ASFV major capsid p72 trimers function as a pH sensor during uncoating process of virus endocytosis and facilitate its application as conformational antigen detection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article ASFV major capsid p72 trimers function as a pH sensor during uncoating process of virus endocytosis and facilitate its application as conformational antigen detection Wenzhuang Zhu, Yangnan Huyan, Chenggang Jiang, Kaiwen Meng, Qi Liu, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6368001/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract African swine fever virus (ASFV), a member of the nucleocytoplasmic large DNA virus (NCLDV) family, is the sole representative of the Asfarviridae family. Recent studies have shown that the uncoating process of ASFV occurs through a pH-dependent mechanism within late endosomal compartments. However, the molecular mechanisms underlying pH-mediated capsid destabilization remain poorly understood, and the key viral components responsible for pH sensing during uncoating have not yet been clearly identified. In this study, we identified that the major capsid protein p72 of ASFV functions as a pH-sensitive structural component enriched with ionizable residues. By simulating the acidic environment of endosomes, we observed that the molecular weight and particle size of the acidified p72 protein decreased. Cryo-electron microscopy (Cryo-EM) revealed that the p72 protein underwent trimer depolymerization at acidic pH levels similar to those found in endosomes. This destabilization of the trimer provides a mechanistic basis for proposing a model of the uncoating mechanism of ASFV. Based on these insights, we developed a double-antibody sandwich lateral immunochromatographic test strip targeting p72 trimers. This test strip demonstrated high specificity and sensitivity, making it a valuable tool for detecting ASFV infections and evaluating the efficacy of mild disinfectants used in swine farms against African swine fever virus. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction African swine fever (ASF) is a highly contagious and fatal acute hemorrhagic fever in domestic and wild boars that was first reported in Kenya in 1921 [1–2]. In 2018, ASF has spread to China and rapidly transmission to several countries in the world. The disease exhibited morbidity and mortality rates approaching 100%, inflicting substantial economic losses on the global swine industry [3–4]. At present, ASF has not been completely eliminated in China and neighboring countries. Although ASF does not infect humans (i.e., it is not a zoonotic disease), it significantly impacts the health safety and stability of the food chain derived from animals. As the only known member of nucleocytoplasmic large DNA viruses (NCLDVs) that infect mammals, African swine fever virus (ASFV) belongs to the Asfarviridae. Many NCLDVs, including ASFV, Iridovirus, Mimivirus, Paramecium bursaria chlorella virus (PBCV), and Faustovirus (FV), exhibit icosahedral or near-icosahedral capsid symmetry [5–8]. Their capsids are assembled from trimeric major capsid protein (MCP) that feature the characteristic double jelly-roll (DJR) fold [9–13]. Similar to other NCLDVs, the ASFV is multi-layered. The ASFV particle is composed of an exterior membrane envelope, an icosahedral capsid (T = 277), an inner membrane, an icosahedral core-shell (T = 17) and an inner core containing the genome [14–15]. Therefore, in the uncoating process, the viral capsid should be disassembled to release the enveloped core shell and further release the genome. However, as a key step in the replication cycle, the uncoating mechanism of ASFV, as well as NCLDVs and other dsDNA viruses, is very limited so far. Previous studies revealed that ASFV enters host cells through the endosomal pathway [16–19]. There is a pH gradient between the vesicles of the endosome system. The pH in the early endosomes is close to 7, and the pH is around 5–6 in the late endosome. Electron microscopic observation of ASFV entering macrophages showed that the density of ASFV capsid is partially lost during the virus transportation from early endosome to late endosome [17]. And it has been verified that the ASFV capsid disruption relies on endosomal acidification [17]. Similar endosomal pathway/low pH-dependent uncoating processes have also been reported in other dsDNA viruses [20–22]. However, the pH-sensing responding component of the ASFV capsid still remains unknown. Furthermore, disinfection is an effective measure to control the spread of ASFV and maintain high biosecurity standards, so the proper use of disinfectants is a fundamental and important aspect of biosecurity [23]. Disinfectants (e.g., glutaraldehyde-based reagents, phenolic compounds, and chlorine-containing preparations) that are currently widely used in pig farms have shown effective nucleic acid inactivation. However, in the process of eliminating pathogens, their intense irritation poses a risk to both operators and livestock [24]. Notably, there is still a serious lack of standardized evaluation protocols to evaluate the virucidal efficacy of low-irritant disinfectants against major porcine pathogens, particularly ASFV, which makes it difficult to confirm their effectiveness in achieving complete viral inactivation during application. In this study, by comparing the histidine components of all capsid proteins, we identified the major capsid protein p72 as a pH sensor. Size-exclusion chromatography (SEC) and protein cross-linking assay showed that p72 trimers depolymerized in an acidic environment similar to late endosomes. Through the structural analysis of single particle cryo-EM, it was found that the p72 trimer underwent conformational changes and depolymerization to produce dimers and monomers under acidic conditions. These results elucidate the acid-induced decomposition mechanism of the p72 capsid trimer structure, revealing low pH-mediated viral uncoating disrupts ASFV infectivity. Based on the insights into this mechanism, we also developed a double-antibody sandwich lateral immunochromatographic test strip (DASLITS). DASLITS offers two key advantages: 1) high specificity – specific detection of intact p72 trimers; 2) Superior sensitivity – The detection limit for ASFV dilution is higher than that of qPCR and can be quickly identified by the naked eye. It is worth mentioning that DASLITS has outstanding advantages in evaluating the inactivation ability of low-irritant disinfectants for ASFV, which effectively solves the key technical gap in the current disinfection effect evaluation. Results ASFV major capsid p72 trimers function as a pH sensor Histidine is widely recognized as a prototypical pH-sensitive amino acid, playing a crucial role in mediating pH-dependent conformational changes in protein molecules [25–27]. Therefore, we systematically quantified and compared the distribution of histidine residues among the structural proteins that constitute the viral capsid, with the aim of identifying potential pH-sensing components. Previous proteomic and structural studies of ASFV have identified several proteins as constituents of the capsid, including p72, p49 (pB438L), H240R, pE120R, and M1249L [14]. Analysis of these proteins revealed that their histidine content varies significantly. Specifically, p72 contains 4.80% histidine (31/646), p49 (pB438L) contains 4.11% (18/438), H240R contains 3.75% (9/240), pE120R contains 3.33% (4/120), and M1249L contains 2.08% (26/1249) (Fig. 1 ). Among these proteins, p72 exhibits the highest histidine content, suggesting that it may play a critical role in capsid pH sensing. The high histidine content is also a distinctive characteristic of ASFV p72 when compared to the MCP of other NCLDVs. To further investigate this, we analyzed the proportion of histidine in the MCP sequences of various NCLDVs that were previously obtained from the National Center for Biotechnology Information (NCBI) database. The results showed that the histidine content of ASFV p72 is at least 1.5 folds of that in other NCLDVs MCP (Fig. 1 B). Notably, among the NCLDVs, the family Iridoviridae exhibited a slightly higher average histidine content in their MCPs compared to other families. Specifically, the average histidine content in Iridoviridae MCPs was 2.02%, while the average histidine content in the MCPs of Ascoviridae, Marseilleviridae, and Poxviridae was 1.39%, 1.68%, and 1.69%, respectively. Furthermore, Iridoviridae is also the closest relative to Asfarviridae among the NCLDVs that infect vertebrates (Figure S1 , Table 1 and S1 ). Table 1 Histidine content in DJR capsid protein. Virus Species PDB ID Samples Method Resolution(Å) Content of histidine ASFV Asfarviridae 6KU9 Reorganized p72 Cryo-EM 2.67 4.8% (31/646) HAdV Adenoviridae 6B1T Viral particles cultured in vitro Cryo-EM 3.2 1.68% (16/952) FV Faustoviridae 5J7O MCP extracted from whole virus X-ray diffraction of crystals 2.37 1.4% (9/644) VACV Poxviridae 2YGC Recombinant D13 protein X-ray diffraction of crystals 3.02 1.45% (8/551) PBCV Phycodnaviridae 1M4X p54 extracted from whole virus X-ray diffraction of crystals 2 0.97% (4/413) Sputnik Lavidaviridae 3J26 Purified virions from infected tissues Cryo-EM 3.5 0.98% (5/508) STIV Turriviridae 3J31 MCPs recombinantly expressed from purified virions from infected tissues Cryo-EM and X-ray diffraction of crystals 4.5 0.58% (2/345) Except for NCLDVs, DJR fold is also a common structural feature of the MCP of several other dsDNA viruses, including Adenoviridae, Lavidaviridae and Turriviridae. We collected and compared all published high-resolution structures of MCP with DJR fold, significant deviation in histidine distribution was observed (Table 1 , Fig. 2 ). Notably, in ASFV p72, histidines are distributed across both the DJR domain and the crown domain. In contrast, in Faustovirus MCP, whose structure is highly similar to p72, the histidine is only distributed in the DJR fold domain (Fig. 2 D). Further analysis based on high-resolution structural information revealed that in p72, at least 21 histidines' side chains are exposed on the surface of the monomer (Fig. 2 C- 2 D). Among them, 5 histidines in the DJR fold domain are exposed on the external contact surface of each trimer, including H80, H445, H450, H451 and H545 (Fig. 2 B). Importantly, the other 16 histidines are located on the contact surfaces between monomers within the trimer (Fig. 2 C), including 9 histidines in the crown domain (H226, H246, H249, H252, H279, H311, H482, H492 and H502), 3 histidines in the N-terminal JR domain (H102, H107, H424), 2 histidines in the C-terminal JR domain (H565, H597) and 2 histidines in the linker between Base domain and JR domain (H59, H63). Cryo-EM structure reveals the conformational change of p72 trimer under acidic conditions Given that the p72 protein exhibits pH-sensitive characteristics, we further investigated whether p72 undergoes acid-dependent conformational changes during the low-pH-dependent uncoating process of ASFV. We successfully expressed the p72 protein, as confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and mass spectrometry (MS) (Figure S2 -3). SEC analysis revealed that the molecular weight of the recombinantly expressed p72 protein was approximately 200 kDa at pH 8.5, consistent with the theoretical size of the p72 trimer (Fig. 3 A). According to different environments that the ASFV may expose to during viral invasion, three pH levels were selected, including pH 5.5, pH 5 and pH 3. Specifically, the buffer of pH 5.5 and pH 5 were used to mimic the acidic environment in late endosome and lysosome, respectively. Additionally, considering that pigs can become infected through the ingestion of ASFV-contaminated feed, a buffer with pH 3 was prepared to assess the effect of a stomach-like environment on the stability of p72. To investigate the effect of pH on the p72 trimer, recombinant p72 was treated with buffer solutions at three different pH levels. SEC revealed that the peak position of the acidified p72 protein shifted significantly backward compared to the untreated protein (Fig. 3 A). Specifically, after treatment with pH 5.5 and pH 5, the theoretical molecular weight of the p72 samples decreased to approximately 150 kDa, indicating a 25% reduction in particle size. In contrast, treatment with pH 3 resulted in a more pronounced change, with the theoretical molecular weight decreasing to approximately 100 kDa, corresponding to a 50% reduction in particle size. Furthermore, the Western blot after cross-linking results revealed the presence of trimeric p72 in all samples; however, the band corresponding to the p72 monomer was only observed in the acid-treated samples (Figure S4 A). Subsequently, the band intensity ratio of p72 monomer to trimer was calculated to correct for any potential loading differences between samples (Figure S4 B). In the low-voltage cryo-EM images of untreated p72 samples, we observed evenly distributed particles with diameters ranging from 7 to 10 nm (Fig. 3 B), consistent with the theoretical size [28]. After treatment with pH 5.5 and pH 5 acidic buffers, no significant changes in the particle size of the p72 protein were detected in images (Fig. 3 C-D). However, following treatment with pH 3 acidic conditions, only small and highly contrasted particles with diameters scattered between 3 and 6 nm could be observed (Fig. 3 E). Moreover, we further used high-voltage cryo-EM to collect acidified p72 data and reconstruct the structure. A total of 629 images were collected with the pixel size of 1.17Å. After particle selection and two-dimensional classification, 109,024 particles were selected for three-dimensional reconstruction (C1 symmetry) using Ab-initio. Finally, three reconstructed structures were obtained, the first was a p72 trimer structure with a resolution of 4.8 Å, and the other two were p72 dimer structures with a resolution of 14.85 Å and 15.91 Å, respectively (Figure S5 ). The volume of the trimeric p72 particle was 119.6 × 10³ ų (map contour level = 0.3), the atomic structure of the p72 trimer (PDB ID: 6KU9) fit well with a correlation coefficient (CC) value of 0.86 (Fig. 4 A). The volume of p72 treated at pH 5.5 were determined to be 85.12 × 10³ ų (map contour level = 0.3), two p72 monomers were successfully fitted into the electron density map with CC value of 0.87 (Fig. 4 B). Combining the results from SEC and single-particle 3D reconstruction, we concluded that exposure of the p72 trimer to a low-pH buffer (pH 5.5), mimicking the endocytic environment, led to approximately 30% reduction in particle volume. Based on the above results, we propose a model for the uncoating mechanism of ASFV. In the endocytosis pathway, the high histidine content in the ASFV capsid leads to repulsion between p72 monomers under low-pH conditions, resulting in depolymerization and the formation of p72 dimers (Fig. 4 C). High specificity and sensitivity of double-antibody sandwich lateral immunochromatography test strip Based on the above study, we found that the p72 protein of ASFV underwent trimer depolymerization induced by low pH, and then we developed DASLITS based on the p72 trimer (Fig. 5 A). Firstly, we use p72 monomer and trimer as the antigen to be tested, and based on previous studies on monoclonal antibodies to p72 trimer of ASFV [29], we apply the obtained 6 monoclonal antibodies to the specific detection of p72 monomer and trimer by the Enzyme linked immunosorbent assay (ELISA). The results of OD450 determination showed that the values of p72-2, p72-3, ASFV-3 and ASFV-11 binding to p72 monomer were all less than 0.2, and p72-6 and ASFV-1 had certain detection ability for p72 monomer at a dilution of 1:16000 and lower, but the OD450 values were less than 0.6, that is, there may be false positives and no specific detection ability. However, the monoclonal antibodies p72-2, p72-3, p72-6, ASFV-1, ASFV-3, and ASFV-11 all have specific detection capabilities for p72 trimers, with OD450 greater than 0.8 at a dilution of 1:2000. In particular, the OD450 values of monoclonal antibody p72-6 were greater than 0.6 in the dilution range of 1:2000 to 1:32000, and the OD450 was greater than 0.2 at very high dilutions of 1:64000 to 1:128000. These results indicate that monoclonal monomers such as p72-6 are highly specific for the detection of p72 trimers (Fig. 5 B). To determine the specificity of DASLITS with p72-6 as the detection antibody for p72 trimers, we tested samples containing both p72 monomer and trimer (Fig. 5 A and C). A sample containing P72 diluted with sample treatment buffer is added to the sample pad of the test strip, and the liquid flows laterally towards the conjugate pad under the action of hydrodynamics and surface tension. The p72 trimer in the sample is captured by the AuNP antibody-conjugated complex against it. Then, the antigen-antibody complex is transferred to the NC membrane. The anti-p72 trimer antibody immobilized in the T (test) line captures the complex and produces a characteristic red band due to the formation of the AuNP antibody-p72 trimer-antibody complex. In addition, once the sample passes through the C (control) line, the immobilized standard secondary antibody directly captures the excess antibody conjugate complex; As a result, a second red band appears on the C line. When the p72 in the test sample is monomeric or trimer-free, it cannot bind to the AuNP antibody, so the T-line does not produce the characteristic red band. As the excess probe antibody is captured by the standard secondary antibody, a distinct red band appears on the C line. The above results showed that the antigen-antibody response based on the DASLITS had high detection specificity for p72 trimer (Fig. 5 A and C). ASFV-infected samples were serially diluted at different concentrations (1:100, 1:1000, 1:5000, and 1:10000) and analyzed using DASLITS. The results show that the T-line coloration gradually decays (from left to right) in response to the increase in dilution. It is important to note that there are still naked eye discernible red T-lines present at a dilution of 1:10,000, but with lighter coloration, so this concentration was determined as the limit of detection (LOD) for DASLITS (Fig. 5 C). At the same time, the results of viral nucleic acid determination by quantitative real-time polymerase chain reaction (qPCR) showed that the threshold cycle (CT) value gradually increased with the increase of dilution. It is important to note that at the limit of detection determined by DASLITS (1:10000 dilution), the corresponding qPCR analysis yielded a CT value of 35 (a predefined critical threshold), indicating a complete loss of viral infectivity at this dilution level, i.e., the detection limit for qPCR was between 1:5000 and 1:10000. Therefore, DASLITS has superior detection sensitivity compared to qPCR (Fig. 5 C). Detection of clinical samples treated with different disinfectants Based on previously established rapid detection methods and the research basis for disinfectants against ASFV [24], we employed DASLITS to assess the disinfection efficacy of three commercially available disinfectants: citrate, sodium hypochlorite, and quaternary ammonium salts. The virus suspension, with an initial titer of 10^7.5 TCID50/mL and untreated with any disinfectant, was tested using DASLITS and displayed clear red bands at both the C and T lines. When the virus samples were treated with citrate (1:40 dilution), sodium hypochlorite (1:64 dilution), and quaternary ammonium salt disinfectant (1:80 dilution) for 2 hours, the results demonstrated that no signal was detected at the T-line in all DASLITS tests. This indicated complete dissociation of the p72 trimer, a key structural protein in the viral capsid (Fig. 5 D). In addition, we also assessed the efficacy of the disinfectants by monitoring the fluorescence signal of the eGFP reporter gene in the recombinant ASFV strain HLJ/18-DP148R-del. Porcine alveolar macrophages (PAMs) were re-infected with virus samples both before and after disinfection treatment. The results indicated that the eGFP fluorescence signal remained above 90% in the positive samples that were not disinfected. In contrast, no eGFP fluorescence signal was detected after re-infection of PAMs with virus samples that had been treated with citrate, sodium hypochlorite, or quaternary ammonium disinfectant for 2 hours. These findings confirm that the disinfectants successfully disrupted the integrity of the virus (Fig. 5 E). Crucially, in the case of the mild disinfectant treatment, parallel qPCR results revealed Ct values of 27.397 for citrate disinfectant and 27.878 for quaternary ammonium disinfectant, respectively (with a predefined critical threshold of 35). This indicates that nucleic acid integrity was preserved under the same treatment conditions (Fig. 5 D). This dichotomy of DASLITS for assessing capsid integrity and qPCR for evaluating nucleic acid stability highlights the unique capability of DASLITS. It can specifically detect disinfectant-induced structural inactivation (i.e., loss of infectivity) without being confounded by nucleic acid degradation. These findings establish DASLITS as a powerful platform to evaluate the effectiveness of mild disinfectants in inactivating ASFV, particularly for pre- and post-disinfection rapid detection in animal farms with ASF outbreaks. Discussion Since the in vitro low pH treatment (pH 5) is sufficient for inducing ASFV disruption, the disassembly does not require other biomolecules provided by the host [17]. The disassembly process is likely to depend on at least one pH sensing protein. In this study, we identified the major capsid protein p72 as the pH sensor. It is found that the p72 has the highest histidine content compared with the other structural proteins located on the capsid. Histidine is a pH-sensitive amino acid. Low pH could induce reversible protonation in the imidazole ring of histidine, leading to changes in interactions including hydrogen bond, salt bridge, π stacking and so on, and finally cause conformational changes in protein [25–27]. Up to date, the key role of histidine in pH-dependent conformational change has been demonstrated in major histocompatibility complex (MHC) II [30], Hyperpolarization-activated cyclic nucleotide-gated (HCN) [31], Presenilin [32] and influenza virus M2 proteins [33]. Corresponding with the finding that a large number of histidines (at least 21 histidines) are located on the intra-trimer interface, our experiments verified that the p72 trimer undergoes depolymerization under low pH. The results of SEC analysis show that the particle size of recombinant p72 decreases along with lowering pH. Meanwhile, the results of single particle cryo-EM 3D reconstruction showed that only 50% of the particles still maintained the trimeric conformation, and 25% of the particles were found to turn to dimer. In addition, although no structural data were obtained for p72 samples treated with pH 3, the results of size-exclusion chromatography and cryo-electron microscopy strongly support the complete depolymerization of p72 trimer under this condition. This result implies a drastic disassembly process when ASFV infect host by ingestion pathway, as the pH in stomach could be lower than pH 3. In addition, we present a model of the uncoating mechanism of ASFV. In the endocytic pathway, due to the influence of low pH and the existence of histidine on the intra-trimer contact surface, the p72 monomers repel each other, a single monomer was dissociated, and lead to the cracking of capsid. The resulting dimer is highly unstable and may be prone to further depolymerization. Based on the pivotal discovery that low pH induces ASFV p72 trimer dissociation, indicating effective triggering of viral uncoating and subsequent infectivity loss, we established a double-antibody sandwich lateral immunochromatographic test strip targeting conformational epitopes of p72 trimers. Validation studies demonstrated exceptional specificity for intact p72 trimers with a detection sensitivity of 10^4 TCID50/mL. Integrated with qPCR-based nucleic acid integrity verification, this system precisely identifies the critical inactivation mechanism whereby mild disinfectants selectively disrupt p72 trimer spatial conformation while preserving viral nucleic acids. This distinctive capability positions our method as a gold-standard technical criterion for evaluating the selective inactivation efficacy of mild disinfectants against ASFV, providing an essential assessment tool for developing novel disinfection strategies that eliminate viral infectivity while maintaining nucleic acid integrity. Materials and Methods Construction and identification of p72 expression vector. To obtain correctly folded P72 trimer, the expression strain was constructed by referring to the method of co-expressing P72 and B602L reported by Qi Liu et al. [34]. P72 gene, B602L gene, were constructed into the plasmid to form a gene expression box. The gene expression box with homologous recombination arm was amplified by PCR to prepare the repair template. Using CRISPR-Cas9 technology, the gRNA that recognized GGATTTAGGAATCCATAAAA was co-expressed, and the gene expression box was inserted into the Ty2 retrotransposon of multiple copies by homologous recombination to achieve multiple copy gene expression. Expression, Purification and Identification of Recombinant P72 Protein. The culture products were collected and centrifuged at 6000rpm for 10min at 4℃ to collect the cell precipitates. After the precipitation was suspended with 50mL washing buffer, cells were disrupted by a high-pressure homogenizer at 4℃ and 1800bar pressure. The products were centrifuged at 17000rpm at 4℃ for 60min, and the supernatant was collected. The target protein was purified by strep-Tactin XT gravity-flow column. Acid Treatment and SEC Analysis of Recombinant P72 Protein. The co-expression of p72-B602L without acid treatment and after acid treatment was analyzed by size exclusion chromatography (SEC). The purified p72 sample was concentrated and then slowly added to citrate buffers with pH values of 3, 5, and 5.5, followed by incubation at 37℃. The homogeneity and aggregation state of untreated and acid-treated p72 were verified by SEC by column chromatography. Care should be taken to avoid inhaling air bubbles during the process and it should be carried out in a subzero low temperature environment. Finally, the collected samples were analyzed by SDS-PAGE. Western blot analysis of cross-linked p72 samples. Concentrate the purified p72 trimer to 1mg/ml, slowly add the p72 protein into the low pH buffer (100mM citrate buffer of pH 3, pH5 and pH5.5) according to the ratio of p72: buffer = 1:1, blow and mix well. The p72-buffer mixture was acidified at room temperature (25 ℃) for 30min. After the acidification reaction, adjust the pH of p72-buffer mixture to 6–7 with 0.2M Na 2 HPO 4 . Based on the above p72 acidified samples, take 19ul of the above p72-buffer samples and mix them with 1ul of 1% glutaraldehyde, incubated at 4 ℃ for 20min, then place them at room temperature (25 ℃) for 10min to complete the protein crosslink. For protein analysis, samples were diluted with 5 × Loading sample buffer, heated at 95°C for 10 min, and loaded on 6% SDS-PAGE gels. Gels were run at 110 V for 80 min in l × Tris-Glycine running buffer and stained with Coomassie Blue Stain solution. Following SDS-PAGE, proteins were electrically transferred onto 0.2 pm nitrocellulose membrane (Pall), 100mA, 140min. The membranes were blocked in 2% skim milk in PBS at 4°C overnight. Primary antibody at a 1:5,000 dilution of anti-strep antibody in 5% skim milk in PBS, was added and incubated for 4 h at room temperature. Membranes were washed with TBST (3 × for 10 min each) and added with secondary antibody 1:5,000 dilution of goat anti-mouse IgG-HRP in 5% skim milk (PBS) for incubation at room temperature for 1.5 h. Membranes were then washed again with TBST (3 × for 10 min each) and developed using TMB (3,3,5,5'-Tetramethylbenzidine, Sigma Aldrich) and hydrogen peroxide for imagining. Preparation of Frozen Samples of P72 Protein. Frozen samples were prepared from each peak tip obtained through SEC (Fig. 3 ). According to the previously reported rapid freezing preparation method [34], the sample was added to a copper net covered with carbon film and quickly immersed in liquid ethane cooled by liquid nitrogen to rapidly form glassy ice. Vitrobot Marker IV of Tsinghua University cryo-electron microscopy platform was then used to prepare samples. After sample preparation, transfer it to a vacuum cup containing liquid nitrogen, and make sample records. Finally, 200kV Arctica transmission electron microscope (Falcon II camera) of Tsinghua university cryo-electron microscope platform was used to examine the frozen samples. According to the observed ice thickness, protein particle contrast and protein concentration, the frozen samples were optimized by adjusting blot parameters and protein concentration. Collection and Processing of Cryo-electron Microscopy Data. Data collection of frozen samples in this study was completed on the cryo-EM platform of Tsinghua University. Untreated samples were collected using a Titan3 electron microscope equipped with a Gatan K2 Summit direct electronic counting camera. FEI Talos Arctica with 200 kV was used to collect samples treated with pH 5.5 acidic conditions. Samples were loaded by Autoloader. AutoEMation2 software [34] is used for automatic data collection. A total of 629 images were collected with the pixel size of 1.17Å. Then, CryoSparc and RELION software were used for routine processing procedures and data analysis. After particle selection, 158530 particles were classified using two-dimensional (2D) classification. Finally, 109,024 particles were selected for three-dimensional reconstruction (C1 symmetry) using Ab-initio. Among these, the initial model of the second class closely matched the p72 trimer, and C3 symmetry was applied for 3D refinement, resulting in a final reconstruction resolution of 4.8 Å. For the third class, an additional round of 3D reconstruction was performed with C1 symmetry, yielding five final reconstruction results that exhibited dimer-like particle morphology. Among these, the higher-quality classes, namely class 2 and class 3 in the second round of 3D reconstruction, were further optimized, resulting in final resolutions of 14.85 Å and 15.91 Å, respectively. Finally, we used UCSF Chimera to analyze the electron density map and the p72 atomic structure. Selection of p72 trimer-specific AuNP-labeled antibodies The plates were coated with p72 monomer and p72 trimer at a concentration of 1 ug/ml and coated at 4°C overnight. Then block with blocking solution at 37°C for 2 h, then pat dry for later use. The monoclonal antibody p72-2, p72-3, p72-6, ASFV-1, ASFV-3, and ASFV-11 were diluted in serial dilutions (1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000), and 100ul was added to the above-mentioned coated microplate for 37°C for 30min, and then HRP-labeled goat anti-mouse secondary antibody was added (1: 5000) 100ul, 37°C reaction for 30min. Add the chromogenic solution to 37°C and protect it from light for 10min, add the stop solution, and then use the microplate reader to detect the results under OD450. Sensitivity and specificity of the double-antibody sandwich lateral immunochromatographic test strip The test strip was composed of a sample pad, conjugate pad, nitrocellulose (NC) membrane and absorbent pad. The conjugation pad was prepared by dispensing a desired volume of AuNP-labeled p72 antibody (AuNP-p72 antibody) onto the glass fiber pad using an XYZ Platform Dispenser, followed by drying at 37°C for 1 h and then storage at 4°C. Antigen against p72 trimers was sprayed on the test line on the NC membrane, and a standard second antibody was sprayed on the control line. The sample pad, conjugate pad, NC membrane and absorbent pad were sequentially attached to a PVC backing card with a 1–2 mm overlap. The card was then cut into 4 mm wide strips and assembled into a plastic shell for future use. Purified p72 monomer and trimer samples were diluted 1:100, 1:1000, 1:5000, and 1:10000, dropwise into the sample pad, and the specificity of DASLITS was determined by observing the specific red bands of C and T lines. Second, we judged the detection limit of DASLITS by the specific red bands of DASLITS for different dilutions of p72 trimer. qPCR tests samples after disinfectant disinfection of ASFV ASFV genomic DNA was extracted from ASFV-infected cell supernatants using the GenElute™ Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, USA). qPCR protocols in the QuantStudio 5 system (Applied Biosystems, USA) conform to the procedures recommended by the World Organisation for Animal Health (OIE) [24]. DASLITS evaluates the effectiveness of disinfectants in inactivating ASFV Citric acid disinfectant was diluted at 1:40, 1:80 and 1:160, 84 disinfectant was diluted at 1:64, 1:128 and 1:256, and quaternary ammonium disinfectant was diluted at 1:80, 1:160 and 1:320 for 0.5 h and 2 h, respectively. In addition, unsterilized ASFV samples were used as positive controls and PBS as negative controls. The above samples were added dropwise to the sample pad and reacted at room temperature for 3-5min, and the disinfection effect of DASLITS on ASFV under different dilutions was judged by observing the C and T lines of DASLITS. Only the C line indicates that ASFV is not detected, and the C line and T line are displayed at the same time indicates that ASFV is detectable. It should be noted that if the C line is not displayed, it means that DASLITS is invalid. Fluorescence microscopy analysis of ASFV infected PAM cells after disinfection Based on the ASFV strain HLJ/18-DP 148 R-del [35], PAM cells were infected with diluted ASFV and the eGFP reporter signal was visualized by fluorescence microscopy. Referring to the previous research method [24], the PAM cells in the 96-well plate were re-infected with the sterilized virus samples after the ASFV was treated for 0.5 h and 2 h, respectively, using the immersion disinfection test and spray disinfection test. Incubate at 37°C and 5% CO2, and observe cell status and fluorescence every 24 h. In addition, a negative control that does not contain the virus is included in this experiment. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials The data used and/or analyzed during this research are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This work was financially supported by the National Key Research and Development Program of China (2019YFC1604602-1) and the Natural Science Foundation of HeBei province (19226631D). Authors' contributions Wenzhuang Zhu designed the p72 protein and developed the DASLITS method. Yangnan Huyan purified the p72 protein, completed the cross-linking and Western blot experiments, organized the figures, and wrote the main manuscript. Chenggang Jiang conducted the qPCR and PAM cell infection experiments. Kaiwen Meng performed sequence and structural analysis of NCLDVs, collected cryo-EM data, and drew the figures. Qi Liu collected cryo-EM data for the acidified p72 protein. Yuli Liu, Ziyi Fang, and Junyi Li analyzed the data. Yuanmao Zhu, Miao Sun, Zhigao Bu, and Ye Xiang provided technical support and experimental guidance. Dongming Zhao and Geng Meng conceived the study and served as corresponding authors. Geng Meng is the project leader. All authors reviewed the manuscript. Acknowledgements Not applicable. References Eustace Montgomery R. On A Form of Swine Fever Occurring in British East Africa (Kenya Colony). Journal of Comparative Pathology and Therapeutics. 1921;34:159 − 91. https://doi.org/10.1016/s0368-1742(21)80031-4. Baños JV, Boklund A, Gogin A, Gortázar C, Guberti V, Helyes G, et al. Epidemiological analyses of African swine fever in the European Union. EFSA Journal. 2022;20(5). https://doi.org/10.2903/j.efsa.2022.7290. Li M, Zheng H. Insights and progress on epidemic characteristics, pathogenesis, and preventive measures of African swine fever virus: A review. Virulence. 2025;16(1). https://doi.org/10.1080/21505594.2025.2457949. Food and Agriculture Organization of the United Nations, 2019. ASF situation in Asia update. http://www.fao.org/ag/againfo/programmes/en/empres/ASF/situation_update.html (2019). Alonso C, Borca M, Dixon L, Revilla Y, Rodriguez F, Escribano JM, et al. ICTV Virus Taxonomy Profile: Asfarviridae. J Gen Virol. 2018;99(5):613-4. https://doi.org/10.1099/jgv.0.001049. Alejo A, Matamoros T, Guerra M, Andrés G. A Proteomic Atlas of the African Swine Fever Virus Particle. J Virol. 2018;92(23). https://doi.org/10.1128/JVI.01293-18. Gaudreault NN, Madden DW, Wilson WC, Trujillo JD, Richt JA. African Swine Fever Virus: An Emerging DNA Arbovirus. Front Vet Sci. 2020;7:215. https://doi.org/10.3389/fvets.2020.00215. Mönttinen HAM, Bicep C, Williams TA, Hirt RP. The genomes of nucleocytoplasmic large DNA viruses: viral evolution writ large. Microb Genom. 2021;7(9). https://doi.org/10.1099/mgen.0.000649. Fang Q, Zhu D, Agarkova I, Adhikari J, Klose T, Liu Y, et al. Near-atomic structure of a giant virus. Nat Commun. 2019;10(1):388. https://doi.org/10.1038/s41467-019-08319-6. Yan X, Yu Z, Zhang P, Battisti AJ, Holdaway HA, Chipman PR, et al. The capsid proteins of a large, icosahedral dsDNA virus. J Mol Biol. 2009;385(4):1287-99. https://doi.org/10.1016/j.jmb.2008.11.002. Klose T, Reteno DG, Benamar S, Hollerbach A, Colson P, La Scola B, et al. Structure of faustovirus, a large dsDNA virus. Proc Natl Acad Sci U S A. 2016;113(22):6206-11. https://doi.org/10.1073/pnas.1523999113. Andreani J, Khalil JYB, Sevvana M, Benamar S, Di Pinto F, Bitam I, et al. Pacmanvirus, a New Giant Icosahedral Virus at the Crossroads between Asfarviridae and Faustoviruses. J Virol. 2017;91(14). https://doi.org/10.1128/JVI.00212-17. Abergel C, Legendre M, Claverie JM. The rapidly expanding universe of giant viruses: Mimivirus, Pandoravirus, Pithovirus and Mollivirus. FEMS Microbiol Rev. 2015;39(6):779 − 96. https://doi.org/10.1093/femsre/fuv037. Wang N, Zhao D, Wang J, Zhang Y, Wang M, Gao Y, et al. Architecture of African swine fever virus and implications for viral assembly. Science. 2019;366(6465):640-4. https://doi.org/10.1126/science.aaz1439. Liu S, Luo Y, Wang Y, Li S, Zhao Z, Bi Y, et al. Cryo-EM Structure of the African Swine Fever Virus. Cell Host Microbe. 2019;26(6):836 − 43.e3. https://doi.org/10.1016/j.chom.2019.11.004. Valdeira ML, Bernardes C, Cruz B, Geraldes A. Entry of African swine fever virus into Vero cells and uncoating. Vet Microbiol. 1998;60(2–4):131 − 40. https://doi.org/10.1016/s0378-1135(98)00152-7. Hernáez B, Guerra M, Salas ML, Andrés G. African Swine Fever Virus Undergoes Outer Envelope Disruption, Capsid Disassembly and Inner Envelope Fusion before Core Release from Multivesicular Endosomes. PLoS Pathog. 2016;12(4):e1005595. https://doi.org/10.1371/journal.ppat.1005595. Cuesta-Geijo MA, Galindo I, Hernáez B, Quetglas JI, Dalmau-Mena I, Alonso C. Endosomal maturation, Rab7 GTPase and phosphoinositides in African swine fever virus entry. PLoS One. 2012;7(11):e48853. https://doi.org/10.1371/journal.pone.0048853. Sánchez EG, Pérez-Núñez D, Revilla Y. Mechanisms of Entry and Endosomal Pathway of African Swine Fever Virus. Vaccines (Basel). 2017;5(4). https://doi.org/10.3390/vaccines5040042. Schrad JR, Abrahão JS, Cortines JR, Parent KN. Structural and Proteomic Characterization of the Initiation of Giant Virus Infection. Cell. 2020;181(5):1046-61.e6. https://doi.org/10.1016/j.cell.2020.04.032. Zhang X, Sun S, Xiang Y, Wong J, Klose T, Raoult D, et al. Structure of Sputnik, a virophage, at 3.5-Å resolution. Proc Natl Acad Sci U S A. 2012;109(45):18431-6. https://doi.org/10.1073/pnas.1211702109. Greber UF, Willetts M, Webster P, Helenius A. Stepwise dismantling of adenovirus 2 during entry into cells. Cell. 1993;75(3):477 − 86. https://doi.org/10.1016/0092-8674(93)90382-z. Juszkiewicz M, Walczak M, Woźniakowski G. Characteristics of Selected Active Substances used in Disinfectants and their Virucidal Activity Against ASFV. J Vet Res. 2019;63(1):17–25. https://doi.org/10.2478/jvetres-2019-0006. Jiang C-g, Sun Y, Zhang F, Ai X, Feng X-n, Hu W, et al. Viricidal activity of several disinfectants against African swine fever virus. Journal of Integrative Agriculture. 2021;20(11):3084-8. https://doi.org/10.1016/S2095-3119(21)63631-6. Meurisse R, Brasseur R, Thomas A. Aromatic side-chain interactions in proteins. Near- and far-sequence His-X pairs. Biochim Biophys Acta. 2003;1649(1):85–96. https://doi.org/10.1016/s1570-9639(03)00161-4. Heyda J, Mason PE, Jungwirth P. Attractive interactions between side chains of histidine-histidine and histidine-arginine-based cationic dipeptides in water. J Phys Chem B. 2010;114(26):8744-9. https://doi.org/10.1021/jp101031v. Vila JA, Arnautova YA, Vorobjev Y, Scheraga HA. Assessing the fractions of tautomeric forms of the imidazole ring of histidine in proteins as a function of pH. Proc Natl Acad Sci U S A. 2011;108(14):5602-7. https://doi.org/10.1073/pnas.1102373108. Andrés G, Charro D, Matamoros T, Dillard RS, Abrescia NGA. The cryo-EM structure of African swine fever virus unravels a unique architecture comprising two icosahedral protein capsids and two lipoprotein membranes. J Biol Chem. 2020;295(1):1–12. https://doi.org/10.1074/jbc.AC119.011196. Tesfagaber W, Wang W, Wang L, Zhao R, Zhu Y, Li F, et al. A highly efficient blocking ELISA based on p72 monoclonal antibody for the detection of African swine fever virus antibodies and identification of its linear B cell epitope. Int J Biol Macromol. 2024;268(Pt 1):131695. https://doi.org/10.1016/j.ijbiomac.2024.131695. Rötzschke O, Lau JM, Hofstätter M, Falk K, Strominger JL. A pH-sensitive histidine residue as control element for ligand release from HLA-DR molecules. Proc Natl Acad Sci U S A. 2002;99(26):16946-50. https://doi.org/10.1073/pnas.212643999. Zong X, Stieber J, Ludwig A, Hofmann F, Biel M. A single histidine residue determines the pH sensitivity of the pacemaker channel HCN2. J Biol Chem. 2001;276(9):6313-9. https://doi.org/10.1074/jbc.M010326200. Cai T, Hatano A, Kanatsu K, Tomita T. Histidine 131 in presenilin 1 is the pH-sensitive residue that causes the increase in Aβ42 level in acidic pH. J Biochem. 2020;167(5):463 − 71. https://doi.org/10.1093/jb/mvz110. Hong M, DeGrado WF. Structural basis for proton conduction and inhibition by the influenza M2 protein. Protein Sci. 2012;21(11):1620-33. https://doi.org/10.1002/pro.2158. Liu Q, Ma B, Qian N, Zhang F, Tan X, Lei J, et al. Structure of the African swine fever virus major capsid protein p72. Cell Res. 2019;29(11):953-5. https://doi.org/10.1038/s41422-019-0232-x. Chen W, Zhao D, He X, Liu R, Wang Z, Zhang X, et al. A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci China Life Sci. 2020;63(5):623 − 34. https://doi.org/10.1007/s11427-020-1657-9. Additional Declarations No competing interests reported. Supplementary Files FigureS1.png FigureS2.jpg FigureS3.jpg FigureS5.jpg FigureS4.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6368001","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":439802837,"identity":"08910e5b-ce5c-49dc-a8ee-551443478d83","order_by":0,"name":"Wenzhuang Zhu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wenzhuang","middleName":"","lastName":"Zhu","suffix":""},{"id":439802838,"identity":"90b18659-9c1e-4484-8e17-a291946f693a","order_by":1,"name":"Yangnan Huyan","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yangnan","middleName":"","lastName":"Huyan","suffix":""},{"id":439802839,"identity":"1b64f672-793b-4df0-8c81-5e9328fad1df","order_by":2,"name":"Chenggang Jiang","email":"","orcid":"","institution":"Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Chenggang","middleName":"","lastName":"Jiang","suffix":""},{"id":439802840,"identity":"9e7ce3d6-cf96-4c34-9271-c348a797e242","order_by":3,"name":"Kaiwen Meng","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Kaiwen","middleName":"","lastName":"Meng","suffix":""},{"id":439802841,"identity":"994205ea-5464-40d4-86de-ec646533c939","order_by":4,"name":"Qi Liu","email":"","orcid":"","institution":"Tsinghua University","correspondingAuthor":false,"prefix":"","firstName":"Qi","middleName":"","lastName":"Liu","suffix":""},{"id":439802842,"identity":"f97cade8-ae37-47a6-817d-228cf3d6c740","order_by":5,"name":"Yuli Liu","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Yuli","middleName":"","lastName":"Liu","suffix":""},{"id":439802843,"identity":"9ba65f39-0059-426b-b7b2-9d8f481114e7","order_by":6,"name":"Ziyi Fang","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ziyi","middleName":"","lastName":"Fang","suffix":""},{"id":439802844,"identity":"ea94e698-1738-4703-bb59-a5cf6d23fe21","order_by":7,"name":"Junyi Li","email":"","orcid":"","institution":"China Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Junyi","middleName":"","lastName":"Li","suffix":""},{"id":439802846,"identity":"adf0a472-a179-486e-98e4-d9721e8f3bf2","order_by":8,"name":"Yuanmao Zhu","email":"","orcid":"","institution":"Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yuanmao","middleName":"","lastName":"Zhu","suffix":""},{"id":439802848,"identity":"bedf0d1c-50f8-4756-8187-a862aa2beeda","order_by":9,"name":"Miao Sun","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Sun","suffix":""},{"id":439802850,"identity":"cfa225d1-96bf-4e05-a924-46cfd8a09c7a","order_by":10,"name":"Zhigao Bu","email":"","orcid":"","institution":"Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zhigao","middleName":"","lastName":"Bu","suffix":""},{"id":439802852,"identity":"f9d4e50c-cba4-4ad1-a2c3-8a11c3118e6d","order_by":11,"name":"Ye Xiang","email":"","orcid":"","institution":"Tsinghua University","correspondingAuthor":false,"prefix":"","firstName":"Ye","middleName":"","lastName":"Xiang","suffix":""},{"id":439802853,"identity":"2dccd0c1-4341-4ab5-9abc-6dbb5ed51702","order_by":12,"name":"Dongming Zhao","email":"","orcid":"","institution":"Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Dongming","middleName":"","lastName":"Zhao","suffix":""},{"id":439802854,"identity":"f05d2cd1-0829-4a56-94b8-202062ad7ec1","order_by":13,"name":"Geng Meng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAoElEQVRIiWNgGAWjYFAC5gMQ+gDxWtgSSNbCY0CiFt3+NR8//GxjkOO7kcD4uYAYLWY33m6W7G1jMJa8kcAsPYM4LWe3MfC2MSRuuJHAxsxDnJYzzxj/tjHUk6DlfA8bM9CWBAMSbGEzlpY5J2E488zDZmkibTn88OObMht5vuPJBz8TpYVBIgFMAjFjA1EaGBj4DxCpcBSMglEwCkYuAAANIzFK9LBiCQAAAABJRU5ErkJggg==","orcid":"","institution":"China Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Geng","middleName":"","lastName":"Meng","suffix":""}],"badges":[],"createdAt":"2025-04-03 09:38:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6368001/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6368001/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":80254632,"identity":"1ffaf300-bf81-47ab-8104-b487a0d494a9","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2693957,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe histidine content of NCLDVs capsid proteins.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Analysis of the histidine content of structural proteins located in the ASFV capsid.\u003c/p\u003e\n\u003cp\u003e(B) Statistical bar chart of histidine content in NCLDVs capsid protein. The vertical axis is the percentage of histidine in the total amino acids.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/2150156d9f94b1bf6386c9c8.png"},{"id":80254642,"identity":"80240065-8578-4071-8743-204e7dedb449","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":25899182,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistidine distribution within the p72 trimer structure.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Ribbon diagram shows the structure of p72 trimer.\u003c/p\u003e\n\u003cp\u003e(B) Histidine with side chains exposed on the surface of protein monomers in ASFV p72. One of the monomers in the trimer is shown in blue and the remaining two monomers are shown in grey. Histidine whose side chains are exposed on the surface of the p72 monomer are shown as red spheres, including histidine exposed at the trimer-trimer contact interface (B) and histidine exposed on the contact surface between monomers within the trimer (C).\u003c/p\u003e\n\u003cp\u003e(D) Histidine distribution in capsid proteins of DJR. One of the monomers in the trimer is shown in blue and the remaining two monomers are shown in grey.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/fdd3f8c28057510198d065e6.png"},{"id":80254636,"identity":"58555d70-f988-40cf-abf4-7cc25e7a96ef","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":16845672,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe conformational change of p72 trimer under acidic conditions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) SEC peak position of p72 at different pH. Peak tip positions corresponding to p72 target peaks are marked with dotted lines, and the position differences between dotted lines are represented by red line segments.\u003c/p\u003e\n\u003cp\u003e(B-E) Cryo-electron microscope images of P72 at different pH: untreated protein samples (pH8.5) in (B), protein samples exposed to pH5.5 (D), protein samples exposed to pH5 (C), protein samples exposed to pH3 (E).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/eb755140d51b658016d1fa00.png"},{"id":80255315,"identity":"386e9832-161d-4437-9adc-de8182dd683a","added_by":"auto","created_at":"2025-04-09 18:52:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":11346406,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA mechanism model of ASFV uncoating under acidic conditions similar to late endosomes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The superposition of the p72 atomic structure (PDB ID: 6KU9) into the 3D reconstruction results at a resolution of 4.8 Å, with a CC value of 0.86. (contour level = 0.24). The three monomers are shown in blue, green and pink, respectively.\u003c/p\u003e\n\u003cp\u003e(B) The fitting results of the p72 monomer structure (PDB ID: 6KU9) and the electron density with a resolution of 14.85 Å, the CC value of monomer 1 (blue) after fitting is 0.88, and monomer 2 (green) after fitting The C value is 0.87.\u003c/p\u003e\n\u003cp\u003e(C) Uncoating mechanism model of ASFV icosahedral capsid. In the early endosome, pH~6.5, p72 trimer, the main component of the viral capsid, was closely arranged by electrostatic interaction. In late endosome, the pH range is reduced to ~5.5, and a monomer in the trimer dissociates under acidic conditions, resulting in capsid cracking. The dimer may also continue to depolymerize under environmental influence and eventually form monomer.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/a4ff8bfc165b4f63601d7b3b.png"},{"id":80254637,"identity":"f1a0d12e-1b71-4225-9e7d-cbb8db48d5a8","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4572943,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDASLITS specific for p72 trimer to evaluate the inactivation effect of the disinfectant on ASFV.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The schematic of the double-antibody sandwich lateral immunochromatography test strip.\u003c/p\u003e\n\u003cp\u003e(B) Selection of p72 trimer-specific AuNP-labeled antibodies.\u003c/p\u003e\n\u003cp\u003e(C) The specificity and sensitivity of the DASLITS (left). The p72 samples diluted by treating buffer and virus infection activity was determined by qPCR (right).\u003c/p\u003e\n\u003cp\u003e(D) Mild disinfectants (citrate, 1:40 and quaternary ammonium, 1:80) and harsh disinfectant (84, 1:64) were used in treating virus for 2 hours, the DASLITS and qPCR results were shown.\u003c/p\u003e\n\u003cp\u003e(E) Fluorescence microscopy analysis of ASFV infected PAM cells after disinfection.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/2fa7c7ccd9a579339382f228.png"},{"id":82566666,"identity":"e5c02480-1bc3-43d9-bbfd-390059bc8ee3","added_by":"auto","created_at":"2025-05-13 03:02:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":60229573,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/82aa833b-0fcc-4b22-852e-9b4db96706de.pdf"},{"id":80254631,"identity":"0d515e2e-30e9-4c16-920c-e837b9a87a35","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":244592,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.png","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/b70cb3e7dbd61fe3da7015de.png"},{"id":80254635,"identity":"ef5239ea-a82e-4e26-bd40-06d968755b0a","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1004567,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/25bd06d3d1870df48931c971.jpg"},{"id":80254643,"identity":"a92c4291-834b-4b4d-bf03-b95892bcbeec","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":806015,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/ae85fb5053cf84c490e7dda3.jpg"},{"id":80254640,"identity":"01239f31-a13f-478c-b32c-b61e43008446","added_by":"auto","created_at":"2025-04-09 18:36:46","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":2121863,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/c05829ce63ba785c8d2874b0.jpg"},{"id":80254651,"identity":"854adcea-b626-4f5f-bc63-5dc3da3d8fa6","added_by":"auto","created_at":"2025-04-09 18:36:47","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":2977200,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS4.tif","url":"https://assets-eu.researchsquare.com/files/rs-6368001/v1/97c18a16c1d7deda7e19a73a.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"ASFV major capsid p72 trimers function as a pH sensor during uncoating process of virus endocytosis and facilitate its application as conformational antigen detection","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAfrican swine fever (ASF) is a highly contagious and fatal acute hemorrhagic fever in domestic and wild boars that was first reported in Kenya in 1921 [1\u0026ndash;2]. In 2018, ASF has spread to China and rapidly transmission to several countries in the world. The disease exhibited morbidity and mortality rates approaching 100%, inflicting substantial economic losses on the global swine industry [3\u0026ndash;4]. At present, ASF has not been completely eliminated in China and neighboring countries. Although ASF does not infect humans (i.e., it is not a zoonotic disease), it significantly impacts the health safety and stability of the food chain derived from animals.\u003c/p\u003e \u003cp\u003eAs the only known member of nucleocytoplasmic large DNA viruses (NCLDVs) that infect mammals, African swine fever virus (ASFV) belongs to the Asfarviridae. Many NCLDVs, including ASFV, Iridovirus, Mimivirus, Paramecium bursaria chlorella virus (PBCV), and Faustovirus (FV), exhibit icosahedral or near-icosahedral capsid symmetry [5\u0026ndash;8]. Their capsids are assembled from trimeric major capsid protein (MCP) that feature the characteristic double jelly-roll (DJR) fold [9\u0026ndash;13]. Similar to other NCLDVs, the ASFV is multi-layered. The ASFV particle is composed of an exterior membrane envelope, an icosahedral capsid (T\u0026thinsp;=\u0026thinsp;277), an inner membrane, an icosahedral core-shell (T\u0026thinsp;=\u0026thinsp;17) and an inner core containing the genome [14\u0026ndash;15]. Therefore, in the uncoating process, the viral capsid should be disassembled to release the enveloped core shell and further release the genome. However, as a key step in the replication cycle, the uncoating mechanism of ASFV, as well as NCLDVs and other dsDNA viruses, is very limited so far.\u003c/p\u003e \u003cp\u003ePrevious studies revealed that ASFV enters host cells through the endosomal pathway [16\u0026ndash;19]. There is a pH gradient between the vesicles of the endosome system. The pH in the early endosomes is close to 7, and the pH is around 5\u0026ndash;6 in the late endosome. Electron microscopic observation of ASFV entering macrophages showed that the density of ASFV capsid is partially lost during the virus transportation from early endosome to late endosome [17]. And it has been verified that the ASFV capsid disruption relies on endosomal acidification [17]. Similar endosomal pathway/low pH-dependent uncoating processes have also been reported in other dsDNA viruses [20\u0026ndash;22]. However, the pH-sensing responding component of the ASFV capsid still remains unknown.\u003c/p\u003e \u003cp\u003eFurthermore, disinfection is an effective measure to control the spread of ASFV and maintain high biosecurity standards, so the proper use of disinfectants is a fundamental and important aspect of biosecurity [23]. Disinfectants (e.g., glutaraldehyde-based reagents, phenolic compounds, and chlorine-containing preparations) that are currently widely used in pig farms have shown effective nucleic acid inactivation. However, in the process of eliminating pathogens, their intense irritation poses a risk to both operators and livestock [24]. Notably, there is still a serious lack of standardized evaluation protocols to evaluate the virucidal efficacy of low-irritant disinfectants against major porcine pathogens, particularly ASFV, which makes it difficult to confirm their effectiveness in achieving complete viral inactivation during application.\u003c/p\u003e \u003cp\u003eIn this study, by comparing the histidine components of all capsid proteins, we identified the major capsid protein p72 as a pH sensor. Size-exclusion chromatography (SEC) and protein cross-linking assay showed that p72 trimers depolymerized in an acidic environment similar to late endosomes. Through the structural analysis of single particle cryo-EM, it was found that the p72 trimer underwent conformational changes and depolymerization to produce dimers and monomers under acidic conditions. These results elucidate the acid-induced decomposition mechanism of the p72 capsid trimer structure, revealing low pH-mediated viral uncoating disrupts ASFV infectivity. Based on the insights into this mechanism, we also developed a double-antibody sandwich lateral immunochromatographic test strip (DASLITS). DASLITS offers two key advantages: 1) high specificity \u0026ndash; specific detection of intact p72 trimers; 2) Superior sensitivity \u0026ndash; The detection limit for ASFV dilution is higher than that of qPCR and can be quickly identified by the naked eye. It is worth mentioning that DASLITS has outstanding advantages in evaluating the inactivation ability of low-irritant disinfectants for ASFV, which effectively solves the key technical gap in the current disinfection effect evaluation.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eASFV major capsid p72 trimers function as a pH sensor\u003c/h2\u003e\n \u003cp\u003eHistidine is widely recognized as a prototypical pH-sensitive amino acid, playing a crucial role in mediating pH-dependent conformational changes in protein molecules [25\u0026ndash;27]. Therefore, we systematically quantified and compared the distribution of histidine residues among the structural proteins that constitute the viral capsid, with the aim of identifying potential pH-sensing components. Previous proteomic and structural studies of ASFV have identified several proteins as constituents of the capsid, including p72, p49 (pB438L), H240R, pE120R, and M1249L [14]. Analysis of these proteins revealed that their histidine content varies significantly. Specifically, p72 contains 4.80% histidine (31/646), p49 (pB438L) contains 4.11% (18/438), H240R contains 3.75% (9/240), pE120R contains 3.33% (4/120), and M1249L contains 2.08% (26/1249) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Among these proteins, p72 exhibits the highest histidine content, suggesting that it may play a critical role in capsid pH sensing.\u003c/p\u003e\n \u003cp\u003eThe high histidine content is also a distinctive characteristic of ASFV p72 when compared to the MCP of other NCLDVs. To further investigate this, we analyzed the proportion of histidine in the MCP sequences of various NCLDVs that were previously obtained from the National Center for Biotechnology Information (NCBI) database. The results showed that the histidine content of ASFV p72 is at least 1.5 folds of that in other NCLDVs MCP (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB). Notably, among the NCLDVs, the family Iridoviridae exhibited a slightly higher average histidine content in their MCPs compared to other families. Specifically, the average histidine content in Iridoviridae MCPs was 2.02%, while the average histidine content in the MCPs of Ascoviridae, Marseilleviridae, and Poxviridae was 1.39%, 1.68%, and 1.69%, respectively. Furthermore, Iridoviridae is also the closest relative to Asfarviridae among the NCLDVs that infect vertebrates (Figure \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e, Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eHistidine content in DJR capsid protein.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eVirus\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePDB ID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSamples\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eMethod\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eResolution(\u0026Aring;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eContent of histidine\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eASFV\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAsfarviridae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6KU9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReorganized p72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCryo-EM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e4.8% (31/646)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHAdV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eAdenoviridae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6B1T\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eViral particles cultured in vitro\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCryo-EM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.68% (16/952)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eFV\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eFaustoviridae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5J7O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMCP extracted from whole virus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eX-ray diffraction of crystals\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.4% (9/644)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eVACV\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ePoxviridae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2YGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eRecombinant D13 protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eX-ray diffraction of crystals\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.45% (8/551)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003ePBCV\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ePhycodnaviridae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1M4X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ep54 extracted from whole virus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eX-ray diffraction of crystals\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.97% (4/413)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSputnik\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eLavidaviridae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3J26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePurified virions from infected tissues\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCryo-EM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.98% (5/508)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSTIV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTurriviridae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3J31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMCPs recombinantly expressed from purified virions from infected tissues\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCryo-EM and X-ray diffraction of crystals\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.58% (2/345)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eExcept for NCLDVs, DJR fold is also a common structural feature of the MCP of several other dsDNA viruses, including Adenoviridae, Lavidaviridae and Turriviridae. We collected and compared all published high-resolution structures of MCP with DJR fold, significant deviation in histidine distribution was observed (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Notably, in ASFV p72, histidines are distributed across both the DJR domain and the crown domain. In contrast, in Faustovirus MCP, whose structure is highly similar to p72, the histidine is only distributed in the DJR fold domain (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD). Further analysis based on high-resolution structural information revealed that in p72, at least 21 histidines\u0026apos; side chains are exposed on the surface of the monomer (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC-\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD). Among them, 5 histidines in the DJR fold domain are exposed on the external contact surface of each trimer, including H80, H445, H450, H451 and H545 (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). Importantly, the other 16 histidines are located on the contact surfaces between monomers within the trimer (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC), including 9 histidines in the crown domain (H226, H246, H249, H252, H279, H311, H482, H492 and H502), 3 histidines in the N-terminal JR domain (H102, H107, H424), 2 histidines in the C-terminal JR domain (H565, H597) and 2 histidines in the linker between Base domain and JR domain (H59, H63).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eCryo-EM structure reveals the conformational change of p72 trimer under acidic conditions\u003c/h3\u003e\n\u003cp\u003eGiven that the p72 protein exhibits pH-sensitive characteristics, we further investigated whether p72 undergoes acid-dependent conformational changes during the low-pH-dependent uncoating process of ASFV. We successfully expressed the p72 protein, as confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and mass spectrometry (MS) (Figure \u003cspan class=\"InternalRef\"\u003eS2\u003c/span\u003e-3). SEC analysis revealed that the molecular weight of the recombinantly expressed p72 protein was approximately 200 kDa at pH 8.5, consistent with the theoretical size of the p72 trimer (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e\n\u003cp\u003eAccording to different environments that the ASFV may expose to during viral invasion, three pH levels were selected, including pH 5.5, pH 5 and pH 3. Specifically, the buffer of pH 5.5 and pH 5 were used to mimic the acidic environment in late endosome and lysosome, respectively. Additionally, considering that pigs can become infected through the ingestion of ASFV-contaminated feed, a buffer with pH 3 was prepared to assess the effect of a stomach-like environment on the stability of p72. To investigate the effect of pH on the p72 trimer, recombinant p72 was treated with buffer solutions at three different pH levels. SEC revealed that the peak position of the acidified p72 protein shifted significantly backward compared to the untreated protein (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). Specifically, after treatment with pH 5.5 and pH 5, the theoretical molecular weight of the p72 samples decreased to approximately 150 kDa, indicating a 25% reduction in particle size. In contrast, treatment with pH 3 resulted in a more pronounced change, with the theoretical molecular weight decreasing to approximately 100 kDa, corresponding to a 50% reduction in particle size. Furthermore, the Western blot after cross-linking results revealed the presence of trimeric p72 in all samples; however, the band corresponding to the p72 monomer was only observed in the acid-treated samples (Figure \u003cspan class=\"InternalRef\"\u003eS4\u003c/span\u003eA). Subsequently, the band intensity ratio of p72 monomer to trimer was calculated to correct for any potential loading differences between samples (Figure \u003cspan class=\"InternalRef\"\u003eS4\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003eIn the low-voltage cryo-EM images of untreated p72 samples, we observed evenly distributed particles with diameters ranging from 7 to 10 nm (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB), consistent with the theoretical size [28]. After treatment with pH 5.5 and pH 5 acidic buffers, no significant changes in the particle size of the p72 protein were detected in images (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). However, following treatment with pH 3 acidic conditions, only small and highly contrasted particles with diameters scattered between 3 and 6 nm could be observed (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE). Moreover, we further used high-voltage cryo-EM to collect acidified p72 data and reconstruct the structure. A total of 629 images were collected with the pixel size of 1.17\u0026Aring;. After particle selection and two-dimensional classification, 109,024 particles were selected for three-dimensional reconstruction (C1 symmetry) using Ab-initio. Finally, three reconstructed structures were obtained, the first was a p72 trimer structure with a resolution of 4.8 \u0026Aring;, and the other two were p72 dimer structures with a resolution of 14.85 \u0026Aring; and 15.91 \u0026Aring;, respectively (Figure \u003cspan class=\"InternalRef\"\u003eS5\u003c/span\u003e). The volume of the trimeric p72 particle was 119.6 \u0026times; 10\u0026sup3; \u0026Aring;\u0026sup3; (map contour level\u0026thinsp;=\u0026thinsp;0.3), the atomic structure of the p72 trimer (PDB ID: 6KU9) fit well with a correlation coefficient (CC) value of 0.86 (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). The volume of p72 treated at pH 5.5 were determined to be 85.12 \u0026times; 10\u0026sup3; \u0026Aring;\u0026sup3; (map contour level\u0026thinsp;=\u0026thinsp;0.3), two p72 monomers were successfully fitted into the electron density map with CC value of 0.87 (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003eCombining the results from SEC and single-particle 3D reconstruction, we concluded that exposure of the p72 trimer to a low-pH buffer (pH 5.5), mimicking the endocytic environment, led to approximately 30% reduction in particle volume. Based on the above results, we propose a model for the uncoating mechanism of ASFV. In the endocytosis pathway, the high histidine content in the ASFV capsid leads to repulsion between p72 monomers under low-pH conditions, resulting in depolymerization and the formation of p72 dimers (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\n\u003ch3\u003eHigh specificity and sensitivity of double-antibody sandwich lateral immunochromatography test strip\u003c/h3\u003e\n\u003cp\u003eBased on the above study, we found that the p72 protein of ASFV underwent trimer depolymerization induced by low pH, and then we developed DASLITS based on the p72 trimer (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA). Firstly, we use p72 monomer and trimer as the antigen to be tested, and based on previous studies on monoclonal antibodies to p72 trimer of ASFV [29], we apply the obtained 6 monoclonal antibodies to the specific detection of p72 monomer and trimer by the Enzyme linked immunosorbent assay (ELISA). The results of OD450 determination showed that the values of p72-2, p72-3, ASFV-3 and ASFV-11 binding to p72 monomer were all less than 0.2, and p72-6 and ASFV-1 had certain detection ability for p72 monomer at a dilution of 1:16000 and lower, but the OD450 values were less than 0.6, that is, there may be false positives and no specific detection ability. However, the monoclonal antibodies p72-2, p72-3, p72-6, ASFV-1, ASFV-3, and ASFV-11 all have specific detection capabilities for p72 trimers, with OD450 greater than 0.8 at a dilution of 1:2000. In particular, the OD450 values of monoclonal antibody p72-6 were greater than 0.6 in the dilution range of 1:2000 to 1:32000, and the OD450 was greater than 0.2 at very high dilutions of 1:64000 to 1:128000. These results indicate that monoclonal monomers such as p72-6 are highly specific for the detection of p72 trimers (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e\n\u003cp\u003eTo determine the specificity of DASLITS with p72-6 as the detection antibody for p72 trimers, we tested samples containing both p72 monomer and trimer (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA and C). A sample containing P72 diluted with sample treatment buffer is added to the sample pad of the test strip, and the liquid flows laterally towards the conjugate pad under the action of hydrodynamics and surface tension. The p72 trimer in the sample is captured by the AuNP antibody-conjugated complex against it. Then, the antigen-antibody complex is transferred to the NC membrane. The anti-p72 trimer antibody immobilized in the T (test) line captures the complex and produces a characteristic red band due to the formation of the AuNP antibody-p72 trimer-antibody complex. In addition, once the sample passes through the C (control) line, the immobilized standard secondary antibody directly captures the excess antibody conjugate complex; As a result, a second red band appears on the C line. When the p72 in the test sample is monomeric or trimer-free, it cannot bind to the AuNP antibody, so the T-line does not produce the characteristic red band. As the excess probe antibody is captured by the standard secondary antibody, a distinct red band appears on the C line. The above results showed that the antigen-antibody response based on the DASLITS had high detection specificity for p72 trimer (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA and C).\u003c/p\u003e\n\u003cp\u003eASFV-infected samples were serially diluted at different concentrations (1:100, 1:1000, 1:5000, and 1:10000) and analyzed using DASLITS. The results show that the T-line coloration gradually decays (from left to right) in response to the increase in dilution. It is important to note that there are still naked eye discernible red T-lines present at a dilution of 1:10,000, but with lighter coloration, so this concentration was determined as the limit of detection (LOD) for DASLITS (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC). At the same time, the results of viral nucleic acid determination by quantitative real-time polymerase chain reaction (qPCR) showed that the threshold cycle (CT) value gradually increased with the increase of dilution. It is important to note that at the limit of detection determined by DASLITS (1:10000 dilution), the corresponding qPCR analysis yielded a CT value of 35 (a predefined critical threshold), indicating a complete loss of viral infectivity at this dilution level, i.e., the detection limit for qPCR was between 1:5000 and 1:10000. Therefore, DASLITS has superior detection sensitivity compared to qPCR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e\n\u003ch3\u003eDetection of clinical samples treated with different disinfectants\u003c/h3\u003e\n\u003cp\u003eBased on previously established rapid detection methods and the research basis for disinfectants against ASFV [24], we employed DASLITS to assess the disinfection efficacy of three commercially available disinfectants: citrate, sodium hypochlorite, and quaternary ammonium salts. The virus suspension, with an initial titer of 10^7.5 TCID50/mL and untreated with any disinfectant, was tested using DASLITS and displayed clear red bands at both the C and T lines. When the virus samples were treated with citrate (1:40 dilution), sodium hypochlorite (1:64 dilution), and quaternary ammonium salt disinfectant (1:80 dilution) for 2 hours, the results demonstrated that no signal was detected at the T-line in all DASLITS tests. This indicated complete dissociation of the p72 trimer, a key structural protein in the viral capsid (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e\n\u003cp\u003eIn addition, we also assessed the efficacy of the disinfectants by monitoring the fluorescence signal of the eGFP reporter gene in the recombinant ASFV strain HLJ/18-DP148R-del. Porcine alveolar macrophages (PAMs) were re-infected with virus samples both before and after disinfection treatment. The results indicated that the eGFP fluorescence signal remained above 90% in the positive samples that were not disinfected. In contrast, no eGFP fluorescence signal was detected after re-infection of PAMs with virus samples that had been treated with citrate, sodium hypochlorite, or quaternary ammonium disinfectant for 2 hours. These findings confirm that the disinfectants successfully disrupted the integrity of the virus (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE).\u003c/p\u003e\n\u003cp\u003eCrucially, in the case of the mild disinfectant treatment, parallel qPCR results revealed Ct values of 27.397 for citrate disinfectant and 27.878 for quaternary ammonium disinfectant, respectively (with a predefined critical threshold of 35). This indicates that nucleic acid integrity was preserved under the same treatment conditions (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD). This dichotomy of DASLITS for assessing capsid integrity and qPCR for evaluating nucleic acid stability highlights the unique capability of DASLITS. It can specifically detect disinfectant-induced structural inactivation (i.e., loss of infectivity) without being confounded by nucleic acid degradation. These findings establish DASLITS as a powerful platform to evaluate the effectiveness of mild disinfectants in inactivating ASFV, particularly for pre- and post-disinfection rapid detection in animal farms with ASF outbreaks.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSince the in vitro low pH treatment (pH 5) is sufficient for inducing ASFV disruption, the disassembly does not require other biomolecules provided by the host [17]. The disassembly process is likely to depend on at least one pH sensing protein. In this study, we identified the major capsid protein p72 as the pH sensor. It is found that the p72 has the highest histidine content compared with the other structural proteins located on the capsid. Histidine is a pH-sensitive amino acid. Low pH could induce reversible protonation in the imidazole ring of histidine, leading to changes in interactions including hydrogen bond, salt bridge, π stacking and so on, and finally cause conformational changes in protein [25\u0026ndash;27]. Up to date, the key role of histidine in pH-dependent conformational change has been demonstrated in major histocompatibility complex (MHC) II [30], Hyperpolarization-activated cyclic nucleotide-gated (HCN) [31], Presenilin [32] and influenza virus M2 proteins [33].\u003c/p\u003e \u003cp\u003eCorresponding with the finding that a large number of histidines (at least 21 histidines) are located on the intra-trimer interface, our experiments verified that the p72 trimer undergoes depolymerization under low pH. The results of SEC analysis show that the particle size of recombinant p72 decreases along with lowering pH. Meanwhile, the results of single particle cryo-EM 3D reconstruction showed that only 50% of the particles still maintained the trimeric conformation, and 25% of the particles were found to turn to dimer. In addition, although no structural data were obtained for p72 samples treated with pH 3, the results of size-exclusion chromatography and cryo-electron microscopy strongly support the complete depolymerization of p72 trimer under this condition. This result implies a drastic disassembly process when ASFV infect host by ingestion pathway, as the pH in stomach could be lower than pH 3. In addition, we present a model of the uncoating mechanism of ASFV. In the endocytic pathway, due to the influence of low pH and the existence of histidine on the intra-trimer contact surface, the p72 monomers repel each other, a single monomer was dissociated, and lead to the cracking of capsid. The resulting dimer is highly unstable and may be prone to further depolymerization.\u003c/p\u003e \u003cp\u003eBased on the pivotal discovery that low pH induces ASFV p72 trimer dissociation, indicating effective triggering of viral uncoating and subsequent infectivity loss, we established a double-antibody sandwich lateral immunochromatographic test strip targeting conformational epitopes of p72 trimers. Validation studies demonstrated exceptional specificity for intact p72 trimers with a detection sensitivity of 10^4 TCID50/mL. Integrated with qPCR-based nucleic acid integrity verification, this system precisely identifies the critical inactivation mechanism whereby mild disinfectants selectively disrupt p72 trimer spatial conformation while preserving viral nucleic acids. This distinctive capability positions our method as a gold-standard technical criterion for evaluating the selective inactivation efficacy of mild disinfectants against ASFV, providing an essential assessment tool for developing novel disinfection strategies that eliminate viral infectivity while maintaining nucleic acid integrity.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e \u003cb\u003eConstruction and identification of p72 expression vector.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo obtain correctly folded P72 trimer, the expression strain was constructed by referring to the method of co-expressing P72 and B602L reported by Qi Liu et al. [34]. P72 gene, B602L gene, were constructed into the plasmid to form a gene expression box. The gene expression box with homologous recombination arm was amplified by PCR to prepare the repair template. Using CRISPR-Cas9 technology, the gRNA that recognized GGATTTAGGAATCCATAAAA was co-expressed, and the gene expression box was inserted into the Ty2 retrotransposon of multiple copies by homologous recombination to achieve multiple copy gene expression.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression, Purification and Identification of Recombinant P72 Protein.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe culture products were collected and centrifuged at 6000rpm for 10min at 4℃ to collect the cell precipitates. After the precipitation was suspended with 50mL washing buffer, cells were disrupted by a high-pressure homogenizer at 4℃ and 1800bar pressure. The products were centrifuged at 17000rpm at 4℃ for 60min, and the supernatant was collected. The target protein was purified by strep-Tactin XT gravity-flow column.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAcid Treatment and SEC Analysis of Recombinant P72 Protein.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe co-expression of p72-B602L without acid treatment and after acid treatment was analyzed by size exclusion chromatography (SEC). The purified p72 sample was concentrated and then slowly added to citrate buffers with pH values of 3, 5, and 5.5, followed by incubation at 37℃. The homogeneity and aggregation state of untreated and acid-treated p72 were verified by SEC by column chromatography. Care should be taken to avoid inhaling air bubbles during the process and it should be carried out in a subzero low temperature environment. Finally, the collected samples were analyzed by SDS-PAGE.\u003c/p\u003e \u003cp\u003e \u003cb\u003eWestern blot analysis of cross-linked p72 samples.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eConcentrate the purified p72 trimer to 1mg/ml, slowly add the p72 protein into the low pH buffer (100mM citrate buffer of pH 3, pH5 and pH5.5) according to the ratio of p72: buffer\u0026thinsp;=\u0026thinsp;1:1, blow and mix well. The p72-buffer mixture was acidified at room temperature (25 ℃) for 30min. After the acidification reaction, adjust the pH of p72-buffer mixture to 6\u0026ndash;7 with 0.2M Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003eBased on the above p72 acidified samples, take 19ul of the above p72-buffer samples and mix them with 1ul of 1% glutaraldehyde, incubated at 4 ℃ for 20min, then place them at room temperature (25 ℃) for 10min to complete the protein crosslink. For protein analysis, samples were diluted with 5 \u0026times; Loading sample buffer, heated at 95\u0026deg;C for 10 min, and loaded on 6% SDS-PAGE gels. Gels were run at 110 V for 80 min in l \u0026times; Tris-Glycine running buffer and stained with Coomassie Blue Stain solution.\u003c/p\u003e \u003cp\u003eFollowing SDS-PAGE, proteins were electrically transferred onto 0.2 pm nitrocellulose membrane (Pall), 100mA, 140min. The membranes were blocked in 2% skim milk in PBS at 4\u0026deg;C overnight. Primary antibody at a 1:5,000 dilution of anti-strep antibody in 5% skim milk in PBS, was added and incubated for 4 h at room temperature. Membranes were washed with TBST (3 \u0026times; for 10 min each) and added with secondary antibody 1:5,000 dilution of goat anti-mouse IgG-HRP in 5% skim milk (PBS) for incubation at room temperature for 1.5 h. Membranes were then washed again with TBST (3 \u0026times; for 10 min each) and developed using TMB (3,3,5,5'-Tetramethylbenzidine, Sigma Aldrich) and hydrogen peroxide for imagining.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of Frozen Samples of P72 Protein.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFrozen samples were prepared from each peak tip obtained through SEC (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). According to the previously reported rapid freezing preparation method [34], the sample was added to a copper net covered with carbon film and quickly immersed in liquid ethane cooled by liquid nitrogen to rapidly form glassy ice. Vitrobot Marker IV of Tsinghua University cryo-electron microscopy platform was then used to prepare samples. After sample preparation, transfer it to a vacuum cup containing liquid nitrogen, and make sample records. Finally, 200kV Arctica transmission electron microscope (Falcon II camera) of Tsinghua university cryo-electron microscope platform was used to examine the frozen samples. According to the observed ice thickness, protein particle contrast and protein concentration, the frozen samples were optimized by adjusting blot parameters and protein concentration.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCollection and Processing of Cryo-electron Microscopy Data.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eData collection of frozen samples in this study was completed on the cryo-EM platform of Tsinghua University. Untreated samples were collected using a Titan3 electron microscope equipped with a Gatan K2 Summit direct electronic counting camera. FEI Talos Arctica with 200 kV was used to collect samples treated with pH 5.5 acidic conditions. Samples were loaded by Autoloader. AutoEMation2 software [34] is used for automatic data collection. A total of 629 images were collected with the pixel size of 1.17\u0026Aring;. Then, CryoSparc and RELION software were used for routine processing procedures and data analysis.\u003c/p\u003e \u003cp\u003eAfter particle selection, 158530 particles were classified using two-dimensional (2D) classification. Finally, 109,024 particles were selected for three-dimensional reconstruction (C1 symmetry) using Ab-initio. Among these, the initial model of the second class closely matched the p72 trimer, and C3 symmetry was applied for 3D refinement, resulting in a final reconstruction resolution of 4.8 \u0026Aring;. For the third class, an additional round of 3D reconstruction was performed with C1 symmetry, yielding five final reconstruction results that exhibited dimer-like particle morphology. Among these, the higher-quality classes, namely class 2 and class 3 in the second round of 3D reconstruction, were further optimized, resulting in final resolutions of 14.85 \u0026Aring; and 15.91 \u0026Aring;, respectively. Finally, we used UCSF Chimera to analyze the electron density map and the p72 atomic structure.\u003c/p\u003e\n\u003ch3\u003eSelection of p72 trimer-specific AuNP-labeled antibodies\u003c/h3\u003e\n\u003cp\u003eThe plates were coated with p72 monomer and p72 trimer at a concentration of 1 ug/ml and coated at 4\u0026deg;C overnight. Then block with blocking solution at 37\u0026deg;C for 2 h, then pat dry for later use.\u003c/p\u003e \u003cp\u003eThe monoclonal antibody p72-2, p72-3, p72-6, ASFV-1, ASFV-3, and ASFV-11 were diluted in serial dilutions (1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000), and 100ul was added to the above-mentioned coated microplate for 37\u0026deg;C for 30min, and then HRP-labeled goat anti-mouse secondary antibody was added (1: 5000) 100ul, 37\u0026deg;C reaction for 30min. Add the chromogenic solution to 37\u0026deg;C and protect it from light for 10min, add the stop solution, and then use the microplate reader to detect the results under OD450.\u003c/p\u003e\n\u003ch3\u003eSensitivity and specificity of the double-antibody sandwich lateral immunochromatographic test strip\u003c/h3\u003e\n\u003cp\u003eThe test strip was composed of a sample pad, conjugate pad, nitrocellulose (NC) membrane and absorbent pad. The conjugation pad was prepared by dispensing a desired volume of AuNP-labeled p72 antibody (AuNP-p72 antibody) onto the glass fiber pad using an XYZ Platform Dispenser, followed by drying at 37\u0026deg;C for 1 h and then storage at 4\u0026deg;C. Antigen against p72 trimers was sprayed on the test line on the NC membrane, and a standard second antibody was sprayed on the control line. The sample pad, conjugate pad, NC membrane and absorbent pad were sequentially attached to a PVC backing card with a 1\u0026ndash;2 mm overlap. The card was then cut into 4 mm wide strips and assembled into a plastic shell for future use.\u003c/p\u003e \u003cp\u003ePurified p72 monomer and trimer samples were diluted 1:100, 1:1000, 1:5000, and 1:10000, dropwise into the sample pad, and the specificity of DASLITS was determined by observing the specific red bands of C and T lines. Second, we judged the detection limit of DASLITS by the specific red bands of DASLITS for different dilutions of p72 trimer.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eqPCR tests samples after disinfectant disinfection of ASFV\u003c/h2\u003e \u003cp\u003eASFV genomic DNA was extracted from ASFV-infected cell supernatants using the GenElute\u0026trade; Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, USA). qPCR protocols in the QuantStudio 5 system (Applied Biosystems, USA) conform to the procedures recommended by the World Organisation for Animal Health (OIE) [24].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDASLITS evaluates the effectiveness of disinfectants in inactivating ASFV\u003c/h2\u003e \u003cp\u003eCitric acid disinfectant was diluted at 1:40, 1:80 and 1:160, 84 disinfectant was diluted at 1:64, 1:128 and 1:256, and quaternary ammonium disinfectant was diluted at 1:80, 1:160 and 1:320 for 0.5 h and 2 h, respectively. In addition, unsterilized ASFV samples were used as positive controls and PBS as negative controls.\u003c/p\u003e \u003cp\u003eThe above samples were added dropwise to the sample pad and reacted at room temperature for 3-5min, and the disinfection effect of DASLITS on ASFV under different dilutions was judged by observing the C and T lines of DASLITS. Only the C line indicates that ASFV is not detected, and the C line and T line are displayed at the same time indicates that ASFV is detectable. It should be noted that if the C line is not displayed, it means that DASLITS is invalid.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eFluorescence microscopy analysis of ASFV infected PAM cells after disinfection\u003c/h2\u003e \u003cp\u003eBased on the ASFV strain HLJ/18-DP 148 R-del [35], PAM cells were infected with diluted ASFV and the eGFP reporter signal was visualized by fluorescence microscopy. Referring to the previous research method [24], the PAM cells in the 96-well plate were re-infected with the sterilized virus samples after the ASFV was treated for 0.5 h and 2 h, respectively, using the immersion disinfection test and spray disinfection test. Incubate at 37\u0026deg;C and 5% CO2, and observe cell status and fluorescence every 24 h. In addition, a negative control that does not contain the virus is included in this experiment.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eAvailability of data and materials\u003c/p\u003e\n\u003cp\u003eThe data used and/or analyzed during this research are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was financially supported by the National Key Research and Development Program of China (2019YFC1604602-1) and the Natural Science Foundation of HeBei province (19226631D).\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eWenzhuang Zhu designed the p72 protein and developed the DASLITS method. Yangnan Huyan purified the p72 protein, completed the cross-linking and Western blot experiments, organized the figures, and wrote the main manuscript. Chenggang Jiang conducted the qPCR and PAM cell infection experiments. Kaiwen Meng performed sequence and structural analysis of NCLDVs, collected cryo-EM data, and drew the figures. Qi Liu collected cryo-EM data for the acidified p72 protein. Yuli Liu, Ziyi Fang, and Junyi Li analyzed the data. Yuanmao Zhu, Miao Sun, Zhigao Bu, and Ye Xiang provided technical support and experimental guidance. Dongming Zhao and Geng Meng conceived the study and served as corresponding authors. Geng Meng is the project leader.\u0026nbsp;All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eEustace Montgomery R. On A Form of Swine Fever Occurring in British East Africa (Kenya Colony). Journal of Comparative Pathology and Therapeutics. 1921;34:159\u0026thinsp;\u0026minus;\u0026thinsp;91. https://doi.org/10.1016/s0368-1742(21)80031-4.\u003c/li\u003e\n\u003cli\u003eBa\u0026ntilde;os JV, Boklund A, Gogin A, Gort\u0026aacute;zar C, Guberti V, Helyes G, et al. Epidemiological analyses of African swine fever in the European Union. EFSA Journal. 2022;20(5). https://doi.org/10.2903/j.efsa.2022.7290.\u003c/li\u003e\n\u003cli\u003eLi M, Zheng H. Insights and progress on epidemic characteristics, pathogenesis, and preventive measures of African swine fever virus: A review. Virulence. 2025;16(1). https://doi.org/10.1080/21505594.2025.2457949.\u003c/li\u003e\n\u003cli\u003eFood and Agriculture Organization of the United Nations, 2019. ASF situation in Asia update. http://www.fao.org/ag/againfo/programmes/en/empres/ASF/situation_update.html (2019).\u003c/li\u003e\n\u003cli\u003eAlonso C, Borca M, Dixon L, Revilla Y, Rodriguez F, Escribano JM, et al. ICTV Virus Taxonomy Profile: Asfarviridae. J Gen Virol. 2018;99(5):613-4. https://doi.org/10.1099/jgv.0.001049.\u003c/li\u003e\n\u003cli\u003eAlejo A, Matamoros T, Guerra M, Andr\u0026eacute;s G. A Proteomic Atlas of the African Swine Fever Virus Particle. J Virol. 2018;92(23). https://doi.org/10.1128/JVI.01293-18.\u003c/li\u003e\n\u003cli\u003eGaudreault NN, Madden DW, Wilson WC, Trujillo JD, Richt JA. African Swine Fever Virus: An Emerging DNA Arbovirus. Front Vet Sci. 2020;7:215. https://doi.org/10.3389/fvets.2020.00215.\u003c/li\u003e\n\u003cli\u003eM\u0026ouml;nttinen HAM, Bicep C, Williams TA, Hirt RP. The genomes of nucleocytoplasmic large DNA viruses: viral evolution writ large. Microb Genom. 2021;7(9). https://doi.org/10.1099/mgen.0.000649.\u003c/li\u003e\n\u003cli\u003eFang Q, Zhu D, Agarkova I, Adhikari J, Klose T, Liu Y, et al. Near-atomic structure of a giant virus. Nat Commun. 2019;10(1):388. https://doi.org/10.1038/s41467-019-08319-6.\u003c/li\u003e\n\u003cli\u003eYan X, Yu Z, Zhang P, Battisti AJ, Holdaway HA, Chipman PR, et al. The capsid proteins of a large, icosahedral dsDNA virus. J Mol Biol. 2009;385(4):1287-99. https://doi.org/10.1016/j.jmb.2008.11.002.\u003c/li\u003e\n\u003cli\u003eKlose T, Reteno DG, Benamar S, Hollerbach A, Colson P, La Scola B, et al. Structure of faustovirus, a large dsDNA virus. Proc Natl Acad Sci U S A. 2016;113(22):6206-11. https://doi.org/10.1073/pnas.1523999113.\u003c/li\u003e\n\u003cli\u003eAndreani J, Khalil JYB, Sevvana M, Benamar S, Di Pinto F, Bitam I, et al. Pacmanvirus, a New Giant Icosahedral Virus at the Crossroads between Asfarviridae and Faustoviruses. J Virol. 2017;91(14). https://doi.org/10.1128/JVI.00212-17.\u003c/li\u003e\n\u003cli\u003eAbergel C, Legendre M, Claverie JM. The rapidly expanding universe of giant viruses: Mimivirus, Pandoravirus, Pithovirus and Mollivirus. FEMS Microbiol Rev. 2015;39(6):779\u0026thinsp;\u0026minus;\u0026thinsp;96. https://doi.org/10.1093/femsre/fuv037.\u003c/li\u003e\n\u003cli\u003eWang N, Zhao D, Wang J, Zhang Y, Wang M, Gao Y, et al. Architecture of African swine fever virus and implications for viral assembly. Science. 2019;366(6465):640-4. https://doi.org/10.1126/science.aaz1439.\u003c/li\u003e\n\u003cli\u003eLiu S, Luo Y, Wang Y, Li S, Zhao Z, Bi Y, et al. Cryo-EM Structure of the African Swine Fever Virus. Cell Host Microbe. 2019;26(6):836\u0026thinsp;\u0026minus;\u0026thinsp;43.e3. https://doi.org/10.1016/j.chom.2019.11.004.\u003c/li\u003e\n\u003cli\u003eValdeira ML, Bernardes C, Cruz B, Geraldes A. Entry of African swine fever virus into Vero cells and uncoating. Vet Microbiol. 1998;60(2\u0026ndash;4):131\u0026thinsp;\u0026minus;\u0026thinsp;40. https://doi.org/10.1016/s0378-1135(98)00152-7.\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ez B, Guerra M, Salas ML, Andr\u0026eacute;s G. African Swine Fever Virus Undergoes Outer Envelope Disruption, Capsid Disassembly and Inner Envelope Fusion before Core Release from Multivesicular Endosomes. PLoS Pathog. 2016;12(4):e1005595. https://doi.org/10.1371/journal.ppat.1005595.\u003c/li\u003e\n\u003cli\u003eCuesta-Geijo MA, Galindo I, Hern\u0026aacute;ez B, Quetglas JI, Dalmau-Mena I, Alonso C. Endosomal maturation, Rab7 GTPase and phosphoinositides in African swine fever virus entry. PLoS One. 2012;7(11):e48853. https://doi.org/10.1371/journal.pone.0048853.\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez EG, P\u0026eacute;rez-N\u0026uacute;\u0026ntilde;ez D, Revilla Y. Mechanisms of Entry and Endosomal Pathway of African Swine Fever Virus. Vaccines (Basel). 2017;5(4). https://doi.org/10.3390/vaccines5040042.\u003c/li\u003e\n\u003cli\u003eSchrad JR, Abrah\u0026atilde;o JS, Cortines JR, Parent KN. Structural and Proteomic Characterization of the Initiation of Giant Virus Infection. Cell. 2020;181(5):1046-61.e6. https://doi.org/10.1016/j.cell.2020.04.032.\u003c/li\u003e\n\u003cli\u003eZhang X, Sun S, Xiang Y, Wong J, Klose T, Raoult D, et al. Structure of Sputnik, a virophage, at 3.5-\u0026Aring; resolution. Proc Natl Acad Sci U S A. 2012;109(45):18431-6. https://doi.org/10.1073/pnas.1211702109.\u003c/li\u003e\n\u003cli\u003eGreber UF, Willetts M, Webster P, Helenius A. Stepwise dismantling of adenovirus 2 during entry into cells. Cell. 1993;75(3):477\u0026thinsp;\u0026minus;\u0026thinsp;86. https://doi.org/10.1016/0092-8674(93)90382-z.\u003c/li\u003e\n\u003cli\u003eJuszkiewicz M, Walczak M, Woźniakowski G. Characteristics of Selected Active Substances used in Disinfectants and their Virucidal Activity Against ASFV. J Vet Res. 2019;63(1):17\u0026ndash;25. https://doi.org/10.2478/jvetres-2019-0006.\u003c/li\u003e\n\u003cli\u003eJiang C-g, Sun Y, Zhang F, Ai X, Feng X-n, Hu W, et al. Viricidal activity of several disinfectants against African swine fever virus. Journal of Integrative Agriculture. 2021;20(11):3084-8. https://doi.org/10.1016/S2095-3119(21)63631-6.\u003c/li\u003e\n\u003cli\u003eMeurisse R, Brasseur R, Thomas A. Aromatic side-chain interactions in proteins. Near- and far-sequence His-X pairs. Biochim Biophys Acta. 2003;1649(1):85\u0026ndash;96. https://doi.org/10.1016/s1570-9639(03)00161-4.\u003c/li\u003e\n\u003cli\u003eHeyda J, Mason PE, Jungwirth P. Attractive interactions between side chains of histidine-histidine and histidine-arginine-based cationic dipeptides in water. J Phys Chem B. 2010;114(26):8744-9. https://doi.org/10.1021/jp101031v.\u003c/li\u003e\n\u003cli\u003eVila JA, Arnautova YA, Vorobjev Y, Scheraga HA. Assessing the fractions of tautomeric forms of the imidazole ring of histidine in proteins as a function of pH. Proc Natl Acad Sci U S A. 2011;108(14):5602-7. https://doi.org/10.1073/pnas.1102373108.\u003c/li\u003e\n\u003cli\u003eAndr\u0026eacute;s G, Charro D, Matamoros T, Dillard RS, Abrescia NGA. The cryo-EM structure of African swine fever virus unravels a unique architecture comprising two icosahedral protein capsids and two lipoprotein membranes. J Biol Chem. 2020;295(1):1\u0026ndash;12. https://doi.org/10.1074/jbc.AC119.011196.\u003c/li\u003e\n\u003cli\u003eTesfagaber W, Wang W, Wang L, Zhao R, Zhu Y, Li F, et al. A highly efficient blocking ELISA based on p72 monoclonal antibody for the detection of African swine fever virus antibodies and identification of its linear B cell epitope. Int J Biol Macromol. 2024;268(Pt 1):131695. https://doi.org/10.1016/j.ijbiomac.2024.131695.\u003c/li\u003e\n\u003cli\u003eR\u0026ouml;tzschke O, Lau JM, Hofst\u0026auml;tter M, Falk K, Strominger JL. A pH-sensitive histidine residue as control element for ligand release from HLA-DR molecules. Proc Natl Acad Sci U S A. 2002;99(26):16946-50. https://doi.org/10.1073/pnas.212643999.\u003c/li\u003e\n\u003cli\u003eZong X, Stieber J, Ludwig A, Hofmann F, Biel M. A single histidine residue determines the pH sensitivity of the pacemaker channel HCN2. J Biol Chem. 2001;276(9):6313-9. https://doi.org/10.1074/jbc.M010326200.\u003c/li\u003e\n\u003cli\u003eCai T, Hatano A, Kanatsu K, Tomita T. Histidine 131 in presenilin 1 is the pH-sensitive residue that causes the increase in A\u0026beta;42 level in acidic pH. J Biochem. 2020;167(5):463\u0026thinsp;\u0026minus;\u0026thinsp;71. https://doi.org/10.1093/jb/mvz110.\u003c/li\u003e\n\u003cli\u003eHong M, DeGrado WF. Structural basis for proton conduction and inhibition by the influenza M2 protein. Protein Sci. 2012;21(11):1620-33. https://doi.org/10.1002/pro.2158.\u003c/li\u003e\n\u003cli\u003eLiu Q, Ma B, Qian N, Zhang F, Tan X, Lei J, et al. Structure of the African swine fever virus major capsid protein p72. Cell Res. 2019;29(11):953-5. https://doi.org/10.1038/s41422-019-0232-x.\u003c/li\u003e\n\u003cli\u003eChen W, Zhao D, He X, Liu R, Wang Z, Zhang X, et al. A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs. Sci China Life Sci. 2020;63(5):623\u0026thinsp;\u0026minus;\u0026thinsp;34. https://doi.org/10.1007/s11427-020-1657-9.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6368001/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6368001/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAfrican swine fever virus (ASFV), a member of the nucleocytoplasmic large DNA virus (NCLDV) family, is the sole representative of the \u003cem\u003eAsfarviridae\u003c/em\u003e family. Recent studies have shown that the uncoating process of ASFV occurs through a pH-dependent mechanism within late endosomal compartments. However, the molecular mechanisms underlying pH-mediated capsid destabilization remain poorly understood, and the key viral components responsible for pH sensing during uncoating have not yet been clearly identified. In this study, we identified that the major capsid protein p72 of ASFV functions as a pH-sensitive structural component enriched with ionizable residues. By simulating the acidic environment of endosomes, we observed that the molecular weight and particle size of the acidified p72 protein decreased. Cryo-electron microscopy (Cryo-EM) revealed that the p72 protein underwent trimer depolymerization at acidic pH levels similar to those found in endosomes. This destabilization of the trimer provides a mechanistic basis for proposing a model of the uncoating mechanism of ASFV. Based on these insights, we developed a double-antibody sandwich lateral immunochromatographic test strip targeting p72 trimers. This test strip demonstrated high specificity and sensitivity, making it a valuable tool for detecting ASFV infections and evaluating the efficacy of mild disinfectants used in swine farms against African swine fever virus.\u003c/p\u003e","manuscriptTitle":"ASFV major capsid p72 trimers function as a pH sensor during uncoating process of virus endocytosis and facilitate its application as conformational antigen detection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-09 18:36:41","doi":"10.21203/rs.3.rs-6368001/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bfeb07fd-2e44-4085-8117-b7e62f9c77e3","owner":[],"postedDate":"April 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-13T02:53:53+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-09 18:36:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6368001","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6368001","identity":"rs-6368001","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.