Hazardous Effects of Heavy Metal Pollution on Histological and Gene Expression Profiles of Nile Tilapia in the Eastern Delta, Egypt Aquatic Ecosystems | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Hazardous Effects of Heavy Metal Pollution on Histological and Gene Expression Profiles of Nile Tilapia in the Eastern Delta, Egypt Aquatic Ecosystems Walaa M. Shaalan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3960734/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Heavy metal pollution threatens the biodiversity and ecological equilibrium of the Nile River. This study investigates the impact of heavy metal pollution on aquatic animal as Nile tilapia (Oreochromis niloticus) in the Damietta branch of the River Nile and El-Rayah El-Tawfeeky, in Benha city in Egypt. Fish and water samples were subsequently analyzed using ICP-OES revealing significantly higher concentrations of Mg, Cd, Hg, Cr, Cu, Ni, Pb, and Zn in fish muscle tissues collected from Damietta branch compared to El-Rayah El-Tawfeeky samples. Histopathological examinations revealed noteworthy alterations in tilapia gill, liver, spleen, and muscle tissues, suggesting potential health risks. Gene expression analysis using RT-qPCR indicated significant changes in genes related to muscle growth (MyoD, IGF-1) and immune response (TNFa, IL6) in fish from Damietta branch relative to fish of El-Rayah El-Tawfeeky. The findings raise concerns about bioaccumulation and potential health implications for consumers. The study underscores the significance of continuous monitoring, utilizing chemical, histopathological, and molecular tools as bioindicators for environmental protection measures against aquatic pollution. heavy metals gene expression River Nile Oreochromis niloticus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The increased heavy metals pollution is alarming and threatens the worldwide aquatic ecosystem. Heavy metals can come to the water from a variety of sources including idol immersion, dumping hospital, emptying of sewers, recreational activities, etc. However, the natural sources of heavy metals are through ore-bearing rocks, forest fires, vegetation, and windblown dust (Hama Aziz et al., 2023). The River Nile is the main resource of water along Egypt. After Cairo the Nile tracks the westnorth direction and then bifurcates into two main branches at El-kanater El-khayriya. The two branches are the Damietta branch and Rossetta branch that enclose the Delta in between. There is another canal called El-Rayah El-Twfeeky that was constructed in 1889 which starts from the Damietta branch at El-kanater El-khayrya as described in (Fig. 1). The Nile River and its branches face serious ecological challenges due to water pollution (El-Saadani et al., 2022). Numerous discharges from point and non-point sources have contaminated the Nile River (AbouelFadl et al., 2016). According to (Authman et al., 2013), The biodiversity of aquatic fish can be adversely affected by metal pollution in the Nile River and its branches, which can alter the natural equilibrium of the river environment. Although the heavy metals Cu, Co, Fe, and Zn are essential micronutrients for living things, excessive concentrations of them can be harmful. Cr, Pb, Hg, As, and Cd heavy metals are microelements that are carcinogenic and does not have any beneficial impact on living animals (Sadak, 2023). Even at lower concentrations, cadmium, lead, tin, and chromium show significant toxicity (Jaishankar et al., 2014). Heavy metals are known to be non-biodegradable and to be deposited, integrated, and bioaccumulated in aquatic habitats, which in turn affects aquatic creatures (Briffa et al., 2020). The bioaccumulation level of heavy metals in fish tissues is affected by biotic and abiotic factors, such as water temperature, pH of water, concentration of dissolved oxygen, fish biological habitat, body mass, and physiologic conditions (Castro-González & Méndez-Armenta, 2008). Fish health and physiological processes are negatively affected by the bioaccumulation of heavy metals in fish (Malik & Maurya, 2014). The type of fish, the concentration of the metals, and the length of exposure all have a substantial impact on the degree of metal toxicity that may be carcinogenic, teratogenic, and/or mutagenic (Ngo et al., 2011). Heavy metals have adverse effects on the nervous system of the fish (Jamil Emon et al., 2023). Fish exposed to heavy metal pollution have decreased gonadosomatic indexes (GSI), fecundities, fertilization rates, and hatching rates, which all have an adverse effect on fish growth and reproductive activity (Gárriz et al., 2019). Therefore, heavy metals may have a negative impact on a number of metabolic processes in developing embryos, which may lead to morphological and functional abnormalities, developmental retardation, or even death in the most vulnerable cases. Furthermore, heavy metals trigger energy-intensive detoxification procedures, which means that less energy may be used for growth in inebriated fish (Sfakianakis et al., 2015). The heavy metals in the aquatic ecosystem can enter the food chain beginning from the fish gills, digestive system, and skin. Then most of them were distributed into the fish body through the blood stream until reach the fillet that can be consumed by human (Jamil Emon et al., 2023). The nutritional value of fish to human is its high-quality protein and inclusion of 2 types of Omega-3 unsaturated fatty acid (Saini et al., 2021). Omega-3 can make protection from different heart disease, thrombosis, reduction of blood clotting (Rodriguez et al., 2022). However, the presence of heavy metal in fish fillet can adverse the benefits of omega-3 in fish and its beneficial effect on heart health (Downer et al., 2017). In addition, heavy metals can be accumulated in food chain and have a major negative impact on human health, including cancer, by increasing their biomagnification over time (Mitra et al., 2022). The native Egyptian species The Nile tilapia ( Oreochromis niloticus ), that has expanded worldwide, mostly due to its value as it is easy to raise and reproduce in a variety of fish culture methods (Authman et al., 2012). O. niloticus is a widespread species of freshwater fish utilized in toxicological investigations, primary field research, and laboratory research (Abidemi-Iromini et al., 2022). To ensure that a sustainable ecosystem continues to function well into the future, it is crucial to monitor the concentration of heavy metals and evaluate the degrees of contamination in the aquatic system. Monitoring heavy metal pollution in aquatic environments using fish tissues facilitates to evaluate aquatic ecosystem’s quality. Fish tissue contamination can serve as a crucial early warning indicator of sediment pollution and/or related water quality issues (Authman et al., 2015). Fish tissue contamination can be evaluated for pollution's effects on fish, metal concentrations in fish that are dangerous for human consumption can be found, and appropriate action can be taken for the preservation of the environment, public health, and socioeconomic reasons (Panda et al., 2023). The goal of the current study is to assess the levels of heavy metals in the muscle, liver, spleen, and gill tissues of Nile tilapia ( Oreochromis niloticus ) fish as well as in water samples taken from the same Damitta branch study locations in Benha City. determining the level of pollution, evaluating the use of tilapia fish as a bioindicator for heavy metal pollution, and creating a model for environmental safety in locations with comparable pollution. Materials and Methods Field study and sample collection Fish (O. niloticus) and water samples were collected from Damietta branch of River Nile in Benha and the reference site. Samples of water were taken between 10 and 20 cm below the water's surface. Using a drag net and assistance from local fisherman, 120 adult fish total with average body lengths of 18.19 ± 0.46, 16.51 ± 0.35 cm and average body weights of 68.85 ± 3.26, 62.54 ± 2.45 g were caught from the two study sites. The animals were handled and collected according to the guidelines of the Animal Ethics Committee of Faculty of Science, Benha University, Egypt, approval (BUFS-REC-2024-114Zoo). An overdose of MS222 (Syndel USA, Ferndale, WA) was used to euthanize several fish samples. Samples of muscle were taken in liquid nitrogen and immediately kept at -80 °C. Measuring heavy metals in in water and muscle samples Inductively coupled plasma optical emission spectrometry (ICP-OES) (Perkin Elmer, Optima 4100DV) was used to examine the muscle tissue and water samples after they had been treated with nitric acid and filtered through a glass filter (0.45 ml pore diameter) in accordance with the procedure outlined in APHA (2005). For the muscle samples, they were prepared for measuring heavy metals according to FAO (1993). Using deionized water, serial dilution of 5, 10, 15, 20, 25, and 30 mg/L were prepared from a stock solution of 1000 mg/L of Aluminum, Arsenic , Cadmium , Cobalt , Chromium , Copper , Nickel , Lead & Strontium. To create the Standard curve, these standards were measured using ICP. Subsequently, WINLAB32 software measured the samples' concentration using this curve. The results were expressed in terms of mircograms per kilogram dry weight. Human risk assessment The evaluation of fish exposed to the reported doses of heavy metals was done by calculating the average daily human consumption dose (ADD) (Khallaf et al., 2018) of specific each metal according to the following equation : ADD (mg/kg/day) = [(C *IR*EF*ED) / (BW*AT)] where IR is the average intake rate, which is 0.1424 kg day−1 for habitual fish eaters and 0.0312 kg day−1 for normal people, and C is the concentration of heavy metals in fish muscle (mg kg−1). The factors denoted by EF, ED, BW, and AT stand for exposure frequency (365 days per year), exposure duration (70 years), body weight (70 kg for average individuals), and mean lifespan (70 years × 365 days per year). Hazard index (HI) was calculate for risk assessment, according to the equation presented by (Omar et al., 2013)using the RfD (the heavy metals' oral reference dose, expressed in mg/kg per day) that is the upper limit of human metal consumption with average body weight of 70 kg. The upper limits for the studied heavy metals Mg, Cd, Hg, Cr, Cu, Ni, Pb, Zn are 0.06, 0.001, 0.006, 2.5, 0.14, 0.012, 0.025, and 0.214 according to ("WHO Guidelines Approved by the Guidelines Review Committee," 2022): Hazard index (HI) = ADD/oral RfD It was reported risk effects to human, when the HI is ≥ 1.0 (Omar et al., 2013). Histological studies analysis Samples of small muscle, gill, liver, and spleen tissue were taken and preserved immediately in 10% neutral buffered formalin. Hematoxylin and eosin (H&E stain) was applied to sections that had been cut into 5 µm thickness using the technique outlined by Bancroft and Gamble (2008). RNA extraction and investigation of gene expression TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to isolate total RNA from each fish (eight fish per location, randomly chosen) and reverse transcribed in accordance with the manufacturer's instructions of the reverse transcriptase kit (Shaalan & Iskandar, 2022). Real-time quantitative PCR (RT-PCR) was performed using SYBR green, and the fold change of the target genes between the two studied sites was determined by using the 2^-ΔΔCT method with B-actin acting as the internal control (Shaalan et al., 2019). The primers were designed using primer3 software as listed in table1. Statistical analysis SPSS software was used to statistically analyze the heavy metal concentration results. The information was displayed as mean ± standard deviation (SD). Microsoft Excel was used to compute and report the fold change that represents the gene expression. Results Heavy metals level in water and tissue samples The concentration of Mg, Cd, Hg, Cr, Cu, Ni, Pb, and Zn in muscle tissue were significantly increased in El-Ryah El-Tawfeek River samples compared to the River Nile samples (p < 0.05) and compared to the references doses given by WHO 2008 (Table 2). The concentration of the measured metals are Zn, Mg, Cr, Cu, Pb, Ni, Hg, and Cd from high to low concentration. The concentrations of heavy metals in the Dammietta River fish were significantly increased compared to the reference published doses. The habitual fish eater from the Damietta River branch showed prediction for risk effect from Ni, Mg, and Pb metals. While the normal fish eater from the same site does not show any risk effects. On the other hand, habitual fish eaters were at risk from all the tested metals except Cu and Cr measured in fish muscle collected from El-Rayah El-Tawfeeky River. While the Normal fish eaters are in risk from the exposure to cd and Ni metals. All water samples collected the two studied sites were significant increase compared to the reference dose reported by (WHO 2008). However, there is a significant increase in Mg, Cr, Cu, and Zn metals (Table 3) for water samples collected from El-Rayah El-Tawfeeky River compared to these collected from The Damietta River Nile (p < 0.05). Histopathological analysis of gill, liver, spleen, and muscle in Damietta River Nile Some histopathological changes were recognized in tilapia fish collected from the Damietta River Nile. The microscopic examination of the gills of Nile tilapia revealed mild histopathological changes where the secondary lamellae of these gills were covered by thin layer of single epithelium. The gill filaments were covered by stratified epithelium with aggregation of few mononuclear cells in some of these filaments (Fig. 2A). Partial fusion of some secondary lamellae and aggregation of some inflammatory cells in gill filaments, mainly lymphocytes were also seen (Fig. 2B). Focal areas of hepatocellular degenerative changes in the form of hydropic and vacuolar degeneration of hepatocytes with focal aggregation of few lymphocytes in-between hepatocytes and activation of kupffer cells were the main detectable microscopic changes in the examined Tilapia liver (Fig.2C). However, aggregation of some melanomacrophages within the hepatopancreas was also recorded (Fig. 2D). The microscopic examination of the spleen showed normal cyto-architecture of the spleen. The examined spleen was covered by a thin capsule and contained red and white pulps with ellipsoids and melanomacrophage centers which formed from aggregation of macrophages and melanin pigments scattered throughout the splenic parenchyma (Fig. 2F). The examined muscles tissue of tilapia showed normal histological structure of these muscles where unbranched and elongated muscle fibers with peripheral flattened nuclei and loose collagenous tissue in-between these muscle fibers were found (Fig.2E). Histopathological analysis of gill, liver, spleen, and muscle in El-Rayah El-Tawfeeky The examined gill of tilapia collected from El-Rayah El-Tawfeeky revealed severe histopathological changes. Mononuclear inflammatory cellular aggregation in the gill filaments with activation of mucous cells were prevalent lesions particularly at the tip of these filaments (Fig.3A). Fusion of secondary lamellae with extensive inflammatory cellular infiltration of gill filament was also prominent (Fig.3B). In addition, focal areas of desquamation and necrosis of gill lamellar epithelium were detected (Fig.3C). Moreover, congestion with aggregation of mononuclear cells and eosinophilic granule cells (EGCs) in the gill arch with proliferation of mucous cells were also recognized (Fig. 3D). Multiple areas of necrosis and degeneration of the hepatocytes with perivascular lymphocytic cellular aggregation were scattered throughout the examined liver of tilapia (Fig. 3E). Mononuclear infiltration of the hepatopancreas and hyperplasia of the bile ductal epithelium were detected (Fig.3F& G). Moreover, vacuolation of the pancreatic acini was also noticed in the hepatopancreas (Fig.3H). The examined spleen revealed thickening of the splenic capsule due to fibrous connective tissue proliferation with severe depletion of the splenic hematopoietic tissue and necrosis of the ellipsoidal sheaths (Fig. 3J). In addition, destruction of melanomacrophage centers was prevalent in the examined spleen (Fig.3K). Moreover, perivascular edema and aggregation of melanomacrophage cells around splenic blood vessels were also recorded (Fig. 3L). Vacuolation and even cavitation of the muscles were the main microscopic changes recorded in the skeletal muscles of tilapia (Fig.3I) Relative gene expression of MyoD, IGF-1, TNFa, and IL6 The Expression of some genes that have a critical role in muscle growth and immunity have been measured by RT-qPCR using B-actin gene as a reference gene for normalization. The results of gene expression of MyoD in muscle tissue showed a significant decrease in its expression in the samples of El- Rayah El-Tawfeky relative to that of the Damietta River Nile samples (p≤0.05). In addition to reporting a significant decrease in IGF-1 gene in muscle tissue of the fish from El-Rayah El-Tawfeky relative to the River Nile fish as in (Fig. 4). on studying the gene expression of TNFa and IL6 genes in spleen tissue. It was recorded a significant increase in TNFa gene by 25.69-folds in fish from El-Rayah El-Tawfeeky relative to that from Damietta River Nile as showed in (Fig. 5). IL6 gene was revealed a significant increase by 5.22 folds in fish samples collected from El-Rayah El-Tawffeky relative to that from Damietta River Nile (p≤0.05). Discussion A variety of sources, including the Earth's crust, sewage spills, agricultural practices, and oil extraction, can introduce heavy metals into the aquatic ecosystem. Metals that have entered sediment are accessible to the ecology because they haven't completely dissolved from their solid phase (Yozukmaz & Yabanlı, 2023). Because they are bioavailable, dissolved metals can build up in aquatic life. Subsequently, The fish live in this ecosystem may absorb heavy metals through their gills, gut, or food chain (Rajeshkumar & Li, 2018). The present study reported different concentration of Mg, Cd, Hg, Cr, Cu, Ni, Pb, and Zn metals in water samples collected from El-Rayah El-Tawfeeky River and the Damietta River Nile. The large concentrations of pollution in water systems are caused by the disposal of dead animals and the dumping of sewage into the canal (El-Kowrany et al., 2016). This finding was also reported in Alexandria (Haidar et al., 2006). Previous studies revealed that most sites of River specially when their was low flow seasons have higher concentrations of Mn, Ni, and Cd (Al-Afify & Abdel-Satar, 2020). It was measured high concentrations of Zn, Mg, Cr, Cu, Pb, Ni, Hg, and Cd metals in fish muscles of El-Rayah El-Tawfeeky River compared to the Damietta River Nile branch. Rivers get silt from a variety of point and diffuse sources, which settles at the bottom and may be a source of metal accumulation in the aquatic food chain due to the biomagnification process (Debnath et al., 2021). In the current study, it was recorded for Zn to be in highest concentration in fish muscle. The same result was reported for fish collected from Southern Caspian Sea, Iran (Tabari et al., 2010). previously It was reported by (Ahmad et al., 2015) that fish species from Rabul River in Pakistan have a concentration of chromium 489-703 mg/kg. In addition, fish species from Calicut in India reported 0.74µg/g of chromium (Sankar et al., 2006). It was measured by (Sankar et al., 2006) that Mn has concentration of 0.5 mg/kg in marine fish species from Kochi Waters. Several fish species collected from Indian waters recorded 2.9 µg/g Mn concentration (Kumar et al., 2011). It was reported that fish collected from Kabul River of Pakistan has 75-135 µg/g of Nickel (Ahmad et al., 2015), while it was measured from those collected from Iskenderum Bay of Turky to have 0.11-12.9 µg/g (Türkmen et al., 2005). In the present study, the concentrations of copper in Tilapia muscle were 54.4 and 38.9 mg/kg in fish from El-Rayah El-Tawfeeky and Damietta River branch, respectively. El Rayah- el tawfeeky reported higher concentration of copper more than that was reported in fish collected from Bangshi River (8.33-43.18 mg/kg) in Bangladesh (Rahman et al., 2012). Previous study in Peral River Delta, China reported (0.02–0.06 μg/g) cadmium (Leung et al., 2014), while it was 0.09-0.89 mg/kg in Bangshi River, Bangladesh (Velusamy et al., 2014). It was recorded a high concentration of Hg in some fish species of Red see (Younis et al., 2021). Lead concentration was reported to be 0.22-0.85 mg/kg in middle Black sea Turky (Tuzen, 2009) and different species from Red sea (Younis et al., 2021). Unusually large metal inputs into the aquatic environment have damaged commercial fisheries, caused significant financial losses, and in certain circumstances, posed health risks to humans (Banerjee, 2003).It was reported that the fish collected from El-Rayah El-Tawfeky River Showed risk effects, from all measured metals to human how mostly have the fish in their meal. Researchers gave a great attention to the heavy metal in aquatic environments due to its great concerns about their accumulation and toxic effects in aquatic organisms and human through the food chain (Tchounwou et al., 2012). Histopathological study It was reported that some histopathological changes in tilapia fish collected from the Damietta River Nile (DRN) compared to fish collected from El-Rayah El-Tawfeeky branch (RTB). Gills are the first target for pollution being in close contact with the surrounding environment and the primary site for heavy metal absorption. Therefore, the histopathological alterations of gills were generally attributed to the toxic effects of heavy metals. It was reported previously that fish exposed to metals have also been observed to exhibit similar gill changes (Ayoola & Alajabo, 2012; Ayoola & Alajabo). It has been demonstrated that the histology of the gills reflects various environmental circumstances for fish and is susceptible to copper exposure (Ayoola & Alajabo, 2012). In the present study there was a fusion of secondary lamellae with extensive inflammatory cellular infiltration of gill filament. The same results were reported for grass carp exposed to heavy metals (Shah et al., 2020). It was observed hepatocellular degeneration and activation of Kupffer cells in the tested DNR tilapia liver. Moreover, necrosis, degeneration of hepatocytes, and hyperplasia of bile ductal epithelium were observed in RTB. Melanomacrophages, hypertrophy, and biological disarray were noted in the fish treated with various aluminum doses by (Alibraheemi, 2019). A high concentration of pollutants that cause hepatocyte loss could be the cause of the necrosis seen in the centrilobular zone (Rajamanickam & Narayanan, 2009). The examined spleen of tilapia fish collected from RTB revealed thickening of splenic capsule, decrease in splenic hematopiotic tissue, necrosis, and edema. The observed data is consistent with the research conducted by (David & Kartheek, 2015), which examined immune suppression in the rainbow trout splenic region after exposure to various chemical toxicant concentrations. Given certain physiological and histological circumstances, might result in changes to the spleen (Garcia-Abiado et al., 2004; Gogal et al., 1999). It was observed vacuolation and cavitation of the muscles of tilapia collected from the Damietta River branch. Lates calcarifer exposed to copper had thickening and separation of muscular bundles with significant oedema (Maharajan et al., 2016). It was previously reported for tilapia fish exposed to heavy elements and microbes contaminants to have degeneration, necrosis, atrophy, and disintegration of muscular bundles in addition to enlargement of the muscle fiber (Dawood et al., 2023). Gene expression analysis Understanding the extent of harm is a crucial component of ecotoxicological study, and tissue specific gene expression is considered as biomarker which indicates the kind, degree, and condition of alterations that need to be thoroughly investigated. Numerous researchers have also carried out investigations using tissue-specific expression levels (Kessabi et al., 2023). Different stressors was studied to affect muscle growth like that was for reported for tilapia (Shaalan et al., 2023). After the liver and spleen, muscle exhibits a notable increase in gene expression due to the bioaccumulative nature of heavy metals. The present study revealed a significant decrease in MyoD and IGF-1 gene expression in Tilapia muscle of RNB compared to that from DRN. The myogenic determining factor (MyoD) gene is one of the muscle specific transcription factors that control the development of the muscle, proliferation, myofibril formation (Zammit, 2017). It was reported that the fish MyoD gene was negatively affected by different stressors. It was revealed the low expression of myoD gene in gibel carp fish which was exposed to 168 h of acute thermal stress (Hu et al., 2023). MyoD and Myf5 are two examples of the muscle-specific genes whose transcription is modulated by Wnt signaling during myogenesis via PKA and the transcription factor CREB (Chen et al., 2005). It was reported previously that Wnt signaling pathways are vulnerable to heavy metal exposure in the environment and are essential for regular cellular processes (Khalid et al., 2021). Previous study presented the effects of zinc and cobalt exposure on rainbow trout's IGF-I, IGF-II, and GH expression levels. It was reported that the exposure of rainbow trout for time to zinc and cobalt resulted in significantly decrease of the expressions of IGF-1 gene and that may be due to the interactions between these metals and metal binding proteins (Ekinci et al., 2011). On the other hand, the results showed a significant increase in TNFa and IL6 gene expression in Tilapia spleen of RNB compared to that from DRN. In Asian carp head kidney, there was a positive correlation found between the expression of mir155 and the mRNA levels of proinflammatory cytokines, such as TNF-α (Jing et al., 2020). It was revealed that the biomolecular response to exposure of D. Setosum to Cd heavy metals demonstrated that TNF-α protein expression, activation, and concentration increased as the concentration of Cd-containing heavy metals increase (Rumahlatu et al., 2019). Oxidative stress is one of the basic chemical mechanisms that underlies toxicity caused by metals (Chen et al., 2018). Certain cellular inflammatory factors such as IL-6 and immunological factors are significantly changed when the immune system is repressed (Jantawongsri et al., 2021). It was measured that the IL-6 was significantly increased in carp spleen exposed to Difenoconazole (Liu et al., 2022). This implies that heavy metals may target MyoD gen in muscle as well as TNF-a and IL-6 genes in spleen in order to cause harmful consequences. Our findings suggest that exposure to heavy metals causes immunological system malfunction and muscle atrophy in addition to spleen tissue damage. Tissue damage, immunosuppression brought on by heavy metal exposure, oxidative stress, inflammation, and apoptosis are all deeply interrelated. Conclusion and recommendations In the present study, the use of various biomarkers at different levels for identification of the heavy metal pollution in Tilapia fish and the surrounding water. It gives indication about the health condition of the fish and the risk effect to the consumer. The data provided in this study justifies one of the most harmful kinds of pollution that cannot be denied which must affect the environment. These toxins threaten the aquatic fish and the human population. The levels of bioaccumulation of heavy metals in fish muscle were on the verge of exceeding safety thresholds in the studied sites, raising concerns for the health of consumers. As a result, it is important to regularly check the metal levels in fish species found in Benha Damietta Branch and El-Rayah El-Tawfeeky branch. The best way to protect these sites from ongoing pollution is to keep waste out of the watershed, lower environmental risks, and regularly monitor the riverine ecosystem before metal levels rise too high and endanger aquatic life as well as humans. The study's findings might provide decision-makers with new information on how to better safeguard the River Nile, branches and related canals from potentially dangerous hazards. Declarations Data Availability All data supporting the findings of this study are available within the paper. Funding Information The authors did not receive support from any organization for the submitted work. Author Contribution W. M. S. conducted the experiment, analyzed the data, wrote and revised the manuscript. Conflict of Interest The authors have no competing interests to declare that are relevant to the content of this article. Ethical Statement The experiments were approved by Ethics committee of faculty of Science, Benha university, Egypt, protocol (BUFS-REC-2024-114Zoo). References Abidemi-Iromini, A. O., Bello-Olusoji, O. A., & Adebayo, I. A. (2022). Bioaccumulation of heavy metals in silver catfish (Chrysichthys nigrodigitatus) and tilapia fish (Oreochromis niloticus) from the brackish and freshwater in South-West, Nigeria. The Journal of Basic and Applied Zoology , 83 (1), 18. https://doi.org/10.1186/s41936-022-00272-z AbouelFadl, K., Aly, W., Abdelreheem, A., Mahmoud, U., Hamed, H., Moustafa, M., & Osman, A. (2016). Heavy Metals Levels in the Blood of Oreochromis niloticus niloticus and Clarias gariepinus as Biomarkers of Metal Pollution in the River Nile. International Journal of Ecotoxicology and Ecobiology , 1 . Ahmad, H., Yousafzai, A. M., Siraj, M., Ahmad, R., Ahmad, I., Nadeem, M. S., . . . Muhammad, K. (2015). Pollution Problem in River Kabul: Accumulation Estimates of Heavy Metals in Native Fish Species. Biomed Res Int , 2015 , 537368. https://doi.org/10.1155/2015/537368 Al-Afify, A. D. G., & Abdel-Satar, A. M. (2020). Risk assessment of heavy metal pollution in water, sediment and plants in the Nile River in the Cairo region, Egypt. Oceanological and Hydrobiological Studies , 49 (1), 1-12. https://doi.org/doi:10.1515/ohs-2020-0001 Alibraheemi, A. (2019). Histopathological changes in gills, liver and kidney of fresh water fish, Tilapia zillii, exposed to aluminum. Authman, M., Abbas, W., & Gaafar, A. (2012). Metals concentrations in Nile tilapia Oreochromis niloticus (Linnaeus, 1758) from illegal fish farm in Al-Minufiya Province, Egypt, and their effects on some tissues structures. Ecotoxicology and environmental safety , 84 , 163-172. https://doi.org/10.1016/j.ecoenv.2012.07.005 Authman, M., Ibrahim, S. A., El-Kasheif, M., & Gaber, H. (2013). Heavy metals pollution and their effects on gills and liver of the nile catfish Clarias gariepinus inhabiting El-Rahawy drain, Egypt. Global Veterinaria , 10 , 103-115. https://doi.org/10.5829/idosi.gv.2013.10.2.71226 Authman, M., Zaki, M., Khallaf, E., & Abbas, H. (2015). Use of Fish as Bio-indicator of the Effects of Heavy Metals Pollution. J Aquaculture Research and Development , J Aquaculture Research and Development , 328. https://doi.org/10.4172/2155-9546.1000328 Ayoola, S. O., & Alajabo, O. (2012). Acute Toxicity and Histopathological Effects of Engine Oil on Sarotherodon melanotheron (Black Jaw Tilapia). American-Eurasian J. Toxicol. Sci. , 4 . Ayoola, S. O., & Alajabo, O. T. Acute toxicity and histopathological effects of engine oil on Sarotherodon melanotheron (black jaw tilapia). 4 (1), 48–55. Briffa, J., Sinagra, E., & Blundell, R. (2020). Heavy metal pollution in the environment and their toxicological effects on humans. Heliyon , 6 (9), e04691. https://doi.org/https://doi.org/10.1016/j.heliyon.2020.e04691 Castro-González, M. I., & Méndez-Armenta, M. (2008). Heavy metals: Implications associated to fish consumption. Environmental Toxicology and Pharmacology , 26 (3), 263-271. https://doi.org/https://doi.org/10.1016/j.etap.2008.06.001 Chen, A. E., Ginty, D. D., & Fan, C. M. (2005). Protein kinase A signalling via CREB controls myogenesis induced by Wnt proteins. Nature , 433 (7023), 317-322. https://doi.org/10.1038/nature03126 Chen, P., Bornhorst, J., Diana Neely, M., & Avila, D. S. (2018). Mechanisms and Disease Pathogenesis Underlying Metal-Induced Oxidative Stress. Oxid Med Cell Longev , 2018 , 7612172. https://doi.org/10.1155/2018/7612172 David, M., & Kartheek, R. M. (2015). Histopathological alterations in spleen of freshwater fish Cyprinus carpio exposed to sublethal concentration of sodium cyanide. Open Vet J , 5 (1), 1-5. Dawood, A.-F. B., Aly, A. A., Ibrahim, M., Andrade Laborde, J. E., Abusharha, A., Rezk, M. M., . . . Rabie, M. M. (2023). Biophysical, histological, and bioaccumulation properties of Tilapia muscle affected by water pollution with heavy elements and microbes at the El-Rahawy drain in Egypt. Heliyon , 9 (3), e14489. https://doi.org/https://doi.org/10.1016/j.heliyon.2023.e14489 Debnath, A., Singh, P. K., & Chandra Sharma, Y. (2021). Metallic contamination of global river sediments and latest developments for their remediation. Journal of Environmental Management , 298 , 113378. https://doi.org/https://doi.org/10.1016/j.jenvman.2021.113378 Downer, M. K., Martínez-González, M. A., Gea, A., Stampfer, M., Warnberg, J., Ruiz-Canela, M., . . . Investigators, P. S. (2017). Mercury exposure and risk of cardiovascular disease: a nested case-control study in the PREDIMED (PREvention with MEDiterranean Diet) study. BMC Cardiovascular Disorders , 17 (1), 9. https://doi.org/10.1186/s12872-016-0435-8 Ekinci, D., Ceyhun, S. B., Aksakal, E., & Erdoğan, O. (2011). IGF and GH mRNA levels are suppressed upon exposure to micromolar concentrations of cobalt and zinc in rainbow trout white muscle. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology , 153 (3), 336-341. https://doi.org/https://doi.org/10.1016/j.cbpc.2010.12.004 El-Kowrany, S. I., El- Zamarany, E. A., El-Nouby, K. A., El-Mehy, D. A., Abo Ali, E. A., Othman, A. A., . . . El-Ebiary, A. A. (2016). Water pollution in the Middle Nile Delta, Egypt: An environmental study. Journal of Advanced Research , 7 (5), 781-794. https://doi.org/https://doi.org/10.1016/j.jare.2015.11.005 El-Saadani, Z., Mingqi, W., He, Z., Hamukwaya, S. L., Abdel Wahed, M. S. M., & Abu Khatita, A. (2022). Environmental Geochemistry and Fractionation of Cadmium Metal in Surficial Bottom Sediments and Water of the Nile River, Egypt. Toxics , 10 (5). https://doi.org/10.3390/toxics10050221 Garcia-Abiado, M. A., Mbahinzireki, G., Rinchard, J., Lee, K. J., & Dabrowski, K. (2004). Effect of diets containing gossypol on blood parameters and spleen structure in tilapia, Oreochromis sp., reared in a recirculating system. J Fish Dis , 27 (6), 359-368. https://doi.org/10.1111/j.1365-2761.2004.00551.x Gogal, R. M., Jr., Smith, B. J., Robertson, J. L., Smith, S. A., & Holladay, S. D. (1999). Tilapia (Oreochromis niloticus) dosed with azathioprine display immune effects similar to those seen in mammals, including apoptosis. Vet Immunol Immunopathol , 68 (2-4), 209-227. https://doi.org/10.1016/s0165-2427(99)00024-0 Gárriz, Á., del Fresno, P. S., Carriquiriborde, P., & Miranda, L. A. (2019). Effects of heavy metals identified in Chascomús shallow lake on the endocrine-reproductive axis of pejerrey fish (Odontesthes bonariensis). General and Comparative Endocrinology , 273 , 152-162. https://doi.org/https://doi.org/10.1016/j.ygcen.2018.06.013 Haidar, S. A. A., Omar, E. A., Sherif, A. A. R., & El-Sahn, A. A. (2006). Cryptosporidiosis among Children Living in Rural and Urban Settings in Alexandria. Journal of High Institute of Public Health , 36 (1), 1-18. https://doi.org/10.21608/jhiph.2006.160185 Hama Aziz, K. H., Mustafa, F. S., Omer, K. M., Hama, S., Hamarawf, R. F., & Rahman, K. O. (2023). Heavy metal pollution in the aquatic environment: efficient and low-cost removal approaches to eliminate their toxicity: a review. RSC Adv , 13 (26), 17595-17610. https://doi.org/10.1039/d3ra00723e Hu, Q., Lu, J., Yang, Y., Li, D., & Liu, J. (2023). Acute Thermal Stress Reduces Skeletal Muscle Growth and Quality in Gibel Carp (Carassius gibelio). Water , 15 (15). Jaishankar, M., Tseten, T., Anbalagan, N., Mathew, B. B., & Beeregowda, K. N. (2014). Toxicity, mechanism and health effects of some heavy metals. Interdiscip Toxicol , 7 (2), 60-72. https://doi.org/10.2478/intox-2014-0009 Jamil Emon, F., Rohani, M. F., Sumaiya, N., Tuj Jannat, M. F., Akter, Y., Shahjahan, M., . . . Goh, K. W. (2023). Bioaccumulation and Bioremediation of Heavy Metals in Fishes-A Review. Toxics , 11 (6). https://doi.org/10.3390/toxics11060510 Jantawongsri, K., Nørregaard, R. D., Bach, L., Dietz, R., Sonne, C., Jørgensen, K., . . . Nowak, B. (2021). Histopathological effects of short-term aqueous exposure to environmentally relevant concentration of lead (Pb) in shorthorn sculpin (Myoxocephalus scorpius) under laboratory conditions. Environmental Science and Pollution Research , 28 (43), 61423-61440. https://doi.org/10.1007/s11356-021-14972-6 Jing, H., Zhang, Q., Li, S., & Gao, X.-j. (2020). Pb exposure triggers MAPK-dependent inflammation by activating oxidative stress and miRNA-155 expression in carp head kidney. Fish & Shellfish Immunology , 106 , 219-227. https://doi.org/https://doi.org/10.1016/j.fsi.2020.08.015 Kessabi, K., Abbassi, A., Lahmar, S., Casado, M., Banni, M., Piña, B., & Messaoudi, I. (2023). Combined toxic effects of cadmium and environmental microplastics in Aphanius fasciatus (Pisces, Cyprinodontidae). Marine Environmental Research , 189 , 106071. https://doi.org/https://doi.org/10.1016/j.marenvres.2023.106071 Khalid, M., Hodjat, M., & Abdollahi, M. (2021). Environmental Exposure to Heavy Metals Contributes to Diseases Via Deregulated Wnt Signaling Pathways. Iran J Pharm Res , 20 (2), 370-382. https://doi.org/10.22037/ijpr.2021.114897.15089 Khallaf, E. A., Authman, M. M. N., & Alne-na-ei, A. A. (2018). Contamination and Ecological Hazard Assessment of Heavy Metals in Freshwater Sediments and Oreochromis niloticus (Linnaeus, 1758) Fish Muscles in a Nile River Canal in Egypt. Environmental Science and Pollution Research , 25 (14), 13796-13812. https://doi.org/10.1007/s11356-018-1521-5 Kumar, B., Shah, R., & Mukherjee, D. (2011). Geochemical distribution of heavy metals in sediments from sewage fed fish ponds from Kolkata Wetlands, India. Chemical Speciation & Bioavailability , 23 (1), 24-32. https://doi.org/10.3184/095422911X12966667026105 Leung, H. M., Leung, A. O., Wang, H. S., Ma, K. K., Liang, Y., Ho, K. C., . . . Yung, K. K. (2014). Assessment of heavy metals/metalloid (As, Pb, Cd, Ni, Zn, Cr, Cu, Mn) concentrations in edible fish species tissue in the Pearl River Delta (PRD), China. Mar Pollut Bull , 78 (1-2), 235-245. https://doi.org/10.1016/j.marpolbul.2013.10.028 Liu, F., Li, X., Bello, B. K., Zhang, T., Yang, H., Wang, K., & Dong, J. (2022). Difenoconazole causes spleen tissue damage and immune dysfunction of carp through oxidative stress and apoptosis. Ecotoxicology and Environmental Safety , 237 , 113563. https://doi.org/https://doi.org/10.1016/j.ecoenv.2022.113563 Maharajan, A., Kitto, M. R., Paruruckumani, P. S., & Ganapiriya, V. (2016). Histopathology biomarker responses in Asian sea bass, Lates calcarifer (Bloch) exposed to copper. The Journal of Basic & Applied Zoology , 77 , 21-30. https://doi.org/https://doi.org/10.1016/j.jobaz.2016.02.001 Malik, D. S., & Maurya, P. K. (2014). Heavy metal concentration in water, sediment, and tissues of fish species (Heteropneustis fossilis and Puntius ticto) from Kali River, India. Toxicological & Environmental Chemistry , 96 (8), 1195-1206. https://doi.org/10.1080/02772248.2015.1015296 Mitra, S., Chakraborty, A. J., Tareq, A. M., Emran, T. B., Nainu, F., Khusro, A., . . . Simal-Gandara, J. (2022). Impact of heavy metals on the environment and human health: Novel therapeutic insights to counter the toxicity. Journal of King Saud University - Science , 34 (3), 101865. https://doi.org/https://doi.org/10.1016/j.jksus.2022.101865 Ngo, H. T. T., Gerstmann, S., & Frank, H. (2011). Subchronic effects of environment-like cadmium levels on the bivalve Anodonta anatina (Linnaeus 1758): III. Effects on carbonic anhydrase activity in relation to calcium metabolism. Toxicological & Environmental Chemistry , 93 (9), 1815-1825. https://doi.org/10.1080/02772240802503619 Omar, W. A., Zaghloul, K. H., Abdel-Khalek, A. A., & Abo-Hegab, S. (2013). Risk Assessment and Toxic Effects of Metal Pollution in Two Cultured and Wild Fish Species from Highly Degraded Aquatic Habitats. Archives of Environmental Contamination and Toxicology , 65 (4), 753-764. https://doi.org/10.1007/s00244-013-9935-z Panda, B. P., Mohanta, Y. K., Parida, S. P., Pradhan, A., Mohanta, T. K., Patowary, K., . . . Sarma, H. (2023). Metal pollution in freshwater fish: A key indicator of contamination and carcinogenic risk to public health. Environ Pollut , 330 , 121796. https://doi.org/10.1016/j.envpol.2023.121796 Rahman, M. S., Molla, A. H., Saha, N., & Rahman, A. (2012). Study on heavy metals levels and its risk assessment in some edible fishes from Bangshi River, Savar, Dhaka, Bangladesh. Food Chemistry , 134 (4), 1847-1854. https://doi.org/https://doi.org/10.1016/j.foodchem.2012.03.099 Rajamanickam, V., & Narayanan, M. (2009). Heavy Metal Induced Histopathological Alterations in Selected Organs of the Cyprinus carpio L.(Common Carp). International Journal of Environmental Research (ISSN: 1735-6865) Vol 3 Num 1 , 3 . Rajeshkumar, S., & Li, X. (2018). Bioaccumulation of heavy metals in fish species from the Meiliang Bay, Taihu Lake, China. Toxicol Rep , 5 , 288-295. https://doi.org/10.1016/j.toxrep.2018.01.007 Rodriguez, D., Lavie, C. J., Elagizi, A., & Milani, R. V. (2022). Update on Omega-3 Polyunsaturated Fatty Acids on Cardiovascular Health. Nutrients , 14 (23). https://doi.org/10.3390/nu14235146 Rumahlatu, D., Duran-Corebima, A., Amin, M., & Rohman, F. (2019). Effect of cadmium on the concentration and expression of TNF-α protein in sea urchin Diadema setosum (Leske, 1778). Hidrobiológica: [revista del Departamento de Hidrobiología] , 29 , 181-188. https://doi.org/10.24275/uam/izt/dcbs/hidro/2020v29n3/Rumahlatu Sadak, O. (2023). Chapter 15 - Chemical sensing of heavy metals in water. In A. Barhoum & Z. Altintas (Eds.), Advanced Sensor Technology (pp. 565-591). Elsevier. https://doi.org/https://doi.org/10.1016/B978-0-323-90222-9.00010-8 Saini, R. K., Prasad, P., Sreedhar, R. V., Akhilender Naidu, K., Shang, X., & Keum, Y. S. (2021). Omega-3 Polyunsaturated Fatty Acids (PUFAs): Emerging Plant and Microbial Sources, Oxidative Stability, Bioavailability, and Health Benefits-A Review. Antioxidants (Basel) , 10 (10). https://doi.org/10.3390/antiox10101627 Sankar, T. V., Zynudheen, A. A., Anandan, R., & Viswanathan Nair, P. G. (2006). Distribution of organochlorine pesticides and heavy metal residues in fish and shellfish from Calicut region, Kerala, India. Chemosphere , 65 (4), 583-590. https://doi.org/10.1016/j.chemosphere.2006.02.038 Sfakianakis, D. G., Renieri, E., Kentouri, M., & Tsatsakis, A. M. (2015). Effect of heavy metals on fish larvae deformities: A review. Environmental Research , 137 , 246-255. https://doi.org/https://doi.org/10.1016/j.envres.2014.12.014 Shaalan, W., Allah, N., El-Serafy, S., & Salem, M. (2023). Molecular Characterization and Expression of Calpains and Cathepsins in Tilapia Muscle in Response to Starvation. Turkish Journal of Fisheries and Aquatic Sciences , 23 , 21895. https://doi.org/10.4194/TRJFAS21895 Shaalan, W. M., El-Hameid, N. A. A., El-Serafy, S. S., & Salem, M. (2019). Expressions and characterization of MuRFs, Atrogin-1, F-box25 genes in tilapia, Oreochromis niloticus, in response to starvation. Fish Physiol Biochem , 45 (4), 1321-1330. https://doi.org/10.1007/s10695-019-00667-w Shaalan, W. M., & Iskandar, M. (2022). Impact of soft drink on skeletal formation indicated by RSPO2, HAO1, and RUNX2 gene expressions. Alfarama Journal of Basic & Applied Sciences , 3 (2), 300-314. https://doi.org/10.21608/ajbas.2022.119909.1087 Shah, N., Khan, A., Ali, R., Marimuthu, K., Uddin, M. N., Rizwan, M., . . . Khisroon, M. (2020). Monitoring Bioaccumulation (in Gills and Muscle Tissues), Hematology, and Genotoxic Alteration in Ctenopharyngodon idella Exposed to Selected Heavy Metals. Biomed Res Int , 2020 , 6185231. https://doi.org/10.1155/2020/6185231 Tabari, S., Saravi, S. S., Bandany, G. A., Dehghan, A., & Shokrzadeh, M. (2010). Heavy metals (Zn, Pb, Cd and Cr) in fish, water and sediments sampled form Southern Caspian Sea, Iran. Toxicol Ind Health , 26 (10), 649-656. https://doi.org/10.1177/0748233710377777 Tchounwou, P. B., Yedjou, C. G., Patlolla, A. K., & Sutton, D. J. (2012). Heavy metal toxicity and the environment. Exp Suppl , 101 , 133-164. https://doi.org/10.1007/978-3-7643-8340-4_6 Tuzen, M. (2009). Toxic and essential trace elemental contents in fish species from the Black Sea, Turkey. Food Chem Toxicol , 47 (8), 1785-1790. https://doi.org/10.1016/j.fct.2009.04.029 Türkmen, A., Türkmen, M., Tepe, Y., & Akyurt, İ. (2005). Heavy metals in three commercially valuable fish species from İskenderun Bay, Northern East Mediterranean Sea, Turkey. Food Chemistry , 91 (1), 167-172. https://doi.org/https://doi.org/10.1016/j.foodchem.2004.08.008 Velusamy, A., Satheesh Kumar, P., Ram, A., & Chinnadurai, S. (2014). Bioaccumulation of heavy metals in commercially important marine fishes from Mumbai Harbor, India. Mar Pollut Bull , 81 (1), 218-224. https://doi.org/10.1016/j.marpolbul.2014.01.049 WHO Guidelines Approved by the Guidelines Review Committee. (2022). In Guidelines for drinking-water quality: Fourth edition incorporating the first and second addenda. World Health Organization © World Health Organization 2022. Younis, E. M., Abdel-Warith, A. A., Al-Asgah, N. A., Elthebite, S. A., & Mostafizur Rahman, M. (2021). Nutritional value and bioaccumulation of heavy metals in muscle tissues of five commercially important marine fish species from the Red Sea. Saudi J Biol Sci , 28 (3), 1860-1866. https://doi.org/10.1016/j.sjbs.2020.12.038 Yozukmaz, A., & Yabanlı, M. (2023). Heavy Metal Contamination and Potential Ecological Risk Assessment in Sediments of Lake Bafa (Turkey). Sustainability , 15 (13). Zammit, P. S. (2017). Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin Cell Dev Biol , 72 , 19-32. https://doi.org/10.1016/j.semcdb.2017.11.011 Tables Table (1) Primers of RT-PCR Gene name Forward primer Reverse primer Accession number MyoD ACGCATGTACTCCAGTCCAA CAGTGAACACAGCAGTCGTC XM_025907525.1 IGF-1 CACCCTCTCACTACTGCTGT CACAGTACATCTCAAGGCGC NM_001279503.1 TNFa CATCTTTCCGGGTTGACTGC CTGCAGAGTACCAGTTCCCA XM_025902124.1 IL6 TTTCTTGCTACATGGCCACG CCTCATGATCTCAAACCGCG XM_005448195.3 B-actin TCTCGGCTGTGGTGGTGAA GACCCACACAGTGCCCATCT XM_003455949 Table (2) the heavy concentrations in muscle tissue of Oreochromis niloticus in mg/kg muscle weight. El Rayah El Tawfeeky Damietta River Nile Concentration (mg/kg) HI (H.) HI (N.) Concentration (mg/kg) HI (H.) HI (N.) Mg 74.533±0.075 *a 2.527 0.553 59.146±0.980 * 2.005 0.439 Cd 2.286±0.115 *a 4.651 1.019 0.270±0.053 * 0.549 0.120 Hg 10.360±0.075 *a 3.512 0.7696 1.500±0.030 * 0.508 0.111 Cr 63.020±0.346 *a 0.051 0.011 38.853±0.449 * 0.031 0.006 Cu 54.406±0.116 *a 0.790 0.173 38.986±0.991 * 0.566 0.124 Ni 23.560±0.019 *a 3.993 0.875 20.823±0.106 * 3.530 0.773 Pb 33.403±2.068 *a 2.718 0.595 14.673±0.723 * 1.193 0.261 Zn 212.086±4.328 *a 2.016 0.441 99.930±0.370 * 0.949 0.208 Table (3) the heavy metals concentrations in water samples from the selected sites in mg/L. Max allowable conc. (mg/L) El-Rayah El-Tawfeeky Water (mg/L) Damietta River Nile Water (mg/L) Mg 0.4 0.757±0.004 *a 0.589±0.006 * Cd 0.00001 0.238±0.008 * 0.241±0.011 * Hg 0.002 0.153±0.006 * 0.135±0.008 * Cr 0.05 0.437±0.004 *a 0.381±0.015 * Cu 1.5 0.545±0.012 *a 0.359±0.025 * Ni 0.07 0.244±0.004 * 0.222±0.023 * Pb 0.1 0.152±0.002 * 0.146±0.006 * Zn 0.01 1.044±0.015 *a 0.975±0.022 * Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3960734","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":274369692,"identity":"31f612d6-1eab-40e9-86e8-c38b2610a18f","order_by":0,"name":"Walaa M. Shaalan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABI0lEQVRIiWNgGAWjYBACgwPMDSA6gYEdSH6wARISID4bPi2MUC3MDAyMM9JI1cLMQ5SW4wcbP/xgqMvjb2Z+9tgmoU6eQbrHgOFD2WEGfv4FWLWYnUlsluxhOFwscZjN3Dgn4bBhg8wZA8YZ5w4zSM54gF3LgcQGCR4GIHmYwUw698eBBAaJHANm3rbDDAY3DmDXcv5h888/DHWJ8w+zf5O2SKiDaPkL1GKPQ4v9jcQ2aR4G5sQNh3nMpBkSmCFaGEG28Ddg1WJ542GbtYzB4cSNh3nKJHuAfmmTOVZwsOdcOo/EDRwhdj758M03FXWJ8463b5P4AQwxfunmjQ9+lFnL8fdjdxhUIxIbFCMgtTwMEgl4tGAH/PhsGQWjYBSMghEEAMCvYOlh1XKsAAAAAElFTkSuQmCC","orcid":"","institution":"Benha University","correspondingAuthor":true,"prefix":"","firstName":"Walaa","middleName":"M.","lastName":"Shaalan","suffix":""}],"badges":[],"createdAt":"2024-02-16 08:36:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3960734/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3960734/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51528488,"identity":"6d99a675-20cf-4d85-903e-e79d3651dccc","added_by":"auto","created_at":"2024-02-23 06:32:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":499615,"visible":true,"origin":"","legend":"\u003cp\u003eRiver Nile in Egypt and Delta branches. A and B the sites at Damietta branch and El-Rayah El-Tawfeeky branch.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-3960734/v1/dc0d50765688ff870ea78fa2.png"},{"id":51528487,"identity":"35ab14ec-3472-4325-b988-bcdc779a426a","added_by":"auto","created_at":"2024-02-23 06:32:22","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1228433,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrograph of gills (A \u0026amp;B), Liver (C\u0026amp;D) Skeletal muscles (E) spleen (F) of tilapia collected from Damietta branch of River Nile. H\u0026amp;E stain X 200. A. Secondary lamellae covered by thin layer of single epithelium (SL) oriented perpendicular to the gill filament (GF) covered by a stratified epithelium with aggregation of few mononuclear cells. B. partial fusion of some secondary lamellae (arrows) with aggregation of few inflammatory cells in gill filament . C. hydropic and vacuolar degeneration of some hepatocytes with activation of kupffer cells(arrows). D. aggregation of melanomacrophages within the hepatopancreas(arrows). E. unbranched and elongated muscle fibers with peripheral flattened nuclei and loose collagenous tissue in-between the muscle fibers. F. splenic red and white pulps with two melanomacrophage centers (arrows).\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3960734/v1/c6c6da94768537174bb9d1c5.jpeg"},{"id":51528691,"identity":"a27d5f40-4f32-4c92-8aed-b482a191482c","added_by":"auto","created_at":"2024-02-23 06:40:22","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":830655,"visible":true,"origin":"","legend":"\u003cp\u003ePhotomicrograph of gills (A-D), Liver (E-H) Skeletal muscles (I) spleen (J-L) of tilapia collected from El-Rayah El-Tawfeeky. H\u0026amp;E stain X 200. A. mononuclear cellular aggregation in the tip of the gill filament with activation of mucous cells. B. extensive inflammatory cellular infiltration of gill filament with fusion of secondary lamellae C. necrosis of the gill lamellae (arrows). D. aggregation of mononuclear cells and eosinophilic cell in the gill arch with activation of mucous cells. E. necrosis and degeneration of the hepatocytes with perivascular lymphocytic cellular aggregation. F. extensive degeneration of hepatic cells with mononuclear infiltration of the hepatopancreas (arrows). G. bile ductal hyperplasia H. Vacuolation of the pancreatic acini. I. vacuolation of the skeletal muscles. J. severe depletion of the splenic hematopoietic tissue and necrosis of the ellipsoidal sheath. K. destruction of melanomacrophage center. L. perivascular edema with aggregation of melanomacrophage cells around splenic blood vessel.\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3960734/v1/f1b23aa023eac414e35a04e2.jpeg"},{"id":51528486,"identity":"1b5c0744-d52d-49c7-b957-f7e589326905","added_by":"auto","created_at":"2024-02-23 06:32:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":13470,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential gene expression of MyoD and IGF-1 genes in tilapia muscle in the studied sites. The gene expressions were determined by qPCR. The B- actin was used to normalize the data. The expression was represented by fold change between El-Rayah El-Tawfeeky relative to the River Nile samples ± standard deviation where n = 8 and p≤ 0.05.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-3960734/v1/d68bea56f4eb122394b3fac5.png"},{"id":51528490,"identity":"ab0b6d66-ed31-48e6-882b-8c98e2519c8d","added_by":"auto","created_at":"2024-02-23 06:32:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":11052,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential gene expression of TNFa and IL6 genes in tilapia spleen in the studied sites. The gene expressions were determined by qPCR. The B- actin was used to normalize the data. The expression was represented by fold change between El-Rayah El-Tawfeeky relative to the River Nile samples ± standard deviation where n = 8 and p≤ 0.05.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-3960734/v1/0feea80ffc80996ac1813fdf.png"},{"id":51565390,"identity":"e4cf7110-7fbf-4200-a2ea-2f9aa830f963","added_by":"auto","created_at":"2024-02-23 19:01:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1677719,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3960734/v1/62830b4d-f43f-439e-a31c-1028ab9caecc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Hazardous Effects of Heavy Metal Pollution on Histological and Gene Expression Profiles of Nile Tilapia in the Eastern Delta, Egypt Aquatic Ecosystems","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe increased heavy metals pollution is alarming and threatens the worldwide aquatic ecosystem. Heavy metals can come to the water from a variety of sources including idol immersion, dumping hospital, emptying of sewers, recreational activities, etc. However, the natural sources of heavy metals are through ore-bearing rocks, forest fires, vegetation, and windblown dust (Hama Aziz et al., 2023). The River Nile is the main resource of water along Egypt. After Cairo the Nile tracks the westnorth direction and then bifurcates into two main branches at El-kanater El-khayriya. The two branches are the Damietta branch and Rossetta branch that enclose the Delta in between. There is another canal called El-Rayah El-Twfeeky that was constructed in 1889 which starts from the Damietta branch at El-kanater El-khayrya as described in (Fig. 1). The Nile River and its branches face serious ecological challenges due to water pollution (El-Saadani et al., 2022).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNumerous discharges from point and non-point sources have contaminated the Nile River\u0026nbsp;(AbouelFadl et al., 2016). According to\u0026nbsp;(Authman et al., 2013), The biodiversity of aquatic fish can be adversely affected by metal pollution in the Nile River and its branches, which can alter the natural equilibrium of the river environment. Although the heavy metals Cu, Co, Fe, and Zn are essential micronutrients for living things, excessive concentrations of them can be harmful.\u0026nbsp;Cr, Pb, Hg, As, and Cd heavy metals are microelements that are carcinogenic and does not have any beneficial impact on living animals\u0026nbsp;(Sadak, 2023). Even at lower concentrations, cadmium, lead, tin, and chromium show significant toxicity\u0026nbsp;(Jaishankar et al., 2014). Heavy metals are known to be non-biodegradable and to be deposited, integrated, and bioaccumulated in aquatic habitats, which in turn affects aquatic creatures\u0026nbsp;(Briffa et al., 2020). The bioaccumulation level of heavy metals in fish tissues is affected by biotic and abiotic factors, such as water temperature, pH of water, concentration of dissolved oxygen, fish biological habitat, body mass, and physiologic conditions\u0026nbsp;(Castro-Gonz\u0026aacute;lez \u0026amp; M\u0026eacute;ndez-Armenta, 2008). Fish health and physiological processes are negatively affected by the bioaccumulation of heavy metals in fish\u0026nbsp;(Malik \u0026amp; Maurya, 2014). The type of fish, the concentration of the metals, and the length of exposure all have a substantial impact on the degree of metal toxicity that may be carcinogenic, teratogenic, and/or mutagenic\u0026nbsp;(Ngo et al., 2011). Heavy metals have adverse effects on the nervous system of the fish\u0026nbsp;(Jamil Emon et al., 2023). Fish exposed to heavy metal pollution have decreased gonadosomatic indexes (GSI), fecundities, fertilization rates, and hatching rates, which all have an adverse effect on fish growth and reproductive activity\u0026nbsp;(G\u0026aacute;rriz et al., 2019). Therefore, heavy metals may have a negative impact on a number of metabolic processes in developing embryos, which may lead to morphological and functional abnormalities, developmental retardation, or even death in the most vulnerable cases. Furthermore, heavy metals trigger energy-intensive detoxification procedures, which means that less energy may be used for growth in inebriated fish\u0026nbsp;(Sfakianakis et al., 2015).\u003c/p\u003e\n\u003cp\u003eThe heavy metals in the aquatic ecosystem can enter the food chain beginning from the fish gills, digestive system, and skin. Then most of them were distributed into the fish body through the blood stream until reach the fillet that can be consumed by human (Jamil Emon et al., 2023). The nutritional value of fish to human is its high-quality protein and inclusion of 2 types of Omega-3 unsaturated fatty acid (Saini et al., 2021). Omega-3 can make protection from different heart disease, thrombosis, reduction of blood clotting (Rodriguez et al., 2022). However, the presence of heavy metal in fish fillet can adverse the benefits of omega-3 in fish and its beneficial effect on heart health (Downer et al., 2017). In addition, heavy metals can be accumulated in food chain and have a major negative impact on human health, including cancer, by increasing their biomagnification over time (Mitra et al., 2022).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe native Egyptian species The Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e), that has expanded worldwide, mostly due to its value as it is easy to raise and reproduce in a variety of fish culture methods\u0026nbsp;(Authman et al., 2012). O. niloticus is a widespread species of freshwater fish utilized in toxicological investigations, primary field research, and laboratory research\u0026nbsp;(Abidemi-Iromini et al., 2022). To ensure that a sustainable ecosystem continues to function well into the future, it is crucial to monitor the concentration of heavy metals and evaluate the degrees of contamination in the aquatic system. Monitoring heavy metal pollution in aquatic environments using fish tissues facilitates to evaluate aquatic ecosystem\u0026rsquo;s quality. Fish tissue contamination can serve as a crucial early warning indicator of sediment pollution and/or related water quality issues\u0026nbsp;(Authman et al., 2015). Fish tissue contamination can be evaluated for pollution\u0026apos;s effects on fish, metal concentrations in fish that are dangerous for human consumption can be found, and appropriate action can be taken for the preservation of the environment, public health, and socioeconomic reasons\u0026nbsp;(Panda et al., 2023).\u003c/p\u003e\n\u003cp\u003eThe goal of the current study is to assess the levels of heavy metals in the muscle, liver, spleen, and gill tissues of Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) fish as well as in water samples taken from the same Damitta branch study locations in Benha City. determining the level of pollution, evaluating the use of tilapia fish as a bioindicator for heavy metal pollution, and creating a model for environmental safety in locations with comparable pollution.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eField study and sample collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFish (O. niloticus) and water samples were collected from Damietta branch of River Nile in Benha and the reference site. Samples of water were taken between 10 and 20 cm below the water\u0026apos;s surface. Using a drag net and assistance from local fisherman, 120 adult fish total with average body lengths of 18.19 \u0026plusmn; 0.46, 16.51 \u0026plusmn; 0.35 cm and average body weights of 68.85 \u0026plusmn; 3.26, 62.54 \u0026plusmn; 2.45 g were caught from the two study sites. The animals were handled and collected according to the guidelines of the Animal Ethics Committee of Faculty of Science, Benha University, Egypt, approval (BUFS-REC-2024-114Zoo).\u0026nbsp;An overdose of MS222 (Syndel USA, Ferndale, WA) was used to euthanize several fish samples. Samples of muscle were taken in liquid nitrogen and immediately kept at -80 \u0026deg;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasuring heavy metals in in water and muscle samples\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInductively coupled plasma optical emission spectrometry (ICP-OES) (Perkin Elmer, Optima 4100DV) was used to examine the muscle tissue and water samples after they had been treated with nitric acid and filtered through a glass filter (0.45 ml pore diameter) in accordance with the procedure outlined in APHA (2005). For the muscle samples, they were prepared for measuring heavy metals according to FAO (1993). Using deionized water, serial dilution of 5, 10, 15, 20, 25, and 30 mg/L were prepared from a stock solution of 1000 mg/L of Aluminum, Arsenic , Cadmium , Cobalt , Chromium , Copper , Nickel , Lead \u0026nbsp;\u0026amp; Strontium.\u0026nbsp;To create the Standard curve, these standards were measured using ICP. Subsequently, WINLAB32 software measured the samples\u0026apos; concentration using this curve.\u0026nbsp;The results were expressed in terms of mircograms per kilogram dry weight.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman risk assessment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe evaluation of fish exposed to the reported doses of heavy metals was done by calculating the average daily human consumption dose (ADD)\u0026nbsp;(Khallaf et al., 2018)\u0026nbsp;of specific each metal according to the following equation :\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eADD (mg/kg/day) = [(C *IR*EF*ED) / (BW*AT)]\u003c/p\u003e\n\u003cp\u003ewhere IR is the average intake rate, which is 0.1424 kg day\u0026minus;1 for habitual fish eaters and 0.0312 kg day\u0026minus;1 for normal people, and C is the concentration of heavy metals in fish muscle (mg kg\u0026minus;1). The factors denoted by EF, ED, BW, and AT stand for exposure frequency (365 days per year), exposure duration (70 years), body weight (70 kg for average individuals), and mean lifespan (70 years \u0026times; 365 days per year).\u003c/p\u003e\n\u003cp\u003eHazard index (HI) was calculate for risk assessment, according to the equation presented by\u0026nbsp;(Omar et al., 2013)using the RfD (the heavy metals\u0026apos; oral reference dose, expressed in mg/kg per day) that is the upper limit of human metal consumption with average body weight of 70 kg. The upper limits for the studied heavy metals Mg, Cd, Hg, Cr, Cu, Ni, Pb, Zn are 0.06, 0.001, 0.006, 2.5, 0.14, 0.012, 0.025, and 0.214 according to\u0026nbsp;(\u0026quot;WHO Guidelines Approved by the Guidelines Review Committee,\u0026quot; 2022):\u003c/p\u003e\n\u003cp\u003eHazard index (HI) = ADD/oral RfD\u003c/p\u003e\n\u003cp\u003eIt was reported risk effects to human, when the HI is \u0026ge;\u0026thinsp;1.0\u0026nbsp;(Omar et al., 2013). \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistological studies analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSamples of small muscle, gill, liver, and spleen tissue were taken and preserved immediately in 10% neutral buffered formalin. Hematoxylin and eosin (H\u0026amp;E stain) was applied to sections that had been cut into 5 \u0026micro;m thickness using the technique outlined by Bancroft and Gamble (2008).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and investigation of gene expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to isolate total RNA from each fish (eight fish per location, randomly chosen) and reverse transcribed in accordance with the manufacturer\u0026apos;s instructions of the reverse transcriptase kit\u0026nbsp;(Shaalan \u0026amp; Iskandar, 2022). Real-time quantitative PCR (RT-PCR) was performed using SYBR green, and the fold change of the target genes between the two studied sites was determined by using the 2^-\u0026Delta;\u0026Delta;CT method with B-actin acting as the internal control\u0026nbsp;(Shaalan et al., 2019). The primers were designed using primer3 software as listed in table1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSPSS software was used to statistically analyze the heavy metal concentration results. The information was displayed as mean \u0026plusmn; standard deviation (SD). Microsoft Excel was used to compute and report the fold change that represents the gene expression. \u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eHeavy metals level in water and tissue samples\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe concentration of Mg, Cd, Hg, Cr, Cu, Ni, Pb, and Zn in muscle tissue were significantly increased in El-Ryah El-Tawfeek River samples compared to the River Nile samples (p \u0026lt; 0.05) and compared to the references doses given by WHO 2008 (Table 2). The concentration of the measured metals are Zn, Mg, Cr, Cu, Pb, Ni, Hg, and Cd from high to low concentration. The concentrations of heavy metals in the Dammietta River fish were significantly increased compared to the reference published doses. The habitual fish eater from the Damietta River branch showed prediction for risk effect from Ni, Mg, and Pb metals. While the normal fish eater from the same site does not show any risk effects. On the other hand, habitual fish eaters were at risk from all the tested metals except Cu and Cr measured in fish muscle collected from El-Rayah El-Tawfeeky River. While the Normal fish eaters are in risk from the exposure to cd and Ni metals. All water samples collected the two studied sites were significant increase compared to the reference dose reported by (WHO 2008). However, there is a significant increase in Mg, Cr, Cu, and Zn metals (Table 3) for water samples collected from El-Rayah El-Tawfeeky River compared to these collected from The Damietta River Nile (p \u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathological analysis of gill, liver, spleen, and muscle in Damietta River Nile\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSome histopathological changes were recognized in tilapia fish collected from the Damietta River Nile. The microscopic examination of the gills of Nile tilapia revealed mild histopathological changes where the secondary lamellae of these gills were covered by thin layer of single epithelium. The gill filaments were covered by stratified epithelium with aggregation of few mononuclear cells in some of these filaments (Fig. 2A). Partial fusion of some secondary lamellae and aggregation of some inflammatory cells in gill filaments, mainly lymphocytes were also seen (Fig. 2B). Focal areas of hepatocellular degenerative changes in the form of hydropic and vacuolar degeneration of hepatocytes with focal aggregation of few lymphocytes in-between hepatocytes and activation of kupffer cells were the main detectable microscopic changes in the examined Tilapia liver (Fig.2C). However, aggregation of some melanomacrophages within the hepatopancreas was also recorded (Fig. 2D).\u0026nbsp;The microscopic examination of the spleen showed normal cyto-architecture of the spleen. The examined spleen was covered by a thin capsule and contained red and white pulps with ellipsoids and melanomacrophage centers which formed from aggregation of macrophages and melanin pigments scattered throughout the splenic parenchyma (Fig. 2F). The examined muscles tissue of tilapia showed normal histological structure of these muscles where unbranched and elongated muscle fibers with peripheral flattened nuclei and loose collagenous tissue in-between these muscle fibers were found (Fig.2E).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathological analysis of gill, liver, spleen, and muscle in El-Rayah El-Tawfeeky\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe examined gill of tilapia collected from El-Rayah El-Tawfeeky revealed severe histopathological changes. Mononuclear inflammatory cellular aggregation in the gill filaments with activation of mucous cells were prevalent lesions particularly at the tip of these filaments (Fig.3A). Fusion of secondary lamellae with extensive inflammatory cellular infiltration of gill filament was also prominent (Fig.3B). In addition, focal areas of desquamation and necrosis of gill lamellar epithelium were detected (Fig.3C). Moreover, congestion with aggregation of mononuclear cells and eosinophilic granule cells (EGCs) in the gill arch with proliferation of mucous cells were also recognized (Fig. 3D). Multiple areas of necrosis and degeneration of the hepatocytes with perivascular lymphocytic cellular aggregation were scattered throughout the examined liver of tilapia (Fig. 3E). Mononuclear infiltration of the hepatopancreas and hyperplasia of the bile ductal epithelium were detected (Fig.3F\u0026amp; G). Moreover, vacuolation of the pancreatic acini was also noticed in the hepatopancreas (Fig.3H). The examined spleen revealed thickening of the splenic capsule due to fibrous connective tissue proliferation with severe depletion of the splenic hematopoietic tissue and necrosis of the ellipsoidal sheaths (Fig. 3J). In addition, destruction of melanomacrophage centers was prevalent in the examined spleen (Fig.3K). Moreover, \u0026nbsp;perivascular edema and aggregation of melanomacrophage cells around splenic blood vessels were also recorded\u0026nbsp;(Fig. 3L). Vacuolation and even cavitation of the muscles were the main microscopic changes recorded in the skeletal muscles of tilapia (Fig.3I)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRelative gene expression of MyoD, IGF-1, TNFa, and IL6\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Expression of some genes that have a critical role in muscle growth and immunity have been measured by RT-qPCR using B-actin gene as a reference gene for normalization. The results of gene expression of MyoD in muscle tissue showed a significant decrease in its expression in the samples of El- Rayah El-Tawfeky relative to that of the Damietta River Nile samples (p\u0026le;0.05). In addition to reporting a significant decrease in IGF-1 gene in muscle tissue of the fish from El-Rayah El-Tawfeky relative to the River Nile fish as in (Fig. 4). on studying the gene expression of TNFa and IL6 genes in spleen tissue. It was recorded a significant increase in TNFa gene by 25.69-folds in fish from El-Rayah El-Tawfeeky relative to that from Damietta River Nile as showed in (Fig. 5). IL6 gene was revealed a significant increase by 5.22 folds in fish samples collected from El-Rayah El-Tawffeky relative to that from Damietta River Nile (p\u0026le;0.05). \u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eA variety of sources, including the Earth\u0026apos;s crust, sewage spills, agricultural practices, and oil extraction, can introduce heavy metals into the aquatic ecosystem. Metals that have entered sediment are accessible to the ecology because they haven\u0026apos;t completely dissolved from their solid phase\u0026nbsp;(Yozukmaz \u0026amp; Yabanlı, 2023).\u0026nbsp;Because they are bioavailable, dissolved metals can build up in aquatic life. Subsequently, The fish live in this ecosystem may absorb heavy metals through their gills, gut, or food chain\u0026nbsp;(Rajeshkumar \u0026amp; Li, 2018). The present study reported different concentration of Mg, Cd, Hg, Cr, Cu, Ni,\u0026nbsp;Pb, and Zn metals in water samples collected from El-Rayah El-Tawfeeky River and the Damietta River Nile. The large concentrations of pollution in water systems are caused by the disposal of dead animals and the dumping of sewage into the canal\u0026nbsp;(El-Kowrany et al., 2016). This finding was also reported in Alexandria\u0026nbsp;(Haidar et al., 2006). Previous studies revealed that most sites of River specially when their was low flow seasons have higher concentrations of Mn, Ni, and Cd\u0026nbsp;(Al-Afify \u0026amp; Abdel-Satar, 2020). It was measured high concentrations of Zn, Mg, Cr, Cu, Pb, Ni, Hg, and Cd metals in fish muscles of El-Rayah El-Tawfeeky River compared to the Damietta River Nile branch. Rivers get silt from a variety of point and diffuse sources, which settles at the bottom and may be a source of metal accumulation in the aquatic food chain due to the biomagnification process\u0026nbsp;(Debnath et al., 2021).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the current study, it was recorded for Zn to be in highest concentration in fish muscle. The same result was reported for fish collected from Southern Caspian Sea, Iran\u0026nbsp;(Tabari et al., 2010). previously It was reported by\u0026nbsp;(Ahmad et al., 2015)\u0026nbsp;that fish species from Rabul River in Pakistan have a concentration of chromium 489-703 mg/kg. In addition, fish species from Calicut in India reported 0.74\u0026micro;g/g of chromium\u0026nbsp;(Sankar et al., 2006). It was measured by\u0026nbsp;(Sankar et al., 2006)\u0026nbsp;that Mn has concentration of 0.5 mg/kg in marine fish species from Kochi Waters. Several fish species collected from Indian waters recorded 2.9 \u0026micro;g/g Mn concentration\u0026nbsp;(Kumar et al., 2011). It was reported that fish collected from Kabul River of Pakistan has 75-135 \u0026micro;g/g of Nickel\u0026nbsp;(Ahmad et al., 2015), while it was measured from those collected from Iskenderum Bay of Turky to have 0.11-12.9 \u0026micro;g/g\u0026nbsp;(T\u0026uuml;rkmen et al., 2005). In the present study, the concentrations of copper in Tilapia muscle were 54.4 and 38.9 mg/kg in fish from El-Rayah El-Tawfeeky and Damietta River branch, respectively. El Rayah- el tawfeeky reported higher concentration of copper more than that was reported in fish collected from Bangshi River (8.33-43.18 mg/kg) \u0026nbsp;in Bangladesh\u0026nbsp;(Rahman et al., 2012). Previous study in Peral River Delta, China reported (0.02\u0026ndash;0.06 \u0026mu;g/g) cadmium\u0026nbsp;(Leung et al., 2014), while it was 0.09-0.89 mg/kg in Bangshi River, Bangladesh\u0026nbsp;(Velusamy et al., 2014). It was recorded a high concentration of Hg in some fish species of Red see\u0026nbsp;(Younis et al., 2021). Lead concentration was reported to be 0.22-0.85 mg/kg in middle Black sea Turky\u0026nbsp;(Tuzen, 2009)\u0026nbsp;and different species from Red sea\u0026nbsp;(Younis et al., 2021).\u0026nbsp;Unusually large metal inputs into the aquatic environment have damaged commercial fisheries, caused significant financial losses, and in certain circumstances, posed health risks to humans (Banerjee, 2003).It was reported that the fish collected from El-Rayah El-Tawfeky River Showed risk effects, from all measured metals to human how mostly have the fish in their meal. Researchers gave a great attention to the heavy metal in aquatic environments due to its great concerns about their accumulation and toxic effects in aquatic organisms and human through the food chain\u0026nbsp;(Tchounwou et al., 2012).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathological study\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt was reported that some histopathological changes in tilapia fish collected from the Damietta River Nile (DRN) compared to fish collected from El-Rayah El-Tawfeeky branch (RTB). Gills are the first target for pollution being in close contact with the surrounding environment and the primary site for heavy metal absorption. Therefore, the histopathological alterations of gills were generally attributed to the toxic effects of heavy metals. It was reported previously that fish exposed to metals have also been observed to exhibit similar gill changes\u0026nbsp;(Ayoola \u0026amp; Alajabo, 2012; Ayoola \u0026amp; Alajabo). It has been demonstrated that the histology of the gills reflects various environmental circumstances for fish and is susceptible to copper exposure\u0026nbsp;(Ayoola \u0026amp; Alajabo, 2012). In the present study there was a fusion of secondary lamellae with extensive inflammatory cellular infiltration of gill filament. The same results were reported for grass carp exposed to heavy metals\u0026nbsp;(Shah et al., 2020).\u003c/p\u003e\n\u003cp\u003eIt was observed hepatocellular degeneration and activation of Kupffer cells in the tested DNR tilapia liver. Moreover, necrosis, degeneration of hepatocytes, and hyperplasia of bile ductal epithelium were observed in RTB. Melanomacrophages, hypertrophy, and biological disarray were noted in the fish treated with various aluminum doses by\u0026nbsp;(Alibraheemi, 2019). A high concentration of pollutants that cause hepatocyte loss could be the cause of the necrosis seen in the centrilobular zone\u0026nbsp;(Rajamanickam \u0026amp; Narayanan, 2009). The examined spleen of tilapia fish collected from RTB revealed thickening of splenic capsule, decrease in splenic hematopiotic tissue, necrosis, and edema. The observed data is consistent with the research conducted by\u0026nbsp;(David \u0026amp; Kartheek, 2015), which examined immune suppression in the rainbow trout splenic region after exposure to various chemical toxicant concentrations. Given certain physiological and histological circumstances, might result in changes to the spleen\u0026nbsp;(Garcia-Abiado et al., 2004; Gogal et al., 1999). It was observed vacuolation and cavitation of the muscles of tilapia collected from the Damietta River branch. \u003cem\u003eLates calcarifer\u003c/em\u003e exposed to copper had thickening and separation of muscular bundles with significant oedema\u0026nbsp;(Maharajan et al., 2016). It was previously reported for tilapia fish exposed to heavy elements and microbes contaminants to have degeneration, necrosis, atrophy, and disintegration of muscular bundles in addition to enlargement of the muscle fiber\u0026nbsp;(Dawood et al., 2023).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene expression analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUnderstanding the extent of harm is a crucial component of ecotoxicological study, and tissue specific gene expression is considered as biomarker which indicates the kind, degree, and condition of alterations that need to be thoroughly investigated. Numerous researchers have also carried out investigations using tissue-specific expression levels (Kessabi et al., 2023). Different stressors was studied to affect muscle growth like that was for reported for tilapia (Shaalan et al., 2023). After the liver and spleen, muscle exhibits a notable increase in gene expression due to the bioaccumulative nature of heavy metals. The present study revealed a significant decrease in MyoD and IGF-1 gene expression in Tilapia muscle of RNB compared to that from DRN. The myogenic determining factor (MyoD) gene is one of the muscle specific transcription factors that control the development of the muscle, proliferation, myofibril formation (Zammit, 2017). \u0026nbsp;It was reported that the fish MyoD gene was negatively affected by different stressors. It was revealed the low expression of myoD gene in gibel carp fish which was exposed to 168 h of acute thermal stress (Hu et al., 2023). MyoD and Myf5 are two examples of the muscle-specific genes whose transcription is modulated by Wnt signaling during myogenesis via PKA and the transcription factor CREB (Chen et al., 2005). It was reported previously that Wnt signaling pathways are vulnerable to heavy metal exposure in the environment and are essential for regular cellular processes (Khalid et al., 2021). Previous study presented the effects of zinc and cobalt exposure on rainbow trout\u0026apos;s IGF-I, IGF-II, and GH expression levels. It was reported that the exposure of rainbow trout for time to zinc and cobalt resulted in significantly decrease of the expressions of IGF-1 gene and that may be due to the interactions between these metals and metal binding proteins (Ekinci et al., 2011). On the other hand, the results showed a significant increase in TNFa and IL6 gene expression in Tilapia spleen of RNB compared to that from DRN. In Asian carp head kidney, there was a positive correlation found between the expression of mir155 and the mRNA levels of proinflammatory cytokines, such as TNF-\u0026alpha; (Jing et al., 2020). It was revealed that the biomolecular response to exposure of D. Setosum to Cd heavy metals demonstrated that TNF-\u0026alpha; protein expression, activation, and concentration increased as the concentration of Cd-containing heavy metals increase (Rumahlatu et al., 2019). Oxidative stress is one of the basic chemical mechanisms that underlies toxicity caused by metals (Chen et al., 2018). Certain cellular inflammatory factors such as IL-6 and immunological factors are significantly changed when the immune system is repressed (Jantawongsri et al., 2021). It was measured that the IL-6 was significantly increased in carp spleen exposed to Difenoconazole (Liu et al., 2022). This implies that heavy metals may target MyoD gen in muscle as well as TNF-a and IL-6 genes in spleen in order to cause harmful consequences. Our findings suggest that exposure to heavy metals causes immunological system malfunction and muscle atrophy in addition to spleen tissue damage. Tissue damage, immunosuppression brought on by heavy metal exposure, oxidative stress, inflammation, and apoptosis are all deeply interrelated.\u003c/p\u003e"},{"header":"Conclusion and recommendations ","content":"\u003cp\u003eIn the present study, the use of various biomarkers at different levels for identification of the heavy metal pollution in Tilapia fish and the surrounding water. It gives indication about the health condition of the fish and the risk effect to the consumer. The data provided in this study justifies one of the most harmful kinds of pollution that cannot be denied which must affect the environment. These toxins threaten the aquatic fish and the human population. The levels of bioaccumulation of heavy metals in fish muscle were on the verge of exceeding safety thresholds in the studied sites, raising concerns for the health of consumers. As a result, it is important to regularly check the metal levels in fish species found in Benha Damietta Branch and El-Rayah El-Tawfeeky branch. The best way to protect these sites from ongoing pollution is to keep waste out of the watershed, lower environmental risks, and regularly monitor the riverine ecosystem before metal levels rise too high and endanger aquatic life as well as humans. The study\u0026apos;s findings might provide decision-makers with new information on how to better safeguard the River Nile, branches and related canals from potentially dangerous hazards.\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data supporting the findings of this study are available within the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Information \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors did not receive support from any organization for the submitted work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Author Contribution \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eW. M. S. conducted the experiment, analyzed the data, wrote and revised the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no competing interests to declare that are relevant to the content of this article.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Statement \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experiments were approved by Ethics committee of faculty of Science, Benha university, Egypt, protocol (BUFS-REC-2024-114Zoo). \u0026nbsp; \u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbidemi-Iromini, A. O., Bello-Olusoji, O. A., \u0026amp; Adebayo, I. A. (2022). Bioaccumulation of heavy metals in silver catfish (Chrysichthys nigrodigitatus) and tilapia fish (Oreochromis niloticus) from the brackish and freshwater in South-West, Nigeria. \u003cem\u003eThe Journal of Basic and Applied Zoology\u003c/em\u003e,\u003cem\u003e 83\u003c/em\u003e(1), 18. https://doi.org/10.1186/s41936-022-00272-z\u003c/li\u003e\n\u003cli\u003eAbouelFadl, K., Aly, W., Abdelreheem, A., Mahmoud, U., Hamed, H., Moustafa, M., \u0026amp; Osman, A. (2016). Heavy Metals Levels in the Blood of Oreochromis niloticus niloticus and Clarias gariepinus as Biomarkers of Metal Pollution in the River Nile. \u003cem\u003eInternational Journal of Ecotoxicology and Ecobiology\u003c/em\u003e,\u003cem\u003e 1\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eAhmad, H., Yousafzai, A. M., Siraj, M., Ahmad, R., Ahmad, I., Nadeem, M. S., . . . Muhammad, K. (2015). Pollution Problem in River Kabul: Accumulation Estimates of Heavy Metals in Native Fish Species. \u003cem\u003eBiomed Res Int\u003c/em\u003e,\u003cem\u003e 2015\u003c/em\u003e, 537368. https://doi.org/10.1155/2015/537368\u003c/li\u003e\n\u003cli\u003eAl-Afify, A. D. G., \u0026amp; Abdel-Satar, A. M. (2020). Risk assessment of heavy metal pollution in water, sediment and plants in the Nile River in the Cairo region, Egypt. \u003cem\u003eOceanological and Hydrobiological Studies\u003c/em\u003e,\u003cem\u003e 49\u003c/em\u003e(1), 1-12. https://doi.org/doi:10.1515/ohs-2020-0001\u003c/li\u003e\n\u003cli\u003eAlibraheemi, A. (2019). Histopathological changes in gills, liver and kidney of fresh water fish, Tilapia zillii, exposed to aluminum.\u003c/li\u003e\n\u003cli\u003eAuthman, M., Abbas, W., \u0026amp; Gaafar, A. (2012). Metals concentrations in Nile tilapia Oreochromis niloticus (Linnaeus, 1758) from illegal fish farm in Al-Minufiya Province, Egypt, and their effects on some tissues structures. \u003cem\u003eEcotoxicology and environmental safety\u003c/em\u003e,\u003cem\u003e 84\u003c/em\u003e, 163-172. https://doi.org/10.1016/j.ecoenv.2012.07.005\u003c/li\u003e\n\u003cli\u003eAuthman, M., Ibrahim, S. A., El-Kasheif, M., \u0026amp; Gaber, H. (2013). Heavy metals pollution and their effects on gills and liver of the nile catfish Clarias gariepinus inhabiting El-Rahawy drain, Egypt. \u003cem\u003eGlobal Veterinaria\u003c/em\u003e,\u003cem\u003e 10\u003c/em\u003e, 103-115. https://doi.org/10.5829/idosi.gv.2013.10.2.71226\u003c/li\u003e\n\u003cli\u003eAuthman, M., Zaki, M., Khallaf, E., \u0026amp; Abbas, H. (2015). Use of Fish as Bio-indicator of the Effects of Heavy Metals Pollution. \u003cem\u003eJ Aquaculture Research and Development\u003c/em\u003e,\u003cem\u003e J Aquaculture Research and Development\u003c/em\u003e, 328. https://doi.org/10.4172/2155-9546.1000328\u003c/li\u003e\n\u003cli\u003eAyoola, S. O., \u0026amp; Alajabo, O. (2012). Acute Toxicity and Histopathological Effects of Engine Oil on Sarotherodon melanotheron (Black Jaw Tilapia). \u003cem\u003eAmerican-Eurasian J. Toxicol. Sci.\u003c/em\u003e,\u003cem\u003e 4\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eAyoola, S. O., \u0026amp; Alajabo, O. T. Acute toxicity and histopathological effects of engine oil on Sarotherodon melanotheron (black jaw tilapia).\u003cem\u003e 4\u003c/em\u003e(1), 48\u0026ndash;55.\u003c/li\u003e\n\u003cli\u003eBriffa, J., Sinagra, E., \u0026amp; Blundell, R. (2020). Heavy metal pollution in the environment and their toxicological effects on humans. \u003cem\u003eHeliyon\u003c/em\u003e,\u003cem\u003e 6\u003c/em\u003e(9), e04691. https://doi.org/https://doi.org/10.1016/j.heliyon.2020.e04691\u003c/li\u003e\n\u003cli\u003eCastro-Gonz\u0026aacute;lez, M. I., \u0026amp; M\u0026eacute;ndez-Armenta, M. (2008). Heavy metals: Implications associated to fish consumption. \u003cem\u003eEnvironmental Toxicology and Pharmacology\u003c/em\u003e,\u003cem\u003e 26\u003c/em\u003e(3), 263-271. https://doi.org/https://doi.org/10.1016/j.etap.2008.06.001\u003c/li\u003e\n\u003cli\u003eChen, A. E., Ginty, D. D., \u0026amp; Fan, C. M. (2005). Protein kinase A signalling via CREB controls myogenesis induced by Wnt proteins. \u003cem\u003eNature\u003c/em\u003e,\u003cem\u003e 433\u003c/em\u003e(7023), 317-322. https://doi.org/10.1038/nature03126\u003c/li\u003e\n\u003cli\u003eChen, P., Bornhorst, J., Diana Neely, M., \u0026amp; Avila, D. S. (2018). Mechanisms and Disease Pathogenesis Underlying Metal-Induced Oxidative Stress. \u003cem\u003eOxid Med Cell Longev\u003c/em\u003e,\u003cem\u003e 2018\u003c/em\u003e, 7612172. https://doi.org/10.1155/2018/7612172\u003c/li\u003e\n\u003cli\u003eDavid, M., \u0026amp; Kartheek, R. M. (2015). Histopathological alterations in spleen of freshwater fish Cyprinus carpio exposed to sublethal concentration of sodium cyanide. \u003cem\u003eOpen Vet J\u003c/em\u003e,\u003cem\u003e 5\u003c/em\u003e(1), 1-5.\u003c/li\u003e\n\u003cli\u003eDawood, A.-F. B., Aly, A. A., Ibrahim, M., Andrade Laborde, J. E., Abusharha, A., Rezk, M. M., . . . Rabie, M. M. (2023). Biophysical, histological, and bioaccumulation properties of Tilapia muscle affected by water pollution with heavy elements and microbes at the El-Rahawy drain in Egypt. \u003cem\u003eHeliyon\u003c/em\u003e,\u003cem\u003e 9\u003c/em\u003e(3), e14489. https://doi.org/https://doi.org/10.1016/j.heliyon.2023.e14489\u003c/li\u003e\n\u003cli\u003eDebnath, A., Singh, P. K., \u0026amp; Chandra Sharma, Y. (2021). Metallic contamination of global river sediments and latest developments for their remediation. \u003cem\u003eJournal of Environmental Management\u003c/em\u003e,\u003cem\u003e 298\u003c/em\u003e, 113378. https://doi.org/https://doi.org/10.1016/j.jenvman.2021.113378\u003c/li\u003e\n\u003cli\u003eDowner, M. K., Mart\u0026iacute;nez-Gonz\u0026aacute;lez, M. A., Gea, A., Stampfer, M., Warnberg, J., Ruiz-Canela, M., . . . Investigators, P. S. (2017). Mercury exposure and risk of cardiovascular disease: a nested case-control study in the PREDIMED (PREvention with MEDiterranean Diet) study. \u003cem\u003eBMC Cardiovascular Disorders\u003c/em\u003e,\u003cem\u003e 17\u003c/em\u003e(1), 9. https://doi.org/10.1186/s12872-016-0435-8\u003c/li\u003e\n\u003cli\u003eEkinci, D., Ceyhun, S. B., Aksakal, E., \u0026amp; Erdoğan, O. (2011). IGF and GH mRNA levels are suppressed upon exposure to micromolar concentrations of cobalt and zinc in rainbow trout white muscle. \u003cem\u003eComparative Biochemistry and Physiology Part C: Toxicology \u0026amp; Pharmacology\u003c/em\u003e,\u003cem\u003e 153\u003c/em\u003e(3), 336-341. https://doi.org/https://doi.org/10.1016/j.cbpc.2010.12.004\u003c/li\u003e\n\u003cli\u003eEl-Kowrany, S. I., El- Zamarany, E. A., El-Nouby, K. A., El-Mehy, D. A., Abo Ali, E. A., Othman, A. A., . . . El-Ebiary, A. A. (2016). Water pollution in the Middle Nile Delta, Egypt: An environmental study. \u003cem\u003eJournal of Advanced Research\u003c/em\u003e,\u003cem\u003e 7\u003c/em\u003e(5), 781-794. https://doi.org/https://doi.org/10.1016/j.jare.2015.11.005\u003c/li\u003e\n\u003cli\u003eEl-Saadani, Z., Mingqi, W., He, Z., Hamukwaya, S. L., Abdel Wahed, M. S. M., \u0026amp; Abu Khatita, A. (2022). Environmental Geochemistry and Fractionation of Cadmium Metal in Surficial Bottom Sediments and Water of the Nile River, Egypt. \u003cem\u003eToxics\u003c/em\u003e,\u003cem\u003e 10\u003c/em\u003e(5). https://doi.org/10.3390/toxics10050221\u003c/li\u003e\n\u003cli\u003eGarcia-Abiado, M. A., Mbahinzireki, G., Rinchard, J., Lee, K. J., \u0026amp; Dabrowski, K. (2004). Effect of diets containing gossypol on blood parameters and spleen structure in tilapia, Oreochromis sp., reared in a recirculating system. \u003cem\u003eJ Fish Dis\u003c/em\u003e,\u003cem\u003e 27\u003c/em\u003e(6), 359-368. https://doi.org/10.1111/j.1365-2761.2004.00551.x\u003c/li\u003e\n\u003cli\u003eGogal, R. M., Jr., Smith, B. J., Robertson, J. L., Smith, S. A., \u0026amp; Holladay, S. D. (1999). Tilapia (Oreochromis niloticus) dosed with azathioprine display immune effects similar to those seen in mammals, including apoptosis. \u003cem\u003eVet Immunol Immunopathol\u003c/em\u003e,\u003cem\u003e 68\u003c/em\u003e(2-4), 209-227. https://doi.org/10.1016/s0165-2427(99)00024-0\u003c/li\u003e\n\u003cli\u003eG\u0026aacute;rriz, \u0026Aacute;., del Fresno, P. S., Carriquiriborde, P., \u0026amp; Miranda, L. A. (2019). Effects of heavy metals identified in Chascom\u0026uacute;s shallow lake on the endocrine-reproductive axis of pejerrey fish (Odontesthes bonariensis). \u003cem\u003eGeneral and Comparative Endocrinology\u003c/em\u003e,\u003cem\u003e 273\u003c/em\u003e, 152-162. https://doi.org/https://doi.org/10.1016/j.ygcen.2018.06.013\u003c/li\u003e\n\u003cli\u003eHaidar, S. A. A., Omar, E. A., Sherif, A. A. R., \u0026amp; El-Sahn, A. A. (2006). Cryptosporidiosis among Children Living in Rural and Urban Settings in Alexandria. \u003cem\u003eJournal of High Institute of Public Health\u003c/em\u003e,\u003cem\u003e 36\u003c/em\u003e(1), 1-18. https://doi.org/10.21608/jhiph.2006.160185\u003c/li\u003e\n\u003cli\u003eHama Aziz, K. H., Mustafa, F. S., Omer, K. M., Hama, S., Hamarawf, R. F., \u0026amp; Rahman, K. O. (2023). Heavy metal pollution in the aquatic environment: efficient and low-cost removal approaches to eliminate their toxicity: a review. \u003cem\u003eRSC Adv\u003c/em\u003e,\u003cem\u003e 13\u003c/em\u003e(26), 17595-17610. https://doi.org/10.1039/d3ra00723e\u003c/li\u003e\n\u003cli\u003eHu, Q., Lu, J., Yang, Y., Li, D., \u0026amp; Liu, J. (2023). Acute Thermal Stress Reduces Skeletal Muscle Growth and Quality in Gibel Carp (Carassius gibelio). \u003cem\u003eWater\u003c/em\u003e,\u003cem\u003e 15\u003c/em\u003e(15).\u003c/li\u003e\n\u003cli\u003eJaishankar, M., Tseten, T., Anbalagan, N., Mathew, B. B., \u0026amp; Beeregowda, K. N. (2014). Toxicity, mechanism and health effects of some heavy metals. \u003cem\u003eInterdiscip Toxicol\u003c/em\u003e,\u003cem\u003e 7\u003c/em\u003e(2), 60-72. https://doi.org/10.2478/intox-2014-0009\u003c/li\u003e\n\u003cli\u003eJamil Emon, F., Rohani, M. F., Sumaiya, N., Tuj Jannat, M. F., Akter, Y., Shahjahan, M., . . . Goh, K. W. (2023). Bioaccumulation and Bioremediation of Heavy Metals in Fishes-A Review. \u003cem\u003eToxics\u003c/em\u003e,\u003cem\u003e 11\u003c/em\u003e(6). https://doi.org/10.3390/toxics11060510\u003c/li\u003e\n\u003cli\u003eJantawongsri, K., N\u0026oslash;rregaard, R. D., Bach, L., Dietz, R., Sonne, C., J\u0026oslash;rgensen, K., . . . Nowak, B. (2021). Histopathological effects of short-term aqueous exposure to environmentally relevant concentration of lead (Pb) in shorthorn sculpin (Myoxocephalus scorpius) under laboratory conditions. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e,\u003cem\u003e 28\u003c/em\u003e(43), 61423-61440. https://doi.org/10.1007/s11356-021-14972-6\u003c/li\u003e\n\u003cli\u003eJing, H., Zhang, Q., Li, S., \u0026amp; Gao, X.-j. (2020). Pb exposure triggers MAPK-dependent inflammation by activating oxidative stress and miRNA-155 expression in carp head kidney. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e,\u003cem\u003e 106\u003c/em\u003e, 219-227. https://doi.org/https://doi.org/10.1016/j.fsi.2020.08.015\u003c/li\u003e\n\u003cli\u003eKessabi, K., Abbassi, A., Lahmar, S., Casado, M., Banni, M., Pi\u0026ntilde;a, B., \u0026amp; Messaoudi, I. (2023). Combined toxic effects of cadmium and environmental microplastics in Aphanius fasciatus (Pisces, Cyprinodontidae). \u003cem\u003eMarine Environmental Research\u003c/em\u003e,\u003cem\u003e 189\u003c/em\u003e, 106071. https://doi.org/https://doi.org/10.1016/j.marenvres.2023.106071\u003c/li\u003e\n\u003cli\u003eKhalid, M., Hodjat, M., \u0026amp; Abdollahi, M. (2021). Environmental Exposure to Heavy Metals Contributes to Diseases Via Deregulated Wnt Signaling Pathways. \u003cem\u003eIran J Pharm Res\u003c/em\u003e,\u003cem\u003e 20\u003c/em\u003e(2), 370-382. https://doi.org/10.22037/ijpr.2021.114897.15089\u003c/li\u003e\n\u003cli\u003eKhallaf, E. A., Authman, M. M. N., \u0026amp; Alne-na-ei, A. A. (2018). Contamination and Ecological Hazard Assessment of Heavy Metals in Freshwater Sediments and Oreochromis niloticus (Linnaeus, 1758) Fish Muscles in a Nile River Canal in Egypt. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e,\u003cem\u003e 25\u003c/em\u003e(14), 13796-13812. https://doi.org/10.1007/s11356-018-1521-5\u003c/li\u003e\n\u003cli\u003eKumar, B., Shah, R., \u0026amp; Mukherjee, D. (2011). Geochemical distribution of heavy metals in sediments from sewage fed fish ponds from Kolkata Wetlands, India. \u003cem\u003eChemical Speciation \u0026amp; Bioavailability\u003c/em\u003e,\u003cem\u003e 23\u003c/em\u003e(1), 24-32. https://doi.org/10.3184/095422911X12966667026105\u003c/li\u003e\n\u003cli\u003eLeung, H. M., Leung, A. O., Wang, H. S., Ma, K. K., Liang, Y., Ho, K. C., . . . Yung, K. K. (2014). Assessment of heavy metals/metalloid (As, Pb, Cd, Ni, Zn, Cr, Cu, Mn) concentrations in edible fish species tissue in the Pearl River Delta (PRD), China. \u003cem\u003eMar Pollut Bull\u003c/em\u003e,\u003cem\u003e 78\u003c/em\u003e(1-2), 235-245. https://doi.org/10.1016/j.marpolbul.2013.10.028\u003c/li\u003e\n\u003cli\u003eLiu, F., Li, X., Bello, B. K., Zhang, T., Yang, H., Wang, K., \u0026amp; Dong, J. (2022). Difenoconazole causes spleen tissue damage and immune dysfunction of carp through oxidative stress and apoptosis. \u003cem\u003eEcotoxicology and Environmental Safety\u003c/em\u003e,\u003cem\u003e 237\u003c/em\u003e, 113563. https://doi.org/https://doi.org/10.1016/j.ecoenv.2022.113563\u003c/li\u003e\n\u003cli\u003eMaharajan, A., Kitto, M. R., Paruruckumani, P. S., \u0026amp; Ganapiriya, V. (2016). Histopathology biomarker responses in Asian sea bass, Lates calcarifer (Bloch) exposed to copper. \u003cem\u003eThe Journal of Basic \u0026amp; Applied Zoology\u003c/em\u003e,\u003cem\u003e 77\u003c/em\u003e, 21-30. https://doi.org/https://doi.org/10.1016/j.jobaz.2016.02.001\u003c/li\u003e\n\u003cli\u003eMalik, D. S., \u0026amp; Maurya, P. K. (2014). Heavy metal concentration in water, sediment, and tissues of fish species (Heteropneustis fossilis and Puntius ticto) from Kali River, India. \u003cem\u003eToxicological \u0026amp; Environmental Chemistry\u003c/em\u003e,\u003cem\u003e 96\u003c/em\u003e(8), 1195-1206. https://doi.org/10.1080/02772248.2015.1015296\u003c/li\u003e\n\u003cli\u003eMitra, S., Chakraborty, A. J., Tareq, A. M., Emran, T. B., Nainu, F., Khusro, A., . . . Simal-Gandara, J. (2022). Impact of heavy metals on the environment and human health: Novel therapeutic insights to counter the toxicity. \u003cem\u003eJournal of King Saud University - Science\u003c/em\u003e,\u003cem\u003e 34\u003c/em\u003e(3), 101865. https://doi.org/https://doi.org/10.1016/j.jksus.2022.101865\u003c/li\u003e\n\u003cli\u003eNgo, H. T. T., Gerstmann, S., \u0026amp; Frank, H. (2011). Subchronic effects of environment-like cadmium levels on the bivalve Anodonta anatina (Linnaeus 1758): III. Effects on carbonic anhydrase activity in relation to calcium metabolism. \u003cem\u003eToxicological \u0026amp; Environmental Chemistry\u003c/em\u003e,\u003cem\u003e 93\u003c/em\u003e(9), 1815-1825. https://doi.org/10.1080/02772240802503619\u003c/li\u003e\n\u003cli\u003eOmar, W. A., Zaghloul, K. H., Abdel-Khalek, A. A., \u0026amp; Abo-Hegab, S. (2013). Risk Assessment and Toxic Effects of Metal Pollution in Two Cultured and Wild Fish Species from Highly Degraded Aquatic Habitats. \u003cem\u003eArchives of Environmental Contamination and Toxicology\u003c/em\u003e,\u003cem\u003e 65\u003c/em\u003e(4), 753-764. https://doi.org/10.1007/s00244-013-9935-z\u003c/li\u003e\n\u003cli\u003ePanda, B. P., Mohanta, Y. K., Parida, S. P., Pradhan, A., Mohanta, T. K., Patowary, K., . . . Sarma, H. (2023). Metal pollution in freshwater fish: A key indicator of contamination and carcinogenic risk to public health. \u003cem\u003eEnviron Pollut\u003c/em\u003e,\u003cem\u003e 330\u003c/em\u003e, 121796. https://doi.org/10.1016/j.envpol.2023.121796\u003c/li\u003e\n\u003cli\u003eRahman, M. S., Molla, A. H., Saha, N., \u0026amp; Rahman, A. (2012). Study on heavy metals levels and its risk assessment in some edible fishes from Bangshi River, Savar, Dhaka, Bangladesh. \u003cem\u003eFood Chemistry\u003c/em\u003e,\u003cem\u003e 134\u003c/em\u003e(4), 1847-1854. https://doi.org/https://doi.org/10.1016/j.foodchem.2012.03.099\u003c/li\u003e\n\u003cli\u003eRajamanickam, V., \u0026amp; Narayanan, M. (2009). Heavy Metal Induced Histopathological Alterations in Selected Organs of the Cyprinus carpio L.(Common Carp). \u003cem\u003eInternational Journal of Environmental Research (ISSN: 1735-6865) Vol 3 Num 1\u003c/em\u003e,\u003cem\u003e 3\u003c/em\u003e.\u003c/li\u003e\n\u003cli\u003eRajeshkumar, S., \u0026amp; Li, X. (2018). Bioaccumulation of heavy metals in fish species from the Meiliang Bay, Taihu Lake, China. \u003cem\u003eToxicol Rep\u003c/em\u003e,\u003cem\u003e 5\u003c/em\u003e, 288-295. https://doi.org/10.1016/j.toxrep.2018.01.007\u003c/li\u003e\n\u003cli\u003eRodriguez, D., Lavie, C. J., Elagizi, A., \u0026amp; Milani, R. V. (2022). Update on Omega-3 Polyunsaturated Fatty Acids on Cardiovascular Health. \u003cem\u003eNutrients\u003c/em\u003e,\u003cem\u003e 14\u003c/em\u003e(23). https://doi.org/10.3390/nu14235146\u003c/li\u003e\n\u003cli\u003eRumahlatu, D., Duran-Corebima, A., Amin, M., \u0026amp; Rohman, F. (2019). Effect of cadmium on the concentration and expression of TNF-\u0026alpha; protein in sea urchin Diadema setosum (Leske, 1778). \u003cem\u003eHidrobiol\u0026oacute;gica: [revista del Departamento de Hidrobiolog\u0026iacute;a]\u003c/em\u003e,\u003cem\u003e 29\u003c/em\u003e, 181-188. https://doi.org/10.24275/uam/izt/dcbs/hidro/2020v29n3/Rumahlatu\u003c/li\u003e\n\u003cli\u003eSadak, O. (2023). Chapter 15 - Chemical sensing of heavy metals in water. In A. Barhoum \u0026amp; Z. Altintas (Eds.), \u003cem\u003eAdvanced Sensor Technology\u003c/em\u003e (pp. 565-591). Elsevier. https://doi.org/https://doi.org/10.1016/B978-0-323-90222-9.00010-8\u003c/li\u003e\n\u003cli\u003eSaini, R. K., Prasad, P., Sreedhar, R. V., Akhilender Naidu, K., Shang, X., \u0026amp; Keum, Y. S. (2021). Omega-3 Polyunsaturated Fatty Acids (PUFAs): Emerging Plant and Microbial Sources, Oxidative Stability, Bioavailability, and Health Benefits-A Review. \u003cem\u003eAntioxidants (Basel)\u003c/em\u003e,\u003cem\u003e 10\u003c/em\u003e(10). https://doi.org/10.3390/antiox10101627\u003c/li\u003e\n\u003cli\u003eSankar, T. V., Zynudheen, A. A., Anandan, R., \u0026amp; Viswanathan Nair, P. G. (2006). Distribution of organochlorine pesticides and heavy metal residues in fish and shellfish from Calicut region, Kerala, India. \u003cem\u003eChemosphere\u003c/em\u003e,\u003cem\u003e 65\u003c/em\u003e(4), 583-590. https://doi.org/10.1016/j.chemosphere.2006.02.038\u003c/li\u003e\n\u003cli\u003eSfakianakis, D. G., Renieri, E., Kentouri, M., \u0026amp; Tsatsakis, A. M. (2015). Effect of heavy metals on fish larvae deformities: A review. \u003cem\u003eEnvironmental Research\u003c/em\u003e,\u003cem\u003e 137\u003c/em\u003e, 246-255. https://doi.org/https://doi.org/10.1016/j.envres.2014.12.014\u003c/li\u003e\n\u003cli\u003eShaalan, W., Allah, N., El-Serafy, S., \u0026amp; Salem, M. (2023). Molecular Characterization and Expression of Calpains and Cathepsins in Tilapia Muscle in Response to Starvation. \u003cem\u003eTurkish Journal of Fisheries and Aquatic Sciences\u003c/em\u003e,\u003cem\u003e 23\u003c/em\u003e, 21895. https://doi.org/10.4194/TRJFAS21895\u003c/li\u003e\n\u003cli\u003eShaalan, W. M., El-Hameid, N. A. A., El-Serafy, S. S., \u0026amp; Salem, M. (2019). Expressions and characterization of MuRFs, Atrogin-1, F-box25 genes in tilapia, Oreochromis niloticus, in response to starvation. \u003cem\u003eFish Physiol Biochem\u003c/em\u003e,\u003cem\u003e 45\u003c/em\u003e(4), 1321-1330. https://doi.org/10.1007/s10695-019-00667-w\u003c/li\u003e\n\u003cli\u003eShaalan, W. M., \u0026amp; Iskandar, M. (2022). Impact of soft drink on skeletal formation indicated by RSPO2, HAO1, and RUNX2 gene expressions. \u003cem\u003eAlfarama Journal of Basic \u0026amp; Applied Sciences\u003c/em\u003e,\u003cem\u003e 3\u003c/em\u003e(2), 300-314. https://doi.org/10.21608/ajbas.2022.119909.1087\u003c/li\u003e\n\u003cli\u003eShah, N., Khan, A., Ali, R., Marimuthu, K., Uddin, M. N., Rizwan, M., . . . Khisroon, M. (2020). Monitoring Bioaccumulation (in Gills and Muscle Tissues), Hematology, and Genotoxic Alteration in Ctenopharyngodon idella Exposed to Selected Heavy Metals. \u003cem\u003eBiomed Res Int\u003c/em\u003e,\u003cem\u003e 2020\u003c/em\u003e, 6185231. https://doi.org/10.1155/2020/6185231\u003c/li\u003e\n\u003cli\u003eTabari, S., Saravi, S. S., Bandany, G. A., Dehghan, A., \u0026amp; Shokrzadeh, M. (2010). Heavy metals (Zn, Pb, Cd and Cr) in fish, water and sediments sampled form Southern Caspian Sea, Iran. \u003cem\u003eToxicol Ind Health\u003c/em\u003e,\u003cem\u003e 26\u003c/em\u003e(10), 649-656. https://doi.org/10.1177/0748233710377777\u003c/li\u003e\n\u003cli\u003eTchounwou, P. B., Yedjou, C. G., Patlolla, A. K., \u0026amp; Sutton, D. J. (2012). Heavy metal toxicity and the environment. \u003cem\u003eExp Suppl\u003c/em\u003e,\u003cem\u003e 101\u003c/em\u003e, 133-164. https://doi.org/10.1007/978-3-7643-8340-4_6\u003c/li\u003e\n\u003cli\u003eTuzen, M. (2009). Toxic and essential trace elemental contents in fish species from the Black Sea, Turkey. \u003cem\u003eFood Chem Toxicol\u003c/em\u003e,\u003cem\u003e 47\u003c/em\u003e(8), 1785-1790. https://doi.org/10.1016/j.fct.2009.04.029\u003c/li\u003e\n\u003cli\u003eT\u0026uuml;rkmen, A., T\u0026uuml;rkmen, M., Tepe, Y., \u0026amp; Akyurt, İ. (2005). Heavy metals in three commercially valuable fish species from İskenderun Bay, Northern East Mediterranean Sea, Turkey. \u003cem\u003eFood Chemistry\u003c/em\u003e,\u003cem\u003e 91\u003c/em\u003e(1), 167-172. https://doi.org/https://doi.org/10.1016/j.foodchem.2004.08.008\u003c/li\u003e\n\u003cli\u003eVelusamy, A., Satheesh Kumar, P., Ram, A., \u0026amp; Chinnadurai, S. (2014). Bioaccumulation of heavy metals in commercially important marine fishes from Mumbai Harbor, India. \u003cem\u003eMar Pollut Bull\u003c/em\u003e,\u003cem\u003e 81\u003c/em\u003e(1), 218-224. https://doi.org/10.1016/j.marpolbul.2014.01.049\u003c/li\u003e\n\u003cli\u003eWHO Guidelines Approved by the Guidelines Review Committee. (2022). In Guidelines for drinking-water quality: Fourth edition incorporating the first and second addenda. World Health Organization\u003c/li\u003e\n\u003cli\u003e\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; \u0026copy; World Health Organization 2022.\u003c/li\u003e\n\u003cli\u003eYounis, E. M., Abdel-Warith, A. A., Al-Asgah, N. A., Elthebite, S. A., \u0026amp; Mostafizur Rahman, M. (2021). Nutritional value and bioaccumulation of heavy metals in muscle tissues of five commercially important marine fish species from the Red Sea. \u003cem\u003eSaudi J Biol Sci\u003c/em\u003e,\u003cem\u003e 28\u003c/em\u003e(3), 1860-1866. https://doi.org/10.1016/j.sjbs.2020.12.038\u003c/li\u003e\n\u003cli\u003eYozukmaz, A., \u0026amp; Yabanlı, M. (2023). Heavy Metal Contamination and Potential Ecological Risk Assessment in Sediments of Lake Bafa (Turkey). \u003cem\u003eSustainability\u003c/em\u003e,\u003cem\u003e 15\u003c/em\u003e(13).\u003c/li\u003e\n\u003cli\u003eZammit, P. S. (2017). Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. \u003cem\u003eSemin Cell Dev Biol\u003c/em\u003e,\u003cem\u003e 72\u003c/em\u003e, 19-32. https://doi.org/10.1016/j.semcdb.2017.11.011\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable (1) Primers of RT-PCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.187800963081862%\" valign=\"top\"\u003e\n \u003cp\u003eGene name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.287319422150883%\" valign=\"top\"\u003e\n \u003cp\u003eForward primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.20064205457464%\" valign=\"top\"\u003e\n \u003cp\u003eReverse primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.324237560192618%\" valign=\"top\"\u003e\n \u003cp\u003eAccession number\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.187800963081862%\" valign=\"top\"\u003e\n \u003cp\u003eMyoD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.287319422150883%\" valign=\"top\"\u003e\n \u003cp\u003eACGCATGTACTCCAGTCCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.20064205457464%\" valign=\"top\"\u003e\n \u003cp\u003eCAGTGAACACAGCAGTCGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.324237560192618%\" valign=\"top\"\u003e\n \u003cp\u003eXM_025907525.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.187800963081862%\" valign=\"top\"\u003e\n \u003cp\u003eIGF-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.287319422150883%\" valign=\"top\"\u003e\n \u003cp\u003eCACCCTCTCACTACTGCTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.20064205457464%\" valign=\"top\"\u003e\n \u003cp\u003eCACAGTACATCTCAAGGCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.324237560192618%\" valign=\"top\"\u003e\n \u003cp\u003eNM_001279503.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.187800963081862%\" valign=\"top\"\u003e\n \u003cp\u003eTNFa\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.287319422150883%\" valign=\"top\"\u003e\n \u003cpre\u003eCATCTTTCCGGGTTGACTGC\u003c/pre\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.20064205457464%\" valign=\"top\"\u003e\n \u003cpre\u003eCTGCAGAGTACCAGTTCCCA\u003c/pre\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.324237560192618%\" valign=\"top\"\u003e\n \u003cp\u003eXM_025902124.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.187800963081862%\" valign=\"top\"\u003e\n \u003cp\u003eIL6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.287319422150883%\" valign=\"top\"\u003e\n \u003cpre\u003eTTTCTTGCTACATGGCCACG\u003c/pre\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.20064205457464%\" valign=\"top\"\u003e\n \u003cpre\u003eCCTCATGATCTCAAACCGCG\u003c/pre\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.324237560192618%\" valign=\"top\"\u003e\n \u003cp\u003eXM_005448195.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.187800963081862%\" valign=\"top\"\u003e\n \u003cp\u003eB-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.287319422150883%\" valign=\"top\"\u003e\n \u003cp\u003eTCTCGGCTGTGGTGGTGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"25.20064205457464%\" valign=\"top\"\u003e\n \u003cp\u003eGACCCACACAGTGCCCATCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.324237560192618%\" valign=\"top\"\u003e\n \u003cp\u003eXM_003455949\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable (2) the heavy concentrations in muscle tissue of \u003cem\u003eOreochromis niloticus\u003c/em\u003e in mg/kg muscle weight.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.7223113964687%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eEl Rayah El Tawfeeky\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.21508828250401%\" colspan=\"3\" valign=\"top\"\u003e\n \u003cp\u003eDamietta River Nile\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003eConcentration (mg/kg)\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003eHI \u0026nbsp;(H.)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003eHI (N.)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003eConcentration (mg/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003eHI \u0026nbsp;(H.)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003eHI (N.)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003eMg\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e74.533\u0026plusmn;0.075\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e2.527\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e0.553\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e59.146\u0026plusmn;0.980\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e2.005\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.439\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003eCd \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e2.286\u0026plusmn;0.115\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e4.651\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e1.019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e0.270\u0026plusmn;0.053\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e0.549\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.120\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003eHg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e10.360\u0026plusmn;0.075\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e3.512\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e0.7696\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e1.500\u0026plusmn;0.030\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e0.508\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.111\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003eCr \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e63.020\u0026plusmn;0.346\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e0.051\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e0.011\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e38.853\u0026plusmn;0.449\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e0.031\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.006\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003eCu \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e54.406\u0026plusmn;0.116\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e0.790\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e0.173\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e38.986\u0026plusmn;0.991\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e0.566\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.124\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003eNi \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e23.560\u0026plusmn;0.019\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e3.993\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e0.875\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e20.823\u0026plusmn;0.106\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e3.530\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.773\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003ePb \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e33.403\u0026plusmn;2.068\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e2.718\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e0.595\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e14.673\u0026plusmn;0.723\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e1.193\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.261\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"7.062600321027287%\" valign=\"top\"\u003e\n \u003cp\u003eZn\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.224719101123597%\" valign=\"top\"\u003e\n \u003cp\u003e212.086\u0026plusmn;4.328\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" valign=\"top\"\u003e\n \u003cp\u003e2.016\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"16.051364365971107%\" valign=\"top\"\u003e\n \u003cp\u003e0.441\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.903691813804173%\" valign=\"top\"\u003e\n \u003cp\u003e99.930\u0026plusmn;0.370\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.754414125200642%\" valign=\"top\"\u003e\n \u003cp\u003e0.949\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.717495987158909%\" valign=\"top\"\u003e\n \u003cp\u003e0.208\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable (3) the heavy metals concentrations in water samples from the selected sites in mg/L.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003eMax allowable conc.\u003cbr\u003e\u0026nbsp;(mg/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003eEl-Rayah El-Tawfeeky Water (mg/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003eDamietta River Nile Water (mg/L)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eMg\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e0.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e0.757\u0026plusmn;0.004\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.589\u0026plusmn;0.006\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eCd\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e0.00001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e0.238\u0026plusmn;0.008\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.241\u0026plusmn;0.011\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eHg\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e0.153\u0026plusmn;0.006\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.135\u0026plusmn;0.008\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eCr\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e0.437\u0026plusmn;0.004\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.381\u0026plusmn;0.015\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eCu\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e0.545\u0026plusmn;0.012\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.359\u0026plusmn;0.025\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eNi\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e0.244\u0026plusmn;0.004\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.222\u0026plusmn;0.023\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003ePb \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e0.152\u0026plusmn;0.002\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.146\u0026plusmn;0.006\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.461538461538462%\" valign=\"top\"\u003e\n \u003cp\u003eZn\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.076923076923077%\" valign=\"top\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"33.65384615384615%\" valign=\"top\"\u003e\n \u003cp\u003e1.044\u0026plusmn;0.015\u003csup\u003e*a\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"29.807692307692307%\" valign=\"top\"\u003e\n \u003cp\u003e0.975\u0026plusmn;0.022\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"heavy metals, gene expression, River Nile, Oreochromis niloticus ","lastPublishedDoi":"10.21203/rs.3.rs-3960734/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3960734/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Heavy metal pollution threatens the biodiversity and ecological equilibrium of the Nile River. This study investigates the impact of heavy metal pollution on aquatic animal as Nile tilapia (Oreochromis niloticus) in the Damietta branch of the River Nile and El-Rayah El-Tawfeeky, in Benha city in Egypt. Fish and water samples were subsequently analyzed using ICP-OES revealing significantly higher concentrations of Mg, Cd, Hg, Cr, Cu, Ni, Pb, and Zn in fish muscle tissues collected from Damietta branch compared to El-Rayah El-Tawfeeky samples. Histopathological examinations revealed noteworthy alterations in tilapia gill, liver, spleen, and muscle tissues, suggesting potential health risks. Gene expression analysis using RT-qPCR indicated significant changes in genes related to muscle growth (MyoD, IGF-1) and immune response (TNFa, IL6) in fish from Damietta branch relative to fish of El-Rayah El-Tawfeeky. The findings raise concerns about bioaccumulation and potential health implications for consumers. The study underscores the significance of continuous monitoring, utilizing chemical, histopathological, and molecular tools as bioindicators for environmental protection measures against aquatic pollution.","manuscriptTitle":"Hazardous Effects of Heavy Metal Pollution on Histological and Gene Expression Profiles of Nile Tilapia in the Eastern Delta, Egypt Aquatic Ecosystems","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-23 06:32:18","doi":"10.21203/rs.3.rs-3960734/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5c2e12bb-8226-45b2-943d-bc02b334db61","owner":[],"postedDate":"February 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-23T18:53:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-23 06:32:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3960734","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3960734","identity":"rs-3960734","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.