MTOR promotes astrocyte activation and participates in neuropathic pain through an upregulation of RIP3

MTOR promotes astrocyte activation and participates in neuropathic pain through an upregulation of RIP3 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article MTOR promotes astrocyte activation and participates in neuropathic pain through an upregulation of RIP3 Bingru Dong, Danyang Li, Shasha Song, Na He, Shouwei Yue, Sen Yin This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4636828/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Neuropathic pain (NP), a chronic pain condition, is mostly the result of astrocyte activation within the spinal cord. Here, we investigated the underlying mechanisms associated with this effect. We found that following chronic constriction injury (CCI) surgery, there was an increase of mTOR in astrocytes and an activation of astrocytes within the spinal cords. Overexpressing mTOR by intrathecal injection of TSC2-shRNA further promoted CCI-induced neuroinflammation and astrocyte activation. Knockdown of astrocytic mTOR reversed hyperalgesia and rescued the downregulation of spinal glutamate metabolism-related protein expression. Interestingly, overexpression of mTOR resulted in the RIP3 up-regulation, and pharmacological inhibition of RIP3 eliminated the mTOR-induced astrocyte activation. Mechanistically, we found that mTOR controlled the expression of RIP3 in astrocytes through ITCH-mediated ubiquitination and an autophagy-dependent degradation. Taken together, our results reveal an unanticipated link between mTOR and RIP3 in promoting astrocyte activation, providing new avenues of investigation directed toward the management and treatment of NP. Neuropathic pain Astrocyte Neuroinflammation mTOR RIP3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction A prevalent, chronic pain condition that exerts a significant impact on the quality of life is that of neuropathic pain (NP). This condition results from disorders or injuries to somatosensory nerves[ 1 ]. While the underlying pathophysiology, which includes peripheral and central sensitization, is well understood, the fundamental mechanisms behind the development of NP remain unclear[ 2 , 3 ]. Moreover, few effective treatments currently exist for the management of NP[ 2 ]. Accordingly, there exists an urgent need to identify the underlying mechanisms contributing to NP for the development of new and more effective treatments of this condition. The most common type of cells within the central nervous system are astrocytes[ 4 ], and there is increasing evidence which suggests that astrocytes are involved in the development and maintenance of neuropathic or inflammatory pain [ 4 – 6 ]. In support of this suggestion are the findings that pain sensibility is reduced when astrocyte activity within the spinal cord is inhibited [ 7 ]. Astrocytes of the A1 subtype exert a neurotoxic effect through the release of pro-inflammatory mediators, whereas the secretion of anti-inflammatory mediators by the A2 subtype has a neuroprotective effect[ 8 , 9 ]. However, the intracellular and intercellular signaling pathways involved in this astrocyte activation are not yet understood. The natural balance of neural functions can be preserved via an appropriate interaction between glial cells and neurons[ 10 ]. For example, a failure of activated astrocytes to clear the glutamate produced by neurons and other astrocytes results in an increasing degree of neuronal excitability which then produces pain[ 11 ]. Therefore, one possible pharmaceutical approach to prevent NP would be to target astrocyte activation in this pain pathway. One such target for consideration is that of mammalian target of rapamycin (mTOR). This protein plays a role in biological processes such as protein translation and gene transcription, and phosphorylates two regulators of protein synthesis, ribosomal protein S6 kinase (S6K) and recombinant eukaryotic translation initiation factor 4E binding protein 1[ 12 ]. Of particular relevance to this report are the findings from several studies indicating that mTOR plays a role in astrocyte proliferation. Notably, hyperactivation of astrocytic mTOR in the tuberous sclerosis complex increases the release of gliotransmitters and thus promotes neuronal hyperexcitability[ 13 ]. There is also evidence that the AKT/mTOR signaling pathway can control endoplasmic reticulum stress through KCa3.1 during reactive astrocyte proliferation[ 14 ]. However, whether mTOR is involved in the astrocyte activation associated with NP remains unknown. Other notable findings as related to the present study include the observation that an inhibition of mTOR alleviates demyelination and neuroinflammation in globoid cell leukodystrophy[ 15 ]. In addition, receptor-interacting protein 3 (RIP3), which is involved in the development and responses to tissue injury, antiviral immunity and many other physiological and pathologic processes[ 16 ], induces neuroinflammatory responses after perceived cellular stress [ 17 ] and accumulates in reactive astrocytes after spinal cord injury[ 18 ]. Yet, little research has been directed toward examining the involvement of RIP3 in NP. As there is evidence indicating that mTOR can regulate RIP3, as demonstrated in enterocolitis[ 19 ], we hypothesized that mTOR may induce astrocyte activation by regulating the expression of RIP3. In this study, we focused on mTOR's function in A1/A2 astrocyte transformation and central sensitization in the spinal cord of a rat model of chronic constriction injury (CCI) of the sciatic nerve. In addition, we further assessed the potential for mTOR to regulate astrocyte activation through an upregulation of RIP3. 2. Materials and Methods 2.1 Animals Adult male Wistar rats weighing 150-180g were obtained from the Laboratory Animal Center at Shandong University. All the rats were housed 3–4 per cage, had free access to food and water and were maintained under conditions with a temperature of 22 ± 2°C and a 12-hour light/dark cycle. The animals were acclimatized to these conditions for 7 days prior to use in the experiment. Strict procedures were implemented to mitigate the pain and suffering and the least number of rats needed to perform valid statistical analyses were used in each part of the study. 2.2 Materials See Supplementary Table 1. 2.3 CCI surgery After anesthetizing the rats with sodium pentobarbital (50 mg/kg body, intraperitoneal injection), the lateral portion of the sciatic nerve was exposed by bluntly dissecting the left biceps femoris muscle. At the proximal end of the trigeminal branch of the sciatic nerve, approximately 6 mm of the nerve was separated from the adherent tissue. Four surgical wires were then used to ligate the nerve at intervals of approximately 1 mm, resulting in a ligation extending 4.5 mm in length along the nerve. An identical procedure was performed in rats of the Sham group, with the exception that the sciatic nerve was not ligated. After surgery, the muscle, lumbar dorsal fascia and skin were sutured sequentially. Surgeries were performed under aseptic conditions. Rats demonstrating self-mutilation or total sensory loss following the surgery were eliminated from the experiment. 2.4 Behavioral tests For the behavioral tests, rats were placed in individual Plexiglas containers with a wire mesh at the bottom and acclimatized to this test environment for approximately 30 min as described previously[ 20 ]. With use of a mechanical pain meter (kw-CT-1, Calvin biotechnology, Nanjing, China), sufficient force was applied vertically to the middle plantar surface of the left hind foot with von Frey filaments. The demonstration of a rapid retraction or licking of the foot were considered as positive responses when assessing the paw withdrawal threshold (PWT). To assess their paw withdrawal latency (PWL), rats were positioned inside a 5-mm thick Plexiglas container. Following a 30-minute acclimatization period, radiant heat was applied through the glass to the surface of the left hindfoot using a thermal nociceptor (KW600 Calvin Biotechnology, Nanjing, China). In accordance with the method used by Hargreaves et al. to evaluate thermal nociceptive sensitization[ 21 ], the PWL was defined as the time between the application of radiant heat and the onset of a positive response as indicated by a licking or retracting of the hind paw. An automated 20-second timer was set to terminate the radiant heat if the rat did not withdraw its rear paw in order to avoid tissue damage. The experiment was replicated three times with 5-minute intervals between each test. The mean score obtained in the three tests was used for statistical analyses. To reduce experimental bias, behavioral tests were conducted under blind conditions. 2.5 Intrathecal injection Intrathecal injections into the subarachnoid space between the L4 and L5 vertebrae were administered to sedated rats using a 10-gauge needle. The precise site was confirmed by the observation of tail flicking. The mTOR inhibitor, rapamycin (RAPA, 50 µg/kg), and the RIP3 inhibitor, GSK872 (GSK, 100 µg/kg), were dissolved in DMSO and administered once daily on days 7–9 after CCI surgery. The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3 − 1 containing the GFAP-specific promoter were constructed and stored at − 80°C. Following removal from the freezer the virus solutions were dissolved by gentle shaking at 37°C and the titer of the virus solution was adjusted to 1×10 8 TU/mL with saline. Rats in each group were injected intrathecally at one week prior to CCI surgery. The negative control (NC) virus and lentiviral vector groups were injected intrathecally with 10 µl volumes for 10-30s of NC-shRNA and lentiviral solution, respectively. The needle remained in place for 5 min following the infusion and was then slowly retracted. 2.6 Cell culture and treatments Human embryonic kidney 293T cells (CRL-3216, ATCC) and the rat astrocyte cell line (CTX TNA2, Jennio Biotech) were cultivated in DMEM supplemented with 10% endotoxin-free fetal bovine serum and incubated at 37°C in 95% O 2 and 5% CO 2 . Cells were grown to 70–80% fusion prior to treatment. For the in vitro experiments, astrocytes were incubated with GSK (5 µM) for 24 h, chloroquine (CQ, 10 µM) for 18 h, SAR405 (10 µM) for 24 h or MG132 (10 µM) for 6 h, with Earle's balanced salt solution (EBSS) medium applied for 0, 6 or 12 hours to induce autophagy via amino acid starvation. 2.7 Transfection Astrocytes were grown to 20% fusion before transfection with LV-TSC2-shRNA. Lentiviral suspensions (moi = 5) were diluted with complete medium and the infection enhancement solution HiTransG P as provided by the reagent vendor was added. The cells were then incubated at 37°C and after 16 h the complete medium was replaced and the incubation continued. GFP fluorescence in cells was monitored by fluorescent microscopy (Leica, Solms, Germany) at 72 h after transfection. Puromycin (2 µg/ml) was used to screen the cells, which were then subcultured. ITCH-siRNA and NC-siRNA were transfected into astrocytes. The positive strand sequence of ITCH-siRNA was 5'-GAGCAAUGCAGCAGUUUAATT-3' and the antisense strand sequence was 3’-UUAAACUGCUGCAUUGCUCTT-5'. Furthermore, pcDNA3.1-RIP3-C-FLAG and pcDNA3.1-ITCH-C-HA were transfected into 293T cells. The lipofectamine 3000 reagent was used according to the manufacturers’ instructions. Cells were cultivated to 70–80% fusion prior to transfection. After fully combining the siRNA or plasmids with lipofectamine 3000, it remained at room temperature for 20 minutes at which time DMEM was added to the cells. The medium was changed to the complete medium 24 h after transfection, before any treatment was administered. 2.8 Co-Immunoprecipitation (Co-IP) Cell lysates were prepared using IP buffer (200:1 mixture of IP Cell lysis buffer and Phenylmethanesulfonyl fluoride). RIP3 (1 µg) and IgG (1 µl) antibodies were added to the IP samples and the mixture was incubated for 2 h on a rotator at 4°C. Each sample received 40 µL of protein A/G agarose beads, which were rotated overnight at 4°C. Samples were eluted three times with IP Cell lysis buffer. IgG was utilized as the negative control. 2.9 Western blotting The L4-L5 spinal cord tissue samples and cultured cells were homogenized in RIPA lysis buffer. Proteins were obtained by centrifugation at 12,000 rpm for 20 min at 4°C and were then applied onto a polyvinylidene fluoride membrane after being separated on a 10% SDS-PAGE gel. The following antibodies were used to incubate the membranes overnight at 4°C after they were blocked with 5% skim milk: Rabbit anti-mTOR, Rabbit anti-p-mTOR, Rabbit anti-P70S6K, Rabbit anti-p-P70S6K, Rabbit anti-RIP3, Rabbit anti-GAPDH, Rabbit anti-GS, Rabbit anti-TSC2, Mouse anti-Ub, Rabbit anti-ITCH, Rabbit anti-p62, Rabbit anti-FLAG, and Rabbit anti-HA antibody. The blots were visualized with use of an enhanced chemiluminescence system (Millipore) and Image J software (National Institutes of Health, MD, USA) was used to analyze the signal intensities. 2.10 Real-time quantitative polymerase chain reaction (RT-qPCR) RT-qPCR was used to assess gene expressions in the tissue samples or cells. With use of RNA extraction kits, total RNA was extracted from these tissue samples or cells (Fastagen Biotech, Shanghai) and cDNA was then synthesized in accordance with the guidelines provided by the manufacturer (GeneCopoeia). The pre-denaturation step was performed at 95°C for 30 s. Then, 40 cycles of 95°C for 10 s and 60°C for 30 s each comprised the PCR amplifications. Target gene expression levels in each sample were normalized using GAPDH mRNA expression, and relative mRNA levels were assessed using the comparative CT method (2-ΔΔCT). Supplementary Table 2 lists the primer sequences that were employed (Biosune, China). 2.11 Immunohistochemistry Analysis The L4-L5 spinal cord tissue samples were preserved in 4% paraformaldehyde, and then embedded and sectioned into tissue slices with a thickness of 5 µm. Slices were rehydrated in graded alcohol solutions after being deparaffinized in xylene. The primary antibody: Rabbit anti-Atf3 or Rabbit anti-TNF-α antibody, was incubated with these spinal cord slices. After incubation with a secondary antibody at 37°C for 60 min, the sections were treated in diaminobenzidine (DAB, ZSGB-BIO technology, Beijing) for 60 minutes and then counterstained with hematoxylin. The immunohistochemistry images were obtained with use of a biological microscope (Nikon, Tokyo, Japan) and Image J software was used to calculate optical densities to quantify these results. The absolute intensities, as obtained with the control group, were used to standardize each group's measurements with the Image J software. 2.12 Immunofluorescence staining For single immunofluorescent staining, the spinal cord sections were incubated with primary antibodies overnight at 4℃ consisting of Rabbit anti-RIP3 or Mouse anti-p-mTOR antibody. After washing three times in PBS, the sections were incubated with fluorescent-conjugated secondary antibody (1:200, Abbkine) for 1 h at room temperature and stained with DAPI for 5 min. Images were captured using a fluorescent microscope (Nikon) and Image J software was used to provide quantitative values for the analyses of fluorescent intensities. Absolute intensities were standardized, as based on the absolute intensity of the control group. For double-immunofluorescence, the spinal cord sections or cells were incubated with primary antibodies overnight at 4℃: Rabbit anti-p-mTOR, or Goat anti-C3d, or Rabbit anti-c-fos, or Rabbit anti-RIP3, or Rabbit anti-p62, and Mouse anti-GFAP, or Mouse anti-IBA1, or Mouse anti-NEUN, or Mouse anti-ITCH antibody. Following three PBS washes, the sections were incubated for 1 hour at room temperature with a combination of fluorescence-conjugated secondary antibodies (1:200, Abbkine) and were then were stained with DAPI for 5 min. Images were captures with use of a Nikon fluorescent microscope and ImageJ software was used to quantify results as described previously[ 22 ]. The total number of double-positive cells within a 436.18µm*327.14µm section of the spinal dorsal horn was counted and the number of double-positive cells per square millimeter was calculated. 2.13 Statistical analysis GraphPad Prism software, version 6 (GraphPad Software, San Diego, CA, USA) was used to analyze all the data, which were expressed as the means ± standard errors. An unpaired Student's t-test was used for comparisons involving two groups while a one-way analysis of variance (ANOVA) was used for comparisons involving three or more groups, with Bonferroni's test used for post-hoc pairwise comparisons following a statistically significant ANOVA. For all analyses, a P < 0.05 was required for results to be considered as statistically significant. All analyses were performed by an investigator who was blinded as to the source of the data. 3. Results 3.1 mTOR in astrocytes mediates CCI-induced NP To investigate the role of mTOR in NP, we carried out CCI surgery (Fig. 1 A). There were no statistically significant differences in PWT and PWL between the sham and CCI groups prior to surgery, however, significant decreases in PWT and PWL were obtained in the CCI versus control group from d3 to d21, with maximal differences being observed on d14 (Fig. 1 B-C). These results suggest that the CCI surgery successfully induced NP. Results from our WB showed that protein levels of p-mTOR and its substrate, p-P70S6K, were elevated in L4-L5 spinal cord tissue samples of rats in the CCI group (Fig. 1 D-F), an effect which was accompanied by increased expressions in the inflammatory factors interleukin 6 (IL-6) (Supplementary Fig. S1 A) and interleukin 1β (IL-1β) (Supplementary Fig. S1 B). To identify the types of cells expressing mTOR in the dorsal horn of the spinal cord, we co-stained p-mTOR with neuronal (NEUN), microglial (IBA1) and astrocyte (GFAP) markers. Immunofluorescent assay results revealed that p-mTOR was predominantly expressed in neurons and astrocytes and this expression of p-mTOR was elevated in astrocytes, but not neurons, after CCI (Fig. 1 G-H). These data suggest that mTOR is specifically activated in astrocytes, but not neurons, within the L4-L5 spinal cord region after CCI. 3.2 mTOR promotes neuroinflammation and astrocyte activation resulting in the A1 subtype To further characterize the role of mTOR in NP, RARA was intrathecally injected into CCI rats. Not surprisingly, RAPA markedly alleviated mechanical allodynia and thermal hyperalgesia (Fig. 2 A, B) and downregulated CCI-elevated p-mTOR, p-P70S6K, and inflammatory factors IL-6 and IL-1β (Fig. 1 D-F, Supplementary Fig. S1 A, B). In addition, as the TSC1/TSC2 protein complex represents a major negative upstream regulator of mTOR[ 24 ], we intrathecally injected TSC2-shRNA into CCI rats to achieve an overexpression of mTOR. Our immunohistochemical results showed that this intrathecal injection of TSC2-shRNA further promoted the CCI-induced upregulation of the inflammatory factors, tumor necrosis factor-α (TNF-α) and activating transcription factor 3 (Atf3) (Fig. 2 C-E)[ 25 , 26 ]. In addition, as C3d is a marker for the activation of neurotoxic responsive astrocytes (A1s)[ 27 , 28 ], we employed immunofluorescence to assess C3d/GFAP co-localization. We found that this co-localization, which was significantly increased in the CCI group, was further increased in the CCI + TSC2-shRNA group as compared with the sham group (Fig. 2 F-G). These findings imply that neuroinflammation and A1 astrocyte activation in NP may be related to mTOR. 3.3 Knockdown of astrocytic mTOR rescues the impairments of spinal glutamate clearance and the increases in excitability of dorsal horn neurons resulting from CCI To determine the molecular basis of NP induction after astrocyte activation, we intrathecally injected a GFAP promoter-containing mTOR-shRNA into rats at one week prior to CCI as an approach to specifically silence mTOR expression in the spinal astrocytes. As expected, p-p70S6K was downregulated after the intrathecal injection of mTOR-shRNA (Fig. 3 A, B), which also significantly alleviated CCI-induced NP (Fig. 3 C, D). With regard to spinal cord glutamate clearance, we found that glutamine synthetase (GS), a marker of glutamate clearance, was reduced after CCI, while silencing of mTOR partially rescued GS expression (Fig. 3 E, F). In addition, our results demonstrating that c-fos-positive neurons were increased by CCI, but significantly reduced by the knockdown of astrocytic mTOR, demonstrate that mTOR exerts a major influence upon the excitability of spinal cord dorsal horn neurons (Fig. 3 G, H). Taken together, these results suggest that reduced spinal glutamate clearance and increased excitability of dorsal horn neurons after CCI are closely associated with a mTOR-induced activation of astrocytes. 3.4 Pharmacological inhibition of RIP3 blocks the mTOR overexpression-induced activation of astrocytes Based on these results, we sought to investigate the mechanisms by which mTOR acts. RIP3, which accumulates in reactive astrocytes in response to spinal cord injury[ 18 ], has also been shown to be associated with mTOR in enterocolitis[ 19 ]. Based on these findings, we hypothesized that the neuroinflammation, as induced by an overexpression of mTOR in astrocytes, results from an upregulation of RIP3. To this end, we transfected astrocytes with TSC2-shRNA to increase mTOR expression and employed RT-qPCR, WB and fluorescent labeling to verify the effect of this viral transfection (Fig. 4 A-D). As shown in Fig. 4 E-G, RIP3 was upregulated in the TSC2-shRNA group, however, TSC2 expression was not affected after treating cells with the RIP3 inhibitor, GSK872. Results from our immunofluorescent assay substantiated these effects (Fig. 4 H-J). In addition, the increased IL-6 expression, as demonstrated with RT-qPCR, established that mTOR overexpression induces an inflammatory response in astrocytes, an effect that was reversed by GSK872 (Fig. 4 K). These data suggest that RIP3 plays an important role in mTOR-induced astrocyte activation. 3.5 RIP3 is required for mTOR-induced neuroinflammation and astrocyte activation To further investigate the role of RIP3 in neuroinflammation induced by mTOR overexpression, we examined the levels of RIP3 in rats of the CCI group. As demonstrated with WB, RIP3 expression levels were increased in the CCI group (Supplementary Fig. S2 A, B) and downregulated by RAPA (Fig. 5 A, B). We also found that after silencing TSC2 to overexpress mTOR, both p-p70S6K and RIP3 were upregulated, but GSK872 did not affect p-p70S6K expression (Fig. 5 C-F), effects which were validated as based on immunofluorescent assay results (Fig. 5 G, H). When assessing whether RIP3 inhibition affects neuroinflammation and astrocyte activation after CCI, we demonstrated that GSK872 reduced the mTOR overexpression-induced upregulation of TNF-α and Atf3 expression (Fig. 2 C-E), while increasing C3d/GFAP co-localization (Fig. 2 F-G). Together, these results demonstrate that mTOR activation induces neuroinflammation and astrocyte activation in CCI-induced NP by upregulating RIP3. 3.6 ITCH is involved in the mTOR regulation of RIP3 ubiquitinated degradation Considering the critical role of RIP3 activation in this pathway, we continued to investigate how mTOR affects RIP3 levels. Transfection of astrocytes with TSC2-shRNA resulted in an overexpression of RIP3 (Fig. 4 E, G), but did not upregulate RIP3 mRNA levels (Fig. 6 A). In addition, we observed a significant increase in RIP3 ubiquitination within WT cells, but a significant decrease in TSC2-shRNA cells (Fig. 6 B), thus suggesting that mTOR may regulate this process through E3 ubiquitin ligases. The UbiBrowser database was then used to predict E3 ligases for RIP3[ 29 , 30 ], and the top 20 E3 ligases are shown in Fig. 6 C. Although we failed to show any interaction between XIAP/PML/RAG1 and RIP3 with use of Co-IP (Supplementary Fig. S3A-C), we did find that ITCH was enriched when RIP3 was targeted by IP (Fig. 6 D), results which clearly demonstrate an interaction between ITCH and RIP3. Moreover, endogenous RIP3 and ITCH were also found to be co-localized in the cytoplasm of astrocytes (Fig. 6 E). As a means to further evaluate the regulatory role of ITCH on RIP3, astrocytes were transfected with ITCH-siRNA to knockdown ITCH (Supplementary Fig. S3D, E) and we also examined whether ITCH could function as an E3 ligase for RIP3. Ubiquitination of RIP3 was reduced upon ITCH silencing (Fig. 6 F), indicating that ITCH can act as an E3 ligase to regulate RIP3 ubiquitination degradation. As expected, the knockdown of ITCH promoted RIP3 upregulation as induced by mTOR overexpression, whereas an overexpression of mTOR interfered with ITCH-mediated RIP3 degradation, suggesting an inhibitory role of mTOR in ITCH function (Fig. 6 G-I). 3.7 The mTOR/ITCH axis regulates RIP3 ubiquitination degradation via the autophagy pathway Normally, protein degradation relies on two degradation pathways, the ubiquitin-proteasome system (UPS) and the autophagy lysosome[ 31 ]. In this series of experiments our goal was to determine which pathway mediates the ITCH-induced ubiquitination degradation of RIP3. In WT astrocytes, the autophagy inducer, EBSS (amino acid starvation), produced a rapid degradation of p62, thereby establishing that autophagy was present (Fig. 7 A, B). While these WT cells showed RIP3 degradation after amino acid starvation, no RIP3 degradation was observed in cells lacking TSC2, suggesting that autophagy triggered by amino acid starvation was ineffective in these latter cells (Fig. 7 A, C). These data demonstrate that mTOR can exert an inhibitory effect on autophagy in TSC2-shRNA cells. As demonstrated with use of CO-IP and immunofluorescence, p62 and RIP3 can form a complex (Fig. 7 D, E), which suggests that p62 plays a role in identifying ubiquitylated cargo proteins that are targeted for autophagic destruction when they are co-localize with astrocytes. When 293T cells were transfected with FLAG-RIP3 and HA-ITCH plasmids, followed by treatment with CQ (autophagosome blocker) and MG132 (proteasome blocker), we found that ITCH-mediated RIP3 degradation was disrupted by CQ, but not MG132 (Fig. 7 F), suggesting that ITCH specifically regulated RIP3 degradation via autophagy. Next, we co-cultured NC-siRNA and ITCH-siRNA cells with EBSS and the Vps34 inhibitor, SAR405, and then examined the levels of p62 and RIP3. While both cells showed comparable amounts of autophagy, the ITCH-siRNA cells showed significantly less RIP3 degradation in response to an identical exposure of amino acid starvation (Supplementary Fig. S4A-C). Moreover, SAR405 was successful in blocking the degradation of RIP3 and p62 (Supplementary Fig. S4A-C). Taken together, these findings imply that the mTOR/ITCH axis regulates ubiquitination degradation of RIP3 through the autophagy pathway. 4. Discussion In the present study, we identified a previously unreported mechanism by which mTOR activation is involved in CCI-triggered NP. Specifically, we show that mTOR activation inhibits the ITCH-driven ubiquitinated degradation of RIP3, induces reactive activation and polarization of spinal astrocytes toward the A1 subtype, triggers neuroinflammation and generates central sensitization (summarized in Fig. 8 ). These findings provide robust evidence that mTOR-driven pain may involve an astrocytic-neuronal communication pathway, thus revealing the potential for the development of novel therapeutic targets. The underlying mechanisms of NP are quite complex and involve both peripheral and central sensitization, making it refractory and unmanageable with current treatments[ 1 ]. In addition to enhancing central sensitization[ 11 ], activation of astrocytes also contributes to central nervous system (CNS) neuroinflammation[ 10 ], which in turn leads to the development and maintenance of NP[ 32 ]. It is well known that the mTOR signaling pathway is responsible for regulating transcription, translation and ribosomal biosynthesis[ 12 ], however, the mechanisms associated with its involvement in pain remain incompletely understood. Results from recent studies have shown that astrocyte activation and proliferation are mediated by mTOR[ 33 ]. In the present study, we observed that during CCI-mediated NP development, mTOR activation was mainly observed in spinal astrocytes. Moreover, a pharmacological inhibition of spinal mTOR or a specific knockdown of mTOR in astrocytes were both found to be effective in significantly alleviating nociceptive hypersensitivity. Such findings imply that astrocytic mTOR substantially contributes to CCI-induced NP. Reactive astrocytes have been reported to be categorized into two phenotypes, C3d A1 and S100A10 A2, which exert neurotoxic and neuroprotective effects, respectively[ 8 , 9 ]. Numerous signaling pathways are involved in the transformation of astrocytes from their normal state to the A1 phenotype. According to Li et al., microglial cells can produce a transformation of astrocytes to the A1 phenotype in chronic postoperative pain via controlling CXCR7/PI3K/Akt[ 34 ]. Autocrine effects may also be important in astrocyte activation, as evidenced by the fact that astrocyte activation persists significantly longer than the peak of microglial activation and, in fact, can still occur in the absence of microglia [ 5 , 35 ]. In our current study we found that the proportion of C3d-positive astrocytes was elevated in the spinal cord of rats after CCI surgery and that an overexpression of mTOR, using TSC2-shRNA, further promoted the activation of type A1 astrocytes. These findings provide compelling evidence indicating a critical role for mTOR in the activation of type A1 astrocytes. The neurotoxic capacity of A1 astrocytes has been widely discussed, but little is known about their potential function in NP[ 10 ]. It has been reported that activation of the NF-κB signaling pathway in astrocytes during CNS inflammation generates NO which, when accumulated in excess, can exert a negative impact on neurons[ 36 ]. Moreover, under conditions of chronic pain, activated astrocytes become less capable of absorbing the excessive amount of glutamate released from neurons and other astrocytes. Under normal conditions, the glutamate transporter proteins, GLT-1 and GS, are primarily responsible for mediating this uptake[ 11 ]. However, the excitotoxicity of neurons, resulting from a prevention of glutamate uptake, can induce NP[ 37 ]. In a mouse model of bone cancer pain the expression level of spinal GLT-1 steadily declined as the disease progressed[ 38 ]. Our experimental results are consistent with this finding as we observed that the expression of GS proteins in the spinal cord was significantly reduced after CCI. A reduction in these proteins may be directly responsible for the reduced pain threshold and central sensitization observed in these rats. Interestingly, a decrease of mTOR in astrocytes inhibited glutamate release within the spinal cord, which is consistent with the previously reported role of mTOR in regulating glutamate metabolism after the onset of status epilepticus[ 39 , 40 ]. In addition, pain research frequently uses c-fos, a marker of neuronal activity after injurious stimuli that is mostly expressed in the nucleus of injurious sensory neurons[ 41 ]. Our results strongly suggest that knockdown of astrocytic mTOR downregulates c-fos-positive neurons. An additional novel and significant finding resulting from this study is the revelation that the astrocytic involvement of mTOR in NP occurs via an induction of RIP3. As demonstrated in a number of studies, RIP3 is implicated in the production and maintenance of NP and inflammation and thus may represent a viable target for pain management[ 17 , 42 ]. Additional evidence indicating a relationship between RIP3 and astrocytes has been provided by Fan H et al. who reported that RIP3 accumulated and persisted in reactive astrocytes for up to 2 weeks after spinal cord injury[ 18 ]. Therefore, a clear link appears to exist among RIP3, reactive astrocytes and NP when collating these findings, but few studies have been directed toward investigating this relationship. Here, we show that RIP3 was upregulated in rats subjected to CCI surgery, while an inhibition of mTOR, as achieved with RAPA, decreased RIP3 expression. Our findings that GSK872 mitigated mechanical and thermal nociceptive hypersensitivity after CCI and that neuroinflammatory responses were also greatly enhanced are supported by the study by Liang YX et al.[ 43 ]. We also found that GSK872 functioned without affecting p-p70S6K expression, implying that mTOR is an upstream regulator of RIP3. Overall, it seems reasonable to conclude that mTOR can induce astrocyte activation and produce inflammatory factors by increasing RIP3 expression. More specifically, our findings imply that mTOR regulates RIP3 mainly at the post-transcriptional level, despite the fact that both transcriptional and post-transcriptional pathways can control RIP3 expression. In this study, with use of the UbiBrowser database[ 29 ], ITCH was identified as a candidate E3 ubiquitin ligase for RIP3. Although ITCH has been reported as an E3 ubiquitin ligase that recognizes a wide range of substrates and functions in many physiological processes[ 44 , 45 ], its role in NP and effects upon RIP3 have not been described. Here, we provide the first evidence for a link between ITCH and RIP3 in astrocytes. Knockdown of ITCH decreased the ubiquitination of RIP3 and furthermore promoted the upregulation of RIP3 by mTOR overexpression. These results suggest that ITCH acts as an E3 ligase involved in the regulation of RIP3 ubiquitination by mTOR, although the exact mechanisms underlying this relationship remain to be elucidated. Two major pathways that regulate protein degradation and interact with each other include the autophagy lysosomal pathway and UPS[ 31 , 46 ]. RIP3, as ubiquitinated by the E3 ligase CHIP, has been reported to be degraded by lysosomes[ 47 ]. Here, our results suggest that a selective autophagy may represent a novel mechanism involved with mediating RIP3 degradation. Amino acid starvation induces autophagy to promote RIP3 degradation, and conversely, RIP3 accumulation occurs upon inhibition of autophagy by an overexpression of mTOR. ITCH-mediated RIP3 degradation can be disrupted by CQ, but is not affected by MG132. Such findings, indicate that ITCH specifically regulates RIP3 degradation through autophagy. Thus, the results of our study suggest that the mTOR/ITCH axis regulates ubiquitination degradation of RIP3 through the autophagy pathway. 5. Conclusions In the present study, we demonstrate that mTOR can serve as a crucial signaling molecule involved in the activation of A1 astrocytes, neuroinflammation and central sensitization in a CCI-induced rat model of NP. We also provide compelling evidence that RIP3 represents a mandatory link enabling mTOR to trigger a cascade of events eventually leading to NP. Therefore, based on these findings, we suggest that mTOR and RIP3 can be considered as potential targets for the treatment of NP. Declarations Funding This work was supported by the Natural Science Foundation of China (82372564, 82172535). This work was also supported by the Introduce Innovative Teams of 2021 New High School 20 Items Project (2021GXRC098) and the Natural Science Foundation of Shandong Province (ZR2022QH022). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author contributions Shouwei Yue and Sen Yin designed the project and supervised all aspects of the project. Bingru Dong performed the experiments, analyzed the data, and wrote the manuscript. Danyang Li analyzed the data. Shasha Song and Na He assisted in collation of concerned literature. All authors contributed to manuscript revision, read, and approved the submitted version. Data Availability The data that support the findings of this study are available on request from the corresponding author. Ethics approval All study protocols were reviewed and approved by Laboratory Animal Ethical and Welfare Committee of Shandong University Cheeloo College of Medicine (Approval No. 23056). Consent to Participate Not applicable. Consent for publication Consent for publication was obtained from the participants. References Finnerup, N.B., R. Kuner, and T.S. Jensen, Neuropathic Pain: From Mechanisms to Treatment. Physiol Rev, 2021. 101(1): p. 259-301. DOI: 10.1152/physrev.00045.2019. Bannister, K., et al., Neuropathic Pain: Mechanism-Based Therapeutics. Annu Rev Pharmacol Toxicol, 2020. 60: p. 257-274. DOI: 10.1146/annurev-pharmtox-010818-021524. Baron, R., A. Binder, and G. Wasner, Neuropathic pain: diagnosis, pathophysiological mechanisms, and treatment. Lancet Neurol, 2010. 9(8): p. 807-19. DOI: 10.1016/S1474-4422(10)70143-5. Sommer, C., M. Leinders, and N. Üçeyler, Inflammation in the pathophysiology of neuropathic pain. Pain, 2018. 159(3): p. 595-602. DOI: 10.1097/j.pain.00000000000001122. Ji, R.R., C.R. Donnelly, and M. Nedergaard, Astrocytes in chronic pain and itch. Nat Rev Neurosci, 2019. 20(11): p. 667-685. DOI: 10.1038/s41583-019-0218-1. Zhang, Z.J., B.C. Jiang, and Y.J. Gao, Chemokines in neuron-glial cell interaction and pathogenesis of neuropathic pain. Cell Mol Life Sci, 2017. 74(18): p. 3275-3291. DOI: 10.1007/s00018-017-2513-1. Fang, Y., et al., Astrocytic phosphatase and tensin homolog deleted on chromosome 10 regulates neuropathic pain by facilitating 3-hydroxy-3-methylglutaryl-CoA reductase-dependent cholesterol biosynthesis. Pain, 2022. 163(12): p. e1192-e1206. DOI: 10.1097/j.pain.00000000000002682. Cameron, E.G., et al., A molecular switch for neuroprotective astrocyte reactivity. Nature, 2024. 626(7999): p. 574-582. DOI: 10.1038/s41586-023-06935-3. Escartin, C., et al., Reactive astrocyte nomenclature, definitions, and future directions. Nat Neurosci, 2021. 24(3): p. 312-325. DOI: 10.1038/s41593-020-00783-4. Linnerbauer, M., M.A. Wheeler, and F.J. Quintana, Astrocyte Crosstalk in CNS Inflammation. Neuron, 2020. 108(4): p. 608-622. DOI: 10.1016/j.neuron.2020.08.012. Mahmoud, S., et al., Astrocytes Maintain Glutamate Homeostasis in the CNS by Controlling the Balance between Glutamate Uptake and Release. Cells, 2019. 8(2). DOI: 10.3390/cells8020184. Inoki, K., T. Zhu, and K.L. Guan, TSC2 mediates cellular energy response to control cell growth and survival. Cell, 2003. 115(5): p. 577-90. DOI: 10.1016/s0092-8674（03）00929-2. Romagnolo, A., et al., Astroglial calcium signaling and homeostasis in tuberous sclerosis complex. Acta Neuropathol, 2024. 147(1): p. 48. DOI: 10.1007/s00401-024-02711-3. Yu, Z., et al., Ca(2+)-dependent endoplasmic reticulum stress correlation with astrogliosis involves upregulation of KCa3.1 and inhibition of AKT/mTOR signaling. J Neuroinflammation, 2018. 15(1): p. 316. DOI: 10.1186/s12974-018-1351-x. Lin, D.S., et al., Rapamycin Alleviates Protein Aggregates, Reduces Neuroinflammation, and Rescues Demyelination in Globoid Cell Leukodystrophy. Cells, 2023. 12(7). DOI: 10.3390/cells12070993. Sun, L., et al., Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell, 2012. 148(1-2): p. 213-27. DOI: 10.1016/j.cell.2011.11.031. He, N., et al., RIP3 Inhibition ameliorates chronic constriction injury-induced neuropathic pain by suppressing JNK signaling. Aging (Albany NY), 2021. 13(21): p. 24417-24431. DOI: 10.18632/aging.203691. Fan, H., et al., Reactive astrocytes undergo M1 microglia/macrohpages-induced necroptosis in spinal cord injury. Mol Neurodegener, 2016. 11: p. 14. DOI: 10.1186/s13024-016-0081-8. Xie, Y., et al., Gut epithelial TSC1/mTOR controls RIPK3-dependent necroptosis in intestinal inflammation and cancer. J Clin Invest, 2020. 130(4): p. 2111-2128. DOI: 10.1172/JCI133264. Chaplan, S.R., et al., Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods, 1994. 53(1): p. 55-63. DOI: 10.1016/0165-0270（94）90144-9. Hargreaves, K., et al., A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain, 1988. 32(1): p. 77-88. DOI: 10.1016/0304-3959（88）90026-7. Zhang, L.Q., et al., DKK3 ameliorates neuropathic pain via inhibiting ASK-1/JNK/p-38-mediated microglia polarization and neuroinflammation. J Neuroinflammation, 2022. 19(1): p. 129. DOI: 10.1186/s12974-022-02495-x. Lin CP, Traets JJH, Vredevoogd DW, Visser NL, Peeper DS. TSC2 regulates tumor susceptibility to TRAIL-mediated T-cell killing by orchestrating mTOR signaling. EMBO J. 2023 Mar 1;42(5):e111614. DOI: 10.15252/embj.2022111614. Curatolo, P., N. Specchio, and E. Aronica, Advances in the genetics and neuropathology of tuberous sclerosis complex: edging closer to targeted therapy. Lancet Neurol, 2022. 21(9): p. 843-856. DOI: 10.1016/S1474-4422（22）00213-7. Sellers, L.A., et al., Adenosine nucleotides acting at the human P2Y1 receptor stimulate mitogen-activated protein kinases and induce apoptosis. J Biol Chem, 2001. 276(19): p. 16379-90. DOI: 10.1074/jbc.M006617200. Tsujino, H., et al., Activating transcription factor 3 (ATF3) induction by axotomy in sensory and motoneurons: A novel neuronal marker of nerve injury. Mol Cell Neurosci, 2000. 15(2): p. 170-82. DOI: 10.1006/mcne.1999.0814. Liddelow, S.A., et al., Neurotoxic reactive astrocytes are induced by activated microglia. Nature, 2017. 541(7638): p. 481-487. DOI: 10.1038/nature21029. Yun, S.P., et al., Block of A1 astrocyte conversion by microglia is neuroprotective in models of Parkinson's disease. Nat Med, 2018. 24(7): p. 931-938. DOI: 10.1038/s41591-018-0051-5. Li, Y., et al., An integrated bioinformatics platform for investigating the human E3 ubiquitin ligase-substrate interaction network. Nat Commun, 2017. 8(1): p. 347. DOI: 10.1038/s41467-017-00299-9 Zhu, T., et al., Autophagy Regulates VDAC3 Ubiquitination by FBXW7 to Promote Erastin-Induced Ferroptosis in Acute Lymphoblastic Leukemia. Front Cell Dev Biol, 2021. 9: p. 740884. DOI: 10.3389/fcell.2021.740884. Sun-Wang, J.L., et al., The ubiquitin-proteasome system and autophagy: self-digestion for metabolic health. Trends Endocrinol Metab, 2021. 32(8): p. 594-608. DOI: 10.1016/j.tem.2021.04.015. Donnelly, C.R., et al., Central Nervous System Targets: Glial Cell Mechanisms in Chronic Pain. Neurotherapeutics, 2020. 17(3): p. 846-860. DOI: 10.1007/s13311-020-00905-7. Banerjee, S., et al., Neurofibromatosis-1 regulates mTOR-mediated astrocyte growth and glioma formation in a TSC/Rheb-independent manner. Proc Natl Acad Sci U S A, 2011. 108(38): p. 15996-6001. DOI: 10.1073/pnas.1019012108. Li, T., et al., Microglia induce the transformation of A1/A2 reactive astrocytes via the CXCR7/PI3K/Akt pathway in chronic post-surgical pain. J Neuroinflammation, 2020. 17(1): p. 211. DOI: 10.1186/s12974-020-01891-5. Robinson, C.R., H. Zhang, and P.M. Dougherty, Astrocytes, but not microglia, are activated in oxaliplatin and bortezomib-induced peripheral neuropathy in the rat. Neuroscience, 2014. 274: p. 308-17. DOI: 10.1016/j.neuroscience.2014.05.051. Wheeler, M.A., et al., Environmental Control of Astrocyte Pathogenic Activities in CNS Inflammation. Cell, 2019. 176(3): p. 581-596.e18. DOI: 10.1016/j.cell.2018.12.012. Tang, J., M. Bair, and G. Descalzi, Reactive Astrocytes: Critical Players in the Development of Chronic Pain. Front Psychiatry, 2021. 12: p. 682056. DOI: 10.3389/fpsyt.2021.682056. Ma, S., et al., Amitriptyline influences the mechanical withdrawal threshold in bone cancer pain rats by regulating glutamate transporter GLAST. Mol Pain, 2019. 15: p. 1744806919855834. DOI: 10.1177/1744806919855834. Wang, X., et al., Deletion of mTOR in Reactive Astrocytes Suppresses Chronic Seizures in a Mouse Model of Temporal Lobe Epilepsy. Mol Neurobiol, 2017. 54(1): p. 175-187. DOI: 10.1007/s12035-015-9590-7. Jeong, K.H., et al., Vascular endothelial growth factor receptor-3 regulates astroglial glutamate transporter-1 expression via mTOR activation in reactive astrocytes following pilocarpine-induced status epilepticus. Glia, 2021. 69(2): p. 296-309. DOI: 10.1002/glia.23897. Ma, J., et al., Photic sensitization is mediated by cortico-accumbens pathway in rats with trigeminal neuropathic pain. Prog Neurobiol, 2023. 231: p. 102533. DOI: 10.1016/j.pneurobio.2023.102533. Duan, Y., et al., Activation of the TNF-α-Necroptosis Pathway in Parvalbumin-Expressing Interneurons of the Anterior Cingulate Cortex Contributes to Neuropathic Pain. Int J Mol Sci, 2023. 24(20). DOI: 10.3390/ijms242015454. Liang, Y.X., et al., Necrostatin-1 Ameliorates Peripheral Nerve Injury-Induced Neuropathic Pain by Inhibiting the RIP1/RIP3 Pathway. Front Cell Neurosci, 2019. 13: p. 211. DOI: 10.3389/fncel.2019.00211. Mattioni, A., et al., Ring Finger Protein 11 acts on ligand-activated EGFR via the direct interaction with the UIM region of ANKRD13 protein family. Febs j, 2020. 287(16): p. 3526-3550. DOI: 10.1111/febs.15226. Upadhyay, A., et al., Selective multifaceted E3 ubiquitin ligases barricade extreme defense: Potential therapeutic targets for neurodegeneration and ageing. Ageing Res Rev, 2015. 24(Pt B): p. 138-59. DOI: 10.1016/j.arr.2015.07.009. Sun-Wang, J.L., S. Ivanova, and A. Zorzano, The dialogue between the ubiquitin-proteasome system and autophagy: Implications in ageing. Ageing Res Rev, 2020. 64: p. 101203. DOI: 10.1016/j.arr.2020.101203. Seo, J., et al., CHIP controls necroptosis through ubiquitylation- and lysosome-dependent degradation of RIPK3. Nat Cell Biol, 2016. 18(3): p. 291-302. DOI: 10.1038/ncb3314. Additional Declarations No competing interests reported. Supplementary Files file.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4636828","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":327142693,"identity":"544e8ef0-4a56-46c9-95cb-c249f70c6c3a","order_by":0,"name":"Bingru Dong","email":"","orcid":"","institution":"Qilu Hospital of Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Bingru","middleName":"","lastName":"Dong","suffix":""},{"id":327142694,"identity":"3caa6bdd-625d-450f-b28e-77a273b71e98","order_by":1,"name":"Danyang Li","email":"","orcid":"","institution":"Qilu Hospital of Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Danyang","middleName":"","lastName":"Li","suffix":""},{"id":327142695,"identity":"0efb13c8-3b57-4782-ac5b-ded9c4200737","order_by":2,"name":"Shasha Song","email":"","orcid":"","institution":"Qilu Hospital of Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Shasha","middleName":"","lastName":"Song","suffix":""},{"id":327142696,"identity":"d4356eeb-7d8c-40dc-b962-42169006e956","order_by":3,"name":"Na He","email":"","orcid":"","institution":"Qilu Hospital of Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"He","suffix":""},{"id":327142697,"identity":"e0f0a8ac-8fb3-4819-91d2-5864175a50fa","order_by":4,"name":"Shouwei Yue","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYDACCSjJz8BgAGQwk6BFsoFELUArDhCrRX528zFpngqLxM3nD2+TYKiwTmxgP3sArxaDO8fSpHnOSCRuu5FWJsFwJj2xgScvAb8WiRwz6dw2kBYeMwnGtsOJDRI8BvgdNgOk5Z9E4ub+M0At/4jQwnADpKVBInEDQw5QSwMRWgxupCVb/zkmYTzjRlqxRcKxdOM2nhxCDks+eHNGTZ1sf//hjTc+1FjL9rOfIeAwKHBsAJEJQMxGlHogsCdW4SgYBaNgFIxAAACUC0Gm5+xU4QAAAABJRU5ErkJggg==","orcid":"","institution":"Qilu Hospital of Shandong University","correspondingAuthor":true,"prefix":"","firstName":"Shouwei","middleName":"","lastName":"Yue","suffix":""},{"id":327142698,"identity":"3969b7ec-8076-41f8-b674-061d90697b6e","order_by":5,"name":"Sen Yin","email":"","orcid":"","institution":"Qilu Hospital of Shandong University","correspondingAuthor":false,"prefix":"","firstName":"Sen","middleName":"","lastName":"Yin","suffix":""}],"badges":[],"createdAt":"2024-06-25 13:33:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4636828/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4636828/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60944666,"identity":"00ddf1ec-0759-4e56-8e9f-2aa5fba26aba","added_by":"auto","created_at":"2024-07-23 22:13:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1365217,"visible":true,"origin":"","legend":"\u003cp\u003eP-mTOR is upregulated and astrocytes are activated in a CCI-induced rat model of NP. Note: (A) Protocol for generating the CCI-induced rat model of NP. (B, C) Mechanical allodynia and thermal hyperalgesia in the ipsilateral hind paw were determined by calculating the paw withdrawal threshold (PWT) and latency (PWL) on days 0, 3, 7, 11, 14 and 21 post-CCI. (D–F) Western blotting and quantification for the ratios of p-mTOR to t-mTOR and p-P70S6K to t-P70S6K in CCI rats treated with the mTOR inhibitor, rapamycin. (G, H) Double-immunofluorescence of p- mTOR (red staining) and GFAP, IBA1 and NEUN (green staining) in the spinal cord of sham and CCI rats. Histogram illustrated that p- mTOR co-localization with GFAP was increased in CCI rats. (*p \u0026lt; 0.05, n = 6 in each group)\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/5ecd31cb348beb359708543b.png"},{"id":60944667,"identity":"4edc9363-a8a6-4436-9c65-64827fff1cea","added_by":"auto","created_at":"2024-07-23 22:13:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1589344,"visible":true,"origin":"","legend":"\u003cp\u003eMTOR promotes neuroinflammation and astrocyte activation resulting in the A1 subtype, effects which were inhibited by the RIP3 inhibitor, GSK872. Note: (A, B) Mechanical allodynia and thermal hyperalgesia in the ipsilateral hind paw was determined using the PWT and PWL on days 0, 3, 7 and 14 post-CCI in rats treated with rapamycin. (C-E) TNF-α and Atf3 as assessed using immunohistochemistry in CCI rats treated with TSC2-shRNA alone or with GSK872. (F, G) Double-immunofluorescence images showing colocalization of GFAP-labeled astrocytes (green staining) and C3d-labeled A1 astrocytes (red staining) in CCI rats treated with TSC2-shRNA alone or with GSK872. (*p \u0026lt; 0.05, n = 6 in each group)\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/2622a2d5f56ca47552a62d9e.png"},{"id":60943987,"identity":"03f1d4ac-f2d2-4d2a-8d5c-bcaeef42c6fc","added_by":"auto","created_at":"2024-07-23 22:05:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":738194,"visible":true,"origin":"","legend":"\u003cp\u003eAstrocytic reduction of mTOR increases glutamate clearance and attenuates spinal dorsal horn neuron excitability induced by CCI. Note: (A, B) Western blotting and quantification of the p-P70S6K to t-P70S6K ratio in the spinal cord of CCI rats with a reduction in the expression of astrocytic mTOR. (C, D) Effect of a reduction in the expression of astrocytic mTOR on mechanical allodynia and thermal hyperalgesia as evaluated using PWT and PWL. (E, F) Spinal glutamine synthetase (GS) expressions were determined and quantified using Western blotting. (G, H) Double-immunofluorescence of c-fos (red staining) and NEUN (green staining) in each group. c-fos–positive neurons were quantified and normalized to that of the vehicle group. (*p \u0026lt; 0.05, n = 6 in each group)\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/e48df4d3b81f137db35704a4.png"},{"id":60944668,"identity":"6e403ade-2bba-4b8b-ae47-2536114f6272","added_by":"auto","created_at":"2024-07-23 22:13:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1062598,"visible":true,"origin":"","legend":"\u003cp\u003ePharmacological inhibition of RIP3 blocks the mTOR overexpression-induced astrocyte activation. Note: (A) mRNA levels of TSC2 in astrocytes before and after transfection with TSC2-shRNA. (B, C) Protein expression of TSC2 in astrocytes before and after transfection with TSC2-shRNA. (D) GFP fluorescence in astrocytes transfected with TSC2-shRNA. (E-G) Western blotting and quantification of ratios of TSC2 and RIP3 to GAPDH in astrocytes treated with TSC2-shRNA or add GSK872 (5μM) for 24h. (H-J) Immunofluorescent staining of p-mTOR and RIP3 in astrocytes treated with TSC2-shRNA or add GSK872 (5μM) for 24h. (K) mRNA levels of IL-6 in astrocytes treated with TSC2-shRNA or add GSK872 (5μM) for 24h. (*p \u0026lt; 0.05, n = 3 in each group)\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/7d44b87639fb3abd506d13a8.png"},{"id":60943990,"identity":"395c4d6c-af48-4082-ac71-166940aaf632","added_by":"auto","created_at":"2024-07-23 22:05:37","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":603083,"visible":true,"origin":"","legend":"\u003cp\u003eRIP3 is required for mTOR-induced neuroinflammation and astrocyte activation. Note: (A, B) Western blotting and quantification of the RIP3 to GAPDH ratio in CCI rats treated with the mTOR inhibitor, rapamycin. (C-F) Western blotting and quantification of the ratios of TSC2 and RIP3 to GAPDH and p-P70S6K to t-P70S6K in CCI rats treated with TSC2-shRNA or add GSK872. (G, H) Immunofluorescence of RIP3 in the lumbar spinal cords of rats. Quantities of RIP3 were determined by calculating the integral optical density. (*p \u0026lt; 0.05, n = 6 in each group)\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/dab57a046ffaa449abca6b7b.png"},{"id":60945293,"identity":"33b14103-cfd2-410a-898c-c824b04d3c18","added_by":"auto","created_at":"2024-07-23 22:21:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":494200,"visible":true,"origin":"","legend":"\u003cp\u003eMTOR modulates the ubiquitinated degradation of RIP3 via ITCH. Note: (A) mRNA levels of RIP3 in astrocytes before and after transfection with TSC2-shRNA. (B) Cell lysates from astrocytes transfected with NC-shRNA or TSC2-shRNA were immunoprecipitated with normal IgG or anti-RIP3 antibodies, then immunoblotted with their respective antibodies. (C) The top 20 E3 ligases of RIP3. (D) Prepare cell lysates and immunoprecipitate with normal IgG or anti-RIP3 antibodies. Co-IP showed the interaction of ITCH with RIP3. (E) Endogenous RIP3 (red staining) colocalized with ITCH (green staining) in WT astrocytes. (F) Lysates of cells treated with NC-siRNA or ITCH-siRNA were subjected to immunoprecipitation with normal IgG or anti-RIP3 antibodies. (G-I) Western blotting demonstrated the ITCH dependency of mTOR mediated RIP3 ubiquitination. (*p \u0026lt; 0.05, n = 3 in each group)\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/306d991296208c6f4ddb12de.png"},{"id":60943991,"identity":"dba7d77b-cc3f-4431-962d-ca763409f1c9","added_by":"auto","created_at":"2024-07-23 22:05:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":292013,"visible":true,"origin":"","legend":"\u003cp\u003eThe mTOR/ITCH axis modulates the ubiquitination and degradation of RIP3 via the autophagy pathway. Note: (A-C) RIP3 and p62 protein levels were determined using western blotting of cell lysates from NC-shRNA and TSC2-shRNA astrocytes treated with amino acid–free Earle’s balanced salt solution (EBSS) medium at the various times indicated. (D) Prepare cell lysates and immunoprecipitate with normal IgG or anti-RIP3 antibodies. (E) Endogenous p62 (red staining) colocalized with ITCH (green staining) in WT astrocytes. (F) HEK 293T cells overexpressing FLAG-RIP3 alone or with HA-ITCH were either treated or not with 10μM chloroquine (CQ, 18h) or 10μM (MG132, 6h), respectively, with cell lysates then probed with anti-RIP3. (*p \u0026lt; 0.05, n = 3 in each group)\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/61ca15f96a28cbb00f582cce.png"},{"id":60943992,"identity":"4e3c0e32-dcae-493a-b81a-e398a4d3f02c","added_by":"auto","created_at":"2024-07-23 22:05:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":195745,"visible":true,"origin":"","legend":"\u003cp\u003eA functional model demonstrating how neuropathic pain is induced by astrocytic mTOR. Note: MTOR is overactived following the loss of TSC2's negative regulation of it after chronic constriction injury, which results in the inhibition of ITCH activity and autophagy biogenesis. Due to the lack of degradation, RIP3 can be highly accumulated in the astrocytes, leading to the release of inflammatory factors. Finally, neuroinflammation induced the increased neuronal excitability and enhancement of neuropathic pain.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/3bdbd594ad3a29fd3f0bc714.png"},{"id":63518526,"identity":"cd876038-e799-46ed-8633-e661dde984ee","added_by":"auto","created_at":"2024-08-29 05:20:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7654281,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/bef114a7-0648-4c49-b418-2f00fbaafb38.pdf"},{"id":60943984,"identity":"9d833236-17e3-4fa2-a0c7-7ed2d3d6b0b6","added_by":"auto","created_at":"2024-07-23 22:05:37","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":450221,"visible":true,"origin":"","legend":"","description":"","filename":"file.docx","url":"https://assets-eu.researchsquare.com/files/rs-4636828/v1/2691f9057abd09f566ee584a.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"MTOR promotes astrocyte activation and participates in neuropathic pain through an upregulation of RIP3","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eA prevalent, chronic pain condition that exerts a significant impact on the quality of life is that of neuropathic pain (NP). This condition results from disorders or injuries to somatosensory nerves[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. While the underlying pathophysiology, which includes peripheral and central sensitization, is well understood, the fundamental mechanisms behind the development of NP remain unclear[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Moreover, few effective treatments currently exist for the management of NP[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Accordingly, there exists an urgent need to identify the underlying mechanisms contributing to NP for the development of new and more effective treatments of this condition.\u003c/p\u003e \u003cp\u003eThe most common type of cells within the central nervous system are astrocytes[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and there is increasing evidence which suggests that astrocytes are involved in the development and maintenance of neuropathic or inflammatory pain [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In support of this suggestion are the findings that pain sensibility is reduced when astrocyte activity within the spinal cord is inhibited [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Astrocytes of the A1 subtype exert a neurotoxic effect through the release of pro-inflammatory mediators, whereas the secretion of anti-inflammatory mediators by the A2 subtype has a neuroprotective effect[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, the intracellular and intercellular signaling pathways involved in this astrocyte activation are not yet understood.\u003c/p\u003e \u003cp\u003eThe natural balance of neural functions can be preserved via an appropriate interaction between glial cells and neurons[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. For example, a failure of activated astrocytes to clear the glutamate produced by neurons and other astrocytes results in an increasing degree of neuronal excitability which then produces pain[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Therefore, one possible pharmaceutical approach to prevent NP would be to target astrocyte activation in this pain pathway.\u003c/p\u003e \u003cp\u003eOne such target for consideration is that of mammalian target of rapamycin (mTOR). This protein plays a role in biological processes such as protein translation and gene transcription, and phosphorylates two regulators of protein synthesis, ribosomal protein S6 kinase (S6K) and recombinant eukaryotic translation initiation factor 4E binding protein 1[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Of particular relevance to this report are the findings from several studies indicating that mTOR plays a role in astrocyte proliferation. Notably, hyperactivation of astrocytic mTOR in the tuberous sclerosis complex increases the release of gliotransmitters and thus promotes neuronal hyperexcitability[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. There is also evidence that the AKT/mTOR signaling pathway can control endoplasmic reticulum stress through KCa3.1 during reactive astrocyte proliferation[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, whether mTOR is involved in the astrocyte activation associated with NP remains unknown. Other notable findings as related to the present study include the observation that an inhibition of mTOR alleviates demyelination and neuroinflammation in globoid cell leukodystrophy[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In addition, receptor-interacting protein 3 (RIP3), which is involved in the development and responses to tissue injury, antiviral immunity and many other physiological and pathologic processes[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], induces neuroinflammatory responses after perceived cellular stress [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and accumulates in reactive astrocytes after spinal cord injury[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Yet, little research has been directed toward examining the involvement of RIP3 in NP. As there is evidence indicating that mTOR can regulate RIP3, as demonstrated in enterocolitis[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], we hypothesized that mTOR may induce astrocyte activation by regulating the expression of RIP3.\u003c/p\u003e \u003cp\u003eIn this study, we focused on mTOR's function in A1/A2 astrocyte transformation and central sensitization in the spinal cord of a rat model of chronic constriction injury (CCI) of the sciatic nerve. In addition, we further assessed the potential for mTOR to regulate astrocyte activation through an upregulation of RIP3.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animals\u003c/h2\u003e \u003cp\u003eAdult male Wistar rats weighing 150-180g were obtained from the Laboratory Animal Center at Shandong University. All the rats were housed 3\u0026ndash;4 per cage, had free access to food and water and were maintained under conditions with a temperature of 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and a 12-hour light/dark cycle. The animals were acclimatized to these conditions for 7 days prior to use in the experiment. Strict procedures were implemented to mitigate the pain and suffering and the least number of rats needed to perform valid statistical analyses were used in each part of the study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Materials\u003c/h2\u003e \u003cp\u003eSee Supplementary Table\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 CCI surgery\u003c/h2\u003e \u003cp\u003eAfter anesthetizing the rats with sodium pentobarbital (50 mg/kg body, intraperitoneal injection), the lateral portion of the sciatic nerve was exposed by bluntly dissecting the left biceps femoris muscle. At the proximal end of the trigeminal branch of the sciatic nerve, approximately 6 mm of the nerve was separated from the adherent tissue. Four surgical wires were then used to ligate the nerve at intervals of approximately 1 mm, resulting in a ligation extending 4.5 mm in length along the nerve. An identical procedure was performed in rats of the Sham group, with the exception that the sciatic nerve was not ligated. After surgery, the muscle, lumbar dorsal fascia and skin were sutured sequentially. Surgeries were performed under aseptic conditions. Rats demonstrating self-mutilation or total sensory loss following the surgery were eliminated from the experiment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Behavioral tests\u003c/h2\u003e \u003cp\u003eFor the behavioral tests, rats were placed in individual Plexiglas containers with a wire mesh at the bottom and acclimatized to this test environment for approximately 30 min as described previously[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. With use of a mechanical pain meter (kw-CT-1, Calvin biotechnology, Nanjing, China), sufficient force was applied vertically to the middle plantar surface of the left hind foot with von Frey filaments. The demonstration of a rapid retraction or licking of the foot were considered as positive responses when assessing the paw withdrawal threshold (PWT).\u003c/p\u003e \u003cp\u003eTo assess their paw withdrawal latency (PWL), rats were positioned inside a 5-mm thick Plexiglas container. Following a 30-minute acclimatization period, radiant heat was applied through the glass to the surface of the left hindfoot using a thermal nociceptor (KW600 Calvin Biotechnology, Nanjing, China). In accordance with the method used by Hargreaves et al. to evaluate thermal nociceptive sensitization[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], the PWL was defined as the time between the application of radiant heat and the onset of a positive response as indicated by a licking or retracting of the hind paw. An automated 20-second timer was set to terminate the radiant heat if the rat did not withdraw its rear paw in order to avoid tissue damage. The experiment was replicated three times with 5-minute intervals between each test. The mean score obtained in the three tests was used for statistical analyses. To reduce experimental bias, behavioral tests were conducted under blind conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Intrathecal injection\u003c/h2\u003e \u003cp\u003eIntrathecal injections into the subarachnoid space between the L4 and L5 vertebrae were administered to sedated rats using a 10-gauge needle. The precise site was confirmed by the observation of tail flicking. The mTOR inhibitor, rapamycin (RAPA, 50 \u0026micro;g/kg), and the RIP3 inhibitor, GSK872 (GSK, 100 \u0026micro;g/kg), were dissolved in DMSO and administered once daily on days 7\u0026ndash;9 after CCI surgery. The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3\u0026thinsp;\u0026minus;\u0026thinsp;1 containing the GFAP-specific promoter were constructed and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. Following removal from the freezer the virus solutions were dissolved by gentle shaking at 37\u0026deg;C and the titer of the virus solution was adjusted to 1\u0026times;10\u003csup\u003e8\u003c/sup\u003e TU/mL with saline. Rats in each group were injected intrathecally at one week prior to CCI surgery. The negative control (NC) virus and lentiviral vector groups were injected intrathecally with 10 \u0026micro;l volumes for 10-30s of NC-shRNA and lentiviral solution, respectively. The needle remained in place for 5 min following the infusion and was then slowly retracted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Cell culture and treatments\u003c/h2\u003e \u003cp\u003eHuman embryonic kidney 293T cells (CRL-3216, ATCC) and the rat astrocyte cell line (CTX TNA2, Jennio Biotech) were cultivated in DMEM supplemented with 10% endotoxin-free fetal bovine serum and incubated at 37\u0026deg;C in 95% O\u003csub\u003e2\u003c/sub\u003e and 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells were grown to 70\u0026ndash;80% fusion prior to treatment.\u003c/p\u003e \u003cp\u003eFor the \u003cem\u003ein vitro\u003c/em\u003e experiments, astrocytes were incubated with GSK (5 \u0026micro;M) for 24 h, chloroquine (CQ, 10 \u0026micro;M) for 18 h, SAR405 (10 \u0026micro;M) for 24 h or MG132 (10 \u0026micro;M) for 6 h, with Earle's balanced salt solution (EBSS) medium applied for 0, 6 or 12 hours to induce autophagy via amino acid starvation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Transfection\u003c/h2\u003e \u003cp\u003eAstrocytes were grown to 20% fusion before transfection with LV-TSC2-shRNA. Lentiviral suspensions (moi\u0026thinsp;=\u0026thinsp;5) were diluted with complete medium and the infection enhancement solution HiTransG P as provided by the reagent vendor was added. The cells were then incubated at 37\u0026deg;C and after 16 h the complete medium was replaced and the incubation continued. GFP fluorescence in cells was monitored by fluorescent microscopy (Leica, Solms, Germany) at 72 h after transfection. Puromycin (2 \u0026micro;g/ml) was used to screen the cells, which were then subcultured.\u003c/p\u003e \u003cp\u003eITCH-siRNA and NC-siRNA were transfected into astrocytes. The positive strand sequence of ITCH-siRNA was 5'-GAGCAAUGCAGCAGUUUAATT-3' and the antisense strand sequence was 3\u0026rsquo;-UUAAACUGCUGCAUUGCUCTT-5'. Furthermore, pcDNA3.1-RIP3-C-FLAG and pcDNA3.1-ITCH-C-HA were transfected into 293T cells. The lipofectamine 3000 reagent was used according to the manufacturers\u0026rsquo; instructions. Cells were cultivated to 70\u0026ndash;80% fusion prior to transfection. After fully combining the siRNA or plasmids with lipofectamine 3000, it remained at room temperature for 20 minutes at which time DMEM was added to the cells. The medium was changed to the complete medium 24 h after transfection, before any treatment was administered.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Co-Immunoprecipitation (Co-IP)\u003c/h2\u003e \u003cp\u003eCell lysates were prepared using IP buffer (200:1 mixture of IP Cell lysis buffer and Phenylmethanesulfonyl fluoride). RIP3 (1 \u0026micro;g) and IgG (1 \u0026micro;l) antibodies were added to the IP samples and the mixture was incubated for 2 h on a rotator at 4\u0026deg;C. Each sample received 40 \u0026micro;L of protein A/G agarose beads, which were rotated overnight at 4\u0026deg;C. Samples were eluted three times with IP Cell lysis buffer. IgG was utilized as the negative control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Western blotting\u003c/h2\u003e \u003cp\u003eThe L4-L5 spinal cord tissue samples and cultured cells were homogenized in RIPA lysis buffer. Proteins were obtained by centrifugation at 12,000 rpm for 20 min at 4\u0026deg;C and were then applied onto a polyvinylidene fluoride membrane after being separated on a 10% SDS-PAGE gel. The following antibodies were used to incubate the membranes overnight at 4\u0026deg;C after they were blocked with 5% skim milk: Rabbit anti-mTOR, Rabbit anti-p-mTOR, Rabbit anti-P70S6K, Rabbit anti-p-P70S6K, Rabbit anti-RIP3, Rabbit anti-GAPDH, Rabbit anti-GS, Rabbit anti-TSC2, Mouse anti-Ub, Rabbit anti-ITCH, Rabbit anti-p62, Rabbit anti-FLAG, and Rabbit anti-HA antibody. The blots were visualized with use of an enhanced chemiluminescence system (Millipore) and Image J software (National Institutes of Health, MD, USA) was used to analyze the signal intensities.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Real-time quantitative polymerase chain reaction (RT-qPCR)\u003c/h2\u003e \u003cp\u003eRT-qPCR was used to assess gene expressions in the tissue samples or cells. With use of RNA extraction kits, total RNA was extracted from these tissue samples or cells (Fastagen Biotech, Shanghai) and cDNA was then synthesized in accordance with the guidelines provided by the manufacturer (GeneCopoeia). The pre-denaturation step was performed at 95\u0026deg;C for 30 s. Then, 40 cycles of 95\u0026deg;C for 10 s and 60\u0026deg;C for 30 s each comprised the PCR amplifications. Target gene expression levels in each sample were normalized using GAPDH mRNA expression, and relative mRNA levels were assessed using the comparative CT method (2-ΔΔCT). Supplementary Table\u0026nbsp;2 lists the primer sequences that were employed (Biosune, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Immunohistochemistry Analysis\u003c/h2\u003e \u003cp\u003eThe L4-L5 spinal cord tissue samples were preserved in 4% paraformaldehyde, and then embedded and sectioned into tissue slices with a thickness of 5 \u0026micro;m. Slices were rehydrated in graded alcohol solutions after being deparaffinized in xylene. The primary antibody: Rabbit anti-Atf3 or Rabbit anti-TNF-α antibody, was incubated with these spinal cord slices. After incubation with a secondary antibody at 37\u0026deg;C for 60 min, the sections were treated in diaminobenzidine (DAB, ZSGB-BIO technology, Beijing) for 60 minutes and then counterstained with hematoxylin. The immunohistochemistry images were obtained with use of a biological microscope (Nikon, Tokyo, Japan) and Image J software was used to calculate optical densities to quantify these results. The absolute intensities, as obtained with the control group, were used to standardize each group's measurements with the Image J software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Immunofluorescence staining\u003c/h2\u003e \u003cp\u003eFor single immunofluorescent staining, the spinal cord sections were incubated with primary antibodies overnight at 4℃ consisting of Rabbit anti-RIP3 or Mouse anti-p-mTOR antibody. After washing three times in PBS, the sections were incubated with fluorescent-conjugated secondary antibody (1:200, Abbkine) for 1 h at room temperature and stained with DAPI for 5 min. Images were captured using a fluorescent microscope (Nikon) and Image J software was used to provide quantitative values for the analyses of fluorescent intensities. Absolute intensities were standardized, as based on the absolute intensity of the control group.\u003c/p\u003e \u003cp\u003eFor double-immunofluorescence, the spinal cord sections or cells were incubated with primary antibodies overnight at 4℃: Rabbit anti-p-mTOR, or Goat anti-C3d, or Rabbit anti-c-fos, or Rabbit anti-RIP3, or Rabbit anti-p62, and Mouse anti-GFAP, or Mouse anti-IBA1, or Mouse anti-NEUN, or Mouse anti-ITCH antibody. Following three PBS washes, the sections were incubated for 1 hour at room temperature with a combination of fluorescence-conjugated secondary antibodies (1:200, Abbkine) and were then were stained with DAPI for 5 min. Images were captures with use of a Nikon fluorescent microscope and ImageJ software was used to quantify results as described previously[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The total number of double-positive cells within a 436.18\u0026micro;m*327.14\u0026micro;m section of the spinal dorsal horn was counted and the number of double-positive cells per square millimeter was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Statistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism software, version 6 (GraphPad Software, San Diego, CA, USA) was used to analyze all the data, which were expressed as the means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard errors. An unpaired Student's t-test was used for comparisons involving two groups while a one-way analysis of variance (ANOVA) was used for comparisons involving three or more groups, with Bonferroni's test used for post-hoc pairwise comparisons following a statistically significant ANOVA. For all analyses, a P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was required for results to be considered as statistically significant. All analyses were performed by an investigator who was blinded as to the source of the data.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.1 mTOR in astrocytes mediates CCI-induced NP\u003c/h2\u003e \u003cp\u003eTo investigate the role of mTOR in NP, we carried out CCI surgery (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). There were no statistically significant differences in PWT and PWL between the sham and CCI groups prior to surgery, however, significant decreases in PWT and PWL were obtained in the CCI versus control group from d3 to d21, with maximal differences being observed on d14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C). These results suggest that the CCI surgery successfully induced NP. Results from our WB showed that protein levels of p-mTOR and its substrate, p-P70S6K, were elevated in L4-L5 spinal cord tissue samples of rats in the CCI group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-F), an effect which was accompanied by increased expressions in the inflammatory factors interleukin 6 (IL-6) (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA) and interleukin 1β (IL-1β) (Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). To identify the types of cells expressing mTOR in the dorsal horn of the spinal cord, we co-stained p-mTOR with neuronal (NEUN), microglial (IBA1) and astrocyte (GFAP) markers. Immunofluorescent assay results revealed that p-mTOR was predominantly expressed in neurons and astrocytes and this expression of p-mTOR was elevated in astrocytes, but not neurons, after CCI (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG-H). These data suggest that mTOR is specifically activated in astrocytes, but not neurons, within the L4-L5 spinal cord region after CCI.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.2 mTOR promotes neuroinflammation and astrocyte activation resulting in the A1 subtype\u003c/h2\u003e \u003cp\u003eTo further characterize the role of mTOR in NP, RARA was intrathecally injected into CCI rats. Not surprisingly, RAPA markedly alleviated mechanical allodynia and thermal hyperalgesia (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B) and downregulated CCI-elevated p-mTOR, p-P70S6K, and inflammatory factors IL-6 and IL-1β (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-F, Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, B). In addition, as the TSC1/TSC2 protein complex represents a major negative upstream regulator of mTOR[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], we intrathecally injected TSC2-shRNA into CCI rats to achieve an overexpression of mTOR. Our immunohistochemical results showed that this intrathecal injection of TSC2-shRNA further promoted the CCI-induced upregulation of the inflammatory factors, tumor necrosis factor-α (TNF-α) and activating transcription factor 3 (Atf3) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E)[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In addition, as C3d is a marker for the activation of neurotoxic responsive astrocytes (A1s)[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], we employed immunofluorescence to assess C3d/GFAP co-localization. We found that this co-localization, which was significantly increased in the CCI group, was further increased in the CCI\u0026thinsp;+\u0026thinsp;TSC2-shRNA group as compared with the sham group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-G). These findings imply that neuroinflammation and A1 astrocyte activation in NP may be related to mTOR.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.3 Knockdown of astrocytic mTOR rescues the impairments of spinal glutamate clearance and the increases in excitability of dorsal horn neurons resulting from CCI\u003c/p\u003e \u003cp\u003eTo determine the molecular basis of NP induction after astrocyte activation, we intrathecally injected a GFAP promoter-containing mTOR-shRNA into rats at one week prior to CCI as an approach to specifically silence mTOR expression in the spinal astrocytes. As expected, p-p70S6K was downregulated after the intrathecal injection of mTOR-shRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B), which also significantly alleviated CCI-induced NP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D). With regard to spinal cord glutamate clearance, we found that glutamine synthetase (GS), a marker of glutamate clearance, was reduced after CCI, while silencing of mTOR partially rescued GS expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, F). In addition, our results demonstrating that c-fos-positive neurons were increased by CCI, but significantly reduced by the knockdown of astrocytic mTOR, demonstrate that mTOR exerts a major influence upon the excitability of spinal cord dorsal horn neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, H). Taken together, these results suggest that reduced spinal glutamate clearance and increased excitability of dorsal horn neurons after CCI are closely associated with a mTOR-induced activation of astrocytes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Pharmacological inhibition of RIP3 blocks the mTOR overexpression-induced activation of astrocytes\u003c/h2\u003e \u003cp\u003eBased on these results, we sought to investigate the mechanisms by which mTOR acts. RIP3, which accumulates in reactive astrocytes in response to spinal cord injury[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], has also been shown to be associated with mTOR in enterocolitis[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Based on these findings, we hypothesized that the neuroinflammation, as induced by an overexpression of mTOR in astrocytes, results from an upregulation of RIP3. To this end, we transfected astrocytes with TSC2-shRNA to increase mTOR expression and employed RT-qPCR, WB and fluorescent labeling to verify the effect of this viral transfection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-D). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-G, RIP3 was upregulated in the TSC2-shRNA group, however, TSC2 expression was not affected after treating cells with the RIP3 inhibitor, GSK872. Results from our immunofluorescent assay substantiated these effects (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-J). In addition, the increased IL-6 expression, as demonstrated with RT-qPCR, established that mTOR overexpression induces an inflammatory response in astrocytes, an effect that was reversed by GSK872 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK). These data suggest that RIP3 plays an important role in mTOR-induced astrocyte activation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 RIP3 is required for mTOR-induced neuroinflammation and astrocyte activation\u003c/h2\u003e \u003cp\u003eTo further investigate the role of RIP3 in neuroinflammation induced by mTOR overexpression, we examined the levels of RIP3 in rats of the CCI group. As demonstrated with WB, RIP3 expression levels were increased in the CCI group (Supplementary Fig. S2 A, B) and downregulated by RAPA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B). We also found that after silencing TSC2 to overexpress mTOR, both p-p70S6K and RIP3 were upregulated, but GSK872 did not affect p-p70S6K expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-F), effects which were validated as based on immunofluorescent assay results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG, H). When assessing whether RIP3 inhibition affects neuroinflammation and astrocyte activation after CCI, we demonstrated that GSK872 reduced the mTOR overexpression-induced upregulation of TNF-α and Atf3 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E), while increasing C3d/GFAP co-localization (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-G). Together, these results demonstrate that mTOR activation induces neuroinflammation and astrocyte activation in CCI-induced NP by upregulating RIP3.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6 ITCH is involved in the mTOR regulation of RIP3 ubiquitinated degradation\u003c/h2\u003e \u003cp\u003eConsidering the critical role of RIP3 activation in this pathway, we continued to investigate how mTOR affects RIP3 levels. Transfection of astrocytes with TSC2-shRNA resulted in an overexpression of RIP3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, G), but did not upregulate RIP3 mRNA levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). In addition, we observed a significant increase in RIP3 ubiquitination within WT cells, but a significant decrease in TSC2-shRNA cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), thus suggesting that mTOR may regulate this process through E3 ubiquitin ligases. The UbiBrowser database was then used to predict E3 ligases for RIP3[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], and the top 20 E3 ligases are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC. Although we failed to show any interaction between XIAP/PML/RAG1 and RIP3 with use of Co-IP (Supplementary Fig. S3A-C), we did find that ITCH was enriched when RIP3 was targeted by IP (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD), results which clearly demonstrate an interaction between ITCH and RIP3. Moreover, endogenous RIP3 and ITCH were also found to be co-localized in the cytoplasm of astrocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). As a means to further evaluate the regulatory role of ITCH on RIP3, astrocytes were transfected with ITCH-siRNA to knockdown ITCH (Supplementary Fig. S3D, E) and we also examined whether ITCH could function as an E3 ligase for RIP3. Ubiquitination of RIP3 was reduced upon ITCH silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), indicating that ITCH can act as an E3 ligase to regulate RIP3 ubiquitination degradation. As expected, the knockdown of ITCH promoted RIP3 upregulation as induced by mTOR overexpression, whereas an overexpression of mTOR interfered with ITCH-mediated RIP3 degradation, suggesting an inhibitory role of mTOR in ITCH function (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-I).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.7 The mTOR/ITCH axis regulates RIP3 ubiquitination degradation via the autophagy pathway\u003c/h2\u003e \u003cp\u003eNormally, protein degradation relies on two degradation pathways, the ubiquitin-proteasome system (UPS) and the autophagy lysosome[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In this series of experiments our goal was to determine which pathway mediates the ITCH-induced ubiquitination degradation of RIP3. In WT astrocytes, the autophagy inducer, EBSS (amino acid starvation), produced a rapid degradation of p62, thereby establishing that autophagy was present (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, B). While these WT cells showed RIP3 degradation after amino acid starvation, no RIP3 degradation was observed in cells lacking TSC2, suggesting that autophagy triggered by amino acid starvation was ineffective in these latter cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, C). These data demonstrate that mTOR can exert an inhibitory effect on autophagy in TSC2-shRNA cells. As demonstrated with use of CO-IP and immunofluorescence, p62 and RIP3 can form a complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, E), which suggests that p62 plays a role in identifying ubiquitylated cargo proteins that are targeted for autophagic destruction when they are co-localize with astrocytes. When 293T cells were transfected with FLAG-RIP3 and HA-ITCH plasmids, followed by treatment with CQ (autophagosome blocker) and MG132 (proteasome blocker), we found that ITCH-mediated RIP3 degradation was disrupted by CQ, but not MG132 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF), suggesting that ITCH specifically regulated RIP3 degradation via autophagy. Next, we co-cultured NC-siRNA and ITCH-siRNA cells with EBSS and the Vps34 inhibitor, SAR405, and then examined the levels of p62 and RIP3. While both cells showed comparable amounts of autophagy, the ITCH-siRNA cells showed significantly less RIP3 degradation in response to an identical exposure of amino acid starvation (Supplementary Fig. S4A-C). Moreover, SAR405 was successful in blocking the degradation of RIP3 and p62 (Supplementary Fig. S4A-C). Taken together, these findings imply that the mTOR/ITCH axis regulates ubiquitination degradation of RIP3 through the autophagy pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study, we identified a previously unreported mechanism by which mTOR activation is involved in CCI-triggered NP. Specifically, we show that mTOR activation inhibits the ITCH-driven ubiquitinated degradation of RIP3, induces reactive activation and polarization of spinal astrocytes toward the A1 subtype, triggers neuroinflammation and generates central sensitization (summarized in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). These findings provide robust evidence that mTOR-driven pain may involve an astrocytic-neuronal communication pathway, thus revealing the potential for the development of novel therapeutic targets.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe underlying mechanisms of NP are quite complex and involve both peripheral and central sensitization, making it refractory and unmanageable with current treatments[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In addition to enhancing central sensitization[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], activation of astrocytes also contributes to central nervous system (CNS) neuroinflammation[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], which in turn leads to the development and maintenance of NP[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. It is well known that the mTOR signaling pathway is responsible for regulating transcription, translation and ribosomal biosynthesis[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], however, the mechanisms associated with its involvement in pain remain incompletely understood. Results from recent studies have shown that astrocyte activation and proliferation are mediated by mTOR[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In the present study, we observed that during CCI-mediated NP development, mTOR activation was mainly observed in spinal astrocytes. Moreover, a pharmacological inhibition of spinal mTOR or a specific knockdown of mTOR in astrocytes were both found to be effective in significantly alleviating nociceptive hypersensitivity. Such findings imply that astrocytic mTOR substantially contributes to CCI-induced NP.\u003c/p\u003e \u003cp\u003eReactive astrocytes have been reported to be categorized into two phenotypes, C3d A1 and S100A10 A2, which exert neurotoxic and neuroprotective effects, respectively[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Numerous signaling pathways are involved in the transformation of astrocytes from their normal state to the A1 phenotype. According to Li et al., microglial cells can produce a transformation of astrocytes to the A1 phenotype in chronic postoperative pain via controlling CXCR7/PI3K/Akt[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Autocrine effects may also be important in astrocyte activation, as evidenced by the fact that astrocyte activation persists significantly longer than the peak of microglial activation and, in fact, can still occur in the absence of microglia [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In our current study we found that the proportion of C3d-positive astrocytes was elevated in the spinal cord of rats after CCI surgery and that an overexpression of mTOR, using TSC2-shRNA, further promoted the activation of type A1 astrocytes. These findings provide compelling evidence indicating a critical role for mTOR in the activation of type A1 astrocytes.\u003c/p\u003e \u003cp\u003eThe neurotoxic capacity of A1 astrocytes has been widely discussed, but little is known about their potential function in NP[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. It has been reported that activation of the NF-κB signaling pathway in astrocytes during CNS inflammation generates NO which, when accumulated in excess, can exert a negative impact on neurons[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Moreover, under conditions of chronic pain, activated astrocytes become less capable of absorbing the excessive amount of glutamate released from neurons and other astrocytes. Under normal conditions, the glutamate transporter proteins, GLT-1 and GS, are primarily responsible for mediating this uptake[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, the excitotoxicity of neurons, resulting from a prevention of glutamate uptake, can induce NP[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. In a mouse model of bone cancer pain the expression level of spinal GLT-1 steadily declined as the disease progressed[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Our experimental results are consistent with this finding as we observed that the expression of GS proteins in the spinal cord was significantly reduced after CCI. A reduction in these proteins may be directly responsible for the reduced pain threshold and central sensitization observed in these rats. Interestingly, a decrease of mTOR in astrocytes inhibited glutamate release within the spinal cord, which is consistent with the previously reported role of mTOR in regulating glutamate metabolism after the onset of status epilepticus[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In addition, pain research frequently uses c-fos, a marker of neuronal activity after injurious stimuli that is mostly expressed in the nucleus of injurious sensory neurons[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Our results strongly suggest that knockdown of astrocytic mTOR downregulates c-fos-positive neurons.\u003c/p\u003e \u003cp\u003eAn additional novel and significant finding resulting from this study is the revelation that the astrocytic involvement of mTOR in NP occurs via an induction of RIP3. As demonstrated in a number of studies, RIP3 is implicated in the production and maintenance of NP and inflammation and thus may represent a viable target for pain management[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Additional evidence indicating a relationship between RIP3 and astrocytes has been provided by Fan H et al. who reported that RIP3 accumulated and persisted in reactive astrocytes for up to 2 weeks after spinal cord injury[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, a clear link appears to exist among RIP3, reactive astrocytes and NP when collating these findings, but few studies have been directed toward investigating this relationship. Here, we show that RIP3 was upregulated in rats subjected to CCI surgery, while an inhibition of mTOR, as achieved with RAPA, decreased RIP3 expression. Our findings that GSK872 mitigated mechanical and thermal nociceptive hypersensitivity after CCI and that neuroinflammatory responses were also greatly enhanced are supported by the study by Liang YX et al.[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. We also found that GSK872 functioned without affecting p-p70S6K expression, implying that mTOR is an upstream regulator of RIP3. Overall, it seems reasonable to conclude that mTOR can induce astrocyte activation and produce inflammatory factors by increasing RIP3 expression.\u003c/p\u003e \u003cp\u003eMore specifically, our findings imply that mTOR regulates RIP3 mainly at the post-transcriptional level, despite the fact that both transcriptional and post-transcriptional pathways can control RIP3 expression. In this study, with use of the UbiBrowser database[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], ITCH was identified as a candidate E3 ubiquitin ligase for RIP3. Although ITCH has been reported as an E3 ubiquitin ligase that recognizes a wide range of substrates and functions in many physiological processes[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], its role in NP and effects upon RIP3 have not been described. Here, we provide the first evidence for a link between ITCH and RIP3 in astrocytes. Knockdown of ITCH decreased the ubiquitination of RIP3 and furthermore promoted the upregulation of RIP3 by mTOR overexpression. These results suggest that ITCH acts as an E3 ligase involved in the regulation of RIP3 ubiquitination by mTOR, although the exact mechanisms underlying this relationship remain to be elucidated. Two major pathways that regulate protein degradation and interact with each other include the autophagy lysosomal pathway and UPS[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. RIP3, as ubiquitinated by the E3 ligase CHIP, has been reported to be degraded by lysosomes[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Here, our results suggest that a selective autophagy may represent a novel mechanism involved with mediating RIP3 degradation. Amino acid starvation induces autophagy to promote RIP3 degradation, and conversely, RIP3 accumulation occurs upon inhibition of autophagy by an overexpression of mTOR. ITCH-mediated RIP3 degradation can be disrupted by CQ, but is not affected by MG132. Such findings, indicate that ITCH specifically regulates RIP3 degradation through autophagy. Thus, the results of our study suggest that the mTOR/ITCH axis regulates ubiquitination degradation of RIP3 through the autophagy pathway.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn the present study, we demonstrate that mTOR can serve as a crucial signaling molecule involved in the activation of A1 astrocytes, neuroinflammation and central sensitization in a CCI-induced rat model of NP. We also provide compelling evidence that RIP3 represents a mandatory link enabling mTOR to trigger a cascade of events eventually leading to NP. Therefore, based on these findings, we suggest that mTOR and RIP3 can be considered as potential targets for the treatment of NP.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of China (82372564, 82172535). This work was also supported by the Introduce Innovative Teams of 2021 New High School 20 Items Project (2021GXRC098) and the Natural Science Foundation of Shandong Province (ZR2022QH022).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eShouwei Yue and Sen Yin designed the project and supervised all aspects of the project. Bingru Dong performed the experiments, analyzed the data, and wrote the manuscript. Danyang Li analyzed the data. Shasha Song and Na He assisted in collation of concerned literature. All authors contributed to manuscript revision, read, and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available on request from the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll study protocols were reviewed and approved by Laboratory Animal Ethical and Welfare Committee of Shandong University Cheeloo College of Medicine (Approval No. 23056).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsent for publication was obtained from the participants.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFinnerup, N.B., R. Kuner, and T.S. Jensen, Neuropathic Pain: From Mechanisms to Treatment. Physiol Rev, 2021. 101(1): p. 259-301. DOI: 10.1152/physrev.00045.2019.\u003c/li\u003e\n\u003cli\u003eBannister, K., et al., Neuropathic Pain: Mechanism-Based Therapeutics. Annu Rev Pharmacol Toxicol, 2020. 60: p. 257-274. DOI: 10.1146/annurev-pharmtox-010818-021524.\u003c/li\u003e\n\u003cli\u003eBaron, R., A. Binder, and G. Wasner, Neuropathic pain: diagnosis, pathophysiological mechanisms, and treatment. Lancet Neurol, 2010. 9(8): p. 807-19. DOI: 10.1016/S1474-4422(10)70143-5.\u003c/li\u003e\n\u003cli\u003eSommer, C., M. Leinders, and N. \u0026Uuml;\u0026ccedil;eyler, Inflammation in the pathophysiology of neuropathic pain. Pain, 2018. 159(3): p. 595-602. DOI: 10.1097/j.pain.00000000000001122.\u003c/li\u003e\n\u003cli\u003eJi, R.R., C.R. Donnelly, and M. Nedergaard, Astrocytes in chronic pain and itch. Nat Rev Neurosci, 2019. 20(11): p. 667-685. DOI: 10.1038/s41583-019-0218-1.\u003c/li\u003e\n\u003cli\u003eZhang, Z.J., B.C. Jiang, and Y.J. Gao, Chemokines in neuron-glial cell interaction and pathogenesis of neuropathic pain. Cell Mol Life Sci, 2017. 74(18): p. 3275-3291. DOI: 10.1007/s00018-017-2513-1.\u003c/li\u003e\n\u003cli\u003eFang, Y., et al., Astrocytic phosphatase and tensin homolog deleted on chromosome 10 regulates neuropathic pain by facilitating 3-hydroxy-3-methylglutaryl-CoA reductase-dependent cholesterol biosynthesis. Pain, 2022. 163(12): p. e1192-e1206. DOI: 10.1097/j.pain.00000000000002682.\u003c/li\u003e\n\u003cli\u003eCameron, E.G., et al., A molecular switch for neuroprotective astrocyte reactivity. Nature, 2024. 626(7999): p. 574-582. DOI: 10.1038/s41586-023-06935-3.\u003c/li\u003e\n\u003cli\u003eEscartin, C., et al., Reactive astrocyte nomenclature, definitions, and future directions. Nat Neurosci, 2021. 24(3): p. 312-325. DOI: 10.1038/s41593-020-00783-4.\u003c/li\u003e\n\u003cli\u003eLinnerbauer, M., M.A. Wheeler, and F.J. Quintana, Astrocyte Crosstalk in CNS Inflammation. Neuron, 2020. 108(4): p. 608-622. DOI: 10.1016/j.neuron.2020.08.012.\u003c/li\u003e\n\u003cli\u003eMahmoud, S., et al., Astrocytes Maintain Glutamate Homeostasis in the CNS by Controlling the Balance between Glutamate Uptake and Release. Cells, 2019. 8(2). DOI: 10.3390/cells8020184.\u003c/li\u003e\n\u003cli\u003eInoki, K., T. Zhu, and K.L. Guan, TSC2 mediates cellular energy response to control cell growth and survival. Cell, 2003. 115(5): p. 577-90. DOI: 10.1016/s0092-8674（03）00929-2.\u003c/li\u003e\n\u003cli\u003eRomagnolo, A., et al., Astroglial calcium signaling and homeostasis in tuberous sclerosis complex. Acta Neuropathol, 2024. 147(1): p. 48. DOI: 10.1007/s00401-024-02711-3.\u003c/li\u003e\n\u003cli\u003eYu, Z., et al., Ca(2+)-dependent endoplasmic reticulum stress correlation with astrogliosis involves upregulation of KCa3.1 and inhibition of AKT/mTOR signaling. J Neuroinflammation, 2018. 15(1): p. 316. DOI: 10.1186/s12974-018-1351-x.\u003c/li\u003e\n\u003cli\u003eLin, D.S., et al., Rapamycin Alleviates Protein Aggregates, Reduces Neuroinflammation, and Rescues Demyelination in Globoid Cell Leukodystrophy. Cells, 2023. 12(7). DOI: 10.3390/cells12070993.\u003c/li\u003e\n\u003cli\u003eSun, L., et al., Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell, 2012. 148(1-2): p. 213-27. DOI: 10.1016/j.cell.2011.11.031.\u003c/li\u003e\n\u003cli\u003eHe, N., et al., RIP3 Inhibition ameliorates chronic constriction injury-induced neuropathic pain by suppressing JNK signaling. Aging (Albany NY), 2021. 13(21): p. 24417-24431. DOI: 10.18632/aging.203691.\u003c/li\u003e\n\u003cli\u003eFan, H., et al., Reactive astrocytes undergo M1 microglia/macrohpages-induced necroptosis in spinal cord injury. Mol Neurodegener, 2016. 11: p. 14. DOI: 10.1186/s13024-016-0081-8.\u003c/li\u003e\n\u003cli\u003eXie, Y., et al., Gut epithelial TSC1/mTOR controls RIPK3-dependent necroptosis in intestinal inflammation and cancer. J Clin Invest, 2020. 130(4): p. 2111-2128. DOI: 10.1172/JCI133264.\u003c/li\u003e\n\u003cli\u003eChaplan, S.R., et al., Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods, 1994. 53(1): p. 55-63. DOI: 10.1016/0165-0270（94）90144-9.\u003c/li\u003e\n\u003cli\u003eHargreaves, K., et al., A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain, 1988. 32(1): p. 77-88. DOI: 10.1016/0304-3959（88）90026-7.\u003c/li\u003e\n\u003cli\u003eZhang, L.Q., et al., DKK3 ameliorates neuropathic pain via inhibiting ASK-1/JNK/p-38-mediated microglia polarization and neuroinflammation. J Neuroinflammation, 2022. 19(1): p. 129. DOI: 10.1186/s12974-022-02495-x.\u003c/li\u003e\n\u003cli\u003eLin CP, Traets JJH, Vredevoogd DW, Visser NL, Peeper DS. TSC2 regulates tumor susceptibility to TRAIL-mediated T-cell killing by orchestrating mTOR signaling. EMBO J. 2023 Mar 1;42(5):e111614. DOI: 10.15252/embj.2022111614.\u003c/li\u003e\n\u003cli\u003eCuratolo, P., N. Specchio, and E. Aronica, Advances in the genetics and neuropathology of tuberous sclerosis complex: edging closer to targeted therapy. Lancet Neurol, 2022. 21(9): p. 843-856. DOI: 10.1016/S1474-4422（22）00213-7.\u003c/li\u003e\n\u003cli\u003eSellers, L.A., et al., Adenosine nucleotides acting at the human P2Y1 receptor stimulate mitogen-activated protein kinases and induce apoptosis. J Biol Chem, 2001. 276(19): p. 16379-90. DOI: 10.1074/jbc.M006617200.\u003c/li\u003e\n\u003cli\u003eTsujino, H., et al., Activating transcription factor 3 (ATF3) induction by axotomy in sensory and motoneurons: A novel neuronal marker of nerve injury. Mol Cell Neurosci, 2000. 15(2): p. 170-82. DOI: 10.1006/mcne.1999.0814.\u003c/li\u003e\n\u003cli\u003eLiddelow, S.A., et al., Neurotoxic reactive astrocytes are induced by activated microglia. Nature, 2017. 541(7638): p. 481-487. DOI: 10.1038/nature21029.\u003c/li\u003e\n\u003cli\u003eYun, S.P., et al., Block of A1 astrocyte conversion by microglia is neuroprotective in models of Parkinson\u0026apos;s disease. Nat Med, 2018. 24(7): p. 931-938. DOI: 10.1038/s41591-018-0051-5.\u003c/li\u003e\n\u003cli\u003eLi, Y., et al., An integrated bioinformatics platform for investigating the human E3 ubiquitin ligase-substrate interaction network. Nat Commun, 2017. 8(1): p. 347. DOI: 10.1038/s41467-017-00299-9\u003c/li\u003e\n\u003cli\u003eZhu, T., et al., Autophagy Regulates VDAC3 Ubiquitination by FBXW7 to Promote Erastin-Induced Ferroptosis in Acute Lymphoblastic Leukemia. Front Cell Dev Biol, 2021. 9: p. 740884. DOI: 10.3389/fcell.2021.740884.\u003c/li\u003e\n\u003cli\u003eSun-Wang, J.L., et al., The ubiquitin-proteasome system and autophagy: self-digestion for metabolic health. Trends Endocrinol Metab, 2021. 32(8): p. 594-608. DOI: 10.1016/j.tem.2021.04.015.\u003c/li\u003e\n\u003cli\u003eDonnelly, C.R., et al., Central Nervous System Targets: Glial Cell Mechanisms in Chronic Pain. Neurotherapeutics, 2020. 17(3): p. 846-860. DOI: 10.1007/s13311-020-00905-7.\u003c/li\u003e\n\u003cli\u003eBanerjee, S., et al., Neurofibromatosis-1 regulates mTOR-mediated astrocyte growth and glioma formation in a TSC/Rheb-independent manner. Proc Natl Acad Sci U S A, 2011. 108(38): p. 15996-6001. DOI: 10.1073/pnas.1019012108.\u003c/li\u003e\n\u003cli\u003eLi, T., et al., Microglia induce the transformation of A1/A2 reactive astrocytes via the CXCR7/PI3K/Akt pathway in chronic post-surgical pain. J Neuroinflammation, 2020. 17(1): p. 211. DOI: 10.1186/s12974-020-01891-5.\u003c/li\u003e\n\u003cli\u003eRobinson, C.R., H. Zhang, and P.M. Dougherty, Astrocytes, but not microglia, are activated in oxaliplatin and bortezomib-induced peripheral neuropathy in the rat. Neuroscience, 2014. 274: p. 308-17. DOI: 10.1016/j.neuroscience.2014.05.051.\u003c/li\u003e\n\u003cli\u003eWheeler, M.A., et al., Environmental Control of Astrocyte Pathogenic Activities in CNS Inflammation. Cell, 2019. 176(3): p. 581-596.e18. DOI: 10.1016/j.cell.2018.12.012.\u003c/li\u003e\n\u003cli\u003eTang, J., M. Bair, and G. Descalzi, Reactive Astrocytes: Critical Players in the Development of Chronic Pain. Front Psychiatry, 2021. 12: p. 682056. DOI: 10.3389/fpsyt.2021.682056.\u003c/li\u003e\n\u003cli\u003eMa, S., et al., Amitriptyline influences the mechanical withdrawal threshold in bone cancer pain rats by regulating glutamate transporter GLAST. Mol Pain, 2019. 15: p. 1744806919855834. DOI: 10.1177/1744806919855834.\u003c/li\u003e\n\u003cli\u003eWang, X., et al., Deletion of mTOR in Reactive Astrocytes Suppresses Chronic Seizures in a Mouse Model of Temporal Lobe Epilepsy. Mol Neurobiol, 2017. 54(1): p. 175-187. DOI: 10.1007/s12035-015-9590-7.\u003c/li\u003e\n\u003cli\u003eJeong, K.H., et al., Vascular endothelial growth factor receptor-3 regulates astroglial glutamate transporter-1 expression via mTOR activation in reactive astrocytes following pilocarpine-induced status epilepticus. Glia, 2021. 69(2): p. 296-309. DOI: 10.1002/glia.23897.\u003c/li\u003e\n\u003cli\u003eMa, J., et al., Photic sensitization is mediated by cortico-accumbens pathway in rats with trigeminal neuropathic pain. Prog Neurobiol, 2023. 231: p. 102533. DOI: 10.1016/j.pneurobio.2023.102533.\u003c/li\u003e\n\u003cli\u003eDuan, Y., et al., Activation of the TNF-\u0026alpha;-Necroptosis Pathway in Parvalbumin-Expressing Interneurons of the Anterior Cingulate Cortex Contributes to Neuropathic Pain. Int J Mol Sci, 2023. 24(20). DOI: 10.3390/ijms242015454.\u003c/li\u003e\n\u003cli\u003eLiang, Y.X., et al., Necrostatin-1 Ameliorates Peripheral Nerve Injury-Induced Neuropathic Pain by Inhibiting the RIP1/RIP3 Pathway. Front Cell Neurosci, 2019. 13: p. 211. DOI: 10.3389/fncel.2019.00211.\u003c/li\u003e\n\u003cli\u003eMattioni, A., et al., Ring Finger Protein 11 acts on ligand-activated EGFR via the direct interaction with the UIM region of ANKRD13 protein family. Febs j, 2020. 287(16): p. 3526-3550. DOI: 10.1111/febs.15226.\u003c/li\u003e\n\u003cli\u003eUpadhyay, A., et al., Selective multifaceted E3 ubiquitin ligases barricade extreme defense: Potential therapeutic targets for neurodegeneration and ageing. Ageing Res Rev, 2015. 24(Pt B): p. 138-59. DOI: 10.1016/j.arr.2015.07.009.\u003c/li\u003e\n\u003cli\u003eSun-Wang, J.L., S. Ivanova, and A. Zorzano, The dialogue between the ubiquitin-proteasome system and autophagy: Implications in ageing. Ageing Res Rev, 2020. 64: p. 101203. DOI: 10.1016/j.arr.2020.101203.\u003c/li\u003e\n\u003cli\u003eSeo, J., et al., CHIP controls necroptosis through ubiquitylation- and lysosome-dependent degradation of RIPK3. Nat Cell Biol, 2016. 18(3): p. 291-302. DOI: 10.1038/ncb3314.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Neuropathic pain, Astrocyte, Neuroinflammation, mTOR, RIP3","lastPublishedDoi":"10.21203/rs.3.rs-4636828/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4636828/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNeuropathic pain (NP), a chronic pain condition, is mostly the result of astrocyte activation within the spinal cord. Here, we investigated the underlying mechanisms associated with this effect. We found that following chronic constriction injury (CCI) surgery, there was an increase of mTOR in astrocytes and an activation of astrocytes within the spinal cords. Overexpressing mTOR by intrathecal injection of TSC2-shRNA further promoted CCI-induced neuroinflammation and astrocyte activation. Knockdown of astrocytic mTOR reversed hyperalgesia and rescued the downregulation of spinal glutamate metabolism-related protein expression. Interestingly, overexpression of mTOR resulted in the RIP3 up-regulation, and pharmacological inhibition of RIP3 eliminated the mTOR-induced astrocyte activation. Mechanistically, we found that mTOR controlled the expression of RIP3 in astrocytes through ITCH-mediated ubiquitination and an autophagy-dependent degradation. Taken together, our results reveal an unanticipated link between mTOR and RIP3 in promoting astrocyte activation, providing new avenues of investigation directed toward the management and treatment of NP.\u003c/p\u003e","manuscriptTitle":"MTOR promotes astrocyte activation and participates in neuropathic pain through an upregulation of RIP3","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-23 22:05:32","doi":"10.21203/rs.3.rs-4636828/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e737faea-41a4-4a52-b7e9-706c6ae5d166","owner":[],"postedDate":"July 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-03T04:36:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-23 22:05:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4636828","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4636828","identity":"rs-4636828","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}