Activation of canine RIPK3 drives inflammatory apoptosis dependent on RIPK1, FADD and Caspases

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Programmed cell death in animal species of the order Carnivora is suspected to be unique due to the potential defects in activating the lytic cell death pathways, necroptosis and pyroptosis. In a wide range of species of the order Carnivora, including domestic cats and dogs, racoons, red foxes, and ferrets, the absence of the necroptosis executioner protein MLKL (mixed-lineage kinase domain-like pseudokinase) is suspected to prohibit necroptotic lysis. It remains unclear what type(s) of cell death are activated in canine cells downstream of RIPK3 (receptor-interacting protein kinase 3). Here, we show that activation of RIPK3 by expressing it with a trimerization domain drives PANoptosis in human fibroblasts but activates apoptosis in canine epithelial cells. Expression of trimerizable canine and human RIPK3 in canine cells activated apoptotic cell death dependent on caspases, FAS-associated death domain protein (FADD), and RIPK1. Human RIPK3 in canine cells activated a rapid apoptosis compared to the canine version. Unlike canonical caspase 8 driven apoptosis, RIPK3-driven canine cell apoptosis is associated with the secretion of danger-associated molecular patterns (DAMPs) and pro-inflammatory cytokines. This is the first study defining the function of canine RIPK3 and potentially immunostimulatory, non-lytic, cell death in canine cells. This form of cell death can be further developed to ignite immunity against virus infections and cancer.
Full text 114,296 characters · extracted from preprint-html · click to expand
Activation of canine RIPK3 drives inflammatory apoptosis dependent on RIPK1, FADD and Caspases | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Activation of canine RIPK3 drives inflammatory apoptosis dependent on RIPK1, FADD and Caspases Sam Workenhe, Sarah Worfolk, Noah Phippen, Shayla Verburg, Katrina Kobal, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7489583/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Programmed cell death in animal species of the order Carnivora is suspected to be unique due to the potential defects in activating the lytic cell death pathways, necroptosis and pyroptosis. In a wide range of species of the order Carnivora, including domestic cats and dogs, racoons, red foxes, and ferrets, the absence of the necroptosis executioner protein MLKL (mixed-lineage kinase domain-like pseudokinase) is suspected to prohibit necroptotic lysis. It remains unclear what type(s) of cell death are activated in canine cells downstream of RIPK3 (receptor-interacting protein kinase 3). Here, we show that activation of RIPK3 by expressing it with a trimerization domain drives PANoptosis in human fibroblasts but activates apoptosis in canine epithelial cells. Expression of trimerizable canine and human RIPK3 in canine cells activated apoptotic cell death dependent on caspases, FAS-associated death domain protein (FADD), and RIPK1. Human RIPK3 in canine cells activated a rapid apoptosis compared to the canine version. Unlike canonical caspase 8 driven apoptosis, RIPK3-driven canine cell apoptosis is associated with the secretion of danger-associated molecular patterns (DAMPs) and pro-inflammatory cytokines. This is the first study defining the function of canine RIPK3 and potentially immunostimulatory, non-lytic, cell death in canine cells. This form of cell death can be further developed to ignite immunity against virus infections and cancer. Biological sciences/Cell biology/Cell death/Apoptosis Biological sciences/Cell biology/Cell death/Necroptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Programmed cell death is essential for maintaining organismal development, tissue homeostasis, and communication of danger to the immune system. Two well-defined forms of programmed cell death, apoptosis and necroptosis, can be activated by similar stimuli and upstream signaling but employ distinct molecular machineries to execute the terminal stages of cell death [ 1 – 4 ]. Apoptosis is mediated by caspases and results in shrinkage of the cell, chromatin condensation, and phagocytic clearance [ 5 – 8 ]. Human and murine studies show that the lack of cell lysis and the immunosuppressive roles of activated caspases renders apoptosis less immunostimulatory [ 9 , 10 ] unless it is activated in the context of other underlying stress, such as infection [ 11 – 16 ]. In contrast, necroptosis, is a pro-inflammatory form of lytic cell death that plays an essential role in the development of immunity against pathogens and cancer [ 9 , 10 , 16 – 25 ]. Necroptosis is initiated by a variety of lethal stimuli that engage the death receptors to activate RIPK1 and RIPK3 [ 26 ]. RIPK3 phosphorylates and activates MLKL, a pore-forming protein that induces the osmotic changes required to activate ninjurin 1 that executes plasma membrane rupture [ 27 , 28 ]. These processes cumulatively activate plasma membrane rupture resulting in the release of damage-associated molecular patterns (DAMPs). Necroptosis can also allow the secretion of cytokines and chemokines through the formation of RIPK1/RIPK3 heterodimers and other partnering proteins forming a necrosome complex that activates NF-kb signaling [ 29 – 31 ]. In humans, the extrinsic apoptosis pathway and necroptosis are regulated by overlapping signaling cascades, involving RIPK1/3. Depending on the signaling complex established, stimulation of the death receptors, for instance by treatment with tumor necrosis factor (TNF) can activate apoptosis or necroptosis. Under conditions of high RIPK3 and MLKL, and a caspase 8 inhibited state, TNF treatment activates necroptosis [ 4 ]. However, in the presence of caspase 8, TNF activates RIPK3 to promote apoptosis by facilitating caspase activation [ 1 ]. The cell death machinery of carnivores and specifically, dogs, have not been widely studied. There are 10 predicted isoforms of canine RIPK3 with no previous characterization of the protein and signaling upon activation. Similar to human RIPK3, canine RIPK3 has a kinase domain and a receptor-interacting protein homotypic interaction motif (RHIM). The kinase domain of RIPK3 is at the N-terminal domain and it phosphorylates itself and other proteins, such as MLKL [ 32 ]. The RHIM domain is used for homo- and hetero-dimerization with itself and other proteins, such as RIPK1 [ 33 , 34 ]. In other mammals, RIPK3 phosphorylates MLKL to trigger necroptosis [ 32 , 35 ]. However, there are no MLKL sequences in the genome of animal species within the order Carnivora, including canines. This divergence prompted us to evaluate what type of cell death and signaling process is driven by RIPK3 in canine cells. Here, we demonstrate that catalytically active forms of human and canine RIPK3 induce apoptosis in canine cells and PANoptosis in human cells. The RIPK3-driven canine cell apoptosis was dependent on RIPK1, FADD, and caspase 8. Additionally, the secretome released by canine cells dying from RIPK3-driven apoptosis was unique from the secretome associated with caspase 8 driven apoptosis. By elucidating the molecular mechanisms of RIPK3 induced canine cell death, our work highlights species-specific adaptations in programmed cell death pathways and underscores the importance of canine models in comparative cell death and immunobiology. Moreover, these findings have implications for understanding immune regulation in canines and may guide the development of targeted therapies for canine diseases, including malignancies and inflammatory conditions, where cell death pathways are implicated. RESULTS Expression of catalytically active RIPK3 leads to reduction in the viability of human and canine cells. To identify conserved motifs and/or differences between canine and human RIPK3 we compared the amino acid sequence and structural differences of the specific domains using Alpha Fold. There are 10 predicted canine RIPK3 sequences and we used the longest coding sequence (Accession: XM_038673261.1). Alignment of the amino acid sequences revealed 57% identity between canine and human RIPK3. Fewer differences are found in the protein kinase domain, while the RHIM and other domains contains most of the observed differences in amino acid sequence ( S. Figure 1A ). Notably, the RHIM consensus sequence VQVG was conserved between the two species. Structural analysis using Alpha Fold revealed that the kinase domain of human and canine RIPK3 are highly conserved with a root mean square deviation of 1.84 ( S. Figure 1C ). The RHIM domains of both proteins are disordered and could not be predicted using Alpha Fold ( S. Figure 1B ). To define the types of cell death activated downstream of expressing catalytically active RIPK3, we used a doxycycline (Dox)-inducible promoter to express flag-tagged human and canine RIPK3 coding sequences linked to the 2L6HC3 trimerization domain (hRIPK3-2L6HC3 and cRIPK3-2L6HC3, respectively) ( Fig. 1A & 2A ) [ 10 ]. We also employed a previously established system to drive apoptosis by expressing the C-terminal caspase 8 fused to the 2L6HC3 trimerization domain (C term -Cas8-2L6HC3) [ 29 , 36 ]. In all studies, we selected MDCK (Madin-Darby canine kidney), a canine kidney epithelial cell line as a representative canine cell line for its ability to respond to infection [ 37 ]. All human experiments used BJ-5ta, an hTERT immortalized human foreskin fibroblast cell line with intact innate immune signaling and programmed cell death pathways [ 38 , 39 ]. Expression of human and canine RIPK3 in canine cells ( Fig. 1B, S. Figure 2A ) increased the cell death measured by SYTOX dye uptake after losing membrane integrity ( Fig. 1E, F ). While both the canine and human RIPK3 peaked at a comparable 50% loss of viability, human RIPK3 induced loss of membrane integrity was rapid. The expression of human and canine RIPK3 reduced the viability of BJ-5ta, although the progression of canine RIPK3 driven loss of viability was slow ( Fig. 2E, F, S. Figure 2C ). Expression of the C term -Casp8-2L6HC3 ( Fig. 1C, S. Figure 2B&D ) also reduced cell viability in human and canine cells ( Fig. 1G & 2G ). Overall, the findings show that dimerizable forms of RIPK3 and caspase 8 are catalytically active to reduce the viability of canine and human cells. Doxycycline treatment of human and canine cells lacking the RIPK3/caspase 8 expressing constructs did not show changes in cell viability ( Fig. 1D & 2D ). Consistent with the loss of membrane integrity data from the SYTOX dye uptake assays, we also measured increased levels of LDH released in RIPK3 expressing canine and human cells ( S. Figure 3 ). Activating RIPK3 drives apoptosis in canine cells and PANoptosis in human cells. Unlike human and mouse cells that activate necroptosis after expression of active RIPK3, the type of cell death activated in canine cells after RIPK3 expression remains unknown. Investigating RIPK3 induced cell death in canine cells is interesting due to the lack of MLKL, a terminal effector of necroptosis. Hence, after confirming catalytically active RIPK3 reduced cell viability, we investigated what type(s) of cell death are activated. Immunoblotting showed that canine cells expressing catalytically active RIPK3 and caspase 8 drive caspase 3 cleavage, confirming the induction of apoptosis ( Fig. 3A, S. Figure 2E ). The lack of antibodies against canine gasdermin proteins prevented us from investigating pyroptosis. Canine cell lines expressing active RIPK3 and caspase 8 showed rapid Annexin V staining confirming apoptotic cell death ( Fig. 3C-E ). Previous studies show that expressing active RIPK3-induced necroptosis in murine fibroblasts [ 36 , 40 , 41 ]. The inducible expression of human active RIPK3 in BJ-5ta simultaneously activated apoptosis, necroptosis and pyroptosis, implicating human RIPK3 as a potential driver of PANoptosis ( Fig. 4A, S. Figure 2F ). Both phosphorylation of MLKL and cleavage of caspase 3 were detectable after 6 hours of expressing trimerizable human RIPK3, while gasdermin E cleavage was not detectable until later timepoints ( Fig. 4A ). Active canine RIPK3 activated only apoptosis in BJ-5ta, indicating that sequence and/or structural variations in canine RIPK3 impair its ability to activate MLKL ( Fig. 4A ). Moreover, catalytically active caspase 8 cleaved gasdermin E alongside the cleavage of caspase 3, which indicates the activation of apoptosis and pyroptosis ( Fig. 4A ). In BJ-5ta cells Annexin V staining only increased for caspase 8 activated cell death ( Fig. 4B-E ). RIPK3-driven apoptosis in canine cells is dependent on caspases, FADD, and RIPK1. To investigate the mechanism of RIPK3-driven apoptosis in canine cells, we used caspase inhibitors and CRISPR-Cas9 mediated RIPK1 and FADD knockouts in MDCK cells. Pretreatment with either a pan-caspase inhibitor (Z-VAD-FMK), a caspase 8 specific inhibitor (Z-IETD-FMK) or knocking out FADD and RIPK1 ( S. Figure 4 ) completely abrogated RIPK3-mediated reduction in cell viability ( Fig. 5A-C ) and detection of apoptosis in canine cells ( Fig. 5D, S. Figure 2G ). Secretion of HMGB1 after RIPK3 activation was lost in the functional absence of caspases, FADD and RIPK1 ( Fig. 5F, S. Figure 2F ). Consistent with the role of caspases, RIPK1 and FADD in canine RIPK3 driven apoptosis, the absence of these cell death adaptor proteins abrogated LDH release ( Fig. 5E ). RIPK3 and caspase 8-driven apoptosis emit diverse types of secretomes. Several types of cell death are associated with the emission of biomolecules that regulate immune responses. RIPK3 activation leads to its heterodimerization with RIPK1 to form a necrosome complex that activates NF-kB for cytokine and chemokine secretion [ 29 , 42 , 43 ]. Knowing this, we postulated that the secretomes from RIPK3 induced canine apoptosis are different from caspase 8 mediated apoptosis. To test this, cell death was activated by expressing active RIPK3 or caspase 8 and cell-free supernatants collected to quantify classical danger signals ATP, HMGB1, and cytokines and chemokines. In canine cells, human RIPK3 drove rapid and high levels of ATP secretion, while activation of canine RIPK3 resulted in gradual accumulation and low levels of extracellular ATP ( Fig. 6A ). In human cells, canine RIPK3 drove high ATP secretion at later timepoints, while human RIPK3 produced low levels of ATP secretion at earlier timepoints ( Fig. 6B ). Unexpectedly, expression of active caspase 8 emitted extracellular ATP in canine but not human cells ( Fig. 6A, B ). In both human and canine cells, HMGB1 release was the highest level in human RIPK3, followed by canine RIPK3 and caspase 8 ( Fig. 6C, D, S. Figure 2I-J ). The cytokines/chemokines released after RIPK3 and caspase 8 mediated cell death are presented in heat maps ( Fig. 7 ). MDCKs expressing active canine or human RIPK3 emitted significantly higher amounts of GM-CSF, IL-8, KC-like, and MCP-1 ( Fig. 7A and S. Figure 5 ). As expected, caspase 8 mediated apoptosis in MDCK cells did not show significant emission of any cytokine/chemokines when compared with untreated cells. In human cells, human and canine RIPK3 as well as caspase 8 showed a shared secretion of IFN-a and IL-6. Human and canine RIPK3 additionally increased emission of IL-2, IL-8, IL-12p40, IL-27, IP-10, MCP-1, RANTES, sCD40L, TGFa, TNFb, and VEGF-A ( Fig. 7B and S. Figure 6 ). Canine RIPK3 uniquely drove the emission of IL-9, M-CSF, and PDGF-AB/BB while human RIPK3 uniquely drove GM-CSF, IL-5, IL-17A, IL-18, CXCL9, MIP-1a, PDGF-AA, and TNFa. DISCUSSION The dog can be used as a valuable model for studying human diseases due to its genetic similarity to humans and its exposure to infectious agents, household chemicals and physical insults that often affect humans. Humans and dogs also have shared susceptibility to diseases involving dysregulated cell death, such as cancer. As a member of the order Carnivora, the dog is speculated to suppress inflammatory lytic cell death [ 44 , 45 ] without detailed understanding of the mechanisms. For example, the lack of MLKL in the genome of dogs has intrigued researchers regarding the type of cell death activated upon RIPK3 activation and if there is also a protein that may replace the function of MLKL in dogs. The findings of this study present the mechanisms of RIPK3-driven apoptosis in canines and demonstrated unique immunostimulatory properties of RIPK3-driven apoptosis in dogs. We have discovered that inducible expression of catalytically active RIPK3 in canines drives RIPK1, FADD, and caspase-dependent apoptosis. These findings are consistent with the induction of apoptosis in humans under conditions of inhibiting MLKL oligomerization, or higher caspase activity inhibiting necrosome formation [ 4 , 46 ]. Moreover, consistent with human findings, canine RIPK3 driven apoptosis is dependent on RIPK1, FADD, and caspase 8 [ 47 – 49 ]. These findings indirectly confirm the absence of a protein replacing the lytic functional role of MLKL downstream of RIPK3 induced signaling. RIPK3 activation has been used previously as a method to activate murine fibroblast necroptosis without a comprehensive characterization of the cell death types activated in humans [ 29 , 36 ]. In this comparative investigation, we identified that RIPK3 activation in human cells results in PANoptosis through simultaneous activation of markers for apoptosis, necroptosis, and pyroptosis. PANoptosis requires the expression and activity of many cell death proteins and BJ-5ta cells are interferon responsive and express most of the known cell death signaling proteins. Activation of necroptosis and apoptosis downstream of RIPK3 is expected in human cells given the ability of RIPK3 to drive caspase 8 activation through FADD and RIPK1 [ 47 ]. Unexpectedly, we also observed the activation of pyroptosis executioner, gasdermin E, following caspase 3 cleavage ( Fig. 2C ). Previous research has identified a role for caspase 3 in cleaving gasdermin E in cells expressing high levels of gasdermin E [ 50 , 51 ]. This is the first report of gasdermin E activation downstream of RIPK3 signaling. Programmed cell death communicates homeostatic disturbances to the immune system. This is done by secreting DAMPs, cytokines and chemokines along with the release of other alarming cellular contents that stimulate innate immune cells. Genetic systems of cell death have allowed us and others to compare the immunostimulatory properties of individual cell death modalities[ 52 ]. In humans and mice apoptosis is not immunostimulatory[ 9 , 10 , 52 ] unless it is activated in the context of other underlying stress[ 11 – 16 ]. In a similar fashion, we have demonstrated that the type of apoptosis initiation and the proteins recruited to the signaling cascade influence the immunostimulatory properties of apoptosis in canine cells. While activation of apoptosis by both RIPK3 and caspase 8 drove emission of DAMPs, only RIPK3 stimulated the secretion of cytokines/chemokines in canine cells possibly involving RIPK1/RIPK3 heterodimers to activate NF-kB [ 42 , 43 ]. These potentially immunostimulatory properties of RIPK3 driven apoptosis likely compensates for the loss of lytic cell death in the antiviral response of Carnivora species. The emission of biomolecules during caspase 8 driven apoptosis differed between human and canine cells. Consistent with our previous studies in murine cancer cells [ 53 ], human cells showed no significant release of ATP or HMGB1, despite abundant secretion of cytokines/chemokines. The opposite was observed in canine cells with the detection of ATP and HMGB1, but no cytokine/chemokine emission. These differences may be accounted for by caspase 8 driving gasdermin E activation in human cells [ 50 , 51 ], facilitating the secretion of selected cytokines/chemokines. The major aspects of pyroptosis signaling in canine cells is still unknown and it is possible that canine cells are defective to induce pyroptosis. Programmed cell death has beneficial and detrimental outcomes during virus infection[ 19 ]. Induction of cell death in the early stages of virus infection is crucial for limiting replication, alerting neighboring cells, and activation of adaptive immune responses [ 54 ]. However, cell death can also be used for virus dissemination and instigate undesirable inflammation which causes severe immunopathology that contributes to viral disease pathogenesis[ 29 , 36 ]. Hence, many viruses express accessory proteins that manipulate lytic cell death in virus infected cells. The ability of human cells, but not canine cells, to activate PANoptosis may indicate an evolutionary advantage to avoid the effects of viral encoded inhibitors of lytic cell death that allows many herpesviruses to establish life-long infection without activating a strong antiviral adaptive immunity. Future studies should investigate virus-host interactions in the context of these evolutionary adaptations and differences in cell death activation between canine and human cells. Certain cytotoxic anticancer treatments activate immunity against cancer, partly by activating immunostimulatory types of lytic cell death [ 36 , 41 , 53 ]. In canine cells, RIPK3 driven apoptosis activated a comparable level of ATP and HMGB1 release as in the human PANoptosis. We were very limited in the number of cytokines/chemokines we can analyze for dogs compared to humans and this limitation obscures the direct comparison of cytokines/chemokines activated by RIPK3 in the two species. Regardless, canine cells showed the emission of selected cytokines/chemokines. It remains interesting to investigate the role of RIPK1/RIPK3 heterodimers in activating NF-kB activation and the release of cytokines/chemokines during RIPK3 mediated apoptosis of canine cells. Previous murine studies showed that deletion of MLKL did not abrogate the anticancer effects of a fibroblast necroptosis vaccine induced by catalytically active RIPK3 [ 36 ]. It remains unknown if shifting the canine apoptosis to necroptosis by co-expressing human RIPK3 and MLKL would change the immunogenicity of dying cells. Future studies comparing the immunological outcomes of activating RIPK3 driven apoptosis and necroptosis are required to identify which modality should be further developed to treat companion animal cancers. In this regard, a variety of delivery vehicles such as oncolytic viruses and self-amplifying mRNAs can be employed to express the pro-cell death molecules. METHODS Cell culture BJ-5ta human hTERT immortalized foreskin fibroblasts (American Type Culture Collection, ATCC, CRL-4001), MDCK canine kidney epithelial cells (ATCC, CCL-34), and Lenti-X 293T (ATCC) were maintained in Dulbecco’s Modified Eagle Medium (DMEM) (Cytiva) containing 4.0 mM L-glutamine and 4500 mg/L glucose and supplemented with 10% fetal bovine serum (FBS) (Thermo Scientific). All cell lines were maintained at 37°C and 5% CO 2 . Cell lines were regularly tested for mycoplasma contamination. Generation of stable h/cRIPK3-2L6HC3 and h/cC-Cas8-2L6HC3 cell lines Canine RIPK3 (FLAG-tagged, Accession: XM_038673261.1, nucleotides 205–1662), human RIPK3, canine C term -Cas8 (Accession: NP_001041494, residues 198–486) and human C term -Cas8 all linked to the trimerization domain, 2L6HC3, were cloned into pCW57.1 (Addgene #41393) via Gateway cloning using LR and BP Clonase Enzyme Mixes (ThermoFisher Scientific; California, USA). Lentivirus was produced as previously described [ 41 ] and 1 mL of lentivirus was used to transduce BJ-5ta or MDCK cells prior to selection with 4 µg/mL puromycin (ThermoFisher Scientific; New York, USA) for 2–3 days. All experiments were performed using polyclonal populations between passages 2 and 15. Cells were treated with doxycycline (ThermoFisher Scientific; New York, USA) at a final concentration of 1 µg/mL for all experiments inducing expression of a transgene. Immunoblotting BJ-5ta and MDCKs were seeded at 400 000 or 250 000 cells per well of a 6-well plate the day before cell lysis and protein isolation for 6-hr and 24-hr experiments, respectively. After applying the respective treatments, cells were lysed and total protein samples were used for immunoblotting as previously described [ 53 ]. The specific antibodies used, source and dilutions are detailed in Table 1 . Table 1 Antibodies used for immunoblotting Antibody target Company CAT # Dilution factor b-actin Cell Signaling Technology (Massachusetts, USA) 4967 1:6000 b-actin Sigma-Aldrich (Missouri, USA) A1978 1:6000 p-MLKL (S358) Abcam (Massachusetts, USA) Ab187091 1:1000 RIPK3 Abcam Ab316957 1:1000 FLAG M2 Sigma-Aldrich F1804 1:1000 RIPK1 Cell Signaling Technology 3493S 1:500 Cleaved caspase 3 Abcam Ab214430 1:2000 Caspase 8 Cell Signaling Technology 4790S 1:1000 GSDME Abcam Ab215191 1:2000 Quantification of cell viability Cell viability was assessed using membrane permeability dyes and live cell imaging. Cells were plated at 2 500 and 10 000 cells per well in 96-well plates for MDCK and BJ-5ta cell lines, respectively. The following day cells were incubated in the following cocktail of viability dyes: Hoechst at 250 ng/mL (Invitrogen; Oregon, USA), SYTOX™ RED at 1I25 nM (Invitrogen; Oregon, USA), and annexin-V FITC at a 1:400 dilution (Invitrogen; Oregon, USA). Following incubation of 100 µL of viability dye cocktail for 2 hours, 100 µL of doxycycline at 2x concentration was added to the 100 µL of dyes. In experiments using Z-VAD-FMK (Invivogen; California, USA) and Z-IETD-FMK (Invivogen; California, USA) the inhibitors were pre-incubated with the dyes prior to doxycycline treatment. 96-well plates were immediately placed into the BioSpa for imaging with the Cytation 10 (Agilent; California, USA). Cells were maintained at 37°C and 5% CO 2 in between imaging in the Cytation 10 every 4 hours for 36 to 48 hours. Images were obtained with a 4x objective, a GFP filter cube, Cy5 filter cube, and DAPI filter cube. Image processing and analysis was conducted using the Gen5 software. Quantification of extracellular ATP, LDH, cytokines, and chemokines Cell free supernatant was collected from BJ-5ta and MDCKs plated at 20 000 and 10 000 cells per well in a 96-well plate, respectively. Cells were exposed to treatments for 24 hours prior to supernatant harvest. Extracellular ATP analysis was conducted using the ENLITEN ATP Assay Kit (Promega) according to manufacturer instructions. LDH was assessed using the LDH-Glo Cytotoxicity Assay (Promega) according to manufacturer's instructions. Cell-free supernatants were collected from BJ-5ta and MDCKs and sent to Eve Technologies for the Human Cytokine Pannel A 48-Plex Discovery Assay and Canine Cytokine 13-Plex Discovery Assay, respectively. Generation of CRISPR-Cas9 knockdown cell lines sgRNAs were designed to target canine RIPK1 and canine FADD genes (Table 2 ). Restriction cloning was used to generate LentiCRISPRv2 (blasticidin) plasmids and lentivirus was generated as previously described [ 41 ]. Table 2 Primer sequences CRISPR-Cas9 guide RNAs Gene target FWD RV RIPK1 CACCGCTCCATGTACTCCATCACCA AAACTGGTGATGGAGTACATGGAGC FADD CACCGGAGCTCAAGTTCCTGTGCCA AAACTGGCACAGGAACTTGAGCTCC Statistics and reproducibility For each statistical test used, normality of the distribution and equality of variance between groups was evaluated beforehand. For differences in means, one-way analysis of variance (ANOVA) with Tukey post hoc analysis or two-way analysis of variance (ANOVA) with Šídák correction multiple comparisons. Bar graphs are shown as a mean +/- standard deviation with individual datapoints included. The null hypothesis was rejected for p values < 0.05. All analysis was carried out using GraphPad Prism version 10 (La Jolla, CA, USA). Declarations Conflict of Interest The authors declare no competing interests. Author Contributions SMW, NJP, SGV, KAK, and NCL conducted the experiments and analyzed the results. STW, SMW, and NJP were involved in the design of the experiments. DGG and JGM were involved in the computational analysis and editing of the manuscript. SKW, and MSM helped in the conception of the specific studies, interpretation of the findings, and editing of the manuscript. STW and SMW wrote the manuscript. STW conceived the overall study, acquired the funding for the study and provided guidance on the overall study. Acknowledgments We thank the OVC Pet Trust for funding to STW. We also thank Dr. Courtney Schott and her team for training SMW in using the Cytation 10 instrument. References Li, D., et al., A phosphorylation of RIPK3 kinase initiates an intracellular apoptotic pathway that promotes prostaglandin2α-induced corpus luteum regression . Elife, 2021. 10. Mandal, P., et al., RIP3 induces apoptosis independent of pro-necrotic kinase activity . Mol. Cell, 2014. 56(4). R, B., et al., Inhibition of MLKL Attenuates Necroptotic Cell Death in a Murine Cell Model of Ischaemia Injury . J Clin Med, 2021. 10(2). D, V., et al., Inhibition of caspases increases the sensitivity of L929 cells to necrosis mediated by tumor necrosis factor . J Exp Med, 1998. 187(9). Bortner, C.D. and J.A. Cidlowski, Uncoupling Cell Shrinkage from Apoptosis Reveals That Na + Influx Is Required for Volume Loss during Programmed Cell Death. JBC, 2003. 278(40). CD, B., H. FM, and C. JA, A primary role for K + and Na + efflux in the activation of apoptosis . JBC, 1997. 272(51). D, J., et al., Novel path to apoptosis: small transmembrane pores created by staphylococcal alpha-toxin in T lymphocytes evoke internucleosomal DNA degradation . Infect Immun, 1994. 62(4). F, B., M. L, and D. L, Human eosinophils in culture undergo a striking and rapid shrinkage during apoptosis. Role of K + channels . J Leuko Bio, 1995. 57(6). Yatim, N., et al., RIPK1 and NF-κB signaling in dying cells determines cross-priming of CD8⁺ T cells . Science (New York, N.Y.), 2015. 350(6258): p. 328–334. Snyder, A.G., et al., Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates antitumor immunity. Science Immunology, 2019. 4(36): p. eaaw2004. Michaud, M., et al., Autophagy-dependent anticancer immune responses induced by chemotherapeutic agents in mice . Science, 2011. 334(6062): p. 1573–7. Obeid, M., et al., Calreticulin exposure dictates the immunogenicity of cancer cell death . Nat Med, 2007. 13(1): p. 54–61. Panaretakis, T., et al., The co-translocation of ERp57 and calreticulin determines the immunogenicity of cell death . Cell Death Differ, 2008. 15(9): p. 1499–509. Panaretakis, T., et al., Mechanisms of pre-apoptotic calreticulin exposure in immunogenic cell death . The EMBO journal, 2009. 28(5): p. 578–590. Ciampricotti, M., et al., Chemotherapy response of spontaneous mammary tumors is independent of the adaptive immune system . Nat Med, 2012. 18(3): p. 344–6; author reply 346. Workenhe, S.T., et al., De novo necroptosis creates an inflammatory environment mediating tumor susceptibility to immune checkpoint inhibitors . Communications Biology, 2020. 3(1): p. 645. Kepp, O., et al., Consensus guidelines for the detection of immunogenic cell death . Oncoimmunology, 2014. 3(9): p. e955691. van Vloten, J.P., et al., Critical Interactions between Immunogenic Cancer Cell Death, Oncolytic Viruses, and the Immune System Define the Rational Design of Combination Immunotherapies . The Journal of Immunology, 2018. 200(2): p. 450. Verburg, S.G., et al., Viral-mediated activation and inhibition of programmed cell death . PLoS Pathog, 2022. 18(8): p. e1010718. Workenhe, S.T., et al., Determinants for Antitumor and Protumor Effects of Programmed Cell Death . Cancer Immunol Res, 2024. 12(1): p. 7–16. Workenhe, S.T. and K.L. Mossman, Rewiring cancer cell death to enhance oncolytic viro-immunotherapy . Oncoimmunology, 2013. 2(12): p. e27138. Workenhe, S.T. and K.L. Mossman, Oncolytic virotherapy and immunogenic cancer cell death: sharpening the sword for improved cancer treatment strategies . Mol Ther, 2014. 22(2): p. 251–6. Workenhe, S.T., J. Pol, and G. Kroemer, Tumor-intrinsic determinants of immunogenic cell death modalities. OncoImmunology, 2021. 10(1): p. 1893466. Workenhe, S.T., et al., Combining oncolytic HSV-1 with immunogenic cell death-inducing drug mitoxantrone breaks cancer immune tolerance and improves therapeutic efficacy . Cancer Immunology Research, 2013. 1(5): p. 309–319. Workenhe, S.T., et al., Immunogenic HSV mediated oncolysis shapes the antitumor immune response and contributes to therapeutic efficacy . Molecular Therapy, 2014. 22(1): p. 123–131. Grootjans, S., T.V. Berghe, and P. Vandenabeele, Initiation and execution mechanisms of necroptosis: an overview . Cell Death Differ, 2017. 24(7). Degen, M., et al., Structural basis of NINJ1-mediated plasma membrane rupture in cell death . Nature, 2023. 618(7967). N, K., et al., NINJ1 mediates plasma membrane rupture during lytic cell death . Nature, 2021. 591(7848). Yatim, N., et al., RIPK1 and NF-κB signaling in dying cells determines cross-priming of CD8 + T cells . Science, 2015. 350(6258). MA, K., et al., The death domain kinase RIP mediates the TNF-induced NF-kappaB signal . Immunity, 1998. 8(3). H, L., et al., Ubiquitination of RIP is required for tumor necrosis factor alpha-induced NF-kappaB activation. JBC, 2006. 281(19). Meng, Y., et al., Phosphorylation-dependent pseudokinase domain dimerization drives full-length MLKL oligomerization . Nat Commun, 2023. 14(1). M, M., et al., The Structure of the Necrosome RIPK1-RIPK3 Core, a Human Hetero-Amyloid Signaling Complex . Cell, 2018. 173(5). X, W., et al., The structure of a minimum amyloid fibril core formed by necroptosis-mediating RHIM of human RIPK3 . PNAS USA, 2021. 118(14). Rodriguez, D.A., et al., Characterization of RIPK3-mediated phosphorylation of the activation loop of MLKL during necroptosis . Cell Death Differ, 2015. 23(1). Snyder, A.G., et al., Intratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates anti-tumor immunity. Sci Immunol, 2019. 4(36). Capellini, F.M., et al., Characterization of MDCK cells and evaluation of their ability to respond to infectious and non-infectious stressors . Cytotechnology, 2019. 72(1). Hare, D.N., et al., Virus-Intrinsic Differences and Heterogeneous IRF3 Activation Influence IFN-Independent Antiviral Protection . iScience, 2020. 23(12). Preston, C.M., A.N. Harman, and M.J. Nicholl, Activation of Interferon Response Factor-3 in Human Cells Infected with Herpes Simplex Virus Type 1 or Human Cytomegalovirus . J Virology, 2001. 75(19). Orozco, S., et al., RIPK1 both positively and negatively regulates RIPK3 oligomerization and necroptosis . Cell death and differentiation, 2014. 21(10): p. 1511–1521. Workenhe, S.T., et al., De novo necroptosis creates an inflammatory environment mediating tumor susceptibility to immune checkpoint inhibitors . Commun Biol, 2020. 3(1). B, S., et al., K45A mutation of RIPK1 results in poor necroptosis and cytokine signaling in macrophages, which impacts inflammatory responses in vivo . Cell Death Differ, 2016. 23(10). M, N., et al., RIPK1 and RIPK3 Kinases Promote Cell-Death-Independent Inflammation by Toll-like Receptor 4 . Immunity, 2016. 45(1). Z, D., et al., Evolutionary loss of inflammasomes in the Carnivora and implications for the carriage of zoonotic infections . Cell Rep, 2021. 36(8). Cui, H. and L. Zhang, Key Components of Inflammasome and Pyroptosis Pathways Are Deficient in Canines and Felines, Possibly Affecting Their Response to SARS-CoV-2 Infection . Frontiers in Immunology, 2021 Jan 28. 11. DW, Z., et al., RIP3, an energy metabolism regulator that switches TNF-induced cell death from apoptosis to necrosis . Science, 2009. 325(5938). Nogusa, S., et al., RIPK3 Activates Parallel Pathways of MLKL-Driven Necroptosis and FADD-Mediated Apoptosis to Protect against Influenza A Virus . Cell Host Microbe, 2016. 20(1). N, N., et al., RIPK1 S213E mutant suppresses RIPK1-dependent cell death by preventing interactions with RIPK3 and CASP8 . Cell Death Discov, 2025. 11(1). Fa, Z., et al., RIPK3/Fas-Associated Death Domain Axis Regulates Pulmonary Immunopathology to Cryptococcal Infection Independent of Necroptosis . Front Immunol, 2017. 8. Jiang, M., et al., The caspase-3/GSDME signal pathway as a switch between apoptosis and pyroptosis in cancer . Cell Death Dis, 2020. 6(1). Cristaldi, M., et al., Caspase-8 activation by cigarette smoke induces pro-inflammatory cell death of human macrophages exposed to lipopolysaccharide . Cell Death Dis, 2023. 14(11). Inkol, J.M., et al., Pyroptosis activates conventional type I dendritic cells to mediate the priming of highly functional anticancer T cells . J Immunother Cancer, 2024. 12(4). Inkol, J.M., et al., Pyroptosis activates conventional type I dendritic cells to mediate the priming of highly functional anticancer T cells . JITC, 2024. 12(4). Verburg, S.G., et al., Viral-mediated activation and inhibition of programmed cell death . PLoS Pathog, 2022. 18(8). Additional Declarations (Not answered) Supplementary Files SuppFig1.ai s.fig.1 SuppFig2.ai Original Data Files (s.fig 2) SuppFig3.ai s.fig 3 SuppFig4.ai s.Fig 4 SuppFig5.ai s.fig 5 SuppFig6.ai s.fig 6 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7489583","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":509021460,"identity":"fb14bc84-1809-410b-84b8-133b408ce099","order_by":0,"name":"Sam Workenhe","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6ElEQVRIiWNgGAWjYJACxgYGhgR+CNuCwYBoLZINYLYECVoMDhCrRX5G8rGPMyru5BnfSD78mqdCIs+cgfnhB3xaDG6kJc/ccOZZsdmNtDRrnjMSxZYNbMYSeLVI5xgzPmw7nLjtRo6ZMW+bROKGAzwMeLXIzwZp+Xc4cfMMkJZ/YC3MP/B65jZQy8aGw4kbJHKMH/M2gLWw4XfY/WfJjDOOHU6cceZZGuOcYxLFBofZzCzwOqzn8GHGnprDif3tyYc/vKmxyTM43vz4Bl6HIQGwexIYmIlVDwTMH8BaRsEoGAWjYBSgAQA0G0+BSWSI0gAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-9521-3903","institution":"University of Guelph","correspondingAuthor":true,"prefix":"","firstName":"Sam","middleName":"","lastName":"Workenhe","suffix":""},{"id":509021461,"identity":"180c8b55-6dcb-4a23-bb49-4b897af08400","order_by":1,"name":"Sarah Worfolk","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"","lastName":"Worfolk","suffix":""},{"id":509021462,"identity":"2f5c2525-4729-482b-a961-340b9d0bbaa3","order_by":2,"name":"Noah Phippen","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Noah","middleName":"","lastName":"Phippen","suffix":""},{"id":509021463,"identity":"3917a4af-b054-4ef3-a428-4a20b095ac02","order_by":3,"name":"Shayla Verburg","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Shayla","middleName":"","lastName":"Verburg","suffix":""},{"id":509021464,"identity":"5eb36b25-d706-41fe-965f-037c1fb958c8","order_by":4,"name":"Katrina Kobal","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Katrina","middleName":"","lastName":"Kobal","suffix":""},{"id":509021465,"identity":"2d0cb30b-4b3c-4394-a69b-aa893ff7697d","order_by":5,"name":"Nicholas Langelaan","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Nicholas","middleName":"","lastName":"Langelaan","suffix":""},{"id":509021466,"identity":"b621c8cc-b0cb-4446-a8a9-0b009881d97f","order_by":6,"name":"Davier Gutierrez-Gongora","email":"","orcid":"https://orcid.org/0000-0001-7972-3217","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Davier","middleName":"","lastName":"Gutierrez-Gongora","suffix":""},{"id":509021467,"identity":"587e07be-719a-47e0-bdca-48b6bc47b631","order_by":7,"name":"Jennifer Geddes-McAlister","email":"","orcid":"","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Jennifer","middleName":"","lastName":"Geddes-McAlister","suffix":""},{"id":509021468,"identity":"4ad4b6da-d216-454d-a3d6-4454dde966dd","order_by":8,"name":"Sarah Wootton","email":"","orcid":"https://orcid.org/0000-0002-5985-2406","institution":"University of Guelph","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"","lastName":"Wootton","suffix":""},{"id":509021469,"identity":"7efcae59-fe79-4ffe-a486-b101fb8e24e1","order_by":9,"name":"Matthew Miller","email":"","orcid":"","institution":"McMaster University","correspondingAuthor":false,"prefix":"","firstName":"Matthew","middleName":"","lastName":"Miller","suffix":""}],"badges":[],"createdAt":"2025-08-29 14:41:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7489583/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7489583/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90774945,"identity":"185f4fc7-7edd-47c8-b572-5e24d3499e37","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":67918,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eterm\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eCas8-2L6HC3 drive cell death in canine epithelial cells.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Schematic illustration of hRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 expression cassettes. \u003cstrong\u003e(B)\u003c/strong\u003e Immunoblots showing expression of hRIPK3-2L6HC3 and cRIPK3-2L6HC3 in MDCK cells treated with doxycycline for 6-hr. \u003cstrong\u003e(C)\u003c/strong\u003e Immunoblot showing expression of C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 in MDCK cells treated with doxycycline for 6-hr. Percent of total cells that are SYTOX\u003csup\u003e+\u003c/sup\u003e cells following doxycycline treatment of MDCK cells expressing \u003cstrong\u003e(D) \u003c/strong\u003eno transgene, \u003cstrong\u003e(E) \u003c/strong\u003ecRIPK3-2L6HC3, \u003cstrong\u003e(F) \u003c/strong\u003ehRIPK3-2L6HC3, or \u003cstrong\u003e(G)\u003c/strong\u003e C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3. Cells were imaged every 4 hours for 36 hours using the Cytation 10. Viability experiments are representative of three biological replicates that are the average of three technical replicates per plate. P-values were determined using two-way ANOVA with Šídák post-hoc test with significance indicated (**** p \u0026lt; 0.0001, *** p \u0026lt; 0.001, ** p \u0026lt; 0.01, * p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/61a3757575448b63efb2089a.png"},{"id":90775367,"identity":"913a9c18-73cc-4024-8ea2-4e53dcb4ad97","added_by":"auto","created_at":"2025-09-08 02:57:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":63003,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eterm\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eCas8-2L6HC3 drive cell death in human fibroblast.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Schematic depiction of hRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 expression cassettes. \u003cstrong\u003e(B)\u003c/strong\u003e Immunoblots showing expression of hRIPK3-2L6HC3 and cRIPK3-2L6HC3 in BJ-5ta cells treated with doxycycline for 6-hr. \u003cstrong\u003e(C)\u003c/strong\u003e Immunoblot of C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 expression in BJ-5ta cells treated with doxycycline for 6-hr. Percent of total cells that are SYTOX\u003csup\u003e+\u003c/sup\u003e cells following doxycycline treatment of BJ-5tas expressing \u003cstrong\u003e(D) \u003c/strong\u003eno transgene, \u003cstrong\u003e(E) \u003c/strong\u003ecRIPK3-2L6HC3, \u003cstrong\u003e(F) \u003c/strong\u003ehRIPK3-2L6HC3, or \u003cstrong\u003e(G)\u003c/strong\u003e C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3. Cells were imaged every 4 hours for 36 hours using the Cytation 10. Viability experiments are representative of three biological replicates that are the average of three technical replicates per plate. P-values were determined using two-way ANOVA with Šídák post-hoc test with significance indicated (**** p \u0026lt; 0.0001, *** p \u0026lt; 0.001, ** p \u0026lt; 0.01, * p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/b3c78a357ce1ea7997fe8c21.png"},{"id":90774942,"identity":"1af7385d-8480-4b77-a900-dbd463fe7681","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":41195,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eterm\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eCas8-2L6HC3 drive apoptosis in canine epithelial cells. (A)\u003c/strong\u003e Cleavage of caspase 3 following expression of hRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 for 24 hours in MDCK cells. Percent of total cells that are Annexin V\u003csup\u003e+\u003c/sup\u003e cells following doxycycline treatment of MDCK cells expressing \u003cstrong\u003e(B) \u003c/strong\u003eno transgene, \u003cstrong\u003e(C) \u003c/strong\u003ecRIPK3-2L6HC3, \u003cstrong\u003e(D) \u003c/strong\u003ehRIPK3-2L6HC3, or \u003cstrong\u003e(E)\u003c/strong\u003e C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3. Cells were imaged every 4 hours for 36 hours using the Cytation 10. Viability experiments are representative of three biological replicates that are the average of three technical replicates per plate. P-values were determined using two-way ANOVA with Šídák post-hoc test with significance indicated (**** p \u0026lt; 0.0001, *** p \u0026lt; 0.001, ** p \u0026lt; 0.01, * p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/5308feb9e8c2251051bfd1af.png"},{"id":90774954,"identity":"cf5eddc8-867a-4a50-a8a3-a76a129a69e0","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":84423,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eterm\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003eCas8-2L6HC3 drive multiple cell death modalities in human fibroblasts. (A)\u003c/strong\u003e Cleavage of caspase 3 (6-hr), phosphorylation of MLKL (6-hr), and cleavage of GSDME (24-hr) following expression of hRIPK3-2L6HC3, cRIPK3-2L6HC3, and C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 in BJ-5ta cells. Percent of total cells that are Annexin V +ve cells following doxycycline treatment of MDCK cells or BJ-5tas expressing \u003cstrong\u003e(B) \u003c/strong\u003eno transgene, \u003cstrong\u003e(C) \u003c/strong\u003ecRIPK3-2L6HC3, \u003cstrong\u003e(D) \u003c/strong\u003ehRIPK3-2L6HC3, or \u003cstrong\u003e(E)\u003c/strong\u003e C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3. Cells were imaged every 4 hours for 36 hours using the Cytation 10. Viability experiments are representative of three biological replicates that are the average of three technical replicates per plate. P-values were determined using two-way ANOVA with Šídák post-hoc test with significance indicated (**** p \u0026lt; 0.0001, *** p \u0026lt; 0.001, ** p \u0026lt; 0.01, * p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/f8f88acd9d09546f0a9090eb.png"},{"id":90775370,"identity":"b50027f5-fce8-43e4-b2cc-7796b34990eb","added_by":"auto","created_at":"2025-09-08 02:57:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":55389,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ecRIPK3 driven apoptosis in canine cells is dependent on caspases, FADD, and RIPK1.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e Percent of total cells that are SYTOX +ve cells following treatment of MDCK cells expressing cRIPK3-2L6HC3 with doxycycline, Z-VAD-FMK + doxycycline, or Z-IETD-FMK + doxycycline. Percent of total cells that are SYTOX\u003csup\u003e+\u003c/sup\u003e cells following treatment of MDCKs expressing cRIPK3-2L6HC3 and with knockdown of \u003cstrong\u003e(B) \u003c/strong\u003eFADD\u003csup\u003e-/-\u003c/sup\u003e or \u003cstrong\u003e(C) \u003c/strong\u003eRIPK1\u003csup\u003e-/-\u003c/sup\u003e with doxycycline. Each value is representative of three biological replicates that are the average of three technical replicates per plate. Cells were imaged every 4 hours for 36 hours using the Cytation 10. P-values were determined using two-way ANOVA with Šídák post-hoc test with significance indicated (**** p \u0026lt; 0.0001, *** p \u0026lt; 0.001, ** p \u0026lt; 0.01, * p \u0026lt; 0.05). \u003cstrong\u003e(D)\u003c/strong\u003e Cleavage of caspase 3 for FADD\u003csup\u003e-/-\u003c/sup\u003e or RIPK1\u003csup\u003e-/-\u003c/sup\u003e MDCKs expressing cRIPK3-2L6HC3. \u003cstrong\u003e(E)\u003c/strong\u003e LDH release from MDCK cells treated with caspase inhibitors or with knockdown of FADD\u003csup\u003e-/-\u003c/sup\u003e or RIPK1\u003csup\u003e-/-\u003c/sup\u003e, 24 hours after transgene induction. Each value is representative of three biological replicates that are the average of three technical replicates per plate. P-values were determined using one-way ANOVA with Tukey post-hoc analysis with significance indicated (**** p \u0026lt; 0.0001, *** p \u0026lt; 0.001, ** p \u0026lt; 0.01, * p \u0026lt; 0.05).\u003cstrong\u003e (F)\u003c/strong\u003e Immunoblot of HMGB1 in the cell free supernatant 24 hours post doxycycline or inhibitor treatment.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/081eaf60642035b7bc5ca6aa.png"},{"id":90774948,"identity":"466f8b4d-b5e5-453d-80b6-b8ff2453b109","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":41101,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRIPK3 and caspase 8 drive unique danger signals in human and canine cells. \u003c/strong\u003eQuantification of extracellular ATP release from \u003cstrong\u003e(A)\u003c/strong\u003e MDCK cells and \u003cstrong\u003e(B)\u003c/strong\u003e BJ-5ta cells expressing hRIPK3-2L6HC3, cRIPK3-2L6HC3, or C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 following 24 hours of doxycycline treatment. Each value is representative of three biological replicates that are the average of three technical replicates per plate. P-values were determined using one-way ANOVA with Tukey post-hoc analysis with significance indicated (**** p \u0026lt; 0.0001, *** p \u0026lt; 0.001, ** p \u0026lt; 0.01, * p \u0026lt; 0.05). Immunoblot of HMGB1 in the cell free supernatant of \u003cstrong\u003e(C) \u003c/strong\u003eMDCKs and \u003cstrong\u003e(D) \u003c/strong\u003eBJ-5tas 24 hours post doxycycline.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/91464317aaf1e0082ce453a0.png"},{"id":90774958,"identity":"79b6c891-f6b5-4da1-9c95-2f2ac61f77b1","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":56266,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRIPK3 and caspase 8 drive unique cytokines and chemokines in human and canine cells. \u003c/strong\u003eQuantification of extracellular cytokine and chemokines in cell free supernatants from \u003cstrong\u003e(A)\u003c/strong\u003e MDCK cells and \u003cstrong\u003e(B)\u003c/strong\u003e BJ-5ta cells expressing hRIPK3-2L6HC3, cRIPK3-2L6HC3, or C\u003csub\u003eterm\u003c/sub\u003eCas8-2L6HC3 following 24 hours of doxycycline treatment. Heatmap of Log2 fold changes of cytokines and chemokines in \u003cstrong\u003e(A) \u003c/strong\u003eMDCKs and \u003cstrong\u003e(F) \u003c/strong\u003eBJ-5ta compared with baseline at 0 hour for each respective group (N = 3). Each value is representative of three biological replicates that are the average of three technical replicates per plate.\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/3f2dc7b637c05acc2bf01148.png"},{"id":92501022,"identity":"14329859-b48c-46e5-9484-618eab190bea","added_by":"auto","created_at":"2025-09-30 11:24:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1623997,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/6de05853-4d98-4de7-af4a-94d05c76c8d6.pdf"},{"id":90774946,"identity":"91959aac-e808-4f46-80e8-e045024fd7ad","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"ai","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2028177,"visible":true,"origin":"","legend":"s.fig.1","description":"","filename":"SuppFig1.ai","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/3b7d9da3935ce3ef087d31c5.ai"},{"id":90775369,"identity":"3c55dfbc-fa18-41a6-bed8-b82e5b1a5430","added_by":"auto","created_at":"2025-09-08 02:57:34","extension":"ai","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2760422,"visible":true,"origin":"","legend":"\u003cp\u003eOriginal Data Files (s.fig 2)\u003c/p\u003e","description":"","filename":"SuppFig2.ai","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/b9fd22a9af99c52c218f75d4.ai"},{"id":90775817,"identity":"6deb6820-a64c-43c7-b1f5-2a0ad6e71ac3","added_by":"auto","created_at":"2025-09-08 03:05:38","extension":"ai","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1332919,"visible":true,"origin":"","legend":"\u003cp\u003es.fig 3\u003c/p\u003e","description":"","filename":"SuppFig3.ai","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/8e4497585122aa2881efdffb.ai"},{"id":90774955,"identity":"0dabe233-ea6d-4aff-81ea-06c070a394cf","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"ai","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1606505,"visible":true,"origin":"","legend":"\u003cp\u003es.Fig 4\u003c/p\u003e","description":"","filename":"SuppFig4.ai","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/f828a3dccdd79da885478b75.ai"},{"id":90774956,"identity":"133a426a-7eaa-4774-84d4-3682bdd3ea58","added_by":"auto","created_at":"2025-09-08 02:49:34","extension":"ai","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1604201,"visible":true,"origin":"","legend":"\u003cp\u003es.fig 5\u003c/p\u003e","description":"","filename":"SuppFig5.ai","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/a288cf681553570e2be506fa.ai"},{"id":90774971,"identity":"96f96ff4-0b65-4faa-b72c-39142f29d978","added_by":"auto","created_at":"2025-09-08 02:49:35","extension":"ai","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":2344276,"visible":true,"origin":"","legend":"\u003cp\u003es.fig 6\u003c/p\u003e","description":"","filename":"SuppFig6.ai","url":"https://assets-eu.researchsquare.com/files/rs-7489583/v1/7a6aeec6d9443de0b8fe75ea.ai"}],"financialInterests":"(Not answered)","formattedTitle":"Activation of canine RIPK3 drives inflammatory apoptosis dependent on RIPK1, FADD and Caspases","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eProgrammed cell death is essential for maintaining organismal development, tissue homeostasis, and communication of danger to the immune system. Two well-defined forms of programmed cell death, apoptosis and necroptosis, can be activated by similar stimuli and upstream signaling but employ distinct molecular machineries to execute the terminal stages of cell death [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Apoptosis is mediated by caspases and results in shrinkage of the cell, chromatin condensation, and phagocytic clearance [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Human and murine studies show that the lack of cell lysis and the immunosuppressive roles of activated caspases renders apoptosis less immunostimulatory [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] unless it is activated in the context of other underlying stress, such as infection [\u003cspan additionalcitationids=\"CR12 CR13 CR14 CR15\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In contrast, necroptosis, is a pro-inflammatory form of lytic cell death that plays an essential role in the development of immunity against pathogens and cancer [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21 CR22 CR23 CR24\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eNecroptosis is initiated by a variety of lethal stimuli that engage the death receptors to activate RIPK1 and RIPK3 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. RIPK3 phosphorylates and activates MLKL, a pore-forming protein that induces the osmotic changes required to activate ninjurin 1 that executes plasma membrane rupture [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. These processes cumulatively activate plasma membrane rupture resulting in the release of damage-associated molecular patterns (DAMPs). Necroptosis can also allow the secretion of cytokines and chemokines through the formation of RIPK1/RIPK3 heterodimers and other partnering proteins forming a necrosome complex that activates NF-kb signaling [\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn humans, the extrinsic apoptosis pathway and necroptosis are regulated by overlapping signaling cascades, involving RIPK1/3. Depending on the signaling complex established, stimulation of the death receptors, for instance by treatment with tumor necrosis factor (TNF) can activate apoptosis or necroptosis. Under conditions of high RIPK3 and MLKL, and a caspase 8 inhibited state, TNF treatment activates necroptosis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, in the presence of caspase 8, TNF activates RIPK3 to promote apoptosis by facilitating caspase activation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe cell death machinery of carnivores and specifically, dogs, have not been widely studied. There are 10 predicted isoforms of canine \u003cem\u003eRIPK3\u003c/em\u003e with no previous characterization of the protein and signaling upon activation. Similar to human RIPK3, canine RIPK3 has a kinase domain and a receptor-interacting protein homotypic interaction motif (RHIM). The kinase domain of RIPK3 is at the N-terminal domain and it phosphorylates itself and other proteins, such as MLKL [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The RHIM domain is used for homo- and hetero-dimerization with itself and other proteins, such as RIPK1 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In other mammals, RIPK3 phosphorylates MLKL to trigger necroptosis [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. However, there are no MLKL sequences in the genome of animal species within the order Carnivora, including canines. This divergence prompted us to evaluate what type of cell death and signaling process is driven by RIPK3 in canine cells.\u003c/p\u003e\u003cp\u003eHere, we demonstrate that catalytically active forms of human and canine RIPK3 induce apoptosis in canine cells and PANoptosis in human cells. The RIPK3-driven canine cell apoptosis was dependent on RIPK1, FADD, and caspase 8. Additionally, the secretome released by canine cells dying from RIPK3-driven apoptosis was unique from the secretome associated with caspase 8 driven apoptosis. By elucidating the molecular mechanisms of RIPK3 induced canine cell death, our work highlights species-specific adaptations in programmed cell death pathways and underscores the importance of canine models in comparative cell death and immunobiology. Moreover, these findings have implications for understanding immune regulation in canines and may guide the development of targeted therapies for canine diseases, including malignancies and inflammatory conditions, where cell death pathways are implicated.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cb\u003eExpression of catalytically active RIPK3 leads to reduction in the viability of human and canine cells.\u003c/b\u003e To identify conserved motifs and/or differences between canine and human RIPK3 we compared the amino acid sequence and structural differences of the specific domains using Alpha Fold. There are 10 predicted canine RIPK3 sequences and we used the longest coding sequence (Accession: XM_038673261.1). Alignment of the amino acid sequences revealed 57% identity between canine and human RIPK3. Fewer differences are found in the protein kinase domain, while the RHIM and other domains contains most of the observed differences in amino acid sequence (\u003cb\u003eS. Figure\u0026nbsp;1A\u003c/b\u003e). Notably, the RHIM consensus sequence VQVG was conserved between the two species. Structural analysis using Alpha Fold revealed that the kinase domain of human and canine RIPK3 are highly conserved with a root mean square deviation of 1.84 (\u003cb\u003eS. Figure\u0026nbsp;1C\u003c/b\u003e). The RHIM domains of both proteins are disordered and could not be predicted using Alpha Fold (\u003cb\u003eS. Figure\u0026nbsp;1B\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eTo define the types of cell death activated downstream of expressing catalytically active RIPK3, we used a doxycycline (Dox)-inducible promoter to express flag-tagged human and canine RIPK3 coding sequences linked to the 2L6HC3 trimerization domain (hRIPK3-2L6HC3 and cRIPK3-2L6HC3, respectively) (\u003cb\u003eFig.\u0026nbsp;1A \u0026amp; 2A\u003c/b\u003e) [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. We also employed a previously established system to drive apoptosis by expressing the C-terminal caspase 8 fused to the 2L6HC3 trimerization domain (C\u003csub\u003eterm\u003c/sub\u003e-Cas8-2L6HC3) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In all studies, we selected MDCK (Madin-Darby canine kidney), a canine kidney epithelial cell line as a representative canine cell line for its ability to respond to infection [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. All human experiments used BJ-5ta, an hTERT immortalized human foreskin fibroblast cell line with intact innate immune signaling and programmed cell death pathways [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Expression of human and canine RIPK3 in canine cells (\u003cb\u003eFig.\u0026nbsp;1B, S. Figure\u0026nbsp;2A\u003c/b\u003e) increased the cell death measured by SYTOX dye uptake after losing membrane integrity (\u003cb\u003eFig.\u0026nbsp;1E, F\u003c/b\u003e). While both the canine and human RIPK3 peaked at a comparable 50% loss of viability, human RIPK3 induced loss of membrane integrity was rapid. The expression of human and canine RIPK3 reduced the viability of BJ-5ta, although the progression of canine RIPK3 driven loss of viability was slow (\u003cb\u003eFig.\u0026nbsp;2E, F, S. Figure\u0026nbsp;2C\u003c/b\u003e). Expression of the C\u003csub\u003eterm\u003c/sub\u003e-Casp8-2L6HC3 (\u003cb\u003eFig.\u0026nbsp;1C, S. Figure\u0026nbsp;2B\u0026amp;D\u003c/b\u003e) also reduced cell viability in human and canine cells (\u003cb\u003eFig.\u0026nbsp;1G \u0026amp; 2G\u003c/b\u003e). Overall, the findings show that dimerizable forms of RIPK3 and caspase 8 are catalytically active to reduce the viability of canine and human cells. Doxycycline treatment of human and canine cells lacking the RIPK3/caspase 8 expressing constructs did not show changes in cell viability (\u003cb\u003eFig.\u0026nbsp;1D \u0026amp; 2D\u003c/b\u003e). Consistent with the loss of membrane integrity data from the SYTOX dye uptake assays, we also measured increased levels of LDH released in RIPK3 expressing canine and human cells (\u003cb\u003eS. Figure\u0026nbsp;3\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eActivating RIPK3 drives apoptosis in canine cells and PANoptosis in human cells.\u003c/b\u003e Unlike human and mouse cells that activate necroptosis after expression of active RIPK3, the type of cell death activated in canine cells after RIPK3 expression remains unknown. Investigating RIPK3 induced cell death in canine cells is interesting due to the lack of MLKL, a terminal effector of necroptosis. Hence, after confirming catalytically active RIPK3 reduced cell viability, we investigated what type(s) of cell death are activated. Immunoblotting showed that canine cells expressing catalytically active RIPK3 and caspase 8 drive caspase 3 cleavage, confirming the induction of apoptosis (\u003cb\u003eFig.\u0026nbsp;3A, S. Figure\u0026nbsp;2E\u003c/b\u003e). The lack of antibodies against canine gasdermin proteins prevented us from investigating pyroptosis. Canine cell lines expressing active RIPK3 and caspase 8 showed rapid Annexin V staining confirming apoptotic cell death (\u003cb\u003eFig.\u0026nbsp;3C-E\u003c/b\u003e).\u003c/p\u003e\u003cp\u003ePrevious studies show that expressing active RIPK3-induced necroptosis in murine fibroblasts [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The inducible expression of human active RIPK3 in BJ-5ta simultaneously activated apoptosis, necroptosis and pyroptosis, implicating human RIPK3 as a potential driver of PANoptosis (\u003cb\u003eFig.\u0026nbsp;4A, S. Figure\u0026nbsp;2F\u003c/b\u003e). Both phosphorylation of MLKL and cleavage of caspase 3 were detectable after 6 hours of expressing trimerizable human RIPK3, while gasdermin E cleavage was not detectable until later timepoints (\u003cb\u003eFig.\u0026nbsp;4A\u003c/b\u003e). Active canine RIPK3 activated only apoptosis in BJ-5ta, indicating that sequence and/or structural variations in canine RIPK3 impair its ability to activate MLKL (\u003cb\u003eFig.\u0026nbsp;4A\u003c/b\u003e). Moreover, catalytically active caspase 8 cleaved gasdermin E alongside the cleavage of caspase 3, which indicates the activation of apoptosis and pyroptosis (\u003cb\u003eFig.\u0026nbsp;4A\u003c/b\u003e). In BJ-5ta cells Annexin V staining only increased for caspase 8 activated cell death (\u003cb\u003eFig.\u0026nbsp;4B-E\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eRIPK3-driven apoptosis in canine cells is dependent on caspases, FADD, and RIPK1.\u003c/b\u003e To investigate the mechanism of RIPK3-driven apoptosis in canine cells, we used caspase inhibitors and CRISPR-Cas9 mediated RIPK1 and FADD knockouts in MDCK cells. Pretreatment with either a pan-caspase inhibitor (Z-VAD-FMK), a caspase 8 specific inhibitor (Z-IETD-FMK) or knocking out FADD and RIPK1 (\u003cb\u003eS. Figure\u0026nbsp;4\u003c/b\u003e) completely abrogated RIPK3-mediated reduction in cell viability (\u003cb\u003eFig.\u0026nbsp;5A-C\u003c/b\u003e) and detection of apoptosis in canine cells (\u003cb\u003eFig.\u0026nbsp;5D, S. Figure\u0026nbsp;2G\u003c/b\u003e). Secretion of HMGB1 after RIPK3 activation was lost in the functional absence of caspases, FADD and RIPK1 (\u003cb\u003eFig.\u0026nbsp;5F, S. Figure\u0026nbsp;2F\u003c/b\u003e). Consistent with the role of caspases, RIPK1 and FADD in canine RIPK3 driven apoptosis, the absence of these cell death adaptor proteins abrogated LDH release (\u003cb\u003eFig.\u0026nbsp;5E\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eRIPK3 and caspase 8-driven apoptosis emit diverse types of secretomes.\u003c/b\u003e Several types of cell death are associated with the emission of biomolecules that regulate immune responses. RIPK3 activation leads to its heterodimerization with RIPK1 to form a necrosome complex that activates NF-kB for cytokine and chemokine secretion [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Knowing this, we postulated that the secretomes from RIPK3 induced canine apoptosis are different from caspase 8 mediated apoptosis. To test this, cell death was activated by expressing active RIPK3 or caspase 8 and cell-free supernatants collected to quantify classical danger signals ATP, HMGB1, and cytokines and chemokines. In canine cells, human RIPK3 drove rapid and high levels of ATP secretion, while activation of canine RIPK3 resulted in gradual accumulation and low levels of extracellular ATP (\u003cb\u003eFig.\u0026nbsp;6A\u003c/b\u003e). In human cells, canine RIPK3 drove high ATP secretion at later timepoints, while human RIPK3 produced low levels of ATP secretion at earlier timepoints (\u003cb\u003eFig.\u0026nbsp;6B\u003c/b\u003e). Unexpectedly, expression of active caspase 8 emitted extracellular ATP in canine but not human cells (\u003cb\u003eFig.\u0026nbsp;6A, B\u003c/b\u003e). In both human and canine cells, HMGB1 release was the highest level in human RIPK3, followed by canine RIPK3 and caspase 8 (\u003cb\u003eFig.\u0026nbsp;6C, D, S. Figure\u0026nbsp;2I-J\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eThe cytokines/chemokines released after RIPK3 and caspase 8 mediated cell death are presented in heat maps (\u003cb\u003eFig.\u0026nbsp;7\u003c/b\u003e). MDCKs expressing active canine or human RIPK3 emitted significantly higher amounts of GM-CSF, IL-8, KC-like, and MCP-1 (\u003cb\u003eFig.\u0026nbsp;7A and S. Figure\u0026nbsp;5\u003c/b\u003e). As expected, caspase 8 mediated apoptosis in MDCK cells did not show significant emission of any cytokine/chemokines when compared with untreated cells. In human cells, human and canine RIPK3 as well as caspase 8 showed a shared secretion of IFN-a and IL-6. Human and canine RIPK3 additionally increased emission of IL-2, IL-8, IL-12p40, IL-27, IP-10, MCP-1, RANTES, sCD40L, TGFa, TNFb, and VEGF-A (\u003cb\u003eFig.\u0026nbsp;7B and S. Figure\u0026nbsp;6\u003c/b\u003e). Canine RIPK3 uniquely drove the emission of IL-9, M-CSF, and PDGF-AB/BB while human RIPK3 uniquely drove GM-CSF, IL-5, IL-17A, IL-18, CXCL9, MIP-1a, PDGF-AA, and TNFa.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe dog can be used as a valuable model for studying human diseases due to its genetic similarity to humans and its exposure to infectious agents, household chemicals and physical insults that often affect humans. Humans and dogs also have shared susceptibility to diseases involving dysregulated cell death, such as cancer. As a member of the order Carnivora, the dog is speculated to suppress inflammatory lytic cell death [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] without detailed understanding of the mechanisms. For example, the lack of MLKL in the genome of dogs has intrigued researchers regarding the type of cell death activated upon RIPK3 activation and if there is also a protein that may replace the function of MLKL in dogs. The findings of this study present the mechanisms of RIPK3-driven apoptosis in canines and demonstrated unique immunostimulatory properties of RIPK3-driven apoptosis in dogs. We have discovered that inducible expression of catalytically active RIPK3 in canines drives RIPK1, FADD, and caspase-dependent apoptosis. These findings are consistent with the induction of apoptosis in humans under conditions of inhibiting MLKL oligomerization, or higher caspase activity inhibiting necrosome formation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Moreover, consistent with human findings, canine RIPK3 driven apoptosis is dependent on RIPK1, FADD, and caspase 8 [\u003cspan additionalcitationids=\"CR48\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. These findings indirectly confirm the absence of a protein replacing the lytic functional role of MLKL downstream of RIPK3 induced signaling.\u003c/p\u003e\u003cp\u003eRIPK3 activation has been used previously as a method to activate murine fibroblast necroptosis without a comprehensive characterization of the cell death types activated in humans [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In this comparative investigation, we identified that RIPK3 activation in human cells results in PANoptosis through simultaneous activation of markers for apoptosis, necroptosis, and pyroptosis. PANoptosis requires the expression and activity of many cell death proteins and BJ-5ta cells are interferon responsive and express most of the known cell death signaling proteins. Activation of necroptosis and apoptosis downstream of RIPK3 is expected in human cells given the ability of RIPK3 to drive caspase 8 activation through FADD and RIPK1 [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Unexpectedly, we also observed the activation of pyroptosis executioner, gasdermin E, following caspase 3 cleavage (\u003cb\u003eFig.\u0026nbsp;2C\u003c/b\u003e). Previous research has identified a role for caspase 3 in cleaving gasdermin E in cells expressing high levels of gasdermin E [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. This is the first report of gasdermin E activation downstream of RIPK3 signaling.\u003c/p\u003e\u003cp\u003eProgrammed cell death communicates homeostatic disturbances to the immune system. This is done by secreting DAMPs, cytokines and chemokines along with the release of other alarming cellular contents that stimulate innate immune cells. Genetic systems of cell death have allowed us and others to compare the immunostimulatory properties of individual cell death modalities[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In humans and mice apoptosis is not immunostimulatory[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] unless it is activated in the context of other underlying stress[\u003cspan additionalcitationids=\"CR12 CR13 CR14 CR15\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. In a similar fashion, we have demonstrated that the type of apoptosis initiation and the proteins recruited to the signaling cascade influence the immunostimulatory properties of apoptosis in canine cells. While activation of apoptosis by both RIPK3 and caspase 8 drove emission of DAMPs, only RIPK3 stimulated the secretion of cytokines/chemokines in canine cells possibly involving RIPK1/RIPK3 heterodimers to activate NF-kB [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. These potentially immunostimulatory properties of RIPK3 driven apoptosis likely compensates for the loss of lytic cell death in the antiviral response of Carnivora species.\u003c/p\u003e\u003cp\u003eThe emission of biomolecules during caspase 8 driven apoptosis differed between human and canine cells. Consistent with our previous studies in murine cancer cells [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], human cells showed no significant release of ATP or HMGB1, despite abundant secretion of cytokines/chemokines. The opposite was observed in canine cells with the detection of ATP and HMGB1, but no cytokine/chemokine emission. These differences may be accounted for by caspase 8 driving gasdermin E activation in human cells [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], facilitating the secretion of selected cytokines/chemokines. The major aspects of pyroptosis signaling in canine cells is still unknown and it is possible that canine cells are defective to induce pyroptosis.\u003c/p\u003e\u003cp\u003eProgrammed cell death has beneficial and detrimental outcomes during virus infection[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Induction of cell death in the early stages of virus infection is crucial for limiting replication, alerting neighboring cells, and activation of adaptive immune responses [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. However, cell death can also be used for virus dissemination and instigate undesirable inflammation which causes severe immunopathology that contributes to viral disease pathogenesis[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Hence, many viruses express accessory proteins that manipulate lytic cell death in virus infected cells. The ability of human cells, but not canine cells, to activate PANoptosis may indicate an evolutionary advantage to avoid the effects of viral encoded inhibitors of lytic cell death that allows many herpesviruses to establish life-long infection without activating a strong antiviral adaptive immunity. Future studies should investigate virus-host interactions in the context of these evolutionary adaptations and differences in cell death activation between canine and human cells.\u003c/p\u003e\u003cp\u003eCertain cytotoxic anticancer treatments activate immunity against cancer, partly by activating immunostimulatory types of lytic cell death [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. In canine cells, RIPK3 driven apoptosis activated a comparable level of ATP and HMGB1 release as in the human PANoptosis. We were very limited in the number of cytokines/chemokines we can analyze for dogs compared to humans and this limitation obscures the direct comparison of cytokines/chemokines activated by RIPK3 in the two species. Regardless, canine cells showed the emission of selected cytokines/chemokines. It remains interesting to investigate the role of RIPK1/RIPK3 heterodimers in activating NF-kB activation and the release of cytokines/chemokines during RIPK3 mediated apoptosis of canine cells. Previous murine studies showed that deletion of MLKL did not abrogate the anticancer effects of a fibroblast necroptosis vaccine induced by catalytically active RIPK3 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. It remains unknown if shifting the canine apoptosis to necroptosis by co-expressing human RIPK3 and MLKL would change the immunogenicity of dying cells. Future studies comparing the immunological outcomes of activating RIPK3 driven apoptosis and necroptosis are required to identify which modality should be further developed to treat companion animal cancers. In this regard, a variety of delivery vehicles such as oncolytic viruses and self-amplifying mRNAs can be employed to express the pro-cell death molecules.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003eCell culture\u003c/h2\u003e\u003cp\u003eBJ-5ta human hTERT immortalized foreskin fibroblasts (American Type Culture Collection, ATCC, CRL-4001), MDCK canine kidney epithelial cells (ATCC, CCL-34), and Lenti-X 293T (ATCC) were maintained in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) (Cytiva) containing 4.0 mM L-glutamine and 4500 mg/L glucose and supplemented with 10% fetal bovine serum (FBS) (Thermo Scientific). All cell lines were maintained at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Cell lines were regularly tested for mycoplasma contamination.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eGeneration of stable h/cRIPK3-2L6HC3 and h/cC-Cas8-2L6HC3 cell lines\u003c/h3\u003e\n\u003cp\u003eCanine RIPK3 (FLAG-tagged, Accession: XM_038673261.1, nucleotides 205\u0026ndash;1662), human RIPK3, canine C\u003csub\u003eterm\u003c/sub\u003e-Cas8 (Accession: NP_001041494, residues 198\u0026ndash;486) and human C\u003csub\u003eterm\u003c/sub\u003e-Cas8 all linked to the trimerization domain, 2L6HC3, were cloned into pCW57.1 (Addgene #41393) via Gateway cloning using LR and BP Clonase Enzyme Mixes (ThermoFisher Scientific; California, USA). Lentivirus was produced as previously described [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] and 1 mL of lentivirus was used to transduce BJ-5ta or MDCK cells prior to selection with 4 \u0026micro;g/mL puromycin (ThermoFisher Scientific; New York, USA) for 2\u0026ndash;3 days. All experiments were performed using polyclonal populations between passages 2 and 15. Cells were treated with doxycycline (ThermoFisher Scientific; New York, USA) at a final concentration of 1 \u0026micro;g/mL for all experiments inducing expression of a transgene.\u003c/p\u003e\n\u003ch3\u003eImmunoblotting\u003c/h3\u003e\n\u003cp\u003eBJ-5ta and MDCKs were seeded at 400 000 or 250 000 cells per well of a 6-well plate the day before cell lysis and protein isolation for 6-hr and 24-hr experiments, respectively. After applying the respective treatments, cells were lysed and total protein samples were used for immunoblotting as previously described [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. The specific antibodies used, source and dilutions are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAntibodies used for immunoblotting\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAntibody target\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCompany\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAT #\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDilution factor\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eb-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCell Signaling Technology (Massachusetts, USA)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4967\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:6000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eb-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma-Aldrich (Missouri, USA)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eA1978\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:6000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ep-MLKL (S358)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbcam (Massachusetts, USA)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAb187091\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRIPK3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAb316957\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFLAG M2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSigma-Aldrich\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eF1804\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRIPK1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCell Signaling Technology\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3493S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:500\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCleaved caspase 3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAb214430\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:2000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCaspase 8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCell Signaling Technology\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4790S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:1000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGSDME\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAbcam\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAb215191\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1:2000\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eQuantification of cell viability\u003c/h2\u003e\u003cp\u003eCell viability was assessed using membrane permeability dyes and live cell imaging. Cells were plated at 2 500 and 10 000 cells per well in 96-well plates for MDCK and BJ-5ta cell lines, respectively. The following day cells were incubated in the following cocktail of viability dyes: Hoechst at 250 ng/mL (Invitrogen; Oregon, USA), SYTOX\u0026trade; RED at 1I25 nM (Invitrogen; Oregon, USA), and annexin-V FITC at a 1:400 dilution (Invitrogen; Oregon, USA). Following incubation of 100 \u0026micro;L of viability dye cocktail for 2 hours, 100 \u0026micro;L of doxycycline at 2x concentration was added to the 100 \u0026micro;L of dyes. In experiments using Z-VAD-FMK (Invivogen; California, USA) and Z-IETD-FMK (Invivogen; California, USA) the inhibitors were pre-incubated with the dyes prior to doxycycline treatment. 96-well plates were immediately placed into the BioSpa for imaging with the Cytation 10 (Agilent; California, USA). Cells were maintained at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e in between imaging in the Cytation 10 every 4 hours for 36 to 48 hours. Images were obtained with a 4x objective, a GFP filter cube, Cy5 filter cube, and DAPI filter cube. Image processing and analysis was conducted using the Gen5 software.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eQuantification of extracellular ATP, LDH, cytokines, and chemokines\u003c/h3\u003e\n\u003cp\u003eCell free supernatant was collected from BJ-5ta and MDCKs plated at 20 000 and 10 000 cells per well in a 96-well plate, respectively. Cells were exposed to treatments for 24 hours prior to supernatant harvest. Extracellular ATP analysis was conducted using the ENLITEN ATP Assay Kit (Promega) according to manufacturer instructions. LDH was assessed using the LDH-Glo Cytotoxicity Assay (Promega) according to manufacturer's instructions. Cell-free supernatants were collected from BJ-5ta and MDCKs and sent to Eve Technologies for the Human Cytokine Pannel A 48-Plex Discovery Assay and Canine Cytokine 13-Plex Discovery Assay, respectively.\u003c/p\u003e\n\u003ch3\u003eGeneration of CRISPR-Cas9 knockdown cell lines\u003c/h3\u003e\n\u003cp\u003esgRNAs were designed to target canine RIPK1 and canine FADD genes (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Restriction cloning was used to generate LentiCRISPRv2 (blasticidin) plasmids and lentivirus was generated as previously described [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences CRISPR-Cas9 guide RNAs\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene target\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eFWD\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eRV\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRIPK1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCACCGCTCCATGTACTCCATCACCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAACTGGTGATGGAGTACATGGAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFADD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCACCGGAGCTCAAGTTCCTGTGCCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAACTGGCACAGGAACTTGAGCTCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eStatistics and reproducibility\u003c/h2\u003e\u003cp\u003eFor each statistical test used, normality of the distribution and equality of variance between groups was evaluated beforehand. For differences in means, one-way analysis of variance (ANOVA) with Tukey post hoc analysis or two-way analysis of variance (ANOVA) with Š\u0026iacute;d\u0026aacute;k correction multiple comparisons. Bar graphs are shown as a mean +/- standard deviation with individual datapoints included. The null hypothesis was rejected for p values\u0026thinsp;\u0026lt;\u0026thinsp;0.05. All analysis was carried out using GraphPad Prism version 10 (La Jolla, CA, USA).\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of Interest\u003c/h2\u003e\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003ch2\u003eAuthor Contributions\u003c/h2\u003e\u003cp\u003eSMW, NJP, SGV, KAK, and NCL conducted the experiments and analyzed the results. STW, SMW, and NJP were involved in the design of the experiments. DGG and JGM were involved in the computational analysis and editing of the manuscript. SKW, and MSM helped in the conception of the specific studies, interpretation of the findings, and editing of the manuscript. STW and SMW wrote the manuscript. STW conceived the overall study, acquired the funding for the study and provided guidance on the overall study.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e\u003cp\u003eWe thank the OVC Pet Trust for funding to STW. We also thank Dr. Courtney Schott and her team for training SMW in using the Cytation 10 instrument.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLi, D., et al., \u003cem\u003eA phosphorylation of RIPK3 kinase initiates an intracellular apoptotic pathway that promotes prostaglandin2α-induced corpus luteum regression\u003c/em\u003e. Elife, 2021. 10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMandal, P., et al., \u003cem\u003eRIP3 induces apoptosis independent of pro-necrotic kinase activity\u003c/em\u003e. Mol. Cell, 2014. 56(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR, B., et al., \u003cem\u003eInhibition of MLKL Attenuates Necroptotic Cell Death in a Murine Cell Model of Ischaemia Injury\u003c/em\u003e. J Clin Med, 2021. 10(2).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD, V., et al., \u003cem\u003eInhibition of caspases increases the sensitivity of L929 cells to necrosis mediated by tumor necrosis factor\u003c/em\u003e. J Exp Med, 1998. 187(9).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBortner, C.D. and J.A. Cidlowski, \u003cem\u003eUncoupling Cell Shrinkage from Apoptosis Reveals That Na\u0026thinsp;+\u0026thinsp;Influx Is Required for Volume Loss during Programmed Cell Death.\u003c/em\u003e JBC, 2003. 278(40).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCD, B., H. FM, and C. JA, \u003cem\u003eA primary role for K\u0026thinsp;+\u0026thinsp;and Na\u0026thinsp;+\u0026thinsp;efflux in the activation of apoptosis\u003c/em\u003e. JBC, 1997. 272(51).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eD, J., et al., \u003cem\u003eNovel path to apoptosis: small transmembrane pores created by staphylococcal alpha-toxin in T lymphocytes evoke internucleosomal DNA degradation\u003c/em\u003e. Infect Immun, 1994. 62(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eF, B., M. L, and D. L, \u003cem\u003eHuman eosinophils in culture undergo a striking and rapid shrinkage during apoptosis. Role of K\u0026thinsp;+\u0026thinsp;channels\u003c/em\u003e. J Leuko Bio, 1995. 57(6).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYatim, N., et al., \u003cem\u003eRIPK1 and NF-κB signaling in dying cells determines cross-priming of CD8⁺ T cells\u003c/em\u003e. Science (New York, N.Y.), 2015. 350(6258): p. 328\u0026ndash;334.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSnyder, A.G., et al., \u003cem\u003eIntratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates antitumor immunity.\u003c/em\u003e Science Immunology, 2019. 4(36): p. eaaw2004.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMichaud, M., et al., \u003cem\u003eAutophagy-dependent anticancer immune responses induced by chemotherapeutic agents in mice\u003c/em\u003e. Science, 2011. 334(6062): p. 1573\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eObeid, M., et al., \u003cem\u003eCalreticulin exposure dictates the immunogenicity of cancer cell death\u003c/em\u003e. Nat Med, 2007. 13(1): p. 54\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePanaretakis, T., et al., \u003cem\u003eThe co-translocation of ERp57 and calreticulin determines the immunogenicity of cell death\u003c/em\u003e. Cell Death Differ, 2008. 15(9): p. 1499\u0026ndash;509.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePanaretakis, T., et al., \u003cem\u003eMechanisms of pre-apoptotic calreticulin exposure in immunogenic cell death\u003c/em\u003e. The EMBO journal, 2009. 28(5): p. 578\u0026ndash;590.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCiampricotti, M., et al., \u003cem\u003eChemotherapy response of spontaneous mammary tumors is independent of the adaptive immune system\u003c/em\u003e. Nat Med, 2012. 18(3): p. 344\u0026ndash;6; author reply 346.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T., et al., \u003cem\u003eDe novo necroptosis creates an inflammatory environment mediating tumor susceptibility to immune checkpoint inhibitors\u003c/em\u003e. Communications Biology, 2020. 3(1): p. 645.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKepp, O., et al., \u003cem\u003eConsensus guidelines for the detection of immunogenic cell death\u003c/em\u003e. Oncoimmunology, 2014. 3(9): p. e955691.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003evan Vloten, J.P., et al., \u003cem\u003eCritical Interactions between Immunogenic Cancer Cell Death, Oncolytic Viruses, and the Immune System Define the Rational Design of Combination Immunotherapies\u003c/em\u003e. The Journal of Immunology, 2018. 200(2): p. 450.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVerburg, S.G., et al., \u003cem\u003eViral-mediated activation and inhibition of programmed cell death\u003c/em\u003e. PLoS Pathog, 2022. 18(8): p. e1010718.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T., et al., \u003cem\u003eDeterminants for Antitumor and Protumor Effects of Programmed Cell Death\u003c/em\u003e. Cancer Immunol Res, 2024. 12(1): p. 7\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T. and K.L. Mossman, \u003cem\u003eRewiring cancer cell death to enhance oncolytic viro-immunotherapy\u003c/em\u003e. Oncoimmunology, 2013. 2(12): p. e27138.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T. and K.L. Mossman, \u003cem\u003eOncolytic virotherapy and immunogenic cancer cell death: sharpening the sword for improved cancer treatment strategies\u003c/em\u003e. Mol Ther, 2014. 22(2): p. 251\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T., J. Pol, and G. Kroemer, \u003cem\u003eTumor-intrinsic determinants of immunogenic cell death modalities.\u003c/em\u003e OncoImmunology, 2021. 10(1): p. 1893466.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T., et al., \u003cem\u003eCombining oncolytic HSV-1 with immunogenic cell death-inducing drug mitoxantrone breaks cancer immune tolerance and improves therapeutic efficacy\u003c/em\u003e. Cancer Immunology Research, 2013. 1(5): p. 309\u0026ndash;319.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T., et al., \u003cem\u003eImmunogenic HSV mediated oncolysis shapes the antitumor immune response and contributes to therapeutic efficacy\u003c/em\u003e. Molecular Therapy, 2014. 22(1): p. 123\u0026ndash;131.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrootjans, S., T.V. Berghe, and P. Vandenabeele, \u003cem\u003eInitiation and execution mechanisms of necroptosis: an overview\u003c/em\u003e. Cell Death Differ, 2017. 24(7).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDegen, M., et al., \u003cem\u003eStructural basis of NINJ1-mediated plasma membrane rupture in cell death\u003c/em\u003e. Nature, 2023. 618(7967).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eN, K., et al., \u003cem\u003eNINJ1 mediates plasma membrane rupture during lytic cell death\u003c/em\u003e. Nature, 2021. 591(7848).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYatim, N., et al., \u003cem\u003eRIPK1 and NF-κB signaling in dying cells determines cross-priming of CD8\u0026thinsp;+\u0026thinsp;T cells\u003c/em\u003e. Science, 2015. 350(6258).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMA, K., et al., \u003cem\u003eThe death domain kinase RIP mediates the TNF-induced NF-kappaB signal\u003c/em\u003e. Immunity, 1998. 8(3).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eH, L., et al., \u003cem\u003eUbiquitination of RIP is required for tumor necrosis factor alpha-induced NF-kappaB activation.\u003c/em\u003e JBC, 2006. 281(19).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMeng, Y., et al., \u003cem\u003ePhosphorylation-dependent pseudokinase domain dimerization drives full-length MLKL oligomerization\u003c/em\u003e. Nat Commun, 2023. 14(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM, M., et al., \u003cem\u003eThe Structure of the Necrosome RIPK1-RIPK3 Core, a Human Hetero-Amyloid Signaling Complex\u003c/em\u003e. Cell, 2018. 173(5).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eX, W., et al., \u003cem\u003eThe structure of a minimum amyloid fibril core formed by necroptosis-mediating RHIM of human RIPK3\u003c/em\u003e. PNAS USA, 2021. 118(14).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRodriguez, D.A., et al., \u003cem\u003eCharacterization of RIPK3-mediated phosphorylation of the activation loop of MLKL during necroptosis\u003c/em\u003e. Cell Death Differ, 2015. 23(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSnyder, A.G., et al., \u003cem\u003eIntratumoral activation of the necroptotic pathway components RIPK1 and RIPK3 potentiates anti-tumor immunity.\u003c/em\u003e Sci Immunol, 2019. 4(36).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCapellini, F.M., et al., \u003cem\u003eCharacterization of MDCK cells and evaluation of their ability to respond to infectious and non-infectious stressors\u003c/em\u003e. Cytotechnology, 2019. 72(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHare, D.N., et al., \u003cem\u003eVirus-Intrinsic Differences and Heterogeneous IRF3 Activation Influence IFN-Independent Antiviral Protection\u003c/em\u003e. iScience, 2020. 23(12).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePreston, C.M., A.N. Harman, and M.J. Nicholl, \u003cem\u003eActivation of Interferon Response Factor-3 in Human Cells Infected with Herpes Simplex Virus Type 1 or Human Cytomegalovirus\u003c/em\u003e. J Virology, 2001. 75(19).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOrozco, S., et al., \u003cem\u003eRIPK1 both positively and negatively regulates RIPK3 oligomerization and necroptosis\u003c/em\u003e. Cell death and differentiation, 2014. 21(10): p. 1511\u0026ndash;1521.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorkenhe, S.T., et al., \u003cem\u003eDe novo necroptosis creates an inflammatory environment mediating tumor susceptibility to immune checkpoint inhibitors\u003c/em\u003e. Commun Biol, 2020. 3(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eB, S., et al., \u003cem\u003eK45A mutation of RIPK1 results in poor necroptosis and cytokine signaling in macrophages, which impacts inflammatory responses in vivo\u003c/em\u003e. Cell Death Differ, 2016. 23(10).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM, N., et al., \u003cem\u003eRIPK1 and RIPK3 Kinases Promote Cell-Death-Independent Inflammation by Toll-like Receptor 4\u003c/em\u003e. Immunity, 2016. 45(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZ, D., et al., \u003cem\u003eEvolutionary loss of inflammasomes in the Carnivora and implications for the carriage of zoonotic infections\u003c/em\u003e. Cell Rep, 2021. 36(8).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui, H. and L. Zhang, \u003cem\u003eKey Components of Inflammasome and Pyroptosis Pathways Are Deficient in Canines and Felines, Possibly Affecting Their Response to SARS-CoV-2 Infection\u003c/em\u003e. Frontiers in Immunology, 2021 Jan 28. 11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDW, Z., et al., \u003cem\u003eRIP3, an energy metabolism regulator that switches TNF-induced cell death from apoptosis to necrosis\u003c/em\u003e. Science, 2009. 325(5938).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNogusa, S., et al., \u003cem\u003eRIPK3 Activates Parallel Pathways of MLKL-Driven Necroptosis and FADD-Mediated Apoptosis to Protect against Influenza A Virus\u003c/em\u003e. Cell Host Microbe, 2016. 20(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eN, N., et al., \u003cem\u003eRIPK1 S213E mutant suppresses RIPK1-dependent cell death by preventing interactions with RIPK3 and CASP8\u003c/em\u003e. Cell Death Discov, 2025. 11(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFa, Z., et al., \u003cem\u003eRIPK3/Fas-Associated Death Domain Axis Regulates Pulmonary Immunopathology to Cryptococcal Infection Independent of Necroptosis\u003c/em\u003e. Front Immunol, 2017. 8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang, M., et al., \u003cem\u003eThe caspase-3/GSDME signal pathway as a switch between apoptosis and pyroptosis in cancer\u003c/em\u003e. Cell Death Dis, 2020. 6(1).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCristaldi, M., et al., \u003cem\u003eCaspase-8 activation by cigarette smoke induces pro-inflammatory cell death of human macrophages exposed to lipopolysaccharide\u003c/em\u003e. Cell Death Dis, 2023. 14(11).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInkol, J.M., et al., \u003cem\u003ePyroptosis activates conventional type I dendritic cells to mediate the priming of highly functional anticancer T cells\u003c/em\u003e. J Immunother Cancer, 2024. 12(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInkol, J.M., et al., \u003cem\u003ePyroptosis activates conventional type I dendritic cells to mediate the priming of highly functional anticancer T cells\u003c/em\u003e. JITC, 2024. 12(4).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVerburg, S.G., et al., \u003cem\u003eViral-mediated activation and inhibition of programmed cell death\u003c/em\u003e. PLoS Pathog, 2022. 18(8).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7489583/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7489583/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProgrammed cell death in animal species of the order Carnivora is suspected to be unique due to the potential defects in activating the lytic cell death pathways, necroptosis and pyroptosis. In a wide range of species of the order Carnivora, including domestic cats and dogs, racoons, red foxes, and ferrets, the absence of the necroptosis executioner protein MLKL (mixed-lineage kinase domain-like pseudokinase) is suspected to prohibit necroptotic lysis. It remains unclear what type(s) of cell death are activated in canine cells downstream of RIPK3 (receptor-interacting protein kinase 3). Here, we show that activation of RIPK3 by expressing it with a trimerization domain drives PANoptosis in human fibroblasts but activates apoptosis in canine epithelial cells. Expression of trimerizable canine and human RIPK3 in canine cells activated apoptotic cell death dependent on caspases, FAS-associated death domain protein (FADD), and RIPK1. Human RIPK3 in canine cells activated a rapid apoptosis compared to the canine version. Unlike canonical caspase 8 driven apoptosis, RIPK3-driven canine cell apoptosis is associated with the secretion of danger-associated molecular patterns (DAMPs) and pro-inflammatory cytokines. This is the first study defining the function of canine RIPK3 and potentially immunostimulatory, non-lytic, cell death in canine cells. This form of cell death can be further developed to ignite immunity against virus infections and cancer.\u003c/p\u003e","manuscriptTitle":"Activation of canine RIPK3 drives inflammatory apoptosis dependent on RIPK1, FADD and Caspases","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-08 02:49:29","doi":"10.21203/rs.3.rs-7489583/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1cd8a082-6bc3-438c-af85-3f6a09355dad","owner":[],"postedDate":"September 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":54059363,"name":"Biological sciences/Cell biology/Cell death/Apoptosis"},{"id":54059364,"name":"Biological sciences/Cell biology/Cell death/Necroptosis"}],"tags":[],"updatedAt":"2025-09-30T11:15:52+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-08 02:49:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7489583","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7489583","identity":"rs-7489583","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00