Morphological and molecular characterization of Odontotermes badius Haviland, 1898 (Blattodea: Macrotermitinae), with the first report from Nigeria

Morphological and molecular characterization of Odontotermes badius Haviland, 1898 (Blattodea: Macrotermitinae), with the first report from Nigeria | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Morphological and molecular characterization of Odontotermes badius Haviland, 1898 (Blattodea: Macrotermitinae), with the first report from Nigeria Abubakar Abdullahi Adeoye, James Adebayo Ojo, Segun Olayinka Oladipo, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8215578/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Odontotermes Holmgren, 1910 is a common genus of termites in Africa with several species found in different regions within the continent. These species have been reported to be serious pests of agriculture. Odontotermes badius Haviland (1898) was first reported in South Africa but has not been reported in Nigeria. Only six Odontotermes species have been reported in Nigeria. Results This new report of O. badius for the first time in Nigeria with morphological and molecular confirmation illustrates the seventh Odontotermes species in the country. Odontotermes badius report serious pests Nigeria Africa Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Odontotermes Holmgren, 1910 is a widely distributed genus of African termite, initially introduced as the sub-genus Termes Linnaeus, 1758 (Krishna et al., 2013 ). This genus is highly diverse, comprising over 190 species found globally (Uys, 2002 ), with 78 species recorded in Africa (Muvengwi, 2017 ). In Nigeria, only six species of Odontotermes have been documented (Onagbola & Scheffrahn, 2019 ). Odontotermes species have been reported to be significant economically, as they forage and nest on trees, wooden structures and litter. Species like Odontotermes badius Haviland and to a lesser extent O. latericius Haviland are serious pests of wood in buildings (Uys, 2002 ) while other species attack trees such as teak (Adeoye et al., 2023 ), Eucalyptus (Alamu et al., 2018 ), mango, neem and mahogany (Abdullahi & Saleh 2020 ). Originally described as Termes badius by Haviland ( 1898 ) in South Africa, Odontotermes badius was later reclassified by Holmgren ( 1909 ). The name Odontotermes badius gained widespread acceptance among researchers collecting the species in several African regions following the work of Ahmad ( 1949 ). Two subspecies of O . badius have been reported in Africa: Odontotermes badius badius which is distributed across the Afrotropical region, and Odontotermes badius littoralis , found in South African (Krishna et al., 2013 ). Odontotermes badius is a relatively large termite, comparable in size to Macrotermes bellicosus and larger than most other Odontotermes species. It constructs mounds, forages across various substrates, and inhabits microhabitats shared with other Macrotermitinae. The species is also a fungus grower that associates with Termitomyces reticulatus (Van der-Westhuizen & Eicker, 1990 ). Following its initial report in South Africa, O. badius has been documented in several African countries, including Angola, Botswana, Cameroon, Congo-Zaire, Ethiopia, Kenya, Malawi, Namibia, Somalia, Swaziland, Tanzania, Uganda, and Zimbabwe (Krishna et al., 2013 ). Here we report and describe the occurrence of O . badius using the morphological and molecular identification in Southwest region of Nigeria for the first time. Material and Methods Data collection and identification Termites were collected from leaf litter in Alejolowo, Akure, Ondo State, Nigeria (Lat. 7°18.93'N; Long. 5°9.03'E) (Fig. 1 ) using transect sampling protocol described by Jones & Eggleton ( 2000 ). Morphological identification was conducted by examining soldier termites under a stereo zoom microscope, following manuals by Ahmad ( 1965 ), Emerson ( 1928 ), Uys ( 2002 ), and Sornnuwat et al. ( 2004 ). Key morphological features such as head shape, mandible serrations, pronotum, postmentum, and antennal elements of ten soldier termites were analyzed under a stereo zoom microscope (Premiere SMZ-02) and measured following Roonwal ( 1969 ). Measurements of 10 soldiers were done on 13 characters/ indices (total body length, length of left mandible from the base, length of head to side base of mandible, length of head with mandible, head width, width of pronotum, length of pronotum, postmentum width, postmentum length, head index (width/length), mandible head index (length of mandible/length of head), head-convergence index (min. width of head/max. width of head), tooth index (tooth distance to tip/mandible length). Images soldier termites were captured using a microscope camera, followed by processing on Adobe Photoshop (Version CS2 13.1.2 San Jose, CA, USA, 2005) and voucher samples were preserved in 80% ethanol at the Department of Zoology Laboratory, Kwara State University. A single sample of genomic DNA was obtained from head and thorax of five (5) individual workers using Quick -DNA™ Miniprep plus kit following the manufacturer’s protocol. The quality and quantity of the extracted DNA was measured using a nanodrop (Thermo Scientific™ NanoDrop™ One Microvolume UV-Vis Spectrophotometer). The polymerase chain reaction (PCR) was carried out using Mastercycler nexus gradient (Eppendorf, Germany) with a reaction volume of 25 µl containing 0.5 µl of each primer (Forward primer LepF1- ATTCAACCAATCATAAAGATATTGG and Reverse primer LepR1- TAAACTTCTGGATGTCCAAAAAATCA), 12.5 µl of the mastermix (OneTaq® Quick-Load® 2X Master Mix), 9.5 µl Nuclease free water and 2 µl of the target DNA. The PCR conditions were as follows: 94°C for 5 min, and 94°C for 30 sec, 50°C for 1 min, 68°C for 1 min 30 sec, 68°C for 5 min. A quality control of the PCR product was performed by electrophoresis on 1% agarose gel, then stained with SafeView Red (5ul) and photographed using a gel documentation system (E-BOX, Vilber Lourmat, Italy). PCR products were cleaned using an enzymatic method (ExoSAP). The DNA sequencing of the cleaned products was performed using the Applied Biosystems ABI 3500XL Genetic Analyser. Data Analysis The sequence chromatogram analysis was performed using FinchTV analysis software. The COI sequence generated from the sample was processed, aligned and assembled using UGENE v. 33 software. The sequence was submitted to the National Center for Biotechnology Information (NCBI), under the accession number OR844425.1. DNA sequences from 20 related representatives from the subfamily Macrotermitinae were retrieved from the nucleotide database (PUBMED) of the NCBI. The COI sequences analyzed in this study varied in length and were aligned based on similarity of nucleotide composition. A representative of the family Heteroterrmitidae (Hellemans et al ., 2024) was included as outgroup to root the tree. T-test was performed on the calculated means of character measurements of both Odontotermes badius (10) and O. obesus to compare the morphometrics using PAST 4.03 software (Hammer et al. 2001 ). Phylogenetic Analysis Sequence OR844425.1 from O. badius , representatives of subfamily Macrotermitinae and outgroup sequences were aligned using MAFFT (Katoh et al. 2019 ). A maximum likelihood tree was reconstructed from the resulting alignment using IQ-TREE 2 (Minh et al. 2020) and 1000 ultrafast bootstraps with the TIM2 + F + I + G4 model detected through ModelFinder (Kalyaanamoorthy et al. 2017 ). Evolutionary distances were calculated in R using the DIST.DNA function with deleting sites with at least one missing data for all the sequences. Results Odontotermes badius Haviland, 1898 New Record : NIGERIA. 14 Soldiers, 41 Workers. Loc. Cashew tree ( Anacardium occidentale ) litter in a disturbed area in Alejolowo Community, Akure, Ondo State, Nigeria. Coordinates: Lat. 7°18.93’N; Long 5°9.03’E, 326.5 m.a.s.l., 20 November, 2022. Collector: A. Adeoye. Label: AACNIGTerm 002. Morphological description : The head capsule of Odontotermes badius is notably large, sub-rectangular, with its anterior portion sloping downward with sparcely distributed pilosity. The head color is dark reddish/brown together with the antennae while the remaining body is yellow-straw with creamy white pigmentation. Mandibles are short, thick and robust and have curvature and more teeth serrations on the left mandible. The right mandible has fewer teeth serrations but has more curvature and is more robust than the left mandible. Antennae are of 16 segments, of which the 3rd segment is either sub-equal to 2nd or a little longer and sub-divided. Labrum has hyaline tip and is triangularly blunt and robust. The pronotum has a saddle-shaped contour, with lightly notched anterior margins and strongly emarginate posterior margins (Fig. 2 ). Postmentum is sub-rectangular. Measurements of distinguishing parts are stated in Table 1 . A few dissimilarities exist among the soldiers of O . badius and other species of Odontotermes . The mandibles of O . badius are robust with multiple serrated teeth, whereas those of O . obesus are slender, each possessing only a pair of teeth on the right and left mandibles (Zaman et al., 2022 ). Additionally, the labrum of O . obesus is more pointed at the tip compared to O. badius , while the pronotum of O . badius is longer and wider than of O . obesus (t-test: t = 2.14, df = 12, p > 0.001). Table 1 A comparison of the morphometric analysis of Odontotermes badius (n = 10 ) and O . obesus body parts. Body parts O. obesus O. badius Reference source Zaman et al., 2022 Present study (10) Locality Pakistan (Haripur) Nigeria Total body length (mm) - 9.72 (9.65–9.87) Length of head with mandible (mm) 2.15 (1.89–2.49) 4.29 (4.25–4.35) Length of head to side base of mandible (mm) 1.33 (1.18–1.5) 3.63 (3.45–3.75) Head width (mm) 1.20 (1-1.35) 2.93 (2.92–2.96) Length of left mandible from the base (mm) 0.82 (0.65–1.02) 1.62 (1.60–1.73) Length of pronotum (mm) 0.58 (0.5–0.7) 0.98 (0.97- 1.00) Width of pronotum (mm) 0.93 (0.8–1.35) 1.74 (1.73–1.80) Postmentum length (mm) 0.87 (0.81–0.91) 2.15 (2.15–2.17) Postmentum width (mm) 0.58 (0.49–0.69) 0.84 (0.83–0.86) Head index (Width/Length) 0.91 (0.67–1.083) 0.81 (0.78–0.82) Mandible head index (Length of mandible/length of head) 0.62 (0.50–0.73) 0.45 (0.43–0.47) Head-convergence index (min. width of head/max. width of head) 0.67 (0.52–0.9) 0.98 (0.98–0.99) Tooth index (tooth distance to tip/mandible Length) 0.36 (0.25–0.55) 0.32 (0.31–0.33) Molecular identification The molecular obtained COI gene fragment (707 bp) through Blast search showed 98.15% similarity with Odontotermes sp. BDIT085 from Burundi (GenBank accession numbers KY224721) sequence and 97.60% with O. badius sequences from South Africa (GenBank accession numbers AY818073) supporting the species identification. The COI tree also shows that the Nigeria specimen forms a well-supported clade with the aforementioned specimens and a few other non-specified specimens from other countries (Fig. 3 ). The composition of nucleotides in the COI gene fragment of the twenty-two species used in the present study was noted and their proportion was illustrated in Fig. 4 . There was high percentage of A + T of the COI gene fragment that varied from 53.95 to 60.08 while G + C percentage ranged from 39.92 to 46.05. The closest species to Odontotermes badius (44.41%) of this study with respect to the A + T percentage is Odontotermes sp. (Accession number KY197484) with 44.47% while the farthest species with A + T percentage was Macrotermes subhyalinus (Accession number KY224559) with 39.92%. The evolutionary genetic distance for the COI fragments of the sequences used in the present study showed overall sequence dissimilarities of genus Odontotermes ranged from 0 to 10 (Fig. 5 ), while genus Hypotermes and Macrotermes are between 10 to 20 dissimilarity ranges. Coptotermes intermedius which is the out-group species has the highest dissimilarity. The molecular sequence data of Odontotermes badius originating from Ondo State in the present study generated has 707 bp. Discussion The species was identified from leaf litter in a disturbed area under a cashew tree in Alejolowo, near the North Gate of the Federal University of Technology, Akure. Odontotermes badius encountered in Nigeria could also be destructive to the cashew tree where it was collected if proper control was not done to curb its infestation. Ondo State, part of Nigeria's moist rainforest zone, hosts high termite diversity, with over thirty species reported in a single region (Olugbemi 2013 ). However, O. badius was yet to be documented in this area. The species reported in this study was not found in the Nigerian checklist of termites where only six Odontotermes species were reported (Onagbola & Scheffrahn, 2019 ). Several species in the genus Odontotermes have been reported to be economically important in Africa because they are mainly wood feeders, thereby destroying wood and wooden structures (Ahmed et al. 2011 ). Odontotermes sp. has been reported on Kwara State University campus (Adeoye et al., 2024 ) and other economically important plantations such as teak (Adeoye et al., 2023 ) and Eucalyptus (Alamu et al. 2018 ). Also, wooden structures in buildings were destroyed by Odontotermes badius in South Africa (Uys 2002 ). The use of both morphological and molecular identifications may increase the certainty of the taxonomical identification, which is key in biodiversity studies. The information on the molecular analysis of O. badius is important because most of the termites reported in Nigeria have not been identified molecularly. It was illustrated from the molecular information of O. badius reported here that there was a high percentage of A + T of the COI gene fragment which varied from 53.95 to 60.08 while the G + C percentage ranged from 39.92 to 46.05. Nucleotide variation of higher A + T composition is one of the general features of COI mitochondrial fragments of many arthropods (Mangold et al., 1998 ). Many researchers have proven that A + T composition is always higher than the G + C composition in the COI sequence of termites. Based on the DNA sequence of the COI gene of some Indian termites, the A + T percentage ranged from 62.98 to 64.35% (Mandakini et al., 2015 ). Ondo State is a moist rainforest ecological zone in Nigeria resulting in a high intensification of land use. This intensification is an important factor in determining species richness and diversity and could indicate the presence of a high diversity of termite species in the area (Olugbemi, 2013 ). Termites also play important roles in the ecological and economic function of the area, thereby leading to high agricultural practices in the zone. More research is required in all the ecological zones of Nigeria as there could be more species that are exotic or yet to be recorded in Nigeria. Identification of species using molecular analysis is very useful because most of the insects in Nigeria and other African countries have not been reported with their molecular information. Declarations List of Abbreviations Not applicable Acknowledgements We thank Alhaji Alejolowo of Alejolowo block industry for allowing AA to collect samples. Author contributions The conception and design of the study were jointly developed by AAA and JAO. AAA was responsible for material preparation and data collection. The methodology was crafted by AAA and AO. The phylogenetic analysis and interpretation of the data was carried out by RAC and SOO. The initial manuscript draft was written by AAA, and all authors provided feedback on previous drafts. All authors reviewed and approved the final version of the manuscript. Funding Data availability No datasets were generated or analysed during the current study. Ethics approval and consent to participate This work does not contain any studies involving human and animal subjects. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Disclaimer The findings and conclusions in this publication have not been formally disseminated by the U.S. Department of Agriculture and should not be construed to represent any Agency determination or policy. Any mention of trade names or commercial products in this publication is solely to provide specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer. References Abdullahi, J. M. & Saleh, J. B. (2020). Rapid Biodiversity Evaluation of the Arboreal Termites in Kano University of Science and Technology, Wudil, Nigeria . BioScientific Review, 2(2), 33–40 . https://doi.org/10.32350/BSR.0202.04 Adeoye A.A., Ojo J.A. & Ajao A.M. (2024). Species composition, relative abundance and diversity of termites (Blattodea: Insecta: Isoptera) in the Kwara State University Campus, Malete, Kwara State, Nigeria. Agricultura Tropica et Subtropica, 57, 108-115. Adeoye, A. A., Ojo, J. A. Ajao A. M., Obembe, A. & Oladipo, S. O. (2023). Assessments of Termite Infestation and Diversity at the University of Ilorin Teak ( Tectona grandis ) Plantation. LAUTECH Crop and Environmental Review, 4(1), 16–30 Ahmad, M. (1949). On the identity of Odontotermes (Isoptera, Termitidae). American Museum Novitates, 1392: 1–11. Ahmad, M. (1965). Termites (Isoptera) of Thailand. American Museum of Natural History 131, 1–114 Ahmed (Shiday), B. M., Nkunika, P. O. Y., Sileshi, G. W., French, J. R. J., Nyeko, P. & Jain, S. Potential Impact of Climate Change on Termite Distribution in Africa. British Journal of Environment and Climate Change, 1(4), 172–189 Alamu, O. T., Ewete, F. K. & Jimoh, S. O. (2018). Occurrence and diversity of termite species in Eucalyptus plantations in Afaka, Kaduna state, Nigeria. Journal of Research in Forestry, Wildlife and Environment , 10(2), 33–38 Emerson, A.E . ( 1928). Termites of the Belgian Congo and the Cameroon. Bulletin of American Museum of Natural History, 57, 212–222 Hammer, O., Harper, D. A. T. & Ryan, P. D. (2001). PAST: Paleontological Statistics software package for education and data analysis. Palaeontologia Electronica, 4, 1–9. Haviland, G. D. (1898). Observations on termites; with descriptions of new species. Journal of the Linnean Society of London, Zoology , 26 (169), 358–442 + 4 pls. Hellemans, S., Rocha, M. M., Wang, M., Arias, J. R., Aanen, D. K.,Bagnères, A-G., Buček, A., Carrijo, T. F., Chouvenc, T., Cuezzo, C., Constantini, J. P., Constantino, R., Dedeine, F., Deligne, J, Eggleton, P., Evans, T. A., Hanus, R., Harrison, M. C., Harry, M., Josens, G., Jouault, C., Kalleshwaraswamy, C. M., Kaymak, E., Korb, J., Lee, C-Y., Legendre, F., Li, H-F., Lo, N., Lu, T., Matsuura, K., Maekawa, K., McMahon, D. P., Mizumoto, N., Oliveira, D. E., Poulsen, M., Sillam-Dussès, D., Su, N-Y., Tokuda, G., Vargo, E. L., Ware, J. I., Šobotník, J., Scheffrahn, R. H., Cancello, E., Roisin, Y., Engel, M. S. & Bourguignon. T. (2024). Genomic data provide insights into the classification of extant termites. Nature Communications, 15, 6724. https://doi.org/10.1038/s41467-024-51028-y Holmgren, N. (1909). Termitenstudien. 1. Anatomische Untersuchungen. Kungliga Svenska Vetenskaps-Akademiens Handlingar , 44 (3), 1–215 + 3 pls. Jones, D.T. & Eggleton, P. ( 2000). Sampling Termite Assemblages in Tropical Forests: Testing a Rapid Biodiversity Assessment Protocol. Journal of Applied Ecology, 37, 191–203. https://doi. org/10.1046/j.1365-2664.2000.00464.x Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K. F., von Haeseler, A. & Jermiin, L. S. (2017). ModelFinder: Fast model selection for accurate phylogenetic estimates. National Methods, 14, 587–589. https://doi.org/10.1038/nmeth.4285 Katoh, K., Rozewicki, J. & Yamada, K. D. (2019). MAFFT Online Service: Multiple Sequence Alignment, Interactive Sequence Choice and Visualization. Briefings in Bioinformatics, 20, 1160–1166. https://doi.org/10.1093/bib/bbx108 Krishna, K., Grimaldi, D. A., Krishna, V. & Engel, M. S. (2013). Treatise on the Isoptera of the World. Bulletin of the American Museum of Natural History, 377, 1–200. https://doi.org/10.1206/377.1 Mandakini, S., Neha, G., Sobti, R. C. & Sharma, V. L. (2015). Estimating molecular phylogeny of some Indian termites combining partial COI sequences. Journal of Entomology and Zoology Studies, 3(6), 213–218 Mangold, A. J., Barques, M. D. & Mas-Coma, S. (1998). Mitochondrial 16Sr DNA sequences and phylogenetic relationships of species of Riphicephalus and other tick genera among Metastriata (Acari: Ixodidae). Parasitology Research, 84(6), 478–484 Minh, B. Q., Schmidt, H. A., Chernomor, O., Schrempf, D., Woodhams, M. D., von Haeseler, A. & Lanfear, R. (2020). IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution, 37, 1530–1534. https://doi.org/10.1093/molbev/msaa015 Muvengwi, J. (2017). Relationships between termite ( Macrotermes ) mound distribution, plant diversity and large mammalian herbivory patterns in Gonarezhou National Park, Zimbabwe (Thesis). hdl:10539/22729 Olugbemi, B.O. (2013). Termite assemblages and decomposition of tissue paper baits along a gradient of land use intensification in Owena, Southwest, Nigeria. Applied ecology and environmental research, 11(2), 223–235 Onagbola, E. O. & Scheffrahn, R. H. (2019). Checklist of Nigerian termites (Blattodea, Isoptera): An update. African Entomology, 27(2), 000–000 Roonwal, M. L. (1969). Measurement of termites (Isoptera) for taxonomic purposes. Journal of the Zoological Society of India, 21, 9–66. Sornnuwat, Y., Vongkaluang, C. & Takematsu, Y. (2004). A systematic key to termites of Thailand. Kasetsart Journal National Science, 38, 349–368 Tamura, K., Stecher, G. & Kumar, S. (2021). MEGA11: Molecular Evolutionary Genetics Analysis version 11. Molecular Biology and Evolution 38(7), 3022–3027. https://doi:10.1093/molbev/msab120 Uys, V. (2002). A guide to the termite genera of Southern Africa. 1st Edn. Plant Protection Research Institute Agricultural Research Council, Pretoria, ISBN: 1-86849-216-8, 116 Van Der Westhuizen, G. C. A. & Eicker, A. (1990). Species of Termitomyces occurring in South Africa. Mycological Research, 94(7), 923–37 Zaman, M., Khan, I. A., Schmidt, S., Murphy, R. & Poulsen, M. (2022). Morphometrics, Distribution, and DNA Barcoding: An Integrative Identification Approach to the Genus Odontotermes (Termitidae: Blattodea) of Khyber Pakhtunkhwa, Pakistan. Forests, 13, 674. https://doi.org/10.3390/f13050674 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8215578","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":567092684,"identity":"ee645c87-c409-446a-a7fb-6b6c33773c69","order_by":0,"name":"Abubakar Abdullahi Adeoye","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABNUlEQVRIiWNgGAWjYDACCQY2BoYDYKYBiJCTgEowNhCrxZh0LYkzCGnhn91j9uDHGbt8BvbDGx98bLNJnzkj+fFnHgYb2Q0HeA+/wGbJnTPmhj03ki0beNKKDWe2peXOlkgzk+ZhSDPecIAvzQKbNTdyzCR4PjADHZVjJs3bdjh3nnSCGTMPw+HEDQd4zAyw6JAHapH886HegIH/jflv3rb/6XLS6Z+BDvuPU4sBUIs0z43DBgwSOWbMvG0HEqSlcwyADjsA0mL8AIsWwzvHyo1lzhw3YJN4Viw541yy4cz5b8ok5xgkG888zGOGzStyt5u3PXxzrNqAnz9544cPZXbyEmeOb/7wpsJOtu94j/EHHAENBmwggpEN7mAgZmZgk8CpHg7+oHKZ8doyCkbBKBgFIwUAAN9hZhljktURAAAAAElFTkSuQmCC","orcid":"","institution":"Kwara State University","correspondingAuthor":true,"prefix":"","firstName":"Abubakar","middleName":"Abdullahi","lastName":"Adeoye","suffix":""},{"id":567092686,"identity":"f09bdbd8-aab3-4cc4-8ae2-789cdaf4c1ad","order_by":1,"name":"James Adebayo Ojo","email":"","orcid":"","institution":"Kwara State University","correspondingAuthor":false,"prefix":"","firstName":"James","middleName":"Adebayo","lastName":"Ojo","suffix":""},{"id":567092689,"identity":"3c21b27c-eb84-4600-9118-905f80162a8b","order_by":2,"name":"Segun Olayinka Oladipo","email":"","orcid":"","institution":"Kwara State University","correspondingAuthor":false,"prefix":"","firstName":"Segun","middleName":"Olayinka","lastName":"Oladipo","suffix":""},{"id":567092691,"identity":"2612d131-8d06-499b-8ef4-79aa4ea998dd","order_by":3,"name":"Abiodun Obembe","email":"","orcid":"","institution":"Kwara State University","correspondingAuthor":false,"prefix":"","firstName":"Abiodun","middleName":"","lastName":"Obembe","suffix":""},{"id":567092695,"identity":"364fd97f-5320-4ba5-a9cd-5ac48951933d","order_by":4,"name":"Rebecca A. Clement","email":"","orcid":"","institution":"USDA-APHIS-PPQ-Science and Technology Laboratory","correspondingAuthor":false,"prefix":"","firstName":"Rebecca","middleName":"A.","lastName":"Clement","suffix":""}],"badges":[],"createdAt":"2025-11-26 18:38:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8215578/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8215578/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99282266,"identity":"35cac17f-7817-4ba1-b124-4d672ba36806","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1082026,"visible":true,"origin":"","legend":"","description":"","filename":"FIGUREStosubmit.docx","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/5ed02656469507675415d355.docx"},{"id":99282262,"identity":"aa7e32aa-1e6d-4679-b173-fc128df7c239","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51411,"visible":true,"origin":"","legend":"","description":"","filename":"Adeoyeetal.Odontotermesbadius.docx","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/2f8761ca03e1dcf76547ce9f.docx"},{"id":99320532,"identity":"305e0648-1952-4d99-b7de-8de053f0a831","added_by":"auto","created_at":"2025-12-31 16:38:43","extension":"json","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5969,"visible":true,"origin":"","legend":"","description":"","filename":"adc0c8adf60546debdc6a46bebd239d6.json","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/a1e200a78c10b855a43506e1.json"},{"id":99282271,"identity":"801fa733-4e29-492a-88e9-a6622bbd5120","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80664,"visible":true,"origin":"","legend":"","description":"","filename":"adc0c8adf60546debdc6a46bebd239d61enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/9c10b7760ebad7758efd1c3e.xml"},{"id":99319420,"identity":"00c4e9b3-08fc-4640-afb7-716dee512584","added_by":"auto","created_at":"2025-12-31 16:37:10","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":173430,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/8b73231a684cf4122a49be3f.jpeg"},{"id":99320604,"identity":"3f2e4a5a-00ca-425e-bbcb-b73078994fd0","added_by":"auto","created_at":"2025-12-31 16:38:47","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":534261,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/fce513ab95a5fbc234f9cbca.jpeg"},{"id":99282267,"identity":"988ca3ed-c4e1-45e0-8425-bb94e0d181dc","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":368079,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/d3ff88e42fc9b3211c66efd7.jpeg"},{"id":99320494,"identity":"95a554b8-7b53-472c-9371-f5000c9225af","added_by":"auto","created_at":"2025-12-31 16:38:41","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11482,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/c4b8a22ce2351d3902acaf03.png"},{"id":99319233,"identity":"94f8b430-cf91-4708-83f9-7b77bed97252","added_by":"auto","created_at":"2025-12-31 16:36:43","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":208199,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/8cbdc63e18b2d464b3d4f624.jpeg"},{"id":99282278,"identity":"63f29938-c952-4e45-9ee4-779569b4cd2c","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":157365,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/be5f73d75f5b49c9e00c917e.png"},{"id":99282275,"identity":"aa03a3c5-28a5-4547-9a71-7f168e2c50bd","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":367269,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/108c1859901668ccb9e73410.png"},{"id":99282279,"identity":"2e0311ca-a68c-4066-bac9-167c52fe1fbb","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":83431,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/94ae1a2fde8251d6ff1b6c59.png"},{"id":99318874,"identity":"76361ad4-ea69-474a-b7d2-dc01d799857a","added_by":"auto","created_at":"2025-12-31 16:35:32","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11108,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/c9ab08eaccb333a01209b496.png"},{"id":99282273,"identity":"badbf61f-ef1a-49e1-8f19-4474687d17a9","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70131,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/eae4189cf22ff1b4abe7681a.png"},{"id":99282277,"identity":"89696477-c599-42f7-a0fd-f1455eb2c431","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"xml","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":78625,"visible":true,"origin":"","legend":"","description":"","filename":"adc0c8adf60546debdc6a46bebd239d61structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/8a808e623d301d11134f5b2a.xml"},{"id":99319534,"identity":"b9dcb743-30b2-4509-88d1-33b9ed88a1b6","added_by":"auto","created_at":"2025-12-31 16:37:26","extension":"html","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":91871,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/1531060d1ed9950f313b94f7.html"},{"id":99282258,"identity":"1e16d242-9fe9-4f93-8a54-b2a604f55ecc","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":123944,"visible":true,"origin":"","legend":"\u003cp\u003eMap illustrating the distribution of \u003cem\u003eOdontotermes badius\u003c/em\u003e in Africa.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/92d594897da4dec74b57f3ec.png"},{"id":99320874,"identity":"18cb5221-c979-45d9-9c26-c3bc769615cd","added_by":"auto","created_at":"2025-12-31 16:38:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":879425,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eOdontotermes badius\u003c/em\u003e:\u003cem\u003e \u003c/em\u003e(\u003cstrong\u003eA–B\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eHead capsule of soldier. \u003cstrong\u003eA\u003c/strong\u003e) Dorsal view (Scale = 1 mm); \u003cstrong\u003eB\u003c/strong\u003e) Ventral view (Scale = 1 mm); \u003cstrong\u003eC\u003c/strong\u003e) Dorsal part of the whole body of the soldier (Scale = 2 mm); \u003cstrong\u003eD\u003c/strong\u003e) Lateral part of the whole body of the soldier (Scale = 2 mm); \u003cstrong\u003eE\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMandibles of soldier (Scale = 0.5 mm);\u003cstrong\u003e F\u003c/strong\u003e) Mandibles of worker (Scale = 0.5 mm).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/0ec0a5fece0a08bc1e9bf08f.png"},{"id":99282260,"identity":"cd433be2-854c-49ca-88c5-b9ff6d3d3d57","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":107998,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of termites based on cytochrome oxidase 1 (CO1). A maximum likelihood tree was reconstructed and 1000 ultrafast bootstraps with the TIM2+F+I+G4 model. The purple color indicates the sequence from this paper.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/866f2dd7f87eb6ed63790d4e.png"},{"id":99282264,"identity":"c009ad91-873d-4f5d-805a-93a1b00c382f","added_by":"auto","created_at":"2025-12-31 08:45:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":179728,"visible":true,"origin":"","legend":"\u003cp\u003eNucleotide composition in different species of termites used in the study\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/20e2cdc286388b358efe7b66.png"},{"id":99321304,"identity":"4c41dbd7-eb24-4614-9d7a-e8aacb8094ec","added_by":"auto","created_at":"2025-12-31 16:39:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":468000,"visible":true,"origin":"","legend":"\u003cp\u003eSimilarity matrix between DNA sequences based on COI sequences alignment of the termite species used in this study.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/b09ba3992203e7ef83b81d82.png"},{"id":102397598,"identity":"d993a586-f596-4d11-bfb4-0550a184afde","added_by":"auto","created_at":"2026-02-11 10:18:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2880507,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8215578/v1/055be21b-a03d-4b98-8374-83c26890890f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Morphological and molecular characterization of Odontotermes badius Haviland, 1898 (Blattodea: Macrotermitinae), with the first report from Nigeria","fulltext":[{"header":"Background","content":"\u003cp\u003e \u003cem\u003eOdontotermes\u003c/em\u003e Holmgren, 1910 is a widely distributed genus of African termite, initially introduced as the sub-genus \u003cem\u003eTermes\u003c/em\u003e Linnaeus, 1758 (Krishna et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This genus is highly diverse, comprising over 190 species found globally (Uys, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2002\u003c/span\u003e), with 78 species recorded in Africa (Muvengwi, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In Nigeria, only six species of \u003cem\u003eOdontotermes\u003c/em\u003e have been documented (Onagbola \u0026amp; Scheffrahn, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). \u003cem\u003eOdontotermes\u003c/em\u003e species have been reported to be significant economically, as they forage and nest on trees, wooden structures and litter. Species like \u003cem\u003eOdontotermes badius\u003c/em\u003e Haviland and to a lesser extent \u003cem\u003eO. latericius\u003c/em\u003e Haviland are serious pests of wood in buildings (Uys, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2002\u003c/span\u003e) while other species attack trees such as teak (Adeoye et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), \u003cem\u003eEucalyptus\u003c/em\u003e (Alamu et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), mango, neem and mahogany (Abdullahi \u0026amp; Saleh \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Originally described as \u003cem\u003eTermes badius\u003c/em\u003e by Haviland (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1898\u003c/span\u003e) in South Africa, \u003cem\u003eOdontotermes badius\u003c/em\u003e was later reclassified by Holmgren (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1909\u003c/span\u003e). The name \u003cem\u003eOdontotermes badius\u003c/em\u003e gained widespread acceptance among researchers collecting the species in several African regions following the work of Ahmad (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1949\u003c/span\u003e). Two subspecies of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003ebadius\u003c/em\u003e have been reported in Africa: \u003cem\u003eOdontotermes badius badius\u003c/em\u003e which is distributed across the Afrotropical region, and \u003cem\u003eOdontotermes badius littoralis\u003c/em\u003e, found in South African (Krishna et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eOdontotermes badius\u003c/em\u003e is a relatively large termite, comparable in size to \u003cem\u003eMacrotermes bellicosus\u003c/em\u003e and larger than most other \u003cem\u003eOdontotermes\u003c/em\u003e species. It constructs mounds, forages across various substrates, and inhabits microhabitats shared with other Macrotermitinae. The species is also a fungus grower that associates with \u003cem\u003eTermitomyces reticulatus\u003c/em\u003e (Van der-Westhuizen \u0026amp; Eicker, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). Following its initial report in South Africa, \u003cem\u003eO. badius\u003c/em\u003e has been documented in several African countries, including Angola, Botswana, Cameroon, Congo-Zaire, Ethiopia, Kenya, Malawi, Namibia, Somalia, Swaziland, Tanzania, Uganda, and Zimbabwe (Krishna et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Here we report and describe the occurrence of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003ebadius\u003c/em\u003e using the morphological and molecular identification in Southwest region of Nigeria for the first time.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eData collection and identification\u003c/h2\u003e \u003cp\u003eTermites were collected from leaf litter in Alejolowo, Akure, Ondo State, Nigeria (Lat. 7\u0026deg;18.93'N; Long. 5\u0026deg;9.03'E) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) using transect sampling protocol described by Jones \u0026amp; Eggleton (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Morphological identification was conducted by examining soldier termites under a stereo zoom microscope, following manuals by Ahmad (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1965\u003c/span\u003e), Emerson (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1928\u003c/span\u003e), Uys (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2002\u003c/span\u003e), and Sornnuwat et al. (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Key morphological features such as head shape, mandible serrations, pronotum, postmentum, and antennal elements of ten soldier termites were analyzed under a stereo zoom microscope (Premiere SMZ-02) and measured following Roonwal (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e1969\u003c/span\u003e). Measurements of 10 soldiers were done on 13 characters/ indices (total body length, length of left mandible from the base, length of head to side base of mandible, length of head with mandible, head width, width of pronotum, length of pronotum, postmentum width, postmentum length, head index (width/length), mandible head index (length of mandible/length of head), head-convergence index (min. width of head/max. width of head), tooth index (tooth distance to tip/mandible length). Images soldier termites were captured using a microscope camera, followed by processing on Adobe Photoshop (Version CS2 13.1.2 San Jose, CA, USA, 2005) and voucher samples were preserved in 80% ethanol at the Department of Zoology Laboratory, Kwara State University.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA single sample of genomic DNA was obtained from head and thorax of five (5) individual workers using \u003cem\u003eQuick\u003c/em\u003e-DNA\u0026trade; Miniprep plus kit following the manufacturer\u0026rsquo;s protocol. The quality and quantity of the extracted DNA was measured using a nanodrop (Thermo Scientific\u0026trade; NanoDrop\u0026trade; One Microvolume UV-Vis Spectrophotometer). The polymerase chain reaction (PCR) was carried out using Mastercycler nexus gradient (Eppendorf, Germany) with a reaction volume of 25 \u0026micro;l containing 0.5 \u0026micro;l of each primer (Forward primer LepF1- ATTCAACCAATCATAAAGATATTGG and Reverse primer LepR1- TAAACTTCTGGATGTCCAAAAAATCA), 12.5 \u0026micro;l of the mastermix (OneTaq\u0026reg; Quick-Load\u0026reg; 2X Master Mix), 9.5 \u0026micro;l Nuclease free water and 2 \u0026micro;l of the target DNA. The PCR conditions were as follows: 94\u0026deg;C for 5 min, and 94\u0026deg;C for 30 sec, 50\u0026deg;C for 1 min, 68\u0026deg;C for 1 min 30 sec, 68\u0026deg;C for 5 min. A quality control of the PCR product was performed by electrophoresis on 1% agarose gel, then stained with SafeView Red (5ul) and photographed using a gel documentation system (E-BOX, Vilber Lourmat, Italy). PCR products were cleaned using an enzymatic method (ExoSAP). The DNA sequencing of the cleaned products was performed using the Applied Biosystems ABI 3500XL Genetic Analyser.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eData Analysis\u003c/h2\u003e \u003cp\u003eThe sequence chromatogram analysis was performed using FinchTV analysis software. The COI sequence generated from the sample was processed, aligned and assembled using UGENE v. 33 software. The sequence was submitted to the National Center for Biotechnology Information (NCBI), under the accession number OR844425.1. DNA sequences from 20 related representatives from the subfamily Macrotermitinae were retrieved from the nucleotide database (PUBMED) of the NCBI. The COI sequences analyzed in this study varied in length and were aligned based on similarity of nucleotide composition. A representative of the family Heteroterrmitidae (Hellemans \u003cem\u003eet al\u003c/em\u003e., 2024) was included as outgroup to root the tree. T-test was performed on the calculated means of character measurements of both \u003cem\u003eOdontotermes badius\u003c/em\u003e (10) and \u003cem\u003eO. obesus\u003c/em\u003e to compare the morphometrics using PAST 4.03 software (Hammer et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePhylogenetic Analysis\u003c/h3\u003e\n\u003cp\u003eSequence OR844425.1 from \u003cem\u003eO. badius\u003c/em\u003e, representatives of subfamily Macrotermitinae and outgroup sequences were aligned using MAFFT (Katoh et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). A maximum likelihood tree was reconstructed from the resulting alignment using IQ-TREE 2 (Minh et al. 2020) and 1000 ultrafast bootstraps with the TIM2\u0026thinsp;+\u0026thinsp;F\u0026thinsp;+\u0026thinsp;I\u0026thinsp;+\u0026thinsp;G4 model detected through ModelFinder (Kalyaanamoorthy et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Evolutionary distances were calculated in R using the DIST.DNA function with deleting sites with at least one missing data for all the sequences.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eOdontotermes badius\u003c/b\u003e Haviland, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1898\u003c/span\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003eNew Record\u003c/b\u003e: NIGERIA. 14 Soldiers, 41 Workers. Loc. Cashew tree (\u003cem\u003eAnacardium occidentale\u003c/em\u003e) litter in a disturbed area in Alejolowo Community, Akure, Ondo State, Nigeria. Coordinates: Lat. 7\u0026deg;18.93\u0026rsquo;N; Long 5\u0026deg;9.03\u0026rsquo;E, 326.5 m.a.s.l., 20 November, 2022. Collector: A. Adeoye. Label: AACNIGTerm 002.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMorphological description\u003c/b\u003e: The head capsule of \u003cem\u003eOdontotermes badius\u003c/em\u003e is notably large, sub-rectangular, with its anterior portion sloping downward with sparcely distributed pilosity. The head color is dark reddish/brown together with the antennae while the remaining body is yellow-straw with creamy white pigmentation. Mandibles are short, thick and robust and have curvature and more teeth serrations on the left mandible. The right mandible has fewer teeth serrations but has more curvature and is more robust than the left mandible. Antennae are of 16 segments, of which the 3rd segment is either sub-equal to 2nd or a little longer and sub-divided. Labrum has hyaline tip and is triangularly blunt and robust. The pronotum has a saddle-shaped contour, with lightly notched anterior margins and strongly emarginate posterior margins (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Postmentum is sub-rectangular. Measurements of distinguishing parts are stated in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A few dissimilarities exist among the soldiers of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003ebadius\u003c/em\u003e and other species of \u003cem\u003eOdontotermes\u003c/em\u003e. The mandibles of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003ebadius\u003c/em\u003e are robust with multiple serrated teeth, whereas those of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003eobesus\u003c/em\u003e are slender, each possessing only a pair of teeth on the right and left mandibles (Zaman et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Additionally, the labrum of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003eobesus\u003c/em\u003e is more pointed at the tip compared to \u003cem\u003eO. badius\u003c/em\u003e, while the pronotum of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003ebadius\u003c/em\u003e is longer and wider than of \u003cem\u003eO\u003c/em\u003e. \u003cem\u003eobesus\u003c/em\u003e (t-test: t\u0026thinsp;=\u0026thinsp;2.14, df\u0026thinsp;=\u0026thinsp;12, p\u0026thinsp;\u0026gt;\u0026thinsp;0.001).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eA comparison of the morphometric analysis of \u003cem\u003eOdontotermes badius\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;10\u003cb\u003e)\u003c/b\u003e and \u003cem\u003eO\u003c/em\u003e. \u003cem\u003eobesus\u003c/em\u003e body parts.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBody parts\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eO. obesus\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eO. badius\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eReference source\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eZaman et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2022\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePresent study (10)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLocality\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePakistan (Haripur)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNigeria\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal body length (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.72 (9.65\u0026ndash;9.87)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLength of head with mandible (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.15 (1.89\u0026ndash;2.49)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.29 (4.25\u0026ndash;4.35)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLength of head to side base of mandible (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.33 (1.18\u0026ndash;1.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.63 (3.45\u0026ndash;3.75)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHead width (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.20 (1-1.35)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.93 (2.92\u0026ndash;2.96)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLength of left mandible from the base (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.82 (0.65\u0026ndash;1.02)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.62 (1.60\u0026ndash;1.73)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLength of pronotum (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.58 (0.5\u0026ndash;0.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.98 (0.97- 1.00)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWidth of pronotum (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.93 (0.8\u0026ndash;1.35)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.74 (1.73\u0026ndash;1.80)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePostmentum length (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.87 (0.81\u0026ndash;0.91)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.15 (2.15\u0026ndash;2.17)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePostmentum width (mm)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.58 (0.49\u0026ndash;0.69)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.84 (0.83\u0026ndash;0.86)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHead index (Width/Length)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.91 (0.67\u0026ndash;1.083)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.81 (0.78\u0026ndash;0.82)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMandible head index\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(Length of mandible/length of head)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.62 (0.50\u0026ndash;0.73)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.45 (0.43\u0026ndash;0.47)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHead-convergence index\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(min. width of head/max. width of head)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.67 (0.52\u0026ndash;0.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.98 (0.98\u0026ndash;0.99)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTooth index (tooth\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003edistance to tip/mandible Length)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.36 (0.25\u0026ndash;0.55)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.32 (0.31\u0026ndash;0.33)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMolecular identification\u003c/strong\u003e \u003cp\u003eThe molecular obtained COI gene fragment (707 bp) through Blast search showed 98.15% similarity with \u003cem\u003eOdontotermes\u003c/em\u003e sp. BDIT085 from Burundi (GenBank accession numbers KY224721) sequence and 97.60% with \u003cem\u003eO. badius\u003c/em\u003e sequences from South Africa (GenBank accession numbers AY818073) supporting the species identification. The COI tree also shows that the Nigeria specimen forms a well-supported clade with the aforementioned specimens and a few other non-specified specimens from other countries (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The composition of nucleotides in the COI gene fragment of the twenty-two species used in the present study was noted and their proportion was illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. There was high percentage of A\u0026thinsp;+\u0026thinsp;T of the COI gene fragment that varied from 53.95 to 60.08 while G\u0026thinsp;+\u0026thinsp;C percentage ranged from 39.92 to 46.05.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/p\u003e \u003cp\u003eThe closest species to \u003cem\u003eOdontotermes badius\u003c/em\u003e (44.41%) of this study with respect to the A\u0026thinsp;+\u0026thinsp;T percentage is \u003cem\u003eOdontotermes\u003c/em\u003e sp. (Accession number KY197484) with 44.47% while the farthest species with A\u0026thinsp;+\u0026thinsp;T percentage was \u003cem\u003eMacrotermes subhyalinus\u003c/em\u003e (Accession number KY224559) with 39.92%.\u003c/p\u003e \u003cp\u003eThe evolutionary genetic distance for the COI fragments of the sequences used in the present study showed overall sequence dissimilarities of genus \u003cem\u003eOdontotermes\u003c/em\u003e ranged from 0 to 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), while genus \u003cem\u003eHypotermes\u003c/em\u003e and \u003cem\u003eMacrotermes\u003c/em\u003e are between 10 to 20 dissimilarity ranges. \u003cem\u003eCoptotermes intermedius\u003c/em\u003e which is the out-group species has the highest dissimilarity. The molecular sequence data of \u003cem\u003eOdontotermes badius\u003c/em\u003e originating from Ondo State in the present study generated has 707 bp.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe species was identified from leaf litter in a disturbed area under a cashew tree in Alejolowo, near the North Gate of the Federal University of Technology, Akure. \u003cem\u003eOdontotermes badius\u003c/em\u003e encountered in Nigeria could also be destructive to the cashew tree where it was collected if proper control was not done to curb its infestation. Ondo State, part of Nigeria's moist rainforest zone, hosts high termite diversity, with over thirty species reported in a single region (Olugbemi \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). However, \u003cem\u003eO. badius\u003c/em\u003e was yet to be documented in this area. The species reported in this study was not found in the Nigerian checklist of termites where only six \u003cem\u003eOdontotermes\u003c/em\u003e species were reported (Onagbola \u0026amp; Scheffrahn, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Several species in the genus \u003cem\u003eOdontotermes\u003c/em\u003e have been reported to be economically important in Africa because they are mainly wood feeders, thereby destroying wood and wooden structures (Ahmed et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). \u003cem\u003eOdontotermes\u003c/em\u003e sp. has been reported on Kwara State University campus (Adeoye et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and other economically important plantations such as teak (Adeoye et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and \u003cem\u003eEucalyptus\u003c/em\u003e (Alamu et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Also, wooden structures in buildings were destroyed by \u003cem\u003eOdontotermes badius\u003c/em\u003e in South Africa (Uys \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). The use of both morphological and molecular identifications may increase the certainty of the taxonomical identification, which is key in biodiversity studies.\u003c/p\u003e \u003cp\u003eThe information on the molecular analysis of \u003cem\u003eO. badius\u003c/em\u003e is important because most of the termites reported in Nigeria have not been identified molecularly. It was illustrated from the molecular information of \u003cem\u003eO. badius\u003c/em\u003e reported here that there was a high percentage of A\u0026thinsp;+\u0026thinsp;T of the COI gene fragment which varied from 53.95 to 60.08 while the G\u0026thinsp;+\u0026thinsp;C percentage ranged from 39.92 to 46.05. Nucleotide variation of higher A\u0026thinsp;+\u0026thinsp;T composition is one of the general features of COI mitochondrial fragments of many arthropods (Mangold et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Many researchers have proven that A\u0026thinsp;+\u0026thinsp;T composition is always higher than the G\u0026thinsp;+\u0026thinsp;C composition in the COI sequence of termites. Based on the DNA sequence of the COI gene of some Indian termites, the A\u0026thinsp;+\u0026thinsp;T percentage ranged from 62.98 to 64.35% (Mandakini et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOndo State is a moist rainforest ecological zone in Nigeria resulting in a high intensification of land use. This intensification is an important factor in determining species richness and diversity and could indicate the presence of a high diversity of termite species in the area (Olugbemi, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Termites also play important roles in the ecological and economic function of the area, thereby leading to high agricultural practices in the zone. More research is required in all the ecological zones of Nigeria as there could be more species that are exotic or yet to be recorded in Nigeria. Identification of species using molecular analysis is very useful because most of the insects in Nigeria and other African countries have not been reported with their molecular information.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eList of Abbreviations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Alhaji Alejolowo of Alejolowo block industry for allowing AA to collect samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe conception and design of the study were jointly developed by AAA and JAO. AAA was responsible for material preparation and data collection. The methodology was crafted by AAA and AO. The phylogenetic analysis and interpretation of the data was carried out by RAC and SOO. The initial manuscript draft was written by AAA, and all authors provided feedback on previous drafts. All authors reviewed and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated or analysed during the current study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work does not contain any studies involving human and animal subjects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclaimer\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe findings and conclusions in this publication have not been formally disseminated by the U.S. Department of Agriculture and should not be construed to represent any Agency determination or policy. Any mention of trade names or commercial products in this publication is solely to provide specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAbdullahi, J. M. \u0026amp; Saleh, J. B. (2020). Rapid Biodiversity Evaluation of the Arboreal Termites in Kano University of Science and Technology, Wudil, Nigeria\u003cem\u003e. BioScientific Review,\u003c/em\u003e 2(2), 33\u0026ndash;40\u003cem\u003e.\u0026nbsp;\u003c/em\u003ehttps://doi.org/10.32350/BSR.0202.04\u003c/li\u003e\n \u003cli\u003eAdeoye A.A., Ojo J.A. \u0026amp; Ajao A.M. (2024). Species composition, relative abundance and diversity of termites (Blattodea: Insecta: Isoptera) in the Kwara State University Campus, Malete, Kwara State, Nigeria. \u003cem\u003eAgricultura Tropica et Subtropica,\u0026nbsp;\u003c/em\u003e57, 108-115.\u003c/li\u003e\n \u003cli\u003eAdeoye, A. A., Ojo, J. A. Ajao A. M., Obembe, A. \u0026amp; Oladipo, S. O. (2023). Assessments of Termite Infestation and Diversity at the University of Ilorin Teak (\u003cem\u003eTectona grandis\u003c/em\u003e) Plantation. \u003cem\u003eLAUTECH Crop and Environmental Review,\u003c/em\u003e 4(1), 16\u0026ndash;30\u003c/li\u003e\n \u003cli\u003eAhmad, M. (1949). On the identity of \u003cem\u003eOdontotermes\u0026nbsp;\u003c/em\u003e(Isoptera, Termitidae). \u003cem\u003eAmerican Museum \u0026nbsp;\u003c/em\u003e\u003cem\u003eNovitates,\u0026nbsp;\u003c/em\u003e1392: 1\u0026ndash;11.\u003c/li\u003e\n \u003cli\u003eAhmad, M. (1965). Termites (Isoptera) of Thailand. \u003cem\u003eAmerican Museum of Natural History\u0026nbsp;\u003c/em\u003e131, 1\u0026ndash;114\u003c/li\u003e\n \u003cli\u003eAhmed (Shiday), B. M., Nkunika, P. O. Y., Sileshi, G. W., French, J. R. J., Nyeko, P. \u0026amp; Jain, S. Potential Impact of Climate Change on Termite Distribution in Africa. \u003cem\u003eBritish Journal of Environment and Climate Change,\u0026nbsp;\u003c/em\u003e1(4), 172\u0026ndash;189\u003c/li\u003e\n \u003cli\u003eAlamu, O. T., Ewete, F. K. \u0026amp; Jimoh, S. O. (2018). Occurrence and diversity of termite species in \u003cem\u003eEucalyptus\u0026nbsp;\u003c/em\u003eplantations in Afaka, Kaduna state, Nigeria. \u003cem\u003eJournal\u003c/em\u003e\u003cem\u003e\u0026nbsp;of Research in Forestry,\u0026nbsp;\u003c/em\u003e\u003cem\u003eWildlife and Environment\u003c/em\u003e, 10(2), 33\u0026ndash;38\u003c/li\u003e\n \u003cli\u003eEmerson, A.E\u003cem\u003e.\u003c/em\u003e (\u003ccite\u003e1928).\u0026nbsp;\u003c/cite\u003eTermites of the Belgian Congo and the Cameroon. \u003cem\u003eBulletin of American \u0026nbsp;\u003c/em\u003e\u003cem\u003eMuseum of Natural History,\u0026nbsp;\u003c/em\u003e57, 212\u0026ndash;222\u003c/li\u003e\n \u003cli\u003eHammer, O., Harper, D. A. T. \u0026amp; Ryan, P. D. (2001). PAST: Paleontological Statistics software package for education and data analysis. \u003cem\u003ePalaeontologia Electronica,\u003c/em\u003e 4, 1\u0026ndash;9.\u003c/li\u003e\n \u003cli\u003eHaviland, G. D. (1898). Observations on termites; with descriptions of new species. \u003cem\u003eJournal of \u0026nbsp;\u003c/em\u003e\u003cem\u003ethe Linnean Society of London, Zoology\u003c/em\u003e, 26 (169), 358\u0026ndash;442 + 4 pls.\u003c/li\u003e\n \u003cli\u003eHellemans, S., Rocha, M. M., Wang, M., Arias, J. R., Aanen, D. K.,Bagn\u0026egrave;res, A-G., Buček, A., Carrijo, T. F., Chouvenc, T., Cuezzo, C., Constantini, J. P., Constantino, R., Dedeine, F., Deligne, J, Eggleton, P., Evans, T. A., Hanus, R., Harrison, M. C., Harry, M., Josens, G., Jouault, C., Kalleshwaraswamy, C. M., Kaymak, E., Korb, J., Lee, C-Y., Legendre, F., Li, H-F., Lo, N., Lu, T., Matsuura, K., Maekawa, K., McMahon, D. P., Mizumoto, N., Oliveira, D. E., Poulsen, M., Sillam-Duss\u0026egrave;s, D., Su, N-Y., Tokuda, G., Vargo, E. L., Ware, J. I., \u0026Scaron;obotn\u0026iacute;k, J., Scheffrahn, R. H., Cancello, E., Roisin, Y., Engel, M. S. \u0026amp; Bourguignon. T. (2024). Genomic data provide insights into the classification of extant termites. \u003cem\u003eNature\u003c/em\u003e \u003cem\u003eCommunications,\u003c/em\u003e 15, 6724. https://doi.org/10.1038/s41467-024-51028-y\u003c/li\u003e\n \u003cli\u003eHolmgren, N. (1909). Termitenstudien. 1. \u003cem\u003eAnatomische Untersuchungen. Kungliga Svenska\u0026nbsp;\u003c/em\u003e\u003cem\u003eVetenskaps-Akademiens Handlingar\u003c/em\u003e, 44 (3), 1\u0026ndash;215 + 3 pls.\u003c/li\u003e\n \u003cli\u003eJones, D.T. \u0026amp; Eggleton, P. (\u003ccite\u003e2000).\u0026nbsp;\u003c/cite\u003eSampling Termite Assemblages in Tropical Forests: Testing a Rapid Biodiversity Assessment Protocol. \u003cem\u003eJournal of Applied Ecology,\u003c/em\u003e 37, 191\u0026ndash;203. https://doi. org/10.1046/j.1365-2664.2000.00464.x\u003c/li\u003e\n \u003cli\u003eKalyaanamoorthy, S., Minh, B. Q., Wong, T. K. F., von Haeseler, A. \u0026amp; Jermiin, L. S. (2017). ModelFinder: Fast model selection for accurate phylogenetic estimates. \u003cem\u003eNational Methods,\u003c/em\u003e 14, 587\u0026ndash;589. https://doi.org/10.1038/nmeth.4285\u003c/li\u003e\n \u003cli\u003eKatoh, K., Rozewicki, J. \u0026amp; Yamada, K. D. (2019). MAFFT Online Service: Multiple Sequence Alignment, Interactive Sequence Choice and Visualization. \u003cem\u003eBriefings in Bioinformatics,\u003c/em\u003e 20, 1160\u0026ndash;1166. https://doi.org/10.1093/bib/bbx108\u003c/li\u003e\n \u003cli\u003eKrishna, K., Grimaldi, D. A., Krishna, V. \u0026amp; Engel, M. S.\u003ccite\u003e\u0026nbsp;(2013).\u003c/cite\u003e Treatise on the Isoptera of the World. \u003cem\u003eBulletin of the American Museum of Natural History,\u003c/em\u003e 377, 1\u0026ndash;200. https://doi.org/10.1206/377.1\u003c/li\u003e\n \u003cli\u003eMandakini, S., Neha, G., Sobti, R. C. \u0026amp; Sharma, V. L. (2015). Estimating molecular phylogeny of some Indian termites combining partial COI sequences. \u003cem\u003eJournal of Entomology and Zoology Studies,\u003c/em\u003e 3(6), 213\u0026ndash;218\u003c/li\u003e\n \u003cli\u003eMangold, A. J., Barques, M. D. \u0026amp; Mas-Coma, S. (1998). Mitochondrial 16Sr DNA sequences and phylogenetic relationships of species of Riphicephalus and other tick genera among \u003cem\u003eMetastriata\u003c/em\u003e (Acari: Ixodidae). \u003cem\u003eParasitology Research,\u003c/em\u003e 84(6), 478\u0026ndash;484\u003c/li\u003e\n \u003cli\u003eMinh, B. Q., Schmidt, H. A., Chernomor, O., Schrempf, D., Woodhams, M. D., von Haeseler, A. \u0026amp; Lanfear, R. (2020). IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. \u003cem\u003eMolecular Biology and Evolution,\u003c/em\u003e 37, 1530\u0026ndash;1534. https://doi.org/10.1093/molbev/msaa015\u003c/li\u003e\n \u003cli\u003eMuvengwi, J. (2017). Relationships between termite (\u003cem\u003eMacrotermes\u003c/em\u003e) mound distribution, plant diversity and large mammalian herbivory patterns in Gonarezhou National Park, Zimbabwe (Thesis). hdl:10539/22729\u003c/li\u003e\n \u003cli\u003eOlugbemi, B.O. (2013). Termite assemblages and decomposition of tissue paper baits along a gradient of land use intensification in Owena, Southwest, Nigeria. \u003cem\u003eApplied ecology and environmental research,\u003c/em\u003e 11(2), 223\u0026ndash;235\u003c/li\u003e\n \u003cli\u003eOnagbola, E. O. \u0026amp; Scheffrahn, R. H. (2019). Checklist of Nigerian termites (Blattodea, Isoptera): An update. \u003cem\u003eAfrican Entomology,\u003c/em\u003e 27(2), 000\u0026ndash;000\u003c/li\u003e\n \u003cli\u003eRoonwal, M. L. (1969). Measurement of termites (Isoptera) for taxonomic purposes. \u003cem\u003eJournal of \u0026nbsp;\u003c/em\u003e\u003cem\u003ethe Zoological Society of India,\u003c/em\u003e 21, 9\u0026ndash;66. Sornnuwat, Y., Vongkaluang, C. \u0026amp; Takematsu, Y. (2004). A systematic key to termites of Thailand. \u003cem\u003eKasetsart Journal National Science,\u0026nbsp;\u003c/em\u003e38, 349\u0026ndash;368\u003c/li\u003e\n \u003cli\u003eTamura, K., Stecher, G. \u0026amp; Kumar, S. (2021). MEGA11: Molecular Evolutionary Genetics Analysis version 11. \u003cem\u003eMolecular Biology and Evolution\u003c/em\u003e 38(7), 3022\u0026ndash;3027. https://doi:10.1093/molbev/msab120\u003c/li\u003e\n \u003cli\u003eUys, V. (2002). A guide to the termite genera of Southern Africa. 1st Edn. Plant Protection Research Institute Agricultural Research Council, Pretoria, ISBN: 1-86849-216-8, 116\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eVan Der Westhuizen, G. C. A. \u0026amp; Eicker, A. (1990). Species of \u003cem\u003eTermitomyces\u003c/em\u003e occurring in South Africa. \u003cem\u003eMycological Research,\u003c/em\u003e 94(7), 923\u0026ndash;37\u003c/li\u003e\n \u003cli\u003eZaman, M., Khan, I. A., Schmidt, S., Murphy, R. \u0026amp; Poulsen, M. (2022). Morphometrics, Distribution, and DNA Barcoding: An Integrative Identification Approach to the Genus \u003cem\u003eOdontotermes\u003c/em\u003e (Termitidae: Blattodea) of Khyber Pakhtunkhwa, Pakistan. \u003cem\u003eForests,\u003c/em\u003e 13, 674. https://doi.org/10.3390/f13050674\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Odontotermes badius, report, serious pests, Nigeria, Africa","lastPublishedDoi":"10.21203/rs.3.rs-8215578/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8215578/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eOdontotermes\u003c/em\u003eHolmgren, 1910 is a common genus of termites in Africa with several species found in different regions within the continent. These species have been reported to be serious pests of agriculture. \u003cem\u003eOdontotermes badius \u003c/em\u003eHaviland (1898) was first reported in South Africa but has not been reported in Nigeria. Only six \u003cem\u003eOdontotermes \u003c/em\u003especies have been reported in Nigeria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e This new report of \u003cem\u003eO. badius \u003c/em\u003efor the first time in Nigeria with morphological and molecular confirmation illustrates the seventh \u003cem\u003eOdontotermes \u003c/em\u003especies in the country.\u003c/p\u003e","manuscriptTitle":"Morphological and molecular characterization of Odontotermes badius Haviland, 1898 (Blattodea: Macrotermitinae), with the first report from Nigeria","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-31 08:45:07","doi":"10.21203/rs.3.rs-8215578/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"708ade1f-1b1b-4554-87bf-90f2c698fb4d","owner":[],"postedDate":"December 31st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-10T19:54:13+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-31 08:45:07","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8215578","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8215578","identity":"rs-8215578","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}