:241.\u003c/li\u003e\n\u003cli\u003eCao Z, Zhou N, Zhang Y, et al. Dynamic reprogramming of 5-hydroxymethylcytosine during early porcine embryogenesis. \u003cem\u003eTheriogenology.\u003c/em\u003e 2014;81(3):496-508.\u003c/li\u003e\n\u003cli\u003eZhang J, Hao L, Wei Q, et al. TET3 overexpression facilitates DNA reprogramming and early development of bovine SCNT embryos. \u003cem\u003eReproduction.\u003c/em\u003e 2020;160(3):379-91.\u003c/li\u003e\n\u003cli\u003eUh K, Ryu J, Farrell K, et al. TET family regulates the embryonic pluripotency of porcine preimplantation embryos by maintaining the DNA methylation level of NANOG. \u003cem\u003eEpigenetics. \u003c/em\u003e2020;15(11):1228-42.\u003c/li\u003e\n\u003cli\u003eUh K, Lee K. Ten-Eleven Translocation-3 CXXC domain is critical for postfertilization demethylation and expression of pluripotency genes in pig embryos. \u003cem\u003eBiol Reprod.\u003c/em\u003e 2022;107(5):1205-16.\u003c/li\u003e\n\u003cli\u003eChua GNL, Wassarman KL, Sun H, et al. Cytosine-Based TET Enzyme Inhibitors. \u003cem\u003eACS Med Chem Lett.\u003c/em\u003e 2019;10(2):180-5.\u003c/li\u003e\n\u003cli\u003ePicelli S, Faridani OR, Bj\u0026ouml;rklund AK, et al. Full-length RNA-seq from single cells using Smart-seq2. \u003cem\u003eNat Protoc.\u003c/em\u003e 2014;9(1):171-81.\u003c/li\u003e\n\u003cli\u003eKang J, Lienhard M, Pastor WA, et al. Simultaneous deletion of the methylcytosine oxidases Tet1 and Tet3 increases transcriptome variability in early embryogenesis. \u003cem\u003eProc Natl Acad Sci U S A.\u003c/em\u003e 2015;112(31):E4236-45.\u003c/li\u003e\n\u003cli\u003eArand J, Chiang HR, Martin D, et al. Tet enzymes are essential for early embryogenesis and completion of embryonic genome activation. \u003cem\u003eEMBO Rep.\u003c/em\u003e 2022;23(2):e53968.\u003c/li\u003e\n\u003cli\u003eWang H, Liu L, Gou M, et al. Roles of Tet2 in meiosis, fertility and reproductive aging. \u003cem\u003eProtein Cell.\u003c/em\u003e 2021;12(7):578-85.\u003c/li\u003e\n\u003cli\u003eZhang J, Zhang S, Wang Y, et al. Effect of TET inhibitor on bovine parthenogenetic embryo development. \u003cem\u003ePLoS One.\u003c/em\u003e 2017;12(12):e0189542. \u003c/li\u003e\n\u003cli\u003eVerma N, Pan H, Dor\u0026eacute; LC, et al. TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. \u003cem\u003eNat Genet.\u003c/em\u003e 2018;50(1):83-95.\u003c/li\u003e\n\u003cli\u003eFarthing CR, Ficz G, Ng RK, et al. Global mapping of DNA methylation in mouse promoters reveals epigenetic reprogramming of pluripotency genes. \u003cem\u003ePLoS Genet.\u003c/em\u003e 2008;4(6):e1000116.\u003c/li\u003e\n\u003cli\u003eIto S, D\u0026apos;Alessio AC, Taranova OV, et al. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. \u003cem\u003eNature.\u003c/em\u003e 2010;466(7310):1129-33.\u003c/li\u003e\n\u003cli\u003eFan A, Ma K, An X, et al. Effects of TET1 knockdown on gene expression and DNA methylation in porcine induced pluripotent stem cells. \u003cem\u003eReproduction.\u003c/em\u003e 2013;146(6):569-79.\u003c/li\u003e\n\u003cli\u003eCosta Y, Ding J, Theunissen TW, et al. NANOG-dependent function of TET1 and TET2 in establishment of pluripotency. \u003cem\u003eNature.\u003c/em\u003e 2013;495(7441):370-4.\u003c/li\u003e\n\u003cli\u003eKelsey G, Feil R. New insights into establishment and maintenance of DNA methylation imprints in mammals. \u003cem\u003ePhilos Trans R Soc Lond B Biol Sci.\u003c/em\u003e 2013;368(1609):20110336.\u003c/li\u003e\n\u003cli\u003eWu Q, Kumagai T, Kawahara M, et al. Regulated expression of two sets of paternally imprinted genes is necessary for mouse parthenogenetic development to term. \u003cem\u003eReproduction.\u003c/em\u003e 2006;131(3):481-8.\u003c/li\u003e\n\u003cli\u003ePark CH, Kim HS, Lee SG, et al. Methylation status of differentially methylated regions at Igf2/H19 locus in porcine gametes and preimplantation embryos. \u003cem\u003eGenomics.\u003c/em\u003e 2009;93(2):179-86.\u003c/li\u003e\n\u003cli\u003eZhang T, Zheng Y, Han R, et al. Effects of pyruvate on early embryonic development and zygotic genome activation in pigs. \u003cem\u003eTheriogenology.\u003c/em\u003e 2022;189:77-85.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-2906860/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2906860/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eTen-eleven translocation (TET) enzyme family, which includes TET1/2/3, participates in active DNA demethylation in the eukaryotic genome; however, TET1/2/3 are functionally redundant. The effect of TET1/2/3 triple-gene knockdown or knockout on the porcine oocytes and embryos is unclear. In this study, using Bobcat339, a specific small-molecule inhibitor of the TET family, we explored the combined effects of TET enzymes on oocyte maturation and early embryogenesis in pigs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethod:\u003c/strong\u003e First, porcine cumulus oocyte complexes were cultured in the IVM medium with various concentrations of Bobcat339, and the effects on the expansion of cumulus cells and oocyte maturation were investigated. Further, the apoptotic level of oocytes was assessed using RT-PCR and Annexin-V staining. The spindle architecture and chromosomal alignment were investigated using immunofluorescence staining. Furthermore, the fluorescent signals of 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) were quantified. Subsequently, the effect of Bobcat339 on porcine parthenogenetic embryos was assessed. We recorded the blastocyst formation and developmental rates. Furthermore, the mRNA levels of zygotic gene activation (ZGA)- and pluripotency-related and imprinted genes were assessed using RT-PCR. Finally, RNA sequencing analysis was performed in the embryos at the 4-cell stage to identify differentially expressed genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResult: \u003c/strong\u003eOur results revealed that Bobcat339 treatment blocked porcine oocyte maturation and triggered early apoptosis. Furthermore, in the Bobcat339-treated oocytes, spindle architecture and chromosome alignment were disrupted, probably due to huge loss of 5hmC and concurrent increase in 5mC. Furthermore, after Bobcat339 treatment, early parthenogenetic embryos exhibited abnormal 5mC and 5hmC levels, which resulted in compromised cleavage and blastocyst rate. The mRNA levels of \u003cem\u003eEIF1A and DPPA2\u003c/em\u003e (ZGA marker genes) were significantly decreased, which may explain why the embryos were arrested at the 4-cell stage after Bobcat339 treatment. In addition, the mRNA levels of pluripotency-related genes \u003cem\u003eOCT4\u003c/em\u003e and \u003cem\u003eNANOG\u003c/em\u003e were declined after Bobcat339 treatment. RNA sequencing analysis revealed differentially expressed genes in Bobcat339-treated embryos at the 4-cell stage, which were significantly enriched in cell proliferation, cell component related to mitochondrion, and cell adhesion molecule binding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Our results indicated that TET proteins are essential for porcine oocyte maturation and early embryogenesis, and they act by mediating 5mC/5hmC levels and gene transcription.\u003c/p\u003e","manuscriptTitle":"Bobcat339, a specific TET family inhibitor, impaired oocyte maturation and early embryogenesis in pig","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-05-11 21:59:12","doi":"10.21203/rs.3.rs-2906860/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"78de0d95-f86c-4553-b4e1-b4db764f03fd","owner":[],"postedDate":"May 11th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-06-12T12:29:34+00:00","versionOfRecord":[],"versionCreatedAt":"2023-05-11 21:59:12","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2906860","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2906860","identity":"rs-2906860","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}