Production and downstream processing optimization of plant-made Osmotin and its functional analysis

Production and downstream processing optimization of plant-made Osmotin and its functional analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Production and downstream processing optimization of plant-made Osmotin and its functional analysis Taufiq Nawaz, Umair Khan, Shah Fahad, Azade Tahmasebi, Elsayed Fathi Abd_Allah, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3951169/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Plant-made therapeutic proteins are getting acceptance because of the cost-effective production that displays equal efficacy to the more established platform such as mammalian or bacterial-based production systems. This study demonstrates that the stable expression of recombinant osmotin (rOSM) expressed and purified in large amounts is generally regarded as safe (GRAS) lettuce leaf tissues. In this study, we designed experiments to explore a plant-based system for the expression of rOSM known for exhibiting antifungal activity and stress tolerance. The codon-optimized osmotin sequences for higher expression in lettuce were added with 6xHistag and ER retention signal peptide and three independent transgenic lines were generated and screened for transgene expression with PCR. The protein extraction was optimized considering the impact of ultrasonication, PIC, and tween-20 impact on total protein extraction. Immunoblot analysis confirmed the induction of ~ 28.5 kDa recombinant fusion protein and ELISA quantitation was carried out to confirm the expression level of 127 mg/kg fresh weight (FW) in lettuce leaf tissues. The method has been developed to purify recombinant proteins from leaf tissues with relatively convenient manual techniques for histidine-tagged protein with final product purity of > 90%. The functional analysis of purified proteins exhibited antifungal activity was verified using two human pathogenic fungal strains. In addition, the expression of rOSM made this plant more versatile to tolerate adverse environmental conditions when compared with wild-type cultivars. In this study, we demonstrated that the lettuce plant can produce a high level of functional protein and therefore is a promising production system for therapeutic purposes. Additionally, we outline the dual functionality of expressing osmotin for the synthesis of therapeutic proteins, thereby endowing engineered plants with enhanced stress tolerance. Biological sciences/Biochemistry Biological sciences/Biotechnology Biological sciences/Molecular biology Biological sciences/Plant sciences molecular farming recombinant proteins purification stress tolerance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Plants are a source of diverse proteins and contain a tractable genome that can be dictated to produce valuable recombinant proteins to sustain human health worldwide. In the quest for a cost-effective, scalable, and affordable production system, biomanufacturing of high-value recombinant proteins in plant tissues has significant potential to revolutionize modern medicines. Plant as an alternative production host is a promising technology that has an edge over conventional and more established cellular expression systems such as mammalian cells 1 , bacterial cells 2 insect cells, Chines Hamster Ovary 3 , etc., are the leading examples 4 . The plant offers more diverse and cost-effective production of high-value recombinant proteins those capable of comparable functionality with advantages of its linear scalability, robustness, sustainability, inherent safety, ease of production, lower risk of contamination, capability to produce more complex protein, and ability to perform post-translational modifications essential for a proper functional protein 4–7 . Therapeutic proteins are routinely produced in different unicellular systems such as mammalian cell culture and bacterial fermentation which are expensive because of high input investment, require more sophisticated equipment, require high input ingredients as fermenters are costly because of high-cost media composition, and therefore, contribute to the expensive the end-user product 8 . This is the reason that most high-value recombinant protein drugs are not accessible to resource-less populations worldwide 9 . In the last three decades, a large number of biopharmaceuticals have been expressed in plant systems in various plants using transgenic 5,10 , transient 11 , transplastomic 12 , and plant cell culture 13 methods of production. However, in general, every system comes with its own advantages and disadvantages in terms of cost, scalability, safety and production speed, etc. There are numerous therapeutic proteins 7 , hormones 14 , industrial enzymes 15 , antibodies 16 , growth factors 17 and vaccine antigens 18 have been expressed using different plant production systems, showing each alternative production system with remarkable advantages. However, to achieve a higher overall protein yield, process development can be impaired by a lack of reliable and scalable extraction, proteolytic activities, and purification methods 19 and requires downstream and upstream processes optimization. Osmotin is a 26 kDa cationic protein that also has therapeutic properties, especially because of its functional and structural homolog with mammalian adiponectin protein 20 . It exhibits several important functions such as antimicrobial, antifungal, neuroprotective, and neuroregenerative properties and protects against late leaf spot disease when expressed in different systems such as plants and insect cells. Osmotin is a multifunctional protein named after its induction by osmotic stress and characterized as a stress-responsive antifungal protein and belongs to pathogenesis-related (PR)-5 family. It has a pivotal role to confer the biotic as well as abiotic stress tolerance in plants, and therefore, has been over-expressed in several droughts and salt stress-related studies and exhibited protection to cells from osmotic stress by accumulating osmolyte proline and quenches ROS and free radicals 20 . Osmotin confer plants to sustain in adverse environmental conditions and its expression can be induced by NaCl 21 , ethylene 22 , abscisic acid 22 , cold 23 , drought 24 , salicyclic acid 25 . In addition, osmotin expression is also induced by biotic stresses such as wounding 26 , viral, fungal 27 and bacterial. However, the signaling pathway associated with osmotin induction to biotic and abiotic stresses and its mode of action remains unknown. There are several studies where osmotin and OLPs expression has been induced when plants were exposed to adverse conditions and biotic stresses demonstrating its role in protecting cells from osmotic shocks 28–30 . Given the importance, this study explores therapeutic and stress tolerance properties through its transgenic induction in the lettuce plant. Plant encounter various biotic and abiotic stresses which drastically alter their growth and development 31 . This stress harm plants in many ways such as disturbing cellular activities and eventually contributing to a huge reduction in overall yields 32 . A plant’s genetic makeup is well-programmed to sense and respond to such stresses in a more complex and integrative fashion. For example, as the first line of defense, plants activate many intracellular defense signals such as antimicrobials and pathogenesis-related (PR) proteins in response to biotic stress conditions 33 . PR-5 proteins can be characterized based on isoelectric point (pI) i.e., basic (osmotin), acidic (PR-S), and neutral 34 (osmotin-like protein-OLPs). To improve stress tolerance, several studies have shown to overexpress several genes responsible to add more resistance when plants are grown under adverse conditions. Proline is a multifunctional molecule in plant cells and can be found in up to 80% of a plant’s total amino acid pool during stress conditions. Taking advantage of proline function, osmotin induces its expression to respond to withstand salt or drought conditions. Once plant sense osmotic stress, the osmotin triggers proline accumulation in the cytosol and helps to detoxify ROS and free radicals 35 . Proline overexpression has been studied in tobacco, mulberry and tomato 28,36 , where proline accumulation was recorded even at lower stress tolerance. The lettuce plant is an excellent platform for the expression of functional proteins with a well-established and scalable production platform. We favored transgenic lettuce as a production host because transgenic plants are cost-effective and scalable as compared to CHO cells 37 . In this study, we expressed osmotin as a recombinant fusion protein in the lettuce plant with 6X His-tag and KDEL as Endoplasmic reticulum (ER) retaining signal. We have shown several factors that impacted its extraction and purification, and as result could purify target protein (> 90% purity) that has shown increased cell viability. The overexpression of osmotin also enhanced tolerance to abiotic stress in comparison to wild-type plants. Plant-made recombinant proteins are now economically as good as established production systems, with more convincing advantages of scalability, speed of production, and product safety 7 . However, despite the speed of production being fascinating, downstream processing remains a unique challenge that accounts for more than 80% of production cost 5 . The plant can process and produce large quantities of host cell proteins and abundant particles, especially in the protein extraction step that must be separated using elaborated purification protocols. In this study, we addressed these challenges that affect the recovery of recombinant proteins by minimizing impurities during total protein extraction allowing taking more concentrated crude extracts into the purification process. The major challenges of eluting tightly bonded rOSM proteins fused to his-tag were also addressed with optimization of salt concentration and elution buffer to achieve the quantities of purified proteins. 2. Materials and methods 2.1 Construct development and validation The binary vector pBI121 was purchased commercially (Creative Biogene). DNA encoding osmotin gene (GenBank: M29279.1) was codon-optimized for higher expression in lettuce using an online bioinformatic tool ( https://www.novoprolabs.com/tools/codon-optimization ). The sequences were fused with carboxy-terminal 6xHis followed by the endoplasmic reticulum-retention signal KDEL (Lys-Asp-Glu-Leu) was synthesized. The binary vector pBI121 was digested with XbaI/SacI restriction sites, and the OSM-His-KDEL sequences were ligated and plated on kanamycin supplemented plates until colonies were observed. The final vector pBI121-Osmo-His was transformed E. coli strain DH5-α and grown with kanamycin (50 mg/L) on LB media (NaCl 10 g/L, yeast extract 5 g/L, tryptone 5 g/L) plates and incubated overnight at 37°C. Kanamycin-resistant colonies were isolated after overnight incubation. The colonies were confirmed with colony PCR using primer sequence (forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’). The final vector pBI121-OSM-His was transformed to (Fig. 1A). The vector was transformed into Agrobacterium tumefaciens GV2260 with electroporation, and was incubated in LB media for two hours, and then plated on kanamycin supplemented (10 mg/L) and grown for two days at 28°C. The integration of binary vector was confirmed with colony PCR and were grown in LB media containing 10 mg/L kanamycin and was used for transformation. The correct orientation of the transgene was also confirmed by DNA sequence analysis and digestions. The PCR-positive colony was grown for two days and then cryopreserved in 25% glycerol stock, thoroughly dipped in liquid nitrogen, and then stored at -80°C. 2.2 Plant transformation and selection The seeds of wild-type lettuce ( Lactuca sativa L.; spp. Boston ) were used as explant for infiltration to generate transgenic lines. The seeds were sterilized by rinsing with 70% ethanol for 1 min, followed by three times incubation in 1% bleach (5 min each), and finally rinsed with autoclaved water three times (5 min each). The seeds were air-dried and placed on half-strength Murashige and Skoog (MS) media with 4 g/L phytoblend as gelatin agent and placed under light 16/8h (light/dark) photoperiod at room temperature. The plants were transformed with Agrobacterium tumefaciens GV2260 containing binary vector pBI121-OSM-His grown in 2 mL of LB medium containing kanamycin (100 mg/L) for selection. The agrobacterium was grown at 28°C for 14 h and then diluted (1:40) in MS medium (0.1mM acetosyringone). The seeds grown in half-strength MS media were able to generate cotyledons (5 days after seedling) and were cut to inoculate in diluted agrobacterium suspension for 5 min. The cotyledons were transferred to a solid co-cultivation medium containing two hormones i.e., 1 mg/L 6-benzylaminopurin (BAP) and 0.1 mg/L 1-napthaleneacetic acid (NAA) also containing kanamycin for selection of regenerating shoots and allowed to grow for 4 weeks. The regenerating shoots were transferred to Magenta boxes containing MS medium and 50 mg/L kanamycin for root development. The plants were allowed to grow until leaf samples were collected for DNA extraction and PCR confirmation. 2.3 Nucleic acid isolation and PCR confirmation Total plant genomic DNA was extracted from leaf tissues collected from three lines and wild-type samples. Approximately 50 mg of biomass was ground using liquid nitrogen with a motel and pestle. The extraction buffer was added included 100 mM Tris base, 100 mM NaCl, 100 mM Na2EDTA, pH = 8.5 by HCl) and % (w/v) SDS. The DNA was extracted using CTAB (cetyltrimethylammonium bromide) method following the method described by Shi et al. 10 Polymerase Chain Reaction (PCR) was carried out to confirm the transgene integration. The osmotin sequence-specific primers were designed using primer3 input (version 0.4.0) and synthesized primers (Integrated DNA Technologies). The primers and sequencing with primers targeting transgene OSM-His (forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’; Fig. 1A) with expected amplicon of 360 base pairs (bp). DNA extracted was used as a template (100 ng) by setting up 25 µl total volume reaction of 36 cycles with the following setting i.e., 94°C for 5 min, 94°C for 1 min, 52°C for 1.5 min, and 72°C for 1 min, final extension of 72°C for 5 min, and 4°C as end temperature for unlimited time. The samples were also included with positive (plasmid DNA) and negative (wild-type DNA and water) controls. The amplified PCR product was resolved with 1% SDS gel electrophoresis using agarose as a gelating agent. The SDS-PAGE was run at 90 V for 30 min and was analyzed under UV light to confirm the expected 360 bp amplicon. The positive plants were grown in a greenhouse and were self-pollinated to obtain T 1 generation and were utilized for all analysis. 2.4 Regeneration and selection of transgenic lines on media The seeds obtained from T 1 transgenic lines were washed again as described in section 1.2. The seeds were grown on MS media (half strength) with 100 mg/L kanamycin for selection. The regenerated tissues were analysed with PCR and western blot analysis for transgene and recombinant protein expression. Three generations were studied for this study for the expression of recombinant osmotin in lettuce plants. 2.5 Recombinant protein extraction and purification The leaf tissues collected from transgenic lettuce lines (500 mg) were subjected to total protein extraction. The leaf tissues were grind using liquid nitrogen and were added with extraction buffer comprised of 150 mM NaCl, 10 mM EDTA, 150 mM Tris, SDS 0.5%, Protein inhibition cocktail [1:100], at pH 7.4. in 1:4 ratio to leaf tissues. The samples were included at 4°C for 30 min with continuous shaking. The samples were then filtered with cheesecloth and centrifuged at 10000 g for 10 min at 4°C. The supernatant was collected in a new Eppendorf tube and used for western blot and ELISA analysis. To purify the recombinant proteins, the lettuce leaf tissues were ground in liquid nitrogen and then were added to the extraction buffer as described at a ratio of 1:4 (g/mL). The samples were incubated at 4°C for 30 min and then centrifuged at 10,000 g for 1 h at 4°C. The supernatant was moved to a new tube and then filtered with 0.22 µm filter syringe. For his-tagged proteins, we used His GraviTrap™ TALON ® columns prepacked with 1 ml of TALON ® Superflow medium (Sigma Aldrich, product GE29-0005-94) to capture the his-tagged recombinant osmotin protein. As recommended by the manufacturer, we equilibrated the column with binding buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, pH 7.4) and loaded the lettuce plant extracts. The column was washed with 10 volumes of washing buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 5 mM imidazole, pH 7.4). The rOSM was eluted using elution buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 150 mM imidazole, pH 7.4). SDS-PAGE and Western blot were performed for all fractions and then the elution fraction was concentrated using Amicon Ultra centrifugal filters, then stored at -80°C. We used Bradford assay and ELISA to confirm the quantitation of purified proteins. 2.6 Quantification of total soluble proteins The total soluble protein (TSP) concentration of the extracts was determined by Bradford assay following standard protocol using bovine serum albumin (BSA) as a standard, and TSP from WT as a negative control. A standard curve was generated using BSA ranging from 0.05–0.8 mg/ml recorded at 595 nm using spectrophotometer. 2.7 SDS-PAGE and western blot analysis The total protein extracted from transgenic lines was added with 2-marcapthoethanol and 10 µl of loading dye and incubated at 70°C for 15 min. The samples were then cooled down and short spin before loading. A total of 40µl was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for molecular-sized based separation of proteins using 8% gradient gel. The SDS-PAGE was carried out using electrophoresis at 90 V for 50 min. The well-separated gels were transferred to 0.45 µm nitrocellulose membrane at 80 V for 1 hour. The membrane was washed thoroughly with distilled water and then incubated with PBS-T containing 5% skimmed milk for 30 min. The membrane was then incubated with primate antibody mouse anti-His (dilution of 1:1000) overnight at 4°C with continuous shaking. The blot was then washed three times with PBST at 5 min intervals and then was incubated with goat-anti-mouse-IgG-HRP (sigma Aldrich 12–349) diluted 1/10,000, as a secondary antibody in PBST containing 5% skimmed milk for one hour. The membrane was then washed three times with PBST and was added with TMB stabilized substrate (500 µl each) and was visualized with chemiluminescence of ChemiDoc™ MP Imaging System. 2.8 ELISA quantification of plant-produced recombinant osmotin Enzyme-linked immunosorbent assay (ELISA) quantification was conducted to estimate the total recombinant proteins expressed in transgenic lettuce leaves. The immunlon 2HB 96-well plate was coated with 100µl capture antibody (Goat anti-HisTag) diluted in 1:500 in 1xPBS and incubated at 4°C overnight. The plate was washed three times with 200µl/well of PBS-T (5 min each). The wells were blocked for 1 hour at 37°C with a blocking solution (5% nonfat dry milk in PBS). The plate was washed three times with PBS-T for 5 min. The wells were added 100 µl per well of serial dilution and purified osmotin standard with different dilutions and incubated for 1 hour at 37°C. The plates were washed three times for 5 min with PBS-T. 100µl of Mouse anti-His antibody, dilution (1:1000) and secondary antibody (Goat-anti-mouse-HRP) dilution 1:1500 in PBS with 5% skimmed milk and incubated for 1 hour at 37°C. The plates were washed again three times for 5 min with 200 µl PBS-T. A volume of 100 µl per well was added with microplate colorimetric TMB substrate and incubated for 10 min or until sufficient color has developed. The wells were added with 100 µl 1N HCl to stop the reaction. The reading was recorded using microplate reader at 450 nm absorbance. All incubations were carried out with 100 µl unless otherwise noted. ELISA was performed in triplicate, and standard protein concentrations were interpolated from the linear portion of the standard curve. 2.9Antifungal activity The purified rOSM were treated in different amount to two yeast strains of human pathogens i.e., the spores of Candida albicans (1 × 103/100 µl) and Cryptococcus neoformans (1 × 103/100 µl) were added into 96 well plate (in triplicate) and incubated for 48 hrs at 30°C. The strains were diluted with YPAD medium (2% glucose, 1% yeast extracts, 0.02% adenine, and 3% peptone) before adding to 96-well-plate. The spores were treated/added with different concentrations of purified recombinant protein and incubated for two days (48 hrs) with a final volume of 200 µl. The growth/optical density of the two strains was recorded at OD 650 using a microplate reader to calculate the growth inhibitory activity of the protein. 2.10 Survival, germination and electrolyte leakage assay For survival and electrolyte leakage assays under salt stress, lettuce seeds were germinated and grown for 14 days. The seedlings were watered with NaCl of the final concentration of 50, 100, and 200 mM for one week, followed by recovery growth with no addition of NaCl for one week. The survival rate was recorded by visually overserving seedlings that either remained green leaves or regenerated new leaves. Meanwhile, electrolyte leakage assay was also conducted for plants that survived as previously described by Shi, et. al. (2020). For germination assay under salt stress, seeds were germinated in ½ MS medium containing NaCl of the final concentration of 50, 100, and 200 mM for 10 days. The number of germinating seedlings was counted and recorded. 2.11 Estimation of proline Concentrations of proline in lettuce leaf tissues were analyzed by ninhydrin-based colorimetric assay. Leaf biomass of 1 g was ground with 3% sulfosalicylic acid at a ratio of 1:10, followed by centrifuges at 4000 rpm for 3 min at RT. A reaction mixture was prepared that contained 3% sulfosalicylic acid, glacial acetic acid, and acidic ninhydrin, and 100 µl of supernatant was added. The tubes were vortexed before incubating at 96°C for 1 hour. The reaction was stopped by placing the tube on ice. A volume of 1 ml toluene was added to reaction mix, vortexed briefly and allowed for 5 min to separate the organic and water phases, and the chromophore phase containing toluene was analyzed by reading the absorbance at 520 nm using microplate-reader. The standard curve was prepared using toluene as standard. 2.12 Statistical analysis Each assay was repeated at least three times for all experiments. Data was presented as mean ± standard deviation (SD), And statistical significance was determined by student t-test with p -value less than 0.05. 3. Results 3.1 Creation and characterization of transgenic lettuce expressing recombinant Osmotin. The expression vector, promotor, purification tags, regulatory elements, protein targeting, choice of plant, and transformation conditions always require prior planning and optimization. We have created lettuce transgenic lines (three independent lines) able to express the rOSM in leaf tissues (Fig. 1C), and integrated osmotin without codon optimization (one independent line) for expressional analysis (Fig. 2C). After vector construction, the agrobacterium pBI121 carrying OSM-His-KDEL were able to successfully integrate the transgene and created three independent transgenic events for codon and one for non-codon optimized osmotin expression. The PCR was carried out to confirm the integrity of transgene in each independent line by using forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’. All four transgenic events were confirmed with an expected amplicon of 360 bp (Fig. 1B). The plants expected to express the recombinant proteins were transferred to Magenta boxes containing an equal amount of selection (100 mg/L of kanamycin) and then transferred to the greenhouse after roots were developed. The plants were grown in the greenhouse and were fertile to produce > 2000 seeds per plant. The extraction of TSP from plant tissues is the first step of downstream processing. The overall goal of this process is to extract recombinant proteins in an aqueous buffer environment to protect their functionality. To achieve the most suitable extraction buffer and conditions, we analyzed the impact of pH, Tween-20, protease inhibition cocktail (PIC), and ultrasonication on rOSM recovery from lettuce leaf crude extracts. The plant tissues collected from each transgenic line were subjected to total protein extraction and were confirmed with Western blot analysis and the protein size of ~ 30 kDa was detected in all lettuce lines (Fig. 1C). T 1 seeds were also grown half-strength MS media supplemented with 100 mg/L kanamycin showed 100% germination in comparison to wild-type seeds which were able to regenerate 10–15% in the first 5 days, however, those also dried 10 days after sowing. All independent transgenic events confirmed its selection by expression of nptII genes confers kanamycin resistance. The plants were phenotypically similar in plant growth and development to wild-type plants and also potent to generate > 500 T 1 seeds from each independent line. 3.2 Expression increased over time and generations. The confirmation of homozygosity is important to utilize transgenic lines for different investigations. Therefore, to confirm the integration of transgene into subsequent generations, we investigated the expression of rOSM in three generations. All the generations were able to regenerate on half strength MS media with kanamycin (100 mg/L) confirming the integration of the selection maker in all three generations. Further, DNA extracted from all generations was also confirmed with PCR using primers (forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’; and the expected 360 bp band was amplified (Fig. 1B). Also, more importantly, we confirmed the expression of rOSM in all generations. The total protein extracted from leaf tissues was analyzed with western blot for confirmation of recombinant osmotin expression. The protein band of ~ 30 kDa band was observed in all three generations showing that all generations carry on the expression. Also, to find out whether the expression increases or decreases over generations, we performed ELISA-based quantitation using antibodies specific to His-tag. The ELISA analysis revealed that expression is increasing from T 1 to T 3 exhibiting an ascending pattern of protein expression (Fig. 2B). We also performed ELISA quantitation for plant tissues collected from lettuce over different time periods i.e., 10, 20, 40, 60, 80 and 100 days after generation (Fig. 1D). We observed that plants can accumulate rOSM, and showed an increased expressional pattern from 10–80 DAG, with a maximum expression of 127 mg/kg fresh weight (FW), however, the expression decreased at 100 DAG i.e., 80.6 mg/kg FW (Fig. 1D). For each analysis, the whole plant was collected and homogenized for quantitation. A time point increase in expression of osmotin-His was observed, where plants expressed at day 80 were almost three times of proteins at day 10 (Fig. 2A). 3.3 Protein extraction and codon optimization enhanced the total soluble protein recovery and expression of the recombinant protein. To achieve a higher level of expression in lettuce plants, osmotin sequences were codon-optimized, where rare codons were replaced with preferred ones for higher expression in lettuce. The optimization and usage of preferred codons have been reported earlier in several publications to enhance protein translation by increasing mRNA stability and allowing tRNA to accommodate the tRNA pool in host cells 38 . After codon optimization, 98 of total 245 codons were optimized by replacement with more preferred codons using Nicotiana benthamiana as the codon usage host (Fig. S1 ). The osmotin sequence optimized for expression in lettuce has been shown to effectively increase recombinant protein expression in leaf tissues. An ELISA-based quantitation with anti-His antibodies showed higher intensity of rOSM for optimized sequences indicating that the codon optimization system is effective in enhancing its expression (Fig. 2C). An efficient extraction protocol is critical for extracting all recombinant proteins produced in plant tissues in order to achieve a higher overall yield. We also considered the possibility that rOSM-his recovery is difficult due to intrinsically disordered characteristics of plant material, we also investigated the impact of surfactant i.e., tween-20, protein inhibition cocktail, and ultrasonication on protein extraction using the highest expressional line LS-rOSM-10. The TSP and target protein concentration in the crude extracts were evaluated with Bradford assays and ELISA, respectively. The total soluble proteins were extracted with and without tween-20. The addition of tween-20 had a significant impact on extracting total proteins. The Bradford assay data showed that the addition of 1% (v/v) tween-20 enhanced the extraction of TSP up to 2 folds (Fig. 3A). Tween-20 helped to degrade the lipid biolayer and break down all cellular organelles including ER, and therefore the ER targeted Osmotin could be extracted into an extraction buffer. The addition of tween-20 was also validated with western blot showing higher recovery of target protein. The impact of ultrasonication of plant extracts was also evaluated. Ultrasonication has been used in several studies where it could enhance TPS recovery. Therefore, we analyzed ultrasonication on TSP and found that 5s to 10s (5s on, 10s off) have a positive impact on total protein extraction up to two rounds. The further sonication for the third and fourth rounds negatively impacted the extraction of TSP, and we observed a decline in TSP (Fig. 3B). Ultrasonication generates a considerable amount of heat, and therefore, we kept our samples on ice while ultrasonication to avoid the heat that can possibly degrade proteins. Also, the impact of PIC has been demonstrated in several studies that help recombinant proteins avoid degradation. We analyzed the addition of PIC in the extraction buffer in a 1:100 ratio and compared it to the extraction buffer with no PIC added. The addition of PIC in the extraction buffer had no impact on the recovery of TSP and observed the same amount in the absence. Keeping in view the data obtained from these variables, we developed a procedure for protein extraction and then confirmed the results with ELISA-based quantitation. We observed that the maximum TSP proteins had a positive correlation with the highest expression of rOSM in lettuce samples. 3.4 Recombinant Osmotin was degraded after incubating plant extract at 4°C The stability of recombinant proteins is more important, especially for low-level expressing proteins. Transgenic plants have relatively lower expression in transient, chloroplast, or cell culture-based systems, and therefore it is crucial to minimize the loss of proteins during downstream processing. We, therefore, observed our protein stability in plant extract after shaking incubation at 4°C for 24 hours, without shaking. We observe a decline in protein expression after 4 hours when proteins started degrading. The peak degradation was observed 20 hours after incubation at 4°C (Fig. 3C). We also excluded the possibility of no PIC on protein protection over longer periods. Therefore, we added PIC with a 1:100 ratio to the extraction buffer to study protein degradation over a longer period. However, we observed an equal amount of degradation, comparable to extraction buffer without PIC (data not shown). 3.5 Recombinant Osmotin was purified from lettuce leaf tissue The maximum recovery of total proteins was achieved by optimizing extraction conditions and then confirmed our hypothesis of higher total protein content will have higher rOSM with ELISA. The leaf extracts were used for manual purification of Histidine-tagged-OSM using His GraviTrap™ TALON® Columns Nickel-nitrilotriacetic (Sigma Aldrich). Every fraction was subjected to TSP analysis with Bradford analysis to observe the protein recovery. To find out the purity, we did the densitometric analysis using ImageJ software of the blot and achieved > 90% purity. We also loaded the purified in exceeding amounts up to 15 µg, however could see no degradation based on SDS-PAGE and western blot. 3.6 Lettuce-made recombinant Osmotin inhibits fungal growth To evaluate the inhibitory effect of rOSM, we considered two yeast strains of human pathogens i.e., Candida albicans and Cryptococcus neoformans. The purified rOSM proteins were added in 0.5, 1.0, 1.5 and 2.0 µM concentrations. As shown in Fig. 4, purified rOSM had a significant inhibitory activity for both Candida albicans and Cryptococcus neoformans . The highest amount of 2.0 µM concentration of rOSM inhibited the growth of fungal species to 22% and 13% for Candida albicans and Cryptococcus neoformans , respectively. 3.7 Osmotin expression in lettuce improves stress tolerance, and proline contents To test whether compartmentalization of Osmotin accumulation in lettuce seed endosperm improves seedling salt tolerance, we challenged T 3 transgenic lettuce seedlings with salt in different concentrations. We did not observe a significant difference between wild type and transgenic lines in survival rate under 100mM and 200mM salt stress conditions (Fig. 5A). Similarly, the electrolyte leakage levels in leaves of LS-rOSM-7 and LS-rOSM-10 plants that survived salt stress were slightly, but not significantly, lower compared to WT (Fig. 5C), indicating slightly better cell protection due to rOSM expression in transgenic lines. However, the germination rate of LS-rOSM-7 and LS-rOSM-10 seeds was significantly increased compared to wild-type under 100 and 200 mM NaCl salt stress, indicating a markedly improved salt stress tolerance specifically in transgenic lettuce leaf expressing rOSM (Fig. 5B). Because of a generally better performance of LS-rOSM-10 in the abovementioned aspects, we used this line for all downstream processing. We also estimated the proline contents in the leaf tissues after exposure to a maximum concentration of 200 mM NaCl. Proline is the major contributor to resistance against adverse conditions by overexpressing under stress conditions. We observed a sharp increase in proline contents when both LS-rOSM-7 and LS-rOSM-10 were exposed to salt stress. There was an increase of 57.1% and 67.6% increase in proline contents for LS-rOSM-7 and LS-rOSM-10, respectively (Fig. 5D). 4. Discussion Plant molecular farming (PMF) has great potential as a production host of biopharmaceutical proteins including growth factors, therapeutics, vaccines, nutraceuticals, and enzymes 4 . An increase in PMF research was observed right after Covid-19 pandemic which dragged the world to a complete halt and was also responsible for the ongoing human health crisis. The need for a scalable and rapid bioproduction system mounted and in response, numerous research groups and industries initiated massive research using various plant systems for the production of vaccine antigen, diagnostic reagents, and antiviral drugs needed worldwide. An industry such as Medicago initiated research on plant-made vaccine antigen using Nicotiana benthamiana as a production host and successfully the completed third phase of clinical trials 18,39 , and ultimately received regulatory approval from Health Canada. Therefore, we initiated this study to produce biopharmaceuticals to follow the same regulatory pathway to take plant-made products to the market. We are using lettuce as an expression host because it has GRAS status for production and therefore has been the host for a variety of biopharmaceuticals in numerous studies up to date 40 . We utilized lettuce leaf plant tissues as bioreactors for the production of rOSM because transgenic plants are a cost-effective production choice compared to CHO cells 8,41,42 , and more importantly a part of our investigation to explore the possibility of its oral delivery. Our results were encouraging that lettuce can correctly process this protein and can accumulate in ER without loss of functionality and are in line with previous publications 43,44 . We investigated the downstream processing for rOSM to achieve the highest amount of protein yield by investigating several total protein extractions and purification conditions. Following successful expression and its characterization, we considered the possibility of intrinsically disordered properties of rOSM that could lead to exposed hydrophobic patches that interact with cell debris and cause protein loss during extraction. We considered Tween-20 helps to halt the hydrophobic interactions in plant extract and disorganize the membrane’s lipid bilayer and solubilize the proteins targeted into different organelles such as ER, chloroplast, vacuole, etc. In this study, we designed our construct with the addition of the C-terminal His-tag, and the KDEL motif as a strategy to achieve higher expression. We achieved two objectives: the detection of the target protein and utilization as a purification tag by incorporating His-tag sequences by gravity flow purification column. As osmotin sequences were added to SEKDEL, they targeted our recombinant proteins to ER. The addition of tween-20, therefore, helped to break cellular organelles and extract osmotin targeted into the ER and increased rOSM recovery. The darkening in green color was also observed with the addition of tween-20 was due to disruption of organelles including chloroplast, and therefore exhibited green color. We also observed that recovery was drastically reduced protein recovery at high concentrations probably due to adverse impact on protein stability or could lead to protein degradation at higher concentrations. We also determined whether incubation of plant extraction has any impact on protein stability. Our data shows that a longer incubation time decreases the number of recombinant proteins. This is a crucial finding because if the downstream processing is scaled up, the longer processing time will negatively impact the recombinant protein recovery. However, we also speculate that protein stability may be protein-dependent, and therefore should be evaluated for every protein of interest. We also purified recombinant osmotin from lettuce leaf biomass using 6x His-tag sequences which has been used in several studies as a cost-effective method for purification from plant tissues 45 . As we attached His-tag to the C-terminal of the protein, it helped to purify using gravity flow columns in a more convenient manner. The rOSM was eluted using the elution buffer recommended by the manufacturer. By observing SDS-PAGE and western blot images, we were able to elute the desired protein without observing any degradation. We performed ELISA-based quantitation for crude extracts and purified proteins and then stored them at -80°C for further experimentation. The purified proteins were also concentrated and total rOSM proteins were estimated. We used the highest expression line LS-rOSM-12 for all purifications and all experimentation for process optimization. Previous studies extensively reported biotic and abiotic resistant functions of osmotin and its homologous in a variety of plants 46,47 . In addition, osmotin has been speculated to be involved in several etiological pathways of mammalian diseases by potentially functioning as an agonist of adiponectin, a multi-functional mammalian hormone produced in adipose tissues 20 . Their structural and functional similarities were experimentally evaluated by multiple in vivo and in vitro studies. However, this study represents the first case of lettuce stable transgenic lines expressing rOSM, those were also purified from leaf tissues. Osmotin is an antifungal protein belonging to pathogenesis-related (PR)-5 family. We also report the diverse functions of rOSM with our results which showed significant antifungal activity against two human pathogen strains Candida albicans and Cryptococcus neoformans . Interestingly, we found that expression of rOSM in transgenic lettuce plants significantly increased in salt-induced conditions when compared to WT plants both with irrigation with 200 mM NaCl and seed germination assay. This result is consistent with a previous result showing GUS activity driven by promoters of 15 endosperm-specific genes was accumulated in rice seeds, among which only three promoters (AGPase, PPDK, and 10 KDa prolamin) activated GUS expressions in transgenic rice root and other tissues 48 . Thus, these suggest that the 35s constitutive promoter activated adequate expression of recombinant osmotin in lettuce plants, leading to significant improvement in salt stress tolerance during plant growth and development. However, the potentially weak ectopic expression of osmotin in root and other tissues was not enough to cause significant and systemic phenotypic changes in transgenic lettuce plants under salt stress. In addition. An amino acid, proline, plays a vital role in protecting plants from adverse conditions and helps to overcome stress more rapidly. Therefore, when plants are exposed to stress conditions, there is an increase in proline contents and other physiological characteristics of plants are observed. When rOSM transgenic lines were exposed to salt stress of maximum of 200 mM, there was a sharp growth in proline contents was observed, and the plants containing more rOSM were able to recover faster than the control wild-type lettuce plants. This concludes our hypothesis on a positive note that rOSM containing plants are more resistant to salt stress. 5. Conclusion Osmotin is an important multi-functional plant protein widely distributed in fruits and vegetables. We successfully generated transgenic lines expressing functional rOSM in lettuce and also investigated strategies both for achieving higher expression by codon optimization and ER targeting, and purification by using ultra-sonication, PIC, and Tween-20. rOSM extraction and its purification were challenging due to its instability in crude extracts. We have described a simplified and convenient method of downstream processing for purifying rOSM from lettuce leaf tissues by considering factors that can potentially enhance its extraction and purification. This study shows that by amendment to standard techniques during extraction and purification, product recovery can be improved. The purified protein also exhibited antifungal activities showing the functionality of our purified proteins. This study also concludes that rOSM expression makes lettuce plants more versatile to exhibit salt stress by increasing proline contents and higher germination ratio in stress conditions. The data of this study indicates that lettuce tissues are a promising system to express Osmotin and can be utilized for the production of biopharmaceuticals. Declarations We declare that all the experimental research and field studies on plants (either cultivated or wild), including the collection of plant material comply with relevant institutional, national, and international guidelines and legislation of IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Convention on the Trade in Endangered Species of Wild Fauna and Flora. For consideration for publication, we provide the following statements: All authors listed in this submission have agreed with the publication of this manuscript. The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. I confirm that this work is original and has not been published elsewhere, nor is it currently under consideration for publication elsewhere. And it will not be published elsewhere within one year after its publication in this journal All authors have no conflicts of interest to report. This manuscript contained no human study. Conflict of Interest The authors declare no competing financial interests. Authors’ Contributions T.N., carried out experiments, performed ELISA, performed downstream experiments, defined purity and performed western blots. U. K., and S.F., carried out experiments, developed transgenic plants and wrote sections of manuscript, A.T., coordinated the project, performed purification and stress analysis and interpreted data. IK., formulated hypotheses, designed experiments, wrote the manuscript, analyzed data, and communicated the manuscript, S.F. revised the manuscript, proof reading of the manuscripts. All authors discussed the results, commented on the manuscript, and approved its submission. Funding This research was funded by Researcher’s Supporting Project number RSP2024R134, King Saud University, Riyadh, Saudi Arabia. Data Availability All data generated or analyzed during this study are included in this published in figshare 10.6084/m9.figshare.25289872 References Lalonde, M. E. & Durocher, Y. Therapeutic glycoprotein production in mammalian cells. J Biotechnol 251 , 128-140 (2017). https://doi.org/10.1016/j.jbiotec.2017.04.028 Shiloach, J. & Fass, R. Growing E. coli to high cell density--a historical perspective on method development. Biotechnol Adv 23 , 345-357 (2005). https://doi.org/10.1016/j.biotechadv.2005.04.004 Li, W., Fan, Z., Lin, Y. & Wang, T.-Y. Serum-Free Medium for Recombinant Protein Expression in Chinese Hamster Ovary Cells. Frontiers in Bioengineering and Biotechnology 9 (2021). https://doi.org/10.3389/fbioe.2021.646363 Schillberg, S. & Finnern, R. Plant molecular farming for the production of valuable proteins - Critical evaluation of achievements and future challenges. J Plant Physiol 258-259 , 153359 (2021). https://doi.org/10.1016/j.jplph.2020.153359 Khan, I., Twyman, R. M., Arcalis, E. & Stoger, E. Using storage organelles for the accumulation and encapsulation of recombinant proteins. Biotechnol J 7 , 1099-1108 (2012). https://doi.org/10.1002/biot.201100089 Habibi, P., Shi, Y., Fatima Grossi-de-Sa, M. & Khan, I. Plants as Sources of Natural and Recombinant Antimalaria Agents. Molecular Biotechnology 64 , 1177-1197 (2022). https://doi.org/10.1007/s12033-022-00499-9 Fischer, R. & Buyel, J. F. Molecular farming - The slope of enlightenment. Biotechnol Adv 40 , 107519 (2020). https://doi.org/10.1016/j.biotechadv.2020.107519 Schillberg, E. et al. Reply to Comment on "Distribution of Ixodes scapularis in Northwestern Ontario: Results from Active and Passive Surveillance Activities in the Northwestern Health Unit Catchment Area". Int J Environ Res Public Health 16 (2019). https://doi.org/10.3390/ijerph16112058 Tsekoa, T. L., Singh, A. A. & Buthelezi, S. G. Molecular farming for therapies and vaccines in Africa. Curr Opin Biotechnol 61 , 89-95 (2020). https://doi.org/10.1016/j.copbio.2019.11.005 Shi, Y. et al. Seed-Based System for Cost-Effective Production of Vaccine Against Chronic Respiratory Disease in Chickens. Molecular Biotechnology 65 , 570-580 (2023). https://doi.org/10.1007/s12033-022-00554-5 Alkanaimsh, S. et al. Transient Expression of Tetrameric Recombinant Human Butyrylcholinesterase in Nicotiana benthamiana. Front Plant Sci 7 , 743 (2016). https://doi.org/10.3389/fpls.2016.00743 Berecz, B., Zelenyanszki, H., Polya, S., Tamas-Nyitrai, C. & Oszvald, M. Plastid Molecular Pharming I. Production of Oral Vaccines via Plastid Transformation. Mini Rev Med Chem 17 , 1292-1315 (2017). https://doi.org/10.2174/1389557516666161004161801 Holland, T. & Buyel, J. F. Bioreactor-Based Production of Glycoproteins in Plant Cell Suspension Cultures. Methods Mol Biol 1674 , 129-146 (2018). https://doi.org/10.1007/978-1-4939-7312-5_11 Stoger, E., Ma, J. K., Fischer, R. & Christou, P. Sowing the seeds of success: pharmaceutical proteins from plants. Curr Opin Biotechnol 16 , 167-173 (2005). https://doi.org/10.1016/j.copbio.2005.01.005 Guan, C. et al. Expression of cholera toxin B subunit-lumbrokinase in edible sunflower seeds-the use of transmucosal carrier to enhance its fusion protein's effect on protection of rats and mice against thrombosis. Biotechnol Prog 30 , 1029-1039 (2014). https://doi.org/10.1002/btpr.1963 Strasser, R. et al. Improved virus neutralization by plant-produced anti-HIV antibodies with a homogeneous beta1,4-galactosylated N-glycan profile. J Biol Chem 284 , 20479-20485 (2009). https://doi.org/10.1074/jbc.M109.014126 Ding, S. H., Huang, L. Y., Wang, Y. D., Sun, H. C. & Xiang, Z. H. High-level expression of basic fibroblast growth factor in transgenic soybean seeds and characterization of its biological activity. Biotechnol Lett 28 , 869-875 (2006). https://doi.org/10.1007/s10529-006-9018-6 Ward, B. J. et al. Efficacy, immunogenicity, and safety of a plant-derived, quadrivalent, virus-like particle influenza vaccine in adults (18-64 years) and older adults (>/=65 years): two multicentre, randomised phase 3 trials. Lancet 396 , 1491-1503 (2020). https://doi.org/10.1016/S0140-6736(20)32014-6 Mandal, M. K., Ahvari, H., Schillberg, S. & Schiermeyer, A. Tackling Unwanted Proteolysis in Plant Production Hosts Used for Molecular Farming. Front Plant Sci 7 , 267 (2016). https://doi.org/10.3389/fpls.2016.00267 Anil Kumar, S., Hima Kumari, P., Shravan Kumar, G., Mohanalatha, C. & Kavi Kishor, P. B. Osmotin: a plant sentinel and a possible agonist of mammalian adiponectin. Front Plant Sci 6 , 163 (2015). https://doi.org/10.3389/fpls.2015.00163 Sokhansanj, A., Sadat Noori, S. A. & Niknam, V. Comparison of bacterial and plant genes participating in proline biosynthesis with Osmotin gene, with respect to enhancing salinity tolerance of transgenic tobacco plants. Russian Journal of Plant Physiology 53 , 110-115 (2006). https://doi.org/10.1134/S1021443706010146 Zhu, B., Chen, T. H. & Li, P. H. Expression of an ABA-responsive osmotin-like gene during the induction of freezing tolerance in Solanum commersonii. Plant Mol Biol 21 , 729-735 (1993). https://doi.org/10.1007/BF00014558 Newton, S. S. & Duman, J. G. An osmotin-like cryoprotective protein from the bittersweet nightshade Solanum dulcamara. Plant Mol Biol 44 , 581-589 (2000). https://doi.org/10.1023/a:1026599028063 Parkhi, V. et al. Expression of apoplastically secreted tobacco osmotin in cotton confers drought tolerance. Molecular Breeding 23 , 625-639 (2009). Kim, M. Y. et al. Plant-expressed Fc-fusion protein tetravalent dengue vaccine with inherent adjuvant properties. Plant Biotechnol J 16 , 1283-1294 (2018). https://doi.org/10.1111/pbi.12869 Zhu, B., Chen, T. H. & Li, P. H. Expression of three osmotin-like protein genes in response to osmotic stress and fungal infection in potato. Plant Mol Biol 28 , 17-26 (1995). https://doi.org/10.1007/BF00042034 Tzou, Y. M. et al. Expression of truncated tobacco osmotin in Escherichia coli: purification and antifungal activity. Biotechnol Lett 33 , 539-543 (2011). https://doi.org/10.1007/s10529-010-0453-z Das, M., Chauhan, H., Chhibbar, A., Rizwanul Haq, Q. M. & Khurana, P. High-efficiency transformation and selective tolerance against biotic and abiotic stress in mulberry, Morus indica cv. K2, by constitutive and inducible expression of tobacco osmotin. Transgenic Res 20 , 231-246 (2011). https://doi.org/10.1007/s11248-010-9405-6 Rivero, M. et al. Stacking of antimicrobial genes in potato transgenic plants confers increased resistance to bacterial and fungal pathogens. J Biotechnol 157 , 334-343 (2012). https://doi.org/10.1016/j.jbiotec.2011.11.005 Subramanyam, K. et al. Overexpression of tobacco osmotin (Tbosm) in soybean conferred resistance to salinity stress and fungal infections. Planta 236 , 1909-1925 (2012). https://doi.org/10.1007/s00425-012-1733-8 Pandey, P., Irulappan, V., Bagavathiannan, M. V. & Senthil-Kumar, M. Impact of Combined Abiotic and Biotic Stresses on Plant Growth and Avenues for Crop Improvement by Exploiting Physio-morphological Traits. Front Plant Sci 8 , 537 (2017). https://doi.org/10.3389/fpls.2017.00537 Oerke, E. C. Crop losses to pests. The Journal of Agricultural Science 144 , 31-43 (2006). https://doi.org/10.1017/S0021859605005708 Veronese, P. et al. In defense against pathogens. Both plant sentinels and foot soldiers need to know the enemy. Plant Physiol 131 , 1580-1590 (2003). https://doi.org/10.1104/pp.102.013417 Koiwa, H., Sato, F. & Yamada, Y. Characterization of accumulation of tobacco PR-5 proteins by IEF-immunoblot analysis. Plant Cell Physiol 35 , 821-827 (1994). https://doi.org/10.1093/oxfordjournals.pcp.a078663 Vinocur, B. & Altman, A. Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations. Curr Opin Biotechnol 16 , 123-132 (2005). https://doi.org/10.1016/j.copbio.2005.02.001 Goel, D., Singh, A. K., Yadav, V., Babbar, S. B. & Bansal, K. C. Overexpression of osmotin gene confers tolerance to salt and drought stresses in transgenic tomato (Solanum lycopersicum L.). Protoplasma 245 , 133-141 (2010). https://doi.org/10.1007/s00709-010-0158-0 Buyel, J. F., Twyman, R. M. & Fischer, R. Very-large-scale production of antibodies in plants: The biologization of manufacturing. Biotechnol Adv 35 , 458-465 (2017). https://doi.org/10.1016/j.biotechadv.2017.03.011 Takaiwa, F., Wakasa, Y., Takagi, H. & Hiroi, T. Rice seed for delivery of vaccines to gut mucosal immune tissues. Plant Biotechnol J 13 , 1041-1055 (2015). https://doi.org/10.1111/pbi.12423 Pillet, S. et al. Immunogenicity and safety of a quadrivalent plant-derived virus like particle influenza vaccine candidate-Two randomized Phase II clinical trials in 18 to 49 and >/=50 years old adults. PLoS One 14 , e0216533 (2019). https://doi.org/10.1371/journal.pone.0216533 Joh, L. D., Wroblewski, T., Ewing, N. N. & VanderGheynst, J. S. High-level transient expression of recombinant protein in lettuce. Biotechnol Bioeng 91 , 861-871 (2005). https://doi.org/10.1002/bit.20557 Li, W., Fan, Z., Lin, Y. & Wang, T. Y. Serum-Free Medium for Recombinant Protein Expression in Chinese Hamster Ovary Cells. Front Bioeng Biotechnol 9 , 646363 (2021). https://doi.org/10.3389/fbioe.2021.646363 Tihanyi, B. & Nyitray, L. Recent advances in CHO cell line development for recombinant protein production. Drug Discov Today Technol 38 , 25-34 (2020). https://doi.org/10.1016/j.ddtec.2021.02.003 Kang, H., Park, Y., Lee, Y., Yoo, Y. J. & Hwang, I. Fusion of a highly N-glycosylated polypeptide increases the expression of ER-localized proteins in plants. Sci Rep 8 , 4612 (2018). https://doi.org/10.1038/s41598-018-22860-2 Matsui, T., Asao, H., Ki, M., Sawada, K. & Kato, K. Transgenic lettuce producing a candidate protein for vaccine against edema disease. Biosci Biotechnol Biochem 73 , 1628-1634 (2009). https://doi.org/10.1271/bbb.90129 Islam, M. R. et al. Cost-effective production of tag-less recombinant protein in Nicotiana benthamiana. Plant Biotechnol J 17 , 1094-1105 (2019). https://doi.org/10.1111/pbi.13040 Bashir, M. A. et al. Osmotin: A Cationic Protein Leads to Improve Biotic and Abiotic Stress Tolerance in Plants. Plants (Basel) 9 (2020). https://doi.org/10.3390/plants9080992 Viktorova, J. et al. Recombinant expression of osmotin in barley improves stress resistance and food safety during adverse growing conditions. PLoS One 14 , e0212718 (2019). https://doi.org/10.1371/journal.pone.0212718 Qu le, Q. & Takaiwa, F. Evaluation of tissue specificity and expression strength of rice seed component gene promoters in transgenic rice. Plant Biotechnol J 2 , 113-125 (2004). https://doi.org/10.1111/j.1467-7652.2004.00055.x Additional Declarations No competing interests reported. Supplementary Files Supplementaryfigures.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3951169","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":276159983,"identity":"50f3b978-d026-402f-b144-5adc5126fd3e","order_by":0,"name":"Taufiq Nawaz","email":"","orcid":"","institution":"South Dakota State University","correspondingAuthor":false,"prefix":"","firstName":"Taufiq","middleName":"","lastName":"Nawaz","suffix":""},{"id":276159984,"identity":"52ee9418-c9b2-42dc-99f1-adb812388fef","order_by":1,"name":"Umair Khan","email":"","orcid":"","institution":"Jabir Al Ahmed, AlJabir Sabah Hospital","correspondingAuthor":false,"prefix":"","firstName":"Umair","middleName":"","lastName":"Khan","suffix":""},{"id":276159985,"identity":"9ec0bf8e-300a-4554-8200-6cedeb13feb2","order_by":2,"name":"Shah Fahad","email":"","orcid":"","institution":"Abdul Wali Khan University","correspondingAuthor":false,"prefix":"","firstName":"Shah","middleName":"","lastName":"Fahad","suffix":""},{"id":276159986,"identity":"23a116aa-d689-496b-80ef-720fe20b329d","order_by":3,"name":"Azade Tahmasebi","email":"","orcid":"","institution":"Michigan Technological University","correspondingAuthor":false,"prefix":"","firstName":"Azade","middleName":"","lastName":"Tahmasebi","suffix":""},{"id":276159987,"identity":"39b16527-bcc9-492e-a165-c70d42f9fe59","order_by":4,"name":"Elsayed Fathi Abd_Allah","email":"","orcid":"","institution":"King Saud University","correspondingAuthor":false,"prefix":"","firstName":"Elsayed","middleName":"Fathi","lastName":"Abd_Allah","suffix":""},{"id":276159988,"identity":"788a8b97-c19b-40f5-9a65-747c461b6070","order_by":5,"name":"Imran Khan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYBACNh7mgw8+VIDZjAceAIkGwlrYkg1nnIFwDiQQo4WBh8dMmreNFC18PAfMJGfOs5Mzn918AKjFRnbDAUIO421Itvi4LdlY5s6xBKCWNGPCWvgZDt6cue1A4gyJHAOglsOJRGhhbJDmnQPSkv8BqOU/EVp4m5mkeRvAtoC8f4AILTzHmA1nHEs2lpBIAzrMINl4JiEt8j35Hx98qLGTk5BIfgiMUzvZPkJa0IABacpHwSgYBaNgFOAAAOY0Rg/TDQl/AAAAAElFTkSuQmCC","orcid":"","institution":"Cornell University","correspondingAuthor":true,"prefix":"","firstName":"Imran","middleName":"","lastName":"Khan","suffix":""}],"badges":[],"createdAt":"2024-02-12 14:06:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3951169/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3951169/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52010137,"identity":"558de031-bb0f-4de5-b332-e6e4af286f10","added_by":"auto","created_at":"2024-03-05 10:27:49","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":63675,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA.\u003c/strong\u003e The schematic diagram of expression cassette of pBI121-OSM-His-KDEL. Genetic components included are CaMV 35s, promoter of glutelin gene GluB-4; Osmotin gene sequence; KDEL, Endoplasmic reticulum retention signal; Tnos, termination of the nopaline synthase gene from \u003cem\u003eAgrobacterium tumefaciens; \u003c/em\u003eKanR, Kanamycin resistant gene; LB and RB, left and right border of T-DNA repeat respectively. \u003cstrong\u003eB.\u003c/strong\u003e characterization of genomic integration of pBI121-Osm-His-KDEL cassette in different transgenic lines by PCR using primers. \u003cstrong\u003eC.\u003c/strong\u003eValidation of recombinant Osm-His-KDEL expression in three lines by Western blot with anti-His-tag antibody. \u003cstrong\u003eD.\u003c/strong\u003e quantification of recombinant LS-OSM-His-KDEl expression in different transgenic lines at 80 days after germination\u003c/p\u003e","description":"","filename":"Slide1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3951169/v1/411cf1c857fd07f0327c37b8.jpg"},{"id":52010138,"identity":"64122109-8ef1-4b73-ad7c-4e49c73160d4","added_by":"auto","created_at":"2024-03-05 10:27:49","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":55997,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpressional analysis of transgenic lettuce LS-rOSM-10 over the time\u003c/strong\u003e: \u003cstrong\u003eA\u003c/strong\u003e. Transgenic lettuce lines showing increased expression after sowing; with higher expression recorded 80 days after sowing i.e., 127 mg/Kg FW. \u003cstrong\u003eB.\u003c/strong\u003e Recombinant expression of ostmotin in leaf tissue showed enhanced quantitation in different generations i.e., R1, R2 and R3. \u003cstrong\u003eC\u003c/strong\u003e. Expressional comparison of codon optimized vs non-codon optimized transgenic lines\u003c/p\u003e","description":"","filename":"Slide2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3951169/v1/6769595f0678757c27a00867.jpg"},{"id":52010139,"identity":"89b26f04-1414-4a86-bc3a-63d41f2bc68f","added_by":"auto","created_at":"2024-03-05 10:27:49","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":51921,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of different variables on total protein recovery from leaf tissues.\u003c/strong\u003e Impact of various extraction conditions for maximum recovery of total soluble proteins: \u003cstrong\u003eA.\u003c/strong\u003e Impact of tween-20 on recovery of TSP. \u003cstrong\u003eB. \u003c/strong\u003eImpact of ultrasonication from 0-4 rounds (5 s on, 10 s off) on TSP extraction. \u003cstrong\u003eC\u003c/strong\u003e. The impact of incubation on recombinant OSM in crude extracts at 4 C\u003c/p\u003e","description":"","filename":"Slide3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3951169/v1/251e9193541fadafcc06480e.jpg"},{"id":52010141,"identity":"208cbdd4-6274-4c13-a958-30eeef973be9","added_by":"auto","created_at":"2024-03-05 10:27:49","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":41231,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntifungal activity of purified rOSM from line LS-rOSM-10 and its effect on growth and germination of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCandida albicans \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCryptococcus neoformans\u003c/strong\u003e\u003c/em\u003e. The experiment was conducted in triplicate and gave similar results. The shown graph is obtained is the average of three biological replicates experiments.\u003c/p\u003e","description":"","filename":"Slide4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3951169/v1/7e32a633a59d84346bbdee5f.jpg"},{"id":52010140,"identity":"62824651-24b2-4c93-b426-22e50e66dc42","added_by":"auto","created_at":"2024-03-05 10:27:49","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":88622,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAbiotic stress responses of Lettuce overexpressing rOSM\u003c/strong\u003e. Lettuce plant seeds were grown in the control conditions for two weeks and data was recorded for survival rate (\u003cstrong\u003eA\u003c/strong\u003e), germination rate (\u003cstrong\u003eB\u003c/strong\u003e) electrolyte leakage assay (\u003cstrong\u003eC\u003c/strong\u003e) and proline content (\u003cstrong\u003eD\u003c/strong\u003e). The plants were transferred and grown in a medium supplemented with 0, 100, and 200mM NaCl for one week followed by a recovery growth for one week. For germination assay, germinated seeds were recorded after germination under 0, 100, and 200mM NaCl mdium for 10 days. Error bars represent standard deviation of thriplicates of each sample. *: \u003cem\u003eP\u003c/em\u003e-value \u0026lt;0.05\u003c/p\u003e","description":"","filename":"Slide5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3951169/v1/0d07c165505d460738f875f1.jpg"},{"id":64901921,"identity":"6a7be354-87b9-40b0-8acd-75891114fe2d","added_by":"auto","created_at":"2024-09-20 08:14:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1173280,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3951169/v1/3f2a9dfd-3faa-43e2-8a9c-0c75dab01f32.pdf"},{"id":52010310,"identity":"33ed2d7d-a287-4ec1-9a34-111199c9c648","added_by":"auto","created_at":"2024-03-05 10:35:49","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1180062,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfigures.pptx","url":"https://assets-eu.researchsquare.com/files/rs-3951169/v1/664e7b732cbeb16e59fefd97.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Production and downstream processing optimization of plant-made Osmotin and its functional analysis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003ePlants are a source of diverse proteins and contain a tractable genome that can be dictated to produce valuable recombinant proteins to sustain human health worldwide. In the quest for a cost-effective, scalable, and affordable production system, biomanufacturing of high-value recombinant proteins in plant tissues has significant potential to revolutionize modern medicines. Plant as an alternative production host is a promising technology that has an edge over conventional and more established cellular expression systems such as mammalian cells \u003csup\u003e1\u003c/sup\u003e, bacterial cells\u003csup\u003e2\u003c/sup\u003e insect cells, Chines Hamster Ovary\u003csup\u003e3\u003c/sup\u003e, etc., are the leading examples\u003csup\u003e4\u003c/sup\u003e. The plant offers more diverse and cost-effective production of high-value recombinant proteins those capable of comparable functionality with advantages of its linear scalability, robustness, sustainability, inherent safety, ease of production, lower risk of contamination, capability to produce more complex protein, and ability to perform post-translational modifications essential for a proper functional protein\u003csup\u003e4\u0026ndash;7\u003c/sup\u003e. Therapeutic proteins are routinely produced in different unicellular systems such as mammalian cell culture and bacterial fermentation which are expensive because of high input investment, require more sophisticated equipment, require high input ingredients as fermenters are costly because of high-cost media composition, and therefore, contribute to the expensive the end-user product\u003csup\u003e8\u003c/sup\u003e. This is the reason that most high-value recombinant protein drugs are not accessible to resource-less populations worldwide\u003csup\u003e9\u003c/sup\u003e. In the last three decades, a large number of biopharmaceuticals have been expressed in plant systems in various plants using transgenic\u003csup\u003e5,10\u003c/sup\u003e, transient\u003csup\u003e11\u003c/sup\u003e, transplastomic\u003csup\u003e12\u003c/sup\u003e, and plant cell culture\u003csup\u003e13\u003c/sup\u003e methods of production. However, in general, every system comes with its own advantages and disadvantages in terms of cost, scalability, safety and production speed, etc. There are numerous therapeutic proteins\u003csup\u003e7\u003c/sup\u003e, hormones\u003csup\u003e14\u003c/sup\u003e, industrial enzymes\u003csup\u003e15\u003c/sup\u003e, antibodies\u003csup\u003e16\u003c/sup\u003e, growth factors\u003csup\u003e17\u003c/sup\u003e and vaccine antigens\u003csup\u003e18\u003c/sup\u003e have been expressed using different plant production systems, showing each alternative production system with remarkable advantages. However, to achieve a higher overall protein yield, process development can be impaired by a lack of reliable and scalable extraction, proteolytic activities, and purification methods\u003csup\u003e19\u003c/sup\u003e and requires downstream and upstream processes optimization.\u003c/p\u003e \u003cp\u003eOsmotin is a 26 kDa cationic protein that also has therapeutic properties, especially because of its functional and structural homolog with mammalian adiponectin protein\u003csup\u003e20\u003c/sup\u003e. It exhibits several important functions such as antimicrobial, antifungal, neuroprotective, and neuroregenerative properties and protects against late leaf spot disease when expressed in different systems such as plants and insect cells. Osmotin is a multifunctional protein named after its induction by osmotic stress and characterized as a stress-responsive antifungal protein and belongs to pathogenesis-related (PR)-5 family. It has a pivotal role to confer the biotic as well as abiotic stress tolerance in plants, and therefore, has been over-expressed in several droughts and salt stress-related studies and exhibited protection to cells from osmotic stress by accumulating osmolyte proline and quenches ROS and free radicals\u003csup\u003e20\u003c/sup\u003e. Osmotin confer plants to sustain in adverse environmental conditions and its expression can be induced by NaCl\u003csup\u003e21\u003c/sup\u003e, ethylene\u003csup\u003e22\u003c/sup\u003e, abscisic acid\u003csup\u003e22\u003c/sup\u003e, cold\u003csup\u003e23\u003c/sup\u003e, drought\u003csup\u003e24\u003c/sup\u003e, salicyclic acid\u003csup\u003e25\u003c/sup\u003e. In addition, osmotin expression is also induced by biotic stresses such as wounding\u003csup\u003e26\u003c/sup\u003e, viral, fungal\u003csup\u003e27\u003c/sup\u003e and bacterial. However, the signaling pathway associated with osmotin induction to biotic and abiotic stresses and its mode of action remains unknown. There are several studies where osmotin and OLPs expression has been induced when plants were exposed to adverse conditions and biotic stresses demonstrating its role in protecting cells from osmotic shocks\u003csup\u003e28\u0026ndash;30\u003c/sup\u003e. Given the importance, this study explores therapeutic and stress tolerance properties through its transgenic induction in the lettuce plant.\u003c/p\u003e \u003cp\u003ePlant encounter various biotic and abiotic stresses which drastically alter their growth and development\u003csup\u003e31\u003c/sup\u003e. This stress harm plants in many ways such as disturbing cellular activities and eventually contributing to a huge reduction in overall yields\u003csup\u003e32\u003c/sup\u003e. A plant\u0026rsquo;s genetic makeup is well-programmed to sense and respond to such stresses in a more complex and integrative fashion. For example, as the first line of defense, plants activate many intracellular defense signals such as antimicrobials and pathogenesis-related (PR) proteins in response to biotic stress conditions\u003csup\u003e33\u003c/sup\u003e. PR-5 proteins can be characterized based on isoelectric point (pI) i.e., basic (osmotin), acidic (PR-S), and neutral\u003csup\u003e34\u003c/sup\u003e (osmotin-like protein-OLPs). To improve stress tolerance, several studies have shown to overexpress several genes responsible to add more resistance when plants are grown under adverse conditions.\u003c/p\u003e \u003cp\u003eProline is a multifunctional molecule in plant cells and can be found in up to 80% of a plant\u0026rsquo;s total amino acid pool during stress conditions. Taking advantage of proline function, osmotin induces its expression to respond to withstand salt or drought conditions. Once plant sense osmotic stress, the osmotin triggers proline accumulation in the cytosol and helps to detoxify ROS and free radicals\u003csup\u003e35\u003c/sup\u003e. Proline overexpression has been studied in tobacco, mulberry and tomato\u003csup\u003e28,36\u003c/sup\u003e, where proline accumulation was recorded even at lower stress tolerance.\u003c/p\u003e \u003cp\u003eThe lettuce plant is an excellent platform for the expression of functional proteins with a well-established and scalable production platform. We favored transgenic lettuce as a production host because transgenic plants are cost-effective and scalable as compared to CHO cells\u003csup\u003e37\u003c/sup\u003e. In this study, we expressed osmotin as a recombinant fusion protein in the lettuce plant with 6X His-tag and KDEL as Endoplasmic reticulum (ER) retaining signal. We have shown several factors that impacted its extraction and purification, and as result could purify target protein (\u0026gt;\u0026thinsp;90% purity) that has shown increased cell viability. The overexpression of osmotin also enhanced tolerance to abiotic stress in comparison to wild-type plants.\u003c/p\u003e \u003cp\u003ePlant-made recombinant proteins are now economically as good as established production systems, with more convincing advantages of scalability, speed of production, and product safety\u003csup\u003e7\u003c/sup\u003e. However, despite the speed of production being fascinating, downstream processing remains a unique challenge that accounts for more than 80% of production cost\u003csup\u003e5\u003c/sup\u003e. The plant can process and produce large quantities of host cell proteins and abundant particles, especially in the protein extraction step that must be separated using elaborated purification protocols. In this study, we addressed these challenges that affect the recovery of recombinant proteins by minimizing impurities during total protein extraction allowing taking more concentrated crude extracts into the purification process. The major challenges of eluting tightly bonded rOSM proteins fused to his-tag were also addressed with optimization of salt concentration and elution buffer to achieve the quantities of purified proteins.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Construct development and validation\u003c/h2\u003e \u003cp\u003eThe binary vector pBI121 was purchased commercially (Creative Biogene). DNA encoding osmotin gene (GenBank: M29279.1) was codon-optimized for higher expression in lettuce using an online bioinformatic tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.novoprolabs.com/tools/codon-optimization\u003c/span\u003e\u003cspan address=\"https://www.novoprolabs.com/tools/codon-optimization\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The sequences were fused with carboxy-terminal 6xHis followed by the endoplasmic reticulum-retention signal KDEL (Lys-Asp-Glu-Leu) was synthesized. The binary vector pBI121 was digested with XbaI/SacI restriction sites, and the OSM-His-KDEL sequences were ligated and plated on kanamycin supplemented plates until colonies were observed. The final vector pBI121-Osmo-His was transformed E. coli strain DH5-α and grown with kanamycin (50 mg/L) on LB media (NaCl 10 g/L, yeast extract 5 g/L, tryptone 5 g/L) plates and incubated overnight at 37°C. Kanamycin-resistant colonies were isolated after overnight incubation. The colonies were confirmed with colony PCR using primer sequence (forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’). The final vector pBI121-OSM-His was transformed to (Fig.\u0026nbsp;1A). The vector was transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e GV2260 with electroporation, and was incubated in LB media for two hours, and then plated on kanamycin supplemented (10 mg/L) and grown for two days at 28°C. The integration of binary vector was confirmed with colony PCR and were grown in LB media containing 10 mg/L kanamycin and was used for transformation. The correct orientation of the transgene was also confirmed by DNA sequence analysis and digestions. The PCR-positive colony was grown for two days and then cryopreserved in 25% glycerol stock, thoroughly dipped in liquid nitrogen, and then stored at -80°C.\u003c/p\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003e2.2 Plant transformation and selection\u003c/h2\u003e \u003cp\u003eThe seeds of wild-type lettuce (\u003cem\u003eLactuca sativa L.; spp. Boston\u003c/em\u003e) were used as explant for infiltration to generate transgenic lines. The seeds were sterilized by rinsing with 70% ethanol for 1 min, followed by three times incubation in 1% bleach (5 min each), and finally rinsed with autoclaved water three times (5 min each). The seeds were air-dried and placed on half-strength Murashige and Skoog (MS) media with 4 g/L phytoblend as gelatin agent and placed under light 16/8h (light/dark) photoperiod at room temperature. The plants were transformed with \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e GV2260 containing binary vector pBI121-OSM-His grown in 2 mL of LB medium containing kanamycin (100 mg/L) for selection. The agrobacterium was grown at 28°C for 14 h and then diluted (1:40) in MS medium (0.1mM acetosyringone). The seeds grown in half-strength MS media were able to generate cotyledons (5 days after seedling) and were cut to inoculate in diluted \u003cem\u003eagrobacterium\u003c/em\u003e suspension for 5 min. The cotyledons were transferred to a solid co-cultivation medium containing two hormones i.e., 1 mg/L 6-benzylaminopurin (BAP) and 0.1 mg/L 1-napthaleneacetic acid (NAA) also containing kanamycin for selection of regenerating shoots and allowed to grow for 4 weeks. The regenerating shoots were transferred to Magenta boxes containing MS medium and 50 mg/L kanamycin for root development. The plants were allowed to grow until leaf samples were collected for DNA extraction and PCR confirmation.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Nucleic acid isolation and PCR confirmation\u003c/h2\u003e \u003cp\u003eTotal plant genomic DNA was extracted from leaf tissues collected from three lines and wild-type samples. Approximately 50 mg of biomass was ground using liquid nitrogen with a motel and pestle. The extraction buffer was added included 100 mM Tris base, 100 mM NaCl, 100 mM Na2EDTA, pH = 8.5 by HCl) and % (w/v) SDS. The DNA was extracted using CTAB (cetyltrimethylammonium bromide) method following the method described by Shi et al.\u003csup\u003e10\u003c/sup\u003e Polymerase Chain Reaction (PCR) was carried out to confirm the transgene integration. The osmotin sequence-specific primers were designed using primer3 input (version 0.4.0) and synthesized primers (Integrated DNA Technologies). The primers and sequencing with primers targeting transgene OSM-His (forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’; Fig.\u0026nbsp;1A) with expected amplicon of 360 base pairs (bp). DNA extracted was used as a template (100 ng) by setting up 25 µl total volume reaction of 36 cycles with the following setting i.e., 94°C for 5 min, 94°C for 1 min, 52°C for 1.5 min, and 72°C for 1 min, final extension of 72°C for 5 min, and 4°C as end temperature for unlimited time. The samples were also included with positive (plasmid DNA) and negative (wild-type DNA and water) controls. The amplified PCR product was resolved with 1% SDS gel electrophoresis using agarose as a gelating agent. The SDS-PAGE was run at 90 V for 30 min and was analyzed under UV light to confirm the expected 360 bp amplicon. The positive plants were grown in a greenhouse and were self-pollinated to obtain T\u003csub\u003e1\u003c/sub\u003e generation and were utilized for all analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Regeneration and selection of transgenic lines on media\u003c/h2\u003e \u003cp\u003eThe seeds obtained from T\u003csub\u003e1\u003c/sub\u003e transgenic lines were washed again as described in section 1.2. The seeds were grown on MS media (half strength) with 100 mg/L kanamycin for selection. The regenerated tissues were analysed with PCR and western blot analysis for transgene and recombinant protein expression. Three generations were studied for this study for the expression of recombinant osmotin in lettuce plants.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Recombinant protein extraction and purification\u003c/h2\u003e \u003cp\u003eThe leaf tissues collected from transgenic lettuce lines (500 mg) were subjected to total protein extraction. The leaf tissues were grind using liquid nitrogen and were added with extraction buffer comprised of 150 mM NaCl, 10 mM EDTA, 150 mM Tris, SDS 0.5%, Protein inhibition cocktail [1:100], at pH 7.4. in 1:4 ratio to leaf tissues. The samples were included at 4°C for 30 min with continuous shaking. The samples were then filtered with cheesecloth and centrifuged at 10000 g for 10 min at 4°C. The supernatant was collected in a new Eppendorf tube and used for western blot and ELISA analysis.\u003c/p\u003e \u003cp\u003eTo purify the recombinant proteins, the lettuce leaf tissues were ground in liquid nitrogen and then were added to the extraction buffer as described at a ratio of 1:4 (g/mL). The samples were incubated at 4°C for 30 min and then centrifuged at 10,000 g for 1 h at 4°C. The supernatant was moved to a new tube and then filtered with 0.22 µm filter syringe. For his-tagged proteins, we used His GraviTrap™ TALON\u003csup\u003e®\u003c/sup\u003e columns prepacked with 1 ml of TALON\u003csup\u003e®\u003c/sup\u003e Superflow medium (Sigma Aldrich, product GE29-0005-94) to capture the his-tagged recombinant osmotin protein. As recommended by the manufacturer, we equilibrated the column with binding buffer (50 mM NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 300 mM NaCl, pH 7.4) and loaded the lettuce plant extracts. The column was washed with 10 volumes of washing buffer (50 mM NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 300 mM NaCl, 5 mM imidazole, pH 7.4). The rOSM was eluted using elution buffer (50 mM NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 300 mM NaCl, 150 mM imidazole, pH 7.4). SDS-PAGE and Western blot were performed for all fractions and then the elution fraction was concentrated using Amicon Ultra centrifugal filters, then stored at -80°C. We used Bradford assay and ELISA to confirm the quantitation of purified proteins.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Quantification of total soluble proteins\u003c/h2\u003e \u003cp\u003eThe total soluble protein (TSP) concentration of the extracts was determined by Bradford assay following standard protocol using bovine serum albumin (BSA) as a standard, and TSP from WT as a negative control. A standard curve was generated using BSA ranging from 0.05–0.8 mg/ml recorded at 595 nm using spectrophotometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 SDS-PAGE and western blot analysis\u003c/h2\u003e \u003cp\u003eThe total protein extracted from transgenic lines was added with 2-marcapthoethanol and 10 µl of loading dye and incubated at 70°C for 15 min. The samples were then cooled down and short spin before loading. A total of 40µl was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for molecular-sized based separation of proteins using 8% gradient gel. The SDS-PAGE was carried out using electrophoresis at 90 V for 50 min. The well-separated gels were transferred to 0.45 µm nitrocellulose membrane at 80 V for 1 hour. The membrane was washed thoroughly with distilled water and then incubated with PBS-T containing 5% skimmed milk for 30 min. The membrane was then incubated with primate antibody mouse anti-His (dilution of 1:1000) overnight at 4°C with continuous shaking. The blot was then washed three times with PBST at 5 min intervals and then was incubated with goat-anti-mouse-IgG-HRP (sigma Aldrich 12–349) diluted 1/10,000, as a secondary antibody in PBST containing 5% skimmed milk for one hour. The membrane was then washed three times with PBST and was added with TMB stabilized substrate (500 µl each) and was visualized with chemiluminescence of ChemiDoc™ MP Imaging System.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 ELISA quantification of plant-produced recombinant osmotin\u003c/h2\u003e \u003cp\u003eEnzyme-linked immunosorbent assay (ELISA) quantification was conducted to estimate the total recombinant proteins expressed in transgenic lettuce leaves. The immunlon 2HB 96-well plate was coated with 100µl capture antibody (Goat anti-HisTag) diluted in 1:500 in 1xPBS and incubated at 4°C overnight. The plate was washed three times with 200µl/well of PBS-T (5 min each). The wells were blocked for 1 hour at 37°C with a blocking solution (5% nonfat dry milk in PBS). The plate was washed three times with PBS-T for 5 min. The wells were added 100 µl per well of serial dilution and purified osmotin standard with different dilutions and incubated for 1 hour at 37°C. The plates were washed three times for 5 min with PBS-T. 100µl of Mouse anti-His antibody, dilution (1:1000) and secondary antibody (Goat-anti-mouse-HRP) dilution 1:1500 in PBS with 5% skimmed milk and incubated for 1 hour at 37°C. The plates were washed again three times for 5 min with 200 µl PBS-T. A volume of 100 µl per well was added with microplate colorimetric TMB substrate and incubated for 10 min or until sufficient color has developed. The wells were added with 100 µl 1N HCl to stop the reaction. The reading was recorded using microplate reader at 450 nm absorbance. All incubations were carried out with 100 µl unless otherwise noted. ELISA was performed in triplicate, and standard protein concentrations were interpolated from the linear portion of the standard curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9Antifungal activity\u003c/h2\u003e \u003cp\u003eThe purified rOSM were treated in different amount to two yeast strains of human pathogens i.e., the spores of \u003cem\u003eCandida albicans\u003c/em\u003e (1 × 103/100 µl) and \u003cem\u003eCryptococcus neoformans\u003c/em\u003e (1 × 103/100 µl) were added into 96 well plate (in triplicate) and incubated for 48 hrs at 30°C. The strains were diluted with YPAD medium (2% glucose, 1% yeast extracts, 0.02% adenine, and 3% peptone) before adding to 96-well-plate. The spores were treated/added with different concentrations of purified recombinant protein and incubated for two days (48 hrs) with a final volume of 200 µl. The growth/optical density of the two strains was recorded at OD\u003csub\u003e650\u003c/sub\u003e using a microplate reader to calculate the growth inhibitory activity of the protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Survival, germination and electrolyte leakage assay\u003c/h2\u003e \u003cp\u003eFor survival and electrolyte leakage assays under salt stress, lettuce seeds were germinated and grown for 14 days. The seedlings were watered with NaCl of the final concentration of 50, 100, and 200 mM for one week, followed by recovery growth with no addition of NaCl for one week. The survival rate was recorded by visually overserving seedlings that either remained green leaves or regenerated new leaves. Meanwhile, electrolyte leakage assay was also conducted for plants that survived as previously described by Shi, et. al. (2020). For germination assay under salt stress, seeds were germinated in ½ MS medium containing NaCl of the final concentration of 50, 100, and 200 mM for 10 days. The number of germinating seedlings was counted and recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Estimation of proline\u003c/h2\u003e \u003cp\u003eConcentrations of proline in lettuce leaf tissues were analyzed by ninhydrin-based colorimetric assay. Leaf biomass of 1 g was ground with 3% sulfosalicylic acid at a ratio of 1:10, followed by centrifuges at 4000 rpm for 3 min at RT. A reaction mixture was prepared that contained 3% sulfosalicylic acid, glacial acetic acid, and acidic ninhydrin, and 100 µl of supernatant was added. The tubes were vortexed before incubating at 96°C for 1 hour. The reaction was stopped by placing the tube on ice. A volume of 1 ml toluene was added to reaction mix, vortexed briefly and allowed for 5 min to separate the organic and water phases, and the chromophore phase containing toluene was analyzed by reading the absorbance at 520 nm using microplate-reader. The standard curve was prepared using toluene as standard.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e \u003cp\u003eEach assay was repeated at least three times for all experiments. Data was presented as mean ± standard deviation (SD), And statistical significance was determined by student \u003cem\u003et-test\u003c/em\u003e with \u003cem\u003ep\u003c/em\u003e-value less than 0.05.\u003c/p\u003e \u003c/div\u003e "},{"header":"3. Results","content":"\u003cp\u003e \u003cb\u003e3.1 Creation and characterization of transgenic lettuce expressing recombinant Osmotin.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eThe expression vector, promotor, purification tags, regulatory elements, protein targeting, choice of plant, and transformation conditions always require prior planning and optimization. We have created lettuce transgenic lines (three independent lines) able to express the rOSM in leaf tissues (Fig.\u0026nbsp;1C), and integrated osmotin without codon optimization (one independent line) for expressional analysis (Fig.\u0026nbsp;2C). After vector construction, the agrobacterium pBI121 carrying OSM-His-KDEL were able to successfully integrate the transgene and created three independent transgenic events for codon and one for non-codon optimized osmotin expression. The PCR was carried out to confirm the integrity of transgene in each independent line by using forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’. All four transgenic events were confirmed with an expected amplicon of 360 bp (Fig.\u0026nbsp;1B). The plants expected to express the recombinant proteins were transferred to Magenta boxes containing an equal amount of selection (100 mg/L of kanamycin) and then transferred to the greenhouse after roots were developed. The plants were grown in the greenhouse and were fertile to produce \u0026gt; 2000 seeds per plant.\u003c/p\u003e\u003cp\u003eThe extraction of TSP from plant tissues is the first step of downstream processing. The overall goal of this process is to extract recombinant proteins in an aqueous buffer environment to protect their functionality. To achieve the most suitable extraction buffer and conditions, we analyzed the impact of pH, Tween-20, protease inhibition cocktail (PIC), and ultrasonication on rOSM recovery from lettuce leaf crude extracts. The plant tissues collected from each transgenic line were subjected to total protein extraction and were confirmed with Western blot analysis and the protein size of ~ 30 kDa was detected in all lettuce lines (Fig.\u0026nbsp;1C). T\u003csub\u003e1\u003c/sub\u003e seeds were also grown half-strength MS media supplemented with 100 mg/L kanamycin showed 100% germination in comparison to wild-type seeds which were able to regenerate 10–15% in the first 5 days, however, those also dried 10 days after sowing. All independent transgenic events confirmed its selection by expression of nptII genes confers kanamycin resistance. The plants were phenotypically similar in plant growth and development to wild-type plants and also potent to generate \u0026gt; 500 T\u003csub\u003e1\u003c/sub\u003e seeds from each independent line.\u003c/p\u003e\u003cp\u003e \u003cb\u003e3.2 Expression increased over time and generations.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eThe confirmation of homozygosity is important to utilize transgenic lines for different investigations. Therefore, to confirm the integration of transgene into subsequent generations, we investigated the expression of rOSM in three generations. All the generations were able to regenerate on half strength MS media with kanamycin (100 mg/L) confirming the integration of the selection maker in all three generations. Further, DNA extracted from all generations was also confirmed with PCR using primers (forward primer: 5’- atcgaggtccgaaacaactg − 3’; reverse primer: 5’- tagatttctgggacatttct − 3’; and the expected 360 bp band was amplified (Fig.\u0026nbsp;1B). Also, more importantly, we confirmed the expression of rOSM in all generations. The total protein extracted from leaf tissues was analyzed with western blot for confirmation of recombinant osmotin expression. The protein band of ~ 30 kDa band was observed in all three generations showing that all generations carry on the expression. Also, to find out whether the expression increases or decreases over generations, we performed ELISA-based quantitation using antibodies specific to His-tag. The ELISA analysis revealed that expression is increasing from T\u003csub\u003e1\u003c/sub\u003e to T\u003csub\u003e3\u003c/sub\u003e exhibiting an ascending pattern of protein expression (Fig.\u0026nbsp;2B). We also performed ELISA quantitation for plant tissues collected from lettuce over different time periods i.e., 10, 20, 40, 60, 80 and 100 days after generation (Fig.\u0026nbsp;1D). We observed that plants can accumulate rOSM, and showed an increased expressional pattern from 10–80 DAG, with a maximum expression of 127 mg/kg fresh weight (FW), however, the expression decreased at 100 DAG i.e., 80.6 mg/kg FW (Fig.\u0026nbsp;1D). For each analysis, the whole plant was collected and homogenized for quantitation. A time point increase in expression of osmotin-His was observed, where plants expressed at day 80 were almost three times of proteins at day 10 (Fig.\u0026nbsp;2A).\u003c/p\u003e\u003cp\u003e \u003cb\u003e3.3 Protein extraction and codon optimization enhanced the total soluble protein recovery and expression of the recombinant protein.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eTo achieve a higher level of expression in lettuce plants, osmotin sequences were codon-optimized, where rare codons were replaced with preferred ones for higher expression in lettuce. The optimization and usage of preferred codons have been reported earlier in several publications to enhance protein translation by increasing mRNA stability and allowing tRNA to accommodate the tRNA pool in host cells\u003csup\u003e38\u003c/sup\u003e. After codon optimization, 98 of total 245 codons were optimized by replacement with more preferred codons using \u003cem\u003eNicotiana benthamiana\u003c/em\u003e as the codon usage host (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The osmotin sequence optimized for expression in lettuce has been shown to effectively increase recombinant protein expression in leaf tissues. An ELISA-based quantitation with anti-His antibodies showed higher intensity of rOSM for optimized sequences indicating that the codon optimization system is effective in enhancing its expression (Fig.\u0026nbsp;2C).\u003c/p\u003e\u003cp\u003eAn efficient extraction protocol is critical for extracting all recombinant proteins produced in plant tissues in order to achieve a higher overall yield. We also considered the possibility that rOSM-his recovery is difficult due to intrinsically disordered characteristics of plant material, we also investigated the impact of surfactant i.e., tween-20, protein inhibition cocktail, and ultrasonication on protein extraction using the highest expressional line LS-rOSM-10. The TSP and target protein concentration in the crude extracts were evaluated with Bradford assays and ELISA, respectively. The total soluble proteins were extracted with and without tween-20. The addition of tween-20 had a significant impact on extracting total proteins. The Bradford assay data showed that the addition of 1% (v/v) tween-20 enhanced the extraction of TSP up to 2 folds (Fig.\u0026nbsp;3A). Tween-20 helped to degrade the lipid biolayer and break down all cellular organelles including ER, and therefore the ER targeted Osmotin could be extracted into an extraction buffer. The addition of tween-20 was also validated with western blot showing higher recovery of target protein. The impact of ultrasonication of plant extracts was also evaluated. Ultrasonication has been used in several studies where it could enhance TPS recovery. Therefore, we analyzed ultrasonication on TSP and found that 5s to 10s (5s on, 10s off) have a positive impact on total protein extraction up to two rounds. The further sonication for the third and fourth rounds negatively impacted the extraction of TSP, and we observed a decline in TSP (Fig.\u0026nbsp;3B). Ultrasonication generates a considerable amount of heat, and therefore, we kept our samples on ice while ultrasonication to avoid the heat that can possibly degrade proteins. Also, the impact of PIC has been demonstrated in several studies that help recombinant proteins avoid degradation. We analyzed the addition of PIC in the extraction buffer in a 1:100 ratio and compared it to the extraction buffer with no PIC added. The addition of PIC in the extraction buffer had no impact on the recovery of TSP and observed the same amount in the absence. Keeping in view the data obtained from these variables, we developed a procedure for protein extraction and then confirmed the results with ELISA-based quantitation. We observed that the maximum TSP proteins had a positive correlation with the highest expression of rOSM in lettuce samples.\u003c/p\u003e\u003ch2\u003e3.4 Recombinant Osmotin was degraded after incubating plant extract at 4°C\u003c/h2\u003e\u003cp\u003eThe stability of recombinant proteins is more important, especially for low-level expressing proteins. Transgenic plants have relatively lower expression in transient, chloroplast, or cell culture-based systems, and therefore it is crucial to minimize the loss of proteins during downstream processing. We, therefore, observed our protein stability in plant extract after shaking incubation at 4°C for 24 hours, without shaking. We observe a decline in protein expression after 4 hours when proteins started degrading. The peak degradation was observed 20 hours after incubation at 4°C (Fig.\u0026nbsp;3C). We also excluded the possibility of no PIC on protein protection over longer periods. Therefore, we added PIC with a 1:100 ratio to the extraction buffer to study protein degradation over a longer period. However, we observed an equal amount of degradation, comparable to extraction buffer without PIC (data not shown).\u003c/p\u003e\u003ch2\u003e3.5 Recombinant Osmotin was purified from lettuce leaf tissue\u003c/h2\u003e\u003cp\u003eThe maximum recovery of total proteins was achieved by optimizing extraction conditions and then confirmed our hypothesis of higher total protein content will have higher rOSM with ELISA. The leaf extracts were used for manual purification of Histidine-tagged-OSM using His GraviTrap™ TALON® Columns Nickel-nitrilotriacetic (Sigma Aldrich). Every fraction was subjected to TSP analysis with Bradford analysis to observe the protein recovery. To find out the purity, we did the densitometric analysis using ImageJ software of the blot and achieved \u0026gt; 90% purity. We also loaded the purified in exceeding amounts up to 15 µg, however could see no degradation based on SDS-PAGE and western blot.\u003c/p\u003e\u003ch2\u003e3.6 Lettuce-made recombinant Osmotin inhibits fungal growth\u003c/h2\u003e\u003cp\u003eTo evaluate the inhibitory effect of rOSM, we considered two yeast strains of human pathogens i.e., \u003cem\u003eCandida albicans\u003c/em\u003e and \u003cem\u003eCryptococcus neoformans.\u003c/em\u003e The purified rOSM proteins were added in 0.5, 1.0, 1.5 and 2.0 µM concentrations. As shown in Fig.\u0026nbsp;4, purified rOSM had a significant inhibitory activity for both \u003cem\u003eCandida albicans\u003c/em\u003e and \u003cem\u003eCryptococcus neoformans\u003c/em\u003e. The highest amount of 2.0 µM concentration of rOSM inhibited the growth of fungal species to 22% and 13% for \u003cem\u003eCandida albicans\u003c/em\u003e and \u003cem\u003eCryptococcus neoformans\u003c/em\u003e, respectively.\u003c/p\u003e\u003ch2\u003e3.7 Osmotin expression in lettuce improves stress tolerance, and proline contents\u003c/h2\u003e\u003cp\u003eTo test whether compartmentalization of Osmotin accumulation in lettuce seed endosperm improves seedling salt tolerance, we challenged T\u003csub\u003e3\u003c/sub\u003e transgenic lettuce seedlings with salt in different concentrations. We did not observe a significant difference between wild type and transgenic lines in survival rate under 100mM and 200mM salt stress conditions (Fig.\u0026nbsp;5A). Similarly, the electrolyte leakage levels in leaves of LS-rOSM-7 and LS-rOSM-10 plants that survived salt stress were slightly, but not significantly, lower compared to WT (Fig.\u0026nbsp;5C), indicating slightly better cell protection due to rOSM expression in transgenic lines. However, the germination rate of LS-rOSM-7 and LS-rOSM-10 seeds was significantly increased compared to wild-type under 100 and 200 mM NaCl salt stress, indicating a markedly improved salt stress tolerance specifically in transgenic lettuce leaf expressing rOSM (Fig.\u0026nbsp;5B). Because of a generally better performance of LS-rOSM-10 in the abovementioned aspects, we used this line for all downstream processing.\u003c/p\u003e\u003cp\u003eWe also estimated the proline contents in the leaf tissues after exposure to a maximum concentration of 200 mM NaCl. Proline is the major contributor to resistance against adverse conditions by overexpressing under stress conditions. We observed a sharp increase in proline contents when both LS-rOSM-7 and LS-rOSM-10 were exposed to salt stress. There was an increase of 57.1% and 67.6% increase in proline contents for LS-rOSM-7 and LS-rOSM-10, respectively (Fig.\u0026nbsp;5D).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003ePlant molecular farming (PMF) has great potential as a production host of biopharmaceutical proteins including growth factors, therapeutics, vaccines, nutraceuticals, and enzymes\u003csup\u003e4\u003c/sup\u003e. An increase in PMF research was observed right after Covid-19 pandemic which dragged the world to a complete halt and was also responsible for the ongoing human health crisis. The need for a scalable and rapid bioproduction system mounted and in response, numerous research groups and industries initiated massive research using various plant systems for the production of vaccine antigen, diagnostic reagents, and antiviral drugs needed worldwide. An industry such as Medicago initiated research on plant-made vaccine antigen using \u003cem\u003eNicotiana benthamiana\u003c/em\u003e as a production host and successfully the completed third phase of clinical trials\u003csup\u003e18,39\u003c/sup\u003e, and ultimately received regulatory approval from Health Canada. Therefore, we initiated this study to produce biopharmaceuticals to follow the same regulatory pathway to take plant-made products to the market. We are using lettuce as an expression host because it has GRAS status for production and therefore has been the host for a variety of biopharmaceuticals in numerous studies up to date\u003csup\u003e40\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eWe utilized lettuce leaf plant tissues as bioreactors for the production of rOSM because transgenic plants are a cost-effective production choice compared to CHO cells\u003csup\u003e8,41,42\u003c/sup\u003e, and more importantly a part of our investigation to explore the possibility of its oral delivery. Our results were encouraging that lettuce can correctly process this protein and can accumulate in ER without loss of functionality and are in line with previous publications\u003csup\u003e43,44\u003c/sup\u003e. We investigated the downstream processing for rOSM to achieve the highest amount of protein yield by investigating several total protein extractions and purification conditions. Following successful expression and its characterization, we considered the possibility of intrinsically disordered properties of rOSM that could lead to exposed hydrophobic patches that interact with cell debris and cause protein loss during extraction. We considered Tween-20 helps to halt the hydrophobic interactions in plant extract and disorganize the membrane’s lipid bilayer and solubilize the proteins targeted into different organelles such as ER, chloroplast, vacuole, etc. In this study, we designed our construct with the addition of the C-terminal His-tag, and the KDEL motif as a strategy to achieve higher expression. We achieved two objectives: the detection of the target protein and utilization as a purification tag by incorporating His-tag sequences by gravity flow purification column. As osmotin sequences were added to SEKDEL, they targeted our recombinant proteins to ER. The addition of tween-20, therefore, helped to break cellular organelles and extract osmotin targeted into the ER and increased rOSM recovery. The darkening in green color was also observed with the addition of tween-20 was due to disruption of organelles including chloroplast, and therefore exhibited green color. We also observed that recovery was drastically reduced protein recovery at high concentrations probably due to adverse impact on protein stability or could lead to protein degradation at higher concentrations. We also determined whether incubation of plant extraction has any impact on protein stability. Our data shows that a longer incubation time decreases the number of recombinant proteins. This is a crucial finding because if the downstream processing is scaled up, the longer processing time will negatively impact the recombinant protein recovery. However, we also speculate that protein stability may be protein-dependent, and therefore should be evaluated for every protein of interest.\u003c/p\u003e\u003cp\u003eWe also purified recombinant osmotin from lettuce leaf biomass using 6x His-tag sequences which has been used in several studies as a cost-effective method for purification from plant tissues \u003csup\u003e45\u003c/sup\u003e. As we attached His-tag to the C-terminal of the protein, it helped to purify using gravity flow columns in a more convenient manner. The rOSM was eluted using the elution buffer recommended by the manufacturer. By observing SDS-PAGE and western blot images, we were able to elute the desired protein without observing any degradation. We performed ELISA-based quantitation for crude extracts and purified proteins and then stored them at -80°C for further experimentation. The purified proteins were also concentrated and total rOSM proteins were estimated. We used the highest expression line LS-rOSM-12 for all purifications and all experimentation for process optimization.\u003c/p\u003e\u003cp\u003ePrevious studies extensively reported biotic and abiotic resistant functions of osmotin and its homologous in a variety of plants\u003csup\u003e46,47\u003c/sup\u003e. In addition, osmotin has been speculated to be involved in several etiological pathways of mammalian diseases by potentially functioning as an agonist of adiponectin, a multi-functional mammalian hormone produced in adipose tissues\u003csup\u003e20\u003c/sup\u003e. Their structural and functional similarities were experimentally evaluated by multiple \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e studies. However, this study represents the first case of lettuce stable transgenic lines expressing rOSM, those were also purified from leaf tissues. Osmotin is an antifungal protein belonging to pathogenesis-related (PR)-5 family. We also report the diverse functions of rOSM with our results which showed significant antifungal activity against two human pathogen strains \u003cem\u003eCandida albicans\u003c/em\u003e and \u003cem\u003eCryptococcus neoformans\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eInterestingly, we found that expression of rOSM in transgenic lettuce plants significantly increased in salt-induced conditions when compared to WT plants both with irrigation with 200 mM NaCl and seed germination assay. This result is consistent with a previous result showing GUS activity driven by promoters of 15 endosperm-specific genes was accumulated in rice seeds, among which only three promoters (AGPase, PPDK, and 10 KDa prolamin) activated GUS expressions in transgenic rice root and other tissues\u003csup\u003e48\u003c/sup\u003e. Thus, these suggest that the \u003cem\u003e35s constitutive\u003c/em\u003e promoter activated adequate expression of recombinant osmotin in lettuce plants, leading to significant improvement in salt stress tolerance during plant growth and development. However, the potentially weak ectopic expression of osmotin in root and other tissues was not enough to cause significant and systemic phenotypic changes in transgenic lettuce plants under salt stress. In addition. An amino acid, proline, plays a vital role in protecting plants from adverse conditions and helps to overcome stress more rapidly. Therefore, when plants are exposed to stress conditions, there is an increase in proline contents and other physiological characteristics of plants are observed. When rOSM transgenic lines were exposed to salt stress of maximum of 200 mM, there was a sharp growth in proline contents was observed, and the plants containing more rOSM were able to recover faster than the control wild-type lettuce plants. This concludes our hypothesis on a positive note that rOSM containing plants are more resistant to salt stress.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eOsmotin is an important multi-functional plant protein widely distributed in fruits and vegetables. We successfully generated transgenic lines expressing functional rOSM in lettuce and also investigated strategies both for achieving higher expression by codon optimization and ER targeting, and purification by using ultra-sonication, PIC, and Tween-20. rOSM extraction and its purification were challenging due to its instability in crude extracts. We have described a simplified and convenient method of downstream processing for purifying rOSM from lettuce leaf tissues by considering factors that can potentially enhance its extraction and purification. This study shows that by amendment to standard techniques during extraction and purification, product recovery can be improved. The purified protein also exhibited antifungal activities showing the functionality of our purified proteins. This study also concludes that rOSM expression makes lettuce plants more versatile to exhibit salt stress by increasing proline contents and higher germination ratio in stress conditions. The data of this study indicates that lettuce tissues are a promising system to express Osmotin and can be utilized for the production of biopharmaceuticals.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eWe declare that all the experimental research and field studies on plants (either cultivated or wild), including the collection of plant material comply with relevant institutional, national, and international guidelines and legislation of \u0026nbsp;IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Convention on the Trade in Endangered Species of Wild Fauna and Flora.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor consideration for publication, we provide the following statements:\u003c/p\u003e\n\u003col start=\"1\" type=\"I\"\u003e\n \u003cli\u003eAll authors listed in this submission have agreed with the publication of this manuscript.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eThe authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/li\u003e\n \u003cli\u003eI confirm that this work is original and has not been published elsewhere, nor is it currently under consideration for publication elsewhere. And it will not be published elsewhere within one year after its publication in this journal\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eAll authors have no conflicts of interest to report.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eThis manuscript contained no human study.\u003c/li\u003e\n\u003c/ol\u003e\u003ch3\u003eConflict of Interest\u003c/h3\u003e\n\u003cp\u003eThe authors declare no competing financial interests.\u003c/p\u003e\n\u003ch3\u003eAuthors\u0026rsquo; Contributions\u003c/h3\u003e\n\u003cp\u003eT.N., carried out experiments, performed ELISA, performed downstream experiments, defined purity and performed western blots. U. K., and S.F., carried out experiments, developed transgenic plants and wrote sections of manuscript, A.T., coordinated the project, performed purification and stress analysis and interpreted data. IK., formulated hypotheses, designed experiments, wrote the manuscript, analyzed data, and communicated the manuscript, S.F.\u0026nbsp;revised the manuscript, proof reading of the manuscripts. All authors discussed the results, commented on the manuscript, and approved its submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by Researcher\u0026rsquo;s Supporting Project number RSP2024R134, King Saud University, Riyadh, Saudi Arabia.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published in figshare 10.6084/m9.figshare.25289872\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eLalonde, M. E. \u0026amp; Durocher, Y. Therapeutic glycoprotein production in mammalian cells. \u003cem\u003eJ Biotechnol\u003c/em\u003e \u003cstrong\u003e251\u003c/strong\u003e, 128-140 (2017). https://doi.org/10.1016/j.jbiotec.2017.04.028\u003c/li\u003e\n \u003cli\u003eShiloach, J. \u0026amp; Fass, R. Growing E. coli to high cell density--a historical perspective on method development. \u003cem\u003eBiotechnol Adv\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 345-357 (2005). https://doi.org/10.1016/j.biotechadv.2005.04.004\u003c/li\u003e\n \u003cli\u003eLi, W., Fan, Z., Lin, Y. \u0026amp; Wang, T.-Y. Serum-Free Medium for Recombinant Protein Expression in Chinese Hamster Ovary Cells. \u003cem\u003eFrontiers in Bioengineering and Biotechnology\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e (2021). https://doi.org/10.3389/fbioe.2021.646363\u003c/li\u003e\n \u003cli\u003eSchillberg, S. \u0026amp; Finnern, R. Plant molecular farming for the production of valuable proteins - Critical evaluation of achievements and future challenges. \u003cem\u003eJ Plant Physiol\u003c/em\u003e \u003cstrong\u003e258-259\u003c/strong\u003e, 153359 (2021). https://doi.org/10.1016/j.jplph.2020.153359\u003c/li\u003e\n \u003cli\u003eKhan, I., Twyman, R. M., Arcalis, E. \u0026amp; Stoger, E. Using storage organelles for the accumulation and encapsulation of recombinant proteins. \u003cem\u003eBiotechnol J\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1099-1108 (2012). https://doi.org/10.1002/biot.201100089\u003c/li\u003e\n \u003cli\u003eHabibi, P., Shi, Y., Fatima Grossi-de-Sa, M. \u0026amp; Khan, I. Plants as Sources of Natural and Recombinant Antimalaria Agents. \u003cem\u003eMolecular Biotechnology\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 1177-1197 (2022). https://doi.org/10.1007/s12033-022-00499-9\u003c/li\u003e\n \u003cli\u003eFischer, R. \u0026amp; Buyel, J. F. Molecular farming - The slope of enlightenment. \u003cem\u003eBiotechnol Adv\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 107519 (2020). https://doi.org/10.1016/j.biotechadv.2020.107519\u003c/li\u003e\n \u003cli\u003eSchillberg, E.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Reply to Comment on \u0026quot;Distribution of Ixodes scapularis in Northwestern Ontario: Results from Active and Passive Surveillance Activities in the Northwestern Health Unit Catchment Area\u0026quot;. \u003cem\u003eInt J Environ Res Public Health\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e (2019). https://doi.org/10.3390/ijerph16112058\u003c/li\u003e\n \u003cli\u003eTsekoa, T. L., Singh, A. A. \u0026amp; Buthelezi, S. G. Molecular farming for therapies and vaccines in Africa. \u003cem\u003eCurr Opin Biotechnol\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, 89-95 (2020). https://doi.org/10.1016/j.copbio.2019.11.005\u003c/li\u003e\n \u003cli\u003eShi, Y.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Seed-Based System for Cost-Effective Production of Vaccine Against Chronic Respiratory Disease in Chickens. \u003cem\u003eMolecular Biotechnology\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 570-580 (2023). https://doi.org/10.1007/s12033-022-00554-5\u003c/li\u003e\n \u003cli\u003eAlkanaimsh, S.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Transient Expression of Tetrameric Recombinant Human Butyrylcholinesterase in Nicotiana benthamiana. \u003cem\u003eFront Plant Sci\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 743 (2016). https://doi.org/10.3389/fpls.2016.00743\u003c/li\u003e\n \u003cli\u003eBerecz, B., Zelenyanszki, H., Polya, S., Tamas-Nyitrai, C. \u0026amp; Oszvald, M. Plastid Molecular Pharming I. Production of Oral Vaccines via Plastid Transformation. \u003cem\u003eMini Rev Med Chem\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1292-1315 (2017). https://doi.org/10.2174/1389557516666161004161801\u003c/li\u003e\n \u003cli\u003eHolland, T. \u0026amp; Buyel, J. F. Bioreactor-Based Production of Glycoproteins in Plant Cell Suspension Cultures. \u003cem\u003eMethods Mol Biol\u003c/em\u003e \u003cstrong\u003e1674\u003c/strong\u003e, 129-146 (2018). https://doi.org/10.1007/978-1-4939-7312-5_11\u003c/li\u003e\n \u003cli\u003eStoger, E., Ma, J. K., Fischer, R. \u0026amp; Christou, P. Sowing the seeds of success: pharmaceutical proteins from plants. \u003cem\u003eCurr Opin Biotechnol\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 167-173 (2005). https://doi.org/10.1016/j.copbio.2005.01.005\u003c/li\u003e\n \u003cli\u003eGuan, C.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Expression of cholera toxin B subunit-lumbrokinase in edible sunflower seeds-the use of transmucosal carrier to enhance its fusion protein\u0026apos;s effect on protection of rats and mice against thrombosis. \u003cem\u003eBiotechnol Prog\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 1029-1039 (2014). https://doi.org/10.1002/btpr.1963\u003c/li\u003e\n \u003cli\u003eStrasser, R.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Improved virus neutralization by plant-produced anti-HIV antibodies with a homogeneous beta1,4-galactosylated N-glycan profile. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e284\u003c/strong\u003e, 20479-20485 (2009). https://doi.org/10.1074/jbc.M109.014126\u003c/li\u003e\n \u003cli\u003eDing, S. H., Huang, L. Y., Wang, Y. D., Sun, H. C. \u0026amp; Xiang, Z. H. High-level expression of basic fibroblast growth factor in transgenic soybean seeds and characterization of its biological activity. \u003cem\u003eBiotechnol Lett\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 869-875 (2006). https://doi.org/10.1007/s10529-006-9018-6\u003c/li\u003e\n \u003cli\u003eWard, B. J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Efficacy, immunogenicity, and safety of a plant-derived, quadrivalent, virus-like particle influenza vaccine in adults (18-64 years) and older adults (\u0026gt;/=65 years): two multicentre, randomised phase 3 trials. \u003cem\u003eLancet\u003c/em\u003e \u003cstrong\u003e396\u003c/strong\u003e, 1491-1503 (2020). https://doi.org/10.1016/S0140-6736(20)32014-6\u003c/li\u003e\n \u003cli\u003eMandal, M. K., Ahvari, H., Schillberg, S. \u0026amp; Schiermeyer, A. Tackling Unwanted Proteolysis in Plant Production Hosts Used for Molecular Farming. \u003cem\u003eFront Plant Sci\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 267 (2016). https://doi.org/10.3389/fpls.2016.00267\u003c/li\u003e\n \u003cli\u003eAnil Kumar, S., Hima Kumari, P., Shravan Kumar, G., Mohanalatha, C. \u0026amp; Kavi Kishor, P. B. Osmotin: a plant sentinel and a possible agonist of mammalian adiponectin. \u003cem\u003eFront Plant Sci\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 163 (2015). https://doi.org/10.3389/fpls.2015.00163\u003c/li\u003e\n \u003cli\u003eSokhansanj, A., Sadat Noori, S. A. \u0026amp; Niknam, V. Comparison of bacterial and plant genes participating in proline biosynthesis with Osmotin gene, with respect to enhancing salinity tolerance of transgenic tobacco plants. \u003cem\u003eRussian Journal of Plant Physiology\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 110-115 (2006). https://doi.org/10.1134/S1021443706010146\u003c/li\u003e\n \u003cli\u003eZhu, B., Chen, T. H. \u0026amp; Li, P. H. Expression of an ABA-responsive osmotin-like gene during the induction of freezing tolerance in Solanum commersonii. \u003cem\u003ePlant Mol Biol\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 729-735 (1993). https://doi.org/10.1007/BF00014558\u003c/li\u003e\n \u003cli\u003eNewton, S. S. \u0026amp; Duman, J. G. An osmotin-like cryoprotective protein from the bittersweet nightshade Solanum dulcamara. \u003cem\u003ePlant Mol Biol\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 581-589 (2000). https://doi.org/10.1023/a:1026599028063\u003c/li\u003e\n \u003cli\u003eParkhi, V.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Expression of apoplastically secreted tobacco osmotin in cotton confers drought tolerance. \u003cem\u003eMolecular Breeding\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 625-639 (2009).\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eKim, M. Y.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Plant-expressed Fc-fusion protein tetravalent dengue vaccine with inherent adjuvant properties. \u003cem\u003ePlant Biotechnol J\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 1283-1294 (2018). https://doi.org/10.1111/pbi.12869\u003c/li\u003e\n \u003cli\u003eZhu, B., Chen, T. H. \u0026amp; Li, P. H. Expression of three osmotin-like protein genes in response to osmotic stress and fungal infection in potato. \u003cem\u003ePlant Mol Biol\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 17-26 (1995). https://doi.org/10.1007/BF00042034\u003c/li\u003e\n \u003cli\u003eTzou, Y. M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Expression of truncated tobacco osmotin in Escherichia coli: purification and antifungal activity. \u003cem\u003eBiotechnol Lett\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, 539-543 (2011). https://doi.org/10.1007/s10529-010-0453-z\u003c/li\u003e\n \u003cli\u003eDas, M., Chauhan, H., Chhibbar, A., Rizwanul Haq, Q. M. \u0026amp; Khurana, P. High-efficiency transformation and selective tolerance against biotic and abiotic stress in mulberry, Morus indica cv. K2, by constitutive and inducible expression of tobacco osmotin. \u003cem\u003eTransgenic Res\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 231-246 (2011). https://doi.org/10.1007/s11248-010-9405-6\u003c/li\u003e\n \u003cli\u003eRivero, M.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Stacking of antimicrobial genes in potato transgenic plants confers increased resistance to bacterial and fungal pathogens. \u003cem\u003eJ Biotechnol\u003c/em\u003e \u003cstrong\u003e157\u003c/strong\u003e, 334-343 (2012). https://doi.org/10.1016/j.jbiotec.2011.11.005\u003c/li\u003e\n \u003cli\u003eSubramanyam, K.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Overexpression of tobacco osmotin (Tbosm) in soybean conferred resistance to salinity stress and fungal infections. \u003cem\u003ePlanta\u003c/em\u003e \u003cstrong\u003e236\u003c/strong\u003e, 1909-1925 (2012). https://doi.org/10.1007/s00425-012-1733-8\u003c/li\u003e\n \u003cli\u003ePandey, P., Irulappan, V., Bagavathiannan, M. V. \u0026amp; Senthil-Kumar, M. Impact of Combined Abiotic and Biotic Stresses on Plant Growth and Avenues for Crop Improvement by Exploiting Physio-morphological Traits. \u003cem\u003eFront Plant Sci\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 537 (2017). https://doi.org/10.3389/fpls.2017.00537\u003c/li\u003e\n \u003cli\u003eOerke, E. C. Crop losses to pests. \u003cem\u003eThe Journal of Agricultural Science\u003c/em\u003e \u003cstrong\u003e144\u003c/strong\u003e, 31-43 (2006). https://doi.org/10.1017/S0021859605005708\u003c/li\u003e\n \u003cli\u003eVeronese, P.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e In defense against pathogens. Both plant sentinels and foot soldiers need to know the enemy. \u003cem\u003ePlant Physiol\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e, 1580-1590 (2003). https://doi.org/10.1104/pp.102.013417\u003c/li\u003e\n \u003cli\u003eKoiwa, H., Sato, F. \u0026amp; Yamada, Y. Characterization of accumulation of tobacco PR-5 proteins by IEF-immunoblot analysis. \u003cem\u003ePlant Cell Physiol\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 821-827 (1994). https://doi.org/10.1093/oxfordjournals.pcp.a078663\u003c/li\u003e\n \u003cli\u003eVinocur, B. \u0026amp; Altman, A. Recent advances in engineering plant tolerance to abiotic stress: achievements and limitations. \u003cem\u003eCurr Opin Biotechnol\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 123-132 (2005). https://doi.org/10.1016/j.copbio.2005.02.001\u003c/li\u003e\n \u003cli\u003eGoel, D., Singh, A. K., Yadav, V., Babbar, S. B. \u0026amp; Bansal, K. C. Overexpression of osmotin gene confers tolerance to salt and drought stresses in transgenic tomato (Solanum lycopersicum L.). \u003cem\u003eProtoplasma\u003c/em\u003e \u003cstrong\u003e245\u003c/strong\u003e, 133-141 (2010). https://doi.org/10.1007/s00709-010-0158-0\u003c/li\u003e\n \u003cli\u003eBuyel, J. F., Twyman, R. M. \u0026amp; Fischer, R. Very-large-scale production of antibodies in plants: The biologization of manufacturing. \u003cem\u003eBiotechnol Adv\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 458-465 (2017). https://doi.org/10.1016/j.biotechadv.2017.03.011\u003c/li\u003e\n \u003cli\u003eTakaiwa, F., Wakasa, Y., Takagi, H. \u0026amp; Hiroi, T. Rice seed for delivery of vaccines to gut mucosal immune tissues. \u003cem\u003ePlant Biotechnol J\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1041-1055 (2015). https://doi.org/10.1111/pbi.12423\u003c/li\u003e\n \u003cli\u003ePillet, S.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Immunogenicity and safety of a quadrivalent plant-derived virus like particle influenza vaccine candidate-Two randomized Phase II clinical trials in 18 to 49 and \u0026gt;/=50 years old adults. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e0216533 (2019). https://doi.org/10.1371/journal.pone.0216533\u003c/li\u003e\n \u003cli\u003eJoh, L. D., Wroblewski, T., Ewing, N. N. \u0026amp; VanderGheynst, J. S. High-level transient expression of recombinant protein in lettuce. \u003cem\u003eBiotechnol Bioeng\u003c/em\u003e \u003cstrong\u003e91\u003c/strong\u003e, 861-871 (2005). https://doi.org/10.1002/bit.20557\u003c/li\u003e\n \u003cli\u003eLi, W., Fan, Z., Lin, Y. \u0026amp; Wang, T. Y. Serum-Free Medium for Recombinant Protein Expression in Chinese Hamster Ovary Cells. \u003cem\u003eFront Bioeng Biotechnol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 646363 (2021). https://doi.org/10.3389/fbioe.2021.646363\u003c/li\u003e\n \u003cli\u003eTihanyi, B. \u0026amp; Nyitray, L. Recent advances in CHO cell line development for recombinant protein production. \u003cem\u003eDrug Discov Today Technol\u003c/em\u003e \u003cstrong\u003e38\u003c/strong\u003e, 25-34 (2020). https://doi.org/10.1016/j.ddtec.2021.02.003\u003c/li\u003e\n \u003cli\u003eKang, H., Park, Y., Lee, Y., Yoo, Y. J. \u0026amp; Hwang, I. Fusion of a highly N-glycosylated polypeptide increases the expression of ER-localized proteins in plants. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 4612 (2018). https://doi.org/10.1038/s41598-018-22860-2\u003c/li\u003e\n \u003cli\u003eMatsui, T., Asao, H., Ki, M., Sawada, K. \u0026amp; Kato, K. Transgenic lettuce producing a candidate protein for vaccine against edema disease. \u003cem\u003eBiosci Biotechnol Biochem\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 1628-1634 (2009). https://doi.org/10.1271/bbb.90129\u003c/li\u003e\n \u003cli\u003eIslam, M. R.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Cost-effective production of tag-less recombinant protein in Nicotiana benthamiana. \u003cem\u003ePlant Biotechnol J\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1094-1105 (2019). https://doi.org/10.1111/pbi.13040\u003c/li\u003e\n \u003cli\u003eBashir, M. A.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Osmotin: A Cationic Protein Leads to Improve Biotic and Abiotic Stress Tolerance in Plants. \u003cem\u003ePlants (Basel)\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e (2020). https://doi.org/10.3390/plants9080992\u003c/li\u003e\n \u003cli\u003eViktorova, J.\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e Recombinant expression of osmotin in barley improves stress resistance and food safety during adverse growing conditions. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e0212718 (2019). https://doi.org/10.1371/journal.pone.0212718\u003c/li\u003e\n \u003cli\u003eQu le, Q. \u0026amp; Takaiwa, F. Evaluation of tissue specificity and expression strength of rice seed component gene promoters in transgenic rice. \u003cem\u003ePlant Biotechnol J\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 113-125 (2004). https://doi.org/10.1111/j.1467-7652.2004.00055.x\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"molecular farming, recombinant proteins, purification, stress tolerance","lastPublishedDoi":"10.21203/rs.3.rs-3951169/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3951169/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePlant-made therapeutic proteins are getting acceptance because of the cost-effective production that displays equal efficacy to the more established platform such as mammalian or bacterial-based production systems. This study demonstrates that the stable expression of recombinant osmotin (rOSM) expressed and purified in large amounts is generally regarded as safe (GRAS) lettuce leaf tissues. In this study, we designed experiments to explore a plant-based system for the expression of rOSM known for exhibiting antifungal activity and stress tolerance. The codon-optimized osmotin sequences for higher expression in lettuce were added with 6xHistag and ER retention signal peptide and three independent transgenic lines were generated and screened for transgene expression with PCR. The protein extraction was optimized considering the impact of ultrasonication, PIC, and tween-20 impact on total protein extraction. Immunoblot analysis confirmed the induction of ~\u0026thinsp;28.5 kDa recombinant fusion protein and ELISA quantitation was carried out to confirm the expression level of 127 mg/kg fresh weight (FW) in lettuce leaf tissues. The method has been developed to purify recombinant proteins from leaf tissues with relatively convenient manual techniques for histidine-tagged protein with final product purity of \u0026gt;\u0026thinsp;90%. The functional analysis of purified proteins exhibited antifungal activity was verified using two human pathogenic fungal strains. In addition, the expression of rOSM made this plant more versatile to tolerate adverse environmental conditions when compared with wild-type cultivars. In this study, we demonstrated that the lettuce plant can produce a high level of functional protein and therefore is a promising production system for therapeutic purposes. Additionally, we outline the dual functionality of expressing osmotin for the synthesis of therapeutic proteins, thereby endowing engineered plants with enhanced stress tolerance.\u003c/p\u003e","manuscriptTitle":"Production and downstream processing optimization of plant-made Osmotin and its functional analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-05 10:27:44","doi":"10.21203/rs.3.rs-3951169/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"eacd0ba5-05bf-4ccf-a4d1-1d13c528de61","owner":[],"postedDate":"March 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":29107557,"name":"Biological sciences/Biochemistry"},{"id":29107558,"name":"Biological sciences/Biotechnology"},{"id":29107559,"name":"Biological sciences/Molecular biology"},{"id":29107560,"name":"Biological sciences/Plant sciences"}],"tags":[],"updatedAt":"2024-09-20T08:06:39+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-05 10:27:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3951169","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3951169","identity":"rs-3951169","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}