Full text
51,388 characters
Ā· extracted from
preprint-html
Ā· click to expand
CDCA7 facilitates MET1-mediated CG DNA methylation maintenance in centromeric heterochromatin via histone H1 | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results CDCA7 facilitates MET1-mediated CG DNA methylation maintenance in centromeric heterochromatin via histone H1 View ORCID Profile Shuya Wang , Tong Li , Matthew Naish , Russell Chuang , Evan K. Lin , Christian Fonkalsrud , View ORCID Profile He Yan , Suhua Feng , Ian R. Henderson , Steven E. Jacobsen doi: https://doi.org/10.1101/2025.09.22.677529 Shuya Wang 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Shuya Wang Tong Li 3 Department of Plant Sciences, University of Cambridge , Cambridge, CB2 3EA, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Matthew Naish 3 Department of Plant Sciences, University of Cambridge , Cambridge, CB2 3EA, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Russell Chuang 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Evan K. Lin 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christian Fonkalsrud 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site He Yan 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for He Yan Suhua Feng 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA 4 Eli & Edythe Broad Center of Regenerative Medicine & Stem Cell Research, University of California at Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Ian R. Henderson 3 Department of Plant Sciences, University of Cambridge , Cambridge, CB2 3EA, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: jacobsen{at}ucla.edu irh25{at}cam.ac.uk Steven E. Jacobsen 1 Molecular Biology Institute, University of California Los Angeles , Los Angeles, CA 90095, USA 2 Department of Molecular, Cell and Developmental Biology, University of California Los Angeles , Los Angeles, CA 90095, USA 4 Eli & Edythe Broad Center of Regenerative Medicine & Stem Cell Research, University of California at Los Angeles , Los Angeles, CA 90095, USA 5 Howard Hughes Medical Institute, University of California Los Angeles , Los Angeles, CA 90095, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: jacobsen{at}ucla.edu irh25{at}cam.ac.uk Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract DNA methylation is a conserved epigenetic modification essential for maintaining genome stability. However, how methyltransferases maintain CG methylation within compact chromatin, including centromeres, remains unclear. In humans, CDCA7 is necessary for the inheritance of DNA methylation at juxta-centromeres. Mutations that impair its ability to bind chromatin result in Immunodeficiency, Centromeric Instability, and Facial Anomalies (ICF) syndrome, characterized by centromeric instability. To investigate whether CDCA7 function is conserved, we identified two Arabidopsis thaliana orthologs, CDCA7A and CDCA7B . The loss of both copies results in CG hypomethylation at pericentromeric regions and centromeric satellite repeat arrays. Machine learning analysis suggested that heterochromatic nucleosomes, with enrichment of H1, H2A.W, and H3K9me2 levels, depend heavily on CDCA7 proteins for CG methylation maintenance of the associated DNA. Loss of H1 restores heterochromatic DNA methylation in cdca7a cdca7b mutants, indicating that CDCA7A and CDCA7B mainly remodel H1-containing nucleosomes for methyltransferases to access DNA. Notably, in h1.1 h1.2 mutants, CG methylation shows a significant increase in centromeres, which reveals a new inhibitory role of H1 in DNA methylation maintenance within satellite repeat arrays. Centromeric DNA hypermethylation is lost in h1.1 h1.2 cdca7a cdca7b quadruple mutants, demonstrating that CDCA7A and CDCA7B can act independently of H1 to enhance MET1 activity. Overall, these findings establish CDCA7A and CDCA7B as conserved regulators of DNA methylation within heterochromatin and centromeric satellite repeat arrays. Introduction DNA methylation plays an essential role in silencing genes and transposable elements (TEs), which is indispensable for development and reproduction in mammals [ 1 - 3 ]. In Arabidopsis thaliana (hereafter Arabidopsis ), DNA methylation occurs in CG, CHG (H = A, T, or C), and CHH sequence contexts. VIM proteins recognize hemi-methylated cytosines and recruit MET1 to maintain CG methylation, while non-CG methylation is propagated by CHROMOMETHYLASE2 (CMT2) and CHROMOMETHYLASE3 (CMT3) [ 4 ]. The RNA-directed DNA methylation (RdDM) pathway de novo methylates TEs via methyltransferases DRM1 and DRM2 [ 5 ]. DNA methylation maintenance faces a significant challenge in regions with a high density of nucleosomes, particularly in heterochromatin, which restricts access to un- or hemi-methylated cytosine substrates for DNA methyltransferases [ 6 - 9 ]. To overcome this barrier, Arabidopsis DDM1 has been proposed to remodel H1-containing nucleosomes, enabling DNA methyltransferases to access pericentromeric chromatin [ 6 , 7 , 10 - 12 ]. However, the mechanism guiding DDM1 to its nucleosomal targets remains unclear. In mammals, HELLS (the homolog of DDM1) depends on CDCA7 for localization and activation [ 13 ]. CDCA7 contains an evolutionarily conserved zf-4CXXC_R1 domain that recognizes hemi-methylated CpG in the DNA major groove [ 13 - 17 ]. Simultaneously, CDCA7 can interact with HELLS and relieve its catalytic autoinhibition [ 13 ]. Current research suggests that CDCA7 recruits HELLS to satellite DNA arrays via the zf-4CXXC_R1 domain and activates HELLS to remodel nucleosomes for replication-uncoupled DNA methylation maintenance via UHRF (an ortholog of VIM) and DNMT1 (an ortholog of MET1) [ 15 ]. Mutations in the zf-4CXXC_R1 domain, or HELLS-interacting domain, of CDCA7 lead to DNA hypomethylation at juxta-centromeric satellite DNA, resulting in centromere instability and ICF syndrome [ 18 ]. Mammalian centromeres consist of megabase arrays of alpha-satellite repeats, which serve as the site for CENP-A histone loading and kinetochore formation [ 19 - 22 ]. Although the Arabidopsis genome is smaller (ā¼130 Mb) compared to the human genome (ā¼3 Gb), it also uses comparably sized megabase arrays of a 178-base pair satellite repeat ( CEN178 ) for its centromeres [ 23 - 25 ]. Centromeric and pericentromeric regions are heavily methylated at CG sites in both mammals and Arabidopsis . However, they differ in that CENP-A-occupied repeats are CG hypomethylated in mammals, whereas Arabidopsis CENH3-occupied CEN178 repeats are densely CG methylated [ 22 , 23 ]. Whether CDCA7 proteins operate through similar mechanisms to assist CG methylation maintenance in plant centromeres and other genomic regions remains unknown. Additionally, DDM1 can remodel nucleosomes independently, while HELLS requires CDCA7 binding to perform remodeling activities [ 11 , 26 ]. This indicates that Arabidopsis CDCA7 proteins may function differently from their mammalian counterparts during DNA methylation maintenance. In this study, we show that two Class I CDCA7 proteins work redundantly to maintain CG methylation in Arabidopsis centromeric satellite repeat arrays and pericentromeric regions. The DNA CG hypomethylation seen in cdca7a cdca7b mutants is less severe than in the ddm1-2 and met1 mutants, suggesting that CDCA7 partially contributes to DDM1-dependent methylation. Machine learning analysis identified nucleosome density, histone H1 enrichment, H2A.W abundance, and H3K9me2 levels as key chromatin features predicting methylation loss in the cdca7a cdca7b background, indicating that compact chromatin depends heavily on CDCA7 for CG methylation maintenance. Supporting this, histone H1 depletion restores DNA methylation in cdca7a cdca7b mutants, showing that H1 is the main barrier to VIM and MET1 access when CDCA7 proteins are absent. Therefore, in the wild-type, CDCA7A and CDCA7B act on H1-containing nucleosomes to promote the access of VIM and MET1. To determine whether CDCA7 functions independently of H1, we examined the h1.1 h1.2 mutant. We found significant centromeric CG hypermethylation, revealing an unexpected role for H1 in preventing CG methylation within the Arabidopsis centromere satellite repeat arrays. This DNA hypermethylation is abolished in h1.1 h1.2 cdca7a cdca7b quadruple mutants, indicating that CDCA7 also promotes CG methylation, even in the absence of H1. These findings highlight the conserved role of CDCA7 orthologs and demonstrate that Arabidopsis CDCA7 supports MET1 activity across a range of nucleosome contexts, including centromere satellite repeat arrays. Our results also provide genetic evidence that histone H1 regulates DNA methylation levels in centromeric satellite repeat arrays. Results CDCA7A and CDCA7B are conserved CDCA7 orthologs Mutations in three critical amino acids (R274, G294, and R304) of the CDCA7 zf-CXXC_R1 domain reduce its binding affinity to hemi-methylated CpG sites, leading to ICF syndrome [ 15 ]. Among the three classes of Arabidopsis CDCA7 proteins ( Fig. 1A ), only Class I CDCA7s ( CDCA7A and CDCA7B ) retain these residues and the cysteines required for zf-CXXC_R1 domain folding ( Fig. 1B-C ) [ 14 ]. Consistent with this conservation, CDCA7A and CDCA7B preferentially bind hemi-methylated DNA over fully methylated or unmethylated DNA in vitro , suggesting a similar selectivity in vivo [ 15 ] Download figure Open in new tab Figure 1 CDCA7A and CDCA7B are conserved CDCA7 orthologs A . Phylogenetic tree based on the conservation of zf-CXXC_R1 domains of homo sapiens CDCA7 and its Arabidopsis thaliana homologs. B . Functional domain annotations of homo sapiens CDCA7 and two Arabidopsis Class I CDCA7s. C . Sequence alignment calculated by Clustal Omega of the zf-CXXC_R1 domains of homo sapiens CDCA7 and its Arabidopsis homologs. The red asterisks indicate key residues (R274, G294, and R304) that were mutated in ICF syndrome. D . Domain annotations of HELLS and DDM1. E . CDCA7A and DDM1 interaction model predicted by AlphaFold 3. Cyan represents the putative DDM1-binding helix of CDCA7A . Blue represents CC2 of DDM1. Light pink represents the C-terminal helix of CDCA7A . Pink represents putative CDCA7 interface 2 of DDM1. Dark pink represents the ATPase domain of DDM1. Purple indicates the Helicase C term domain of DDM1. Bright pink represents the zf-CXXC_R1 domain of CDCA7A . Class I CDCA7s also share a similar protein structure with mammalian CDCA7, including an N-terminal helix analogous to the HELLS-binding helix (HLBH) ( Fig. 1B , S1A). Both HELLS and Arabidopsis DDM1 have an N-terminal coiled-coil domain (CC2), which is known in HELLS to be critical for interaction with CDCA7 ( Fig. 1D ) [ 11 , 15 ]. AlphaFold 3 (AF3) predicts that the HLBH of CDCA7A and CDCA7B directly interacts with DDM1ās CC2 through multiple types of interactions ( Fig. 1E , S1B-D , Table S1-2) [ 27 ]. Consistent with this, DDM1 lacking the CC2-containing N-terminal domain cannot complement ddm1 mutants [ 12 ], indicating that interaction with CDCA7A/B is essential for DDM1 function. In addition to the HLBH-CC2 interaction, HELLS also relies on the CDCA7-binding interface 2 (CBI2) to strengthen its association with CDCA7. By contrast, DDM1 is predicted to use its helicase domain to interact with the C-terminal helix of CDCA7A/B ( Fig. 1E ). This interaction likely compensates for the absence of CBI2, suggesting different recruitment strategies of CDCA7 proteins in plants and mammals. Overall, AF3ās structural predictions suggest that CDCA7A and CDCA7B retain key features of human CDCA7 and imply their functional conservation. CDCA7A and CDCA7B are required for the maintenance of heterochromatic DNA methylation Given the evolutionary conservation between Arabidopsis CDCA7A and CDCA7B homologs and mammalian CDCA7, we investigated their roles in DNA methylation maintenance. Using CRISPR-Cas9, we generated loss-of-function mutants for cdca7a, cdca7b, cdca7a cdca7b+/- , and cdca7a cdca7b in the Col-0 background ( Fig. S2A ) and conducted Whole-Genome Bisulfite Sequencing (WGBS) to assess genome-wide DNA methylation. Loss of CDCA7A alone results in a 2% reduction in overall CG methylation, primarily observed in heterochromatin ( Fig. 2AāE ). In comparison, knocking out CDCA7B alone causes a 6% decrease in CG methylation at pericentromeric regions ( Fig. 2A-E ), while non-CG methylation shows less than 1% difference ( Fig. 2A , Fig. S2B-C ). These findings suggest that CDCA7B , compared to CDCA7A , plays a more prominent role in supporting VIM and MET1-mediated CG methylation. Download figure Open in new tab Figure 2 CDCA7A and CDCA7B maintain heterochromatic DNA methylation A . Global DNA methylation summary of Col-0, cdca7a, cdca7b, cdca7a cdca7b +/-, cdca7a cdca7b , and ddm1-2 . B . Genome-wide CG methylation landscape of Col-0, cdca7a, cdca7b, cdca7a cdca7b+/-, cdca7a cdca7b , and ddm1-2 . Metaplots showing the CG methylation level at C . heterochromatin TEs, D . RdDM targeted TEs, and E . GbM across samples. F . Spearman and Kendall correlation coefficients between epigenetic features and CG methylation changes in the cdca7a cdca7b mutant compared to wild type. G . Prediction accuracy of generalized boosted regression model. H . Rank of the importance of epigenetic features via the generalized boosted regression model. I . The rank of the importance of epigenetic features, derived by shuffling each feature and measuring the reduction in performance. Since CDCA7A and CDCA7B may be genetically redundant, we knocked out one CDCA7B allele in the cdca7a mutant background. Lacking one CDCA7B copy enhanced the cdc7a CG hypomethylation phenotype ( Fig. 2A-E ), while complete knockout of both CDCA7A and CDCA7B caused severe CG methylation loss at heterochromatic TEs (50% loss), compared to RdDM-targeted TEs (30% loss), and gene-body methylated (GbM) genes (10% loss). This reveals a genetic redundancy and a dosage-dependent role for CDCA7B . In contrast, CHG and CHH methylation decreased only slightly at heterochromatin (less than 10% loss) ( Fig. S2B-C ). Notably, cdca7a cdca7b mutants retained approximately 55% of wild-type pericentromeric CG methylation, which is much higher than the 10% in ddm1-2 mutants and the 2% (near-complete loss) in met1 mutants ( Fig. 2BāE ) [ 28 ]. Therefore, unlike CDCA7 in mammals, CDCA7A and CDCA7B are only partially required for DDM1 function in vivo . DDM1 may either remodel nucleosomes independently of CDCA7A/B or depend on additional methylation readers for recruitment and activity. To further analyze the genome-wide patterns of DNA CG hypomethylation in cdca7a cdca7b mutants, we mapped hypo-methylated differentially methylated regions (hypoDMRs). These regions were mainly enriched in pericentromeric chromatin, which is characterized by high nucleosome density, H2A.W histone variants, H3K9me2 marks, and linker histone H1 ( Fig. S2D-E ). Supporting this, heterochromatic nucleosomes show about 27% CG methylation loss, while genic nucleosomes only exhibit a 3% reduction in cdca7a cdca7b ( Fig. S2F-G ). This suggests that heterochromatic nucleosomes preferentially depend on CDCA7A and CDCA7B for CG methylation maintenance. To identify epigenetic features that predict CG methylation loss, we combined correlation analysis, machine learning, and feature importance ranking. Spearman and Kendall correlation coefficients showed strong links between cdca7a cdc7b CG hypomethylation and the heterochromatic features H2A.W, H1, and H3K9me2 ( Fig. 2F , S2H ). Conversely, transcription-activating marks like H3AC and H2Aub, along with ATAC-seq signals (indicating open chromatin) in wild-type, were associated with increased CG methylation in cdca7a cdca7b mutants ( Fig. S2E, S2H ). This increase in CG DNA methylation occurs at open chromatin regions, consistent with the redistribution of VIMs and MET1 to more accessible euchromatin when heterochromatin access is restricted due to the loss of CDCA7A and CDCA7B . Using a generalized boosted regression model to predict CG methylation loss in cdca7 cdca7b , we achieved an R 2 value of 0.609 and a mean absolute error of ā¼0.3 ( Fig. 2G ). Among all features, H3K9me2, H2A.W, and nucleosome density (MNase-seq signal) emerged as the top predictors of CG hypomethylation in cdca7 cdca7b ( Fig. 2H ). To account for multicollinearity among features, we employed a permutation-based approach, shuffling individual features and quantifying their impact on model performance. Nucleosome density (MNase-seq) was the most critical predictor, followed by H3K9me2, H2A.W, and H1 enrichment ( Fig. 2I ). These findings demonstrate that CDCA7A and CDCA7B preferentially target heterochromatic nucleosomes marked by H3K9me2, H2A.W, and H1 for CG methylation maintenance. The interplay of these features underscores the chromatin context dependency of CDCA7A/B mediated CG methylation. CDCA7A and CDCA7B facilitate methyltransferase activity at H1-containing nucleosomes DDM1 is essential for CG DNA methylation activity in H1-containing chromatin [ 6 , 7 ]. To determine whether CDCA7A/B facilitates DNA methyltransferase activity at H1-containing nucleosomes, we generated h1.1 h1.2 cdca7a cdca7b quadruple mutants ( Fig. S3A ), and compared CG methylation levels to those in cdca7a cdca7b mutants. Genome-wide CG hypomethylation in the cdca7a cdca7b mutants was largely restored in the quadruple mutants, with DNA methylation levels nearly returning to wild-type at heterochromatic TEs, RdDM-targeted TEs, and GbM genes ( Fig. 3AāF ). These findings support that CDCA7A/B and DDM1 operate in the same pathway for DNA methylation maintenance, with one role being to counteract the repression of methylation caused by histone H1 enrichment. Download figure Open in new tab Figure 3 CDCA7A and CDCA7B facilitate methyltransferases to access H1-containing nucleosomes A . Global DNA methylation summary of Col-0, h1.1 h1.2, cdca7a cdca7b, h1.1 h1.2 cdca7a cdca7b , and ddm1-2 . B . Genome browser example showing CG methylation levels at the representative locus in Col-0, cdca7a cdca7b, h1.1 h1.2, h1.1 h1.2 cdca7a cdca7b , and ddm1-2 . C . Genome-wide CG methylation landscape of Col-0, h1.1 h1.2, cdca7a cdca7b, h1.1 h1.2 cdca7a cdca7b , and ddm1-2 . Metaplots showing the CG methylation level at D . heterochromatin TEs, E . RdDM targeted TEs, and F . GbM across samples. G . Normalized expression of genes proximal to the cdca7a cdca7b hypoDMR sites. The bottom bar plot shows the ten deciles clustered by wild-type expression level. Total number of differentially expressed H . genes, and I . TEs in h1.1 h1.2, cdca7a cdca7b , and h1.1 h1.2 cdca7a cdca7b . Log2 fold changes of expression of upregulated J . genes, and K . TEs in the cdca7a cdca7b mutant. We found that a subset of hypoDMRs, located at heterochromatin-euchromatin boundaries, remained DNA hypomethylated in h1.1 h1.2 cdca7a cdca7b mutants ( Fig. S3B ). These regions showed lower nucleosome density, reduced chromatin accessibility, and depletion of repressive histone marks ( Fig. S3C-F ), indicating that CDCA7A and CDCA7B target inaccessible heterochromatin edges. We also found that MORC proteins, ATP-dependent enzymes that compact and silence chromatin (Moissiard, 2012 #58), preferentially target regions that remain hypomethylated in h1.1 h1.2 cdca7a cdca7b mutants ( Fig. S3G ). Therefore, outside of H1-enriched nucleosomes, CDCA7A and CDCA7B may assist VIM-MET1 activity to overcome MORC-mediated chromatin compaction. CG hypomethylation at cdca7a cdca7b hypoDMRs triggered mRNA upregulation of proximal genes (within 100 bp), especially those with low baseline expression in wild type ( Fig. 3G ). Notably, H1 depletion restored the expression of most cdca7a cdca7b upregulated genes to near-wild type levels ( Fig. 3G ). Beyond the genes proximal to cdca7a cdca7b hypoDMRs, genome-wide, cdca7a cdca7b mutants activated approximately 450 genes, with most (85%) becoming transcriptionally silent in h1.1 h1.2 cdca7a cdca7b ( Fig. 3H ). Additionally, about 55 TEs became significantly activated in cdca7a cdca7b ( Fig. 3I ). A subset of the cdca7a cdca7b activated TEs became downregulated by H1 loss, while TEs close to the remaining h1.1 h1.2 cdca7a cdca7b hypoDMRs remained upregulated compared to wild type ( Fig. 3I , Fig. S3H ). When examining the extent of gene and TE transcript upregulation, the loss of H1 significantly reduced the degree of upregulation at activated genes, and also partially at activated TEs ( Fig. 3J-K ), consistent with the degree of DNA methylation rescue. These findings demonstrate that CDCA7A and CDCA7B mainly operate in H1-enriched heterochromatin to preserve DNA methylation and enforce transcriptional silencing. Their ability to act at heterochromatin boundaries, independent of H1, also highlights a context-specific role. CDCA7A and CDCA7B promote DNA methylation at centromeres Since ICF syndrome-associated cdca7 mutations cause DNA hypomethylation at human centromere alpha-satellite repeats [ 15 ], we hypothesized that Arabidopsis CDCA7A and CDCA7B might similarly regulate repetitive regions, including centromeric CEN178 satellite repeats. To test this, we analyzed DNA methylation at centromeric regions using the Col-CEN-v1.2 genome assembly [ 16 ], which fully resolves centromeric sequences. Loss of CDCA7A and CDCA7B resulted in approximately a 50% reduction in CG methylation at satellite repeats, while non-CG methylation was only modestly affected (15%) ( Fig. 4A , Fig. S4A-B ). Within the CEN178 repeat arrays, not only was CG methylation substantially reduced, but its distribution also shifted toward linker DNA regions ( Fig. 4B-D ). This pattern suggests that CDCA7A and CDCA7B are required for proper methylation distribution at CENH3-containing nucleosomes. Supporting this, the decrease in CG methylation was more pronounced at CEN178 repeats with higher CENH3 enrichment ( Fig. 4E-F ). Download figure Open in new tab Figure 4 CDCA7A and CDCA7B promote CG methylation establishment at centromeres independently of H1 A . Global CG methylation summary of Col-0, h1.1 h1.2, cdca7a cdca7b, h1.1 h1.2 cdca7a cdca7b , and ddm1-2 , using Col-Cen-v1.2 as the reference genome. B . Metaplot showing the CG methylation level at CEN178 satellite repeats in Col-0. C. Metaplot showing the normalized wild type CENH3 enrichment at the CEN178 satellite repeats. D . Metaplot showing the CG methylation level at CEN178 satellite repeats in the cdca7a cdca7b mutant. Violin plots showing the CG methylation level at CEN178 satellite repeats with and without CENH3 enrichment in E . Col-0, and F . cdca7a cdca7b . Metaplots showing the CG methylation level at CEN178 satellite repeats in G . h1.1 h1.2 and H . h1.1 h1.2 cdca7a cdca7 . Violin plots showing the CG methylation level at CEN178 satellite repeats with and without CENH3 enrichment in I . h1.1 h1.2 , and J . h1.1 h1.2 cdca7a cdca7b mutants. We next assessed whether H1 depletion in the cdca7a cdca7b mutant background could similarly restore DNA methylation loss, as we previously observed in the chromosome arms and pericentromeres. Compared to cdca7a cdca7b mutants, h1.1 h1.2 cdca7a cdca7b quadruple mutants gained CG methylation within the CEN178 satellite arrays, but only partially (60% versus 80% in wild-type), indicating that CDCA7A and CDCA7B function beyond H1 in the centromeres ( Fig. 4A ). This aligns with the incomplete rescue of DNA methylation at heterochromatin boundaries seen in h1.1 h1.2 cdca7a cdca7b mutants ( Fig. S3B ). To directly examine the role of CDCA7A and CDCA7B in centromeric CG methylation without H1, we compared h1.1 h1.2 and h1.1 h1.2 cdca7a cdca7b mutants. Strikingly and unexpectedly, CG methylation, and to a lesser extent, non-CG methylation, increased significantly with H1 loss ( Fig. 4A , S4A-B ). At CEN178 satellite arrays, CG methylation approaches nearly 100% in h1.1 h1.2 , indicating that H1 acts as a barrier to DNA methylation in Arabidopsis centromeres ( Fig. 4A-C, 4G ). In the h1.1 h1.2 mutants, CG methylation was primarily gained in the centers of CEN178 repeats, which are typically enriched for CENH3 ( Fig. 4B-C, 4G ). This CG hypermethylation in the middle of the CEN178 repeats was lost in the h1.1 h1.2 cdca7a cdca7b mutants ( Fig. 4C, 4G-H ). Consistently, the CG methylation decrease in the quadruple mutant was more pronounced within CENH3-enriched CEN178 repeats, further emphasizing the role of CDCA7A and CDCA7B in maintaining DNA methylation at centromeric nucleosomes ( Fig. 4I-J ). However, the increase in CHG and CHH DNA methylation in h1.1 h1.2 was unaffected by the loss of CDCA7A and CDCA7B ( Fig. S4A-F ), indicating that they specifically promote VIM and MET-mediated CG methylation. We propose that the depletion of histone H1 broadly decompacts heterochromatin, allowing increased access for CDCA7A and CDCA7B to the centromeres thereby promoting CG hypermethylation by VIM and MET1 through a replication-uncoupled mechanism, to compensate for imperfect replication-coupled maintenance [ 15 , 18 ]. However, the mechanism by which CDCA7A and CDCA7B are recruited to centromeres remains unclear. One possibility is that the conserved zf-CXXC_R1 domain in CDCA7A and CDCA7B recognizes non-B DNA structures in centromeric satellites, as shown in vitro [ 17 ]. Alternatively, CDCA7A and CDCA7B might directly recognize satellite repeats CEN178 , or associated centromeric chromatin marks, diverging from the binding preferences seen in mammalian CDCA7. Discussion This work indicates that CDCA7A and CDCA7B , the Arabidopsis counterparts of mammalian CDCA7, interact with DDM1 to help maintain CG methylation. We propose that CDCA7A and CDCA7B promote VIM and MET1 access to tightly packed heterochromatin by remodeling H1-containing nucleosomes at pericentromeric regions. This idea is supported by the rescue of pericentromeric DNA hypomethylation in cdca7a cdca7b mutants when H1 is lost in h1.1 h1.2 cdca7a cdca7b quadruple mutants. We also discovered a role for CDCA7A and CDCA7B in promoting centromeric CG methylation in the absence of H1. We suggest that CDCA7A and CDCA7B remodel CENH3-containing nucleosomes and provide better access to methyltransferases, including but not limited to VIM and MET1. Importantly, our study reveals a novel role for H1 in preventing DNA methylation at centromeric chromatin. Since the loss of H1 results in nearly saturated CG methylation at satellite repeats, primarily due to CDCA7A and CDCA7B activity, we suggest that H1-bound hemi-methylated nucleosomes are common features of Arabidopsis centromeres. H1 depletion then allows DNA methylation maintenance through the CDCA7 pathway. This discovery provides insight into the mechanism behind the low DNA methylation levels at mammalian centromeres, with a high abundance of linker histone H1 likely restricting centromeric DNA methylation. CDCA7A and CDCA7B may directly recognize centromeric DNA motifs to facilitate methylation establishment and maintenance in these regions. The conserved zf-CXXC_R1 domain of CDCA7A and CDCA7B can bind both canonical and non-B DNA structures [ 17 ], but its exact targeting preferences remain unknown. Future studies combining in vitro binding assays and in vivo mutagenesis will clarify whether centromeric repeats or structural features determine CDCA7A/CDCA7B localization. While cdca7a cdca7b mutants show DNA hypomethylation, the extent of reduction is less than in ddm1-2 and met1 mutants. This difference in phenotypic severity suggests two possibilities: (1) Arabidopsis Class II/III CDCA7 homologs might partially compensate for CDCA7A and CDCA7B in recruiting DDM1, or (2) DDM1 can still partially localize to heterochromatin without CDCA7 proteins. Further research into DDM1 recruitment mechanisms is needed to clarify this. These findings underscore the conserved function of CDCA7 proteins in linking chromatin remodelers and methyltransferases across different species, while also revealing plant-specific changes in centromere regulation. By clarifying how CDCA7A/CDCA7B control H1-dependent and H1-independent methylation, this work enhances our understanding of heterochromatin and DNA methylation dynamics. Methods and Materials Phylogenetic Analysis Highly conserved zf-CXXC_R1 domain sequences of Arabidopsis Class I (CDCA7A and CDCA7B), Class II (AT1G67270, AT1G67780, and AT5G38690), Class III (AT1G09060, AT1G11950, and AT3G07610) CDCA7 and human CDCA7 were taken for phylogenetic analysis. All the sequences were listed in Figure 1C . Protein sequence alignments were performed using Clustal Omega. A graphic representation of the phylogenetic tree was generated using Jalview. AlphaFold prediction Full-length proteins of CDCA7A/B and DDM1 are taken for AlphaFold3 prediction [ 27 ]. For each prediction, the best model was selected for further structural analysis. A cutoff distance of 5 Ć
was applied. The protein structures were visualized using Pymol. Plant materials and growth conditions All plants used in this paper were Arabidopsis thaliana Col-0 ecotype and were grown under long-day conditions (16 h light and 8 h dark). Seedlings of the Col-0, cdca7a, cdca7b, cdca7a cdca7b+/-, cdca7a cdca7b, h1.1 h1.2, h1.1 h1.2 cdca7a cdca7b , and ddm1-2 were harvested after 14-day incubation under long-day conditions. The T-DNA insertion lines used in this study are listed here: h1.1 (SALK_128430C), and h1.2 (GABI_406H11_012502). ddm1-2 contains a splice donor site mutation. CRISPR mutants were generated using the pBEE401E CRISPR system [ 29 ]. CDCA7A CRISPR mutant was generated using two combinations of guides: GGGGTTTCTTTGATTAGTTC and TTGGGAATACAGAAAGAAGC or CAAAGGTCTCTCTTTACGAA and ATCCCATCAGTGTAGATAAC. CDCA7B CRISPR mutant was generated using two combinations of guides: TTCGCTCTCGTTCTCACCAC and AAGGCCAGAGATTTACACTG or GAGTTTCCTCCTCCGACTGT and GGTTCCTCTGCGTAGGAAAC. WGBS 14-day old seedlings were harvested from Col-0, cdca7a, cdca7b, cdca7a cdca7b+/-, cdca7a cdca7b, h1.1 h1.2, h1.1 h1.2 cdca7a cdca7b , and ddm1-2 . Samples were immediately frozen in liquid nitrogen. DNA was extracted using the DNeasy Plant Mini kit (Qiagen). A total of 100ng DNA was sheared to ā¼200bp using the Covaris S2 (Covaris). Then the libraries were constructed using the Ovation Ultralow Methyl-seq kit (NuGEN), and bisulfite conversion was achieved using the Epitect Bisulfite Conversion kit (QIAGEN). Finally, the libraries were sequenced on Illumina Novaseq X plus instruments. Correlation analysis Epigenetic data were downloaded from published datasets. H1, H3K9me2, MNase-seq, H3AC, H2Aub, H3K27me3, H2A.W, and ATAC-seq were normalized using the preprocess function from the caret library. Then, correlation coefficients were calculated between variables using the Spearman and Kendall algorithms, provided by the corrplot package. Visualizations of the correlation matrix were performed using the ggplot2 package. Machine learning Epigenetic features with high correlation (>0.78) were removed before data normalization. 75% of data points were used for training, and the remaining 25% were used for testing. The Gradient Boosted Regression (GBM) model was selected based on its highest performance. A 10-fold cross-validation was repeated 10 times to examine model performance. Tuning parameters were applied as follows: interaction depth (3,6,9), number of trees (200, 250, 300). Finally, R-squared and MAE values were calculated, and the importance of epigenetic features was ranked. Feature importance ranking Feature importance measure was alternatively performed using the iml package. Each feature was shuffled and the decrease in the GBM model performance was calculated. The loss in performance was measured with MAE. RNA-seq Three biological replicates were used for each genotype. An individual 2-week-old seedling was collected as a biological replicate and frozen in liquid nitrogen. The samples were then ground into powder, and RNA was extracted using the Direct-zol RNA MiniPrep kit (Zymo Research). 500ng of total RNA from seedling tissues were used for RNA-seq library preparation with TruSeq Stranded mRNA kit (Illumina). The final library was sequenced on Illumina Novaseq X plus instruments. WGBS analysis WGBS were filtered and Illumina adaptors were removed using Trim Galore (v 0.6.7, Babraham Institute). Reads with three or more consecutively methylated CHH sites were treated as non-converted reads and filtered out. Bismark (v 0.19.1, Babraham Institute) [ 30 ] was used to map the reads to the Arabidopsis reference genome (TAIR10) and Col-Cen-v1.2 genome assembly [ 23 ]. ViewBS (v 0.1.11) was used to generate the plots [ 31 ]. DNA methylation levels across 1 kb upstream and downstream of CEN178 centers were first computed using deepTools (v 3.0.2) (Ramirez, 2016 #54) with the option of computeMatrix reference-point. The output matrix was then processed with in-house Perl and R scripts to generate the final methylation profile plots. RNA-seq analysis RNA-seq reads were filtered and Illumina adaptors were trimmed using Trim Galore (v 0.6.7, Babraham Institute). Left reads were mapped to the Arabidopsis reference genome (TAIR10) using STAR (v 2.7.11a) [ 32 ]. Uniquely mapped reads with less than 5% of mismatches were kept. For visualization, bigwig files were generated using deeptools (v 3.0.2) [ 33 ] bamCoverage with the options -- normalizeUsing RPGC and --binSize 10. HTSeq (v 0.13.5) was used to obtain the read counts for genes and TE. DESeq2 (v 1.42.0). Differential analysis was used perform via DESeq2 (v 1.42.0) with the cutoff padj = 1. Eventually, ggplot2 (v 3.4.4) was sued to generate all the related plots. Data availability The high-throughput sequencing data generated in this paper will be deposited in the Gene Expression Omnibus (GEO) database. Authors Contributions Statement S.W., S.E.J., and I.R.H. conceived the study, designed the research, and wrote the manuscript. S.W. performed most of the experiments and data analysis. T.L. and M.N. contributed to the data analysis. R.C., E.K.L., C.F., and Y.H. contributed to the experiments. S.F. performed BS-PCR-seq and all high-throughput sequencing. Competing Interests Statement The authors declare no conflicts of interest. Figure Legends Download figure Open in new tab Supplementary Figure 1 CDCA7A and CDCA7B retain the HLBH domain for interacting with DDM1 A . Sequence alignment calculated by Clustal Omega of the HLBH domains of homo sapiens CDCA7 and Arabidopsis Class I homologs. The red asterisk indicated the point mutations. Predicted Aligned Error (PAE) from AF3 structural modeling of B . CDCA7A or C . CDCA7B and DDM1 interactions. D . Close illustration of the AF3 predicted interface between CDCA7B and DDM1. Cyan represents the putative DDM1-binding helix of CDCA7B . Blue represents CC2 of DDM1. Light pink represents the C-terminal helix of CDCA7B . Pink represents putative CDCA7 interface 2 of DDM1. Dark pink represents the ATPase domain of DDM1. Purple indicates the Helicase C term domain of DDM1. Bright pink represents the zf-CXXC_R1 domain of CDCA7B . Download figure Open in new tab Supplementary Figure 2 CDCA7A and CDCA7B promote DNA methylation at heterochromatic nucleosomes A . Sanger sequencing confirmation of CRISPR-Cas9 introduced A insertion at the CDCA7A and CDCA7B coding regions. B . Genome-wide CHG methylation landscape of Col-0, cdca7a, cdca7b, cdca7a cdca7b+/-, cdca7a cdca7b , and ddm1-2 . C . Genome-wide CHH methylation landscape of Col-0, cdca7a, cdca7b, cdca7a cdca7b+/-, cdca7a cdca7b , and ddm1-2 . D . Distribution of the cdca7a cdca7b hypoDMR. H3K9me2 enrichment marks the locations of heterochromatin. E . Heatmaps showing the relation between epigenetic features and CG methylation changes in the cdca7a cdca7b mutant. Metaplots showing CG methylation levels at F . heterochromatic well-positioned nucleosomes and G . genic well-positioned nucleosomes of Col-0, cdca7a cdca7b , and ddm1-2 . H . Spearman correlation matrix among epigenetic features and changes in CG methylation level in the cdca7a cdca7b mutants. Download figure Open in new tab Supplementary Figure 3 CDCA7A and CDCA7B maintain CG methylation independently of H1 A . Sanger sequencing confirmation of CRISPR-Cas9 introduced mutations at CDCA7A and CDCA7B coding regions. The red lines indicated the region where mutations were introduced. B . Distribution of the non-rescued cdca7a cdca7b hypoDMR (regions with CG methylation levels not recovered in h1.1 h1.2 cdca7a cdca7b ). Relative enrichment of H3K9me2 indicates heterochromatin. Metaplots showing C . MNase-seq signal, D . H2A.W ChIP-seq signal, E . H1 ChIP-seq signal, F . ATAC-seq signal, and G . MORC6 ChIP-seq signal at non-rescued cdca7a cdca7b hypoDMR sites. H . Genome browser examples showing CG methylation and gene expression across Col-0, h1.1 h1.2, cdca7a cdca7b , and h1.1 h1.2 cdca7a cdca7b at non-rescued hypoDMRs in h1.1 h1.2 cdca7a cdca7b mutants. The red arrows indicate the locations of the hypoDMRs in the h1.1 h1.2 cdca7a cdca7b mutants. Download figure Open in new tab Supplementary Figure 4 CDCA7A and CDCA7B play a minor role in regulating non-CG methylation at centromeric regions. Genome-wide A . CHG methylation, and B . CHH methylation landscapes of Col-0, h1.1 h1.2, cdca7a cdca7b, h1.1 h1.2 cdca7a cdca7b , and ddm1-2 . Metaplots showing the non-CG methylation levels at CEN178 satellite repeats of C . Col-0, D . cdca7a cdca7b , E . h1.1 h1.2 , and F . h1.1 h1.2 cdca7a cdca7b . Supplementary Table 1. Details of the predicted interaction interfaces between CDCA7A and DDM1 from AF3 . Supplementary Table 2. Details of the predicted interaction interfaces between CDCA7B and DDM1 from AF3 . Acknowledgments We thank Dr. Colette Picard and Dr. Zhongshou Wu for their discussion and advice. We also thank Mahnaz Akhavan and the UCLA BSCRC BioSequencing Core for the sequencing support. This work was supported by S.E.J. funding from the Howard Hughes Medical Institute. Funder Information Declared Howard Hughes Medical Institute, https://ror.org/006w34k90 Reference 1. āµ Zhang , H. , Z. Lang , and J.K. Zhu , Dynamics and function of DNA methylation in plants . Nat Rev Mol Cell Biol , 2018 . 1G ( 8 ): p. 489 ā 506 . OpenUrl 2. Smith , Z.D. and A. Meissner , DNA methylation: roles in mammalian development . Nat Rev Genet , 2013 . 14 ( 3 ): p. 204 ā 20 . OpenUrl CrossRef PubMed 3. āµ Law , J.A. and S.E. Jacobsen , Establishing, maintaining and modifying DNA methylation patterns in plants and animals . Nat Rev Genet , 2010 . 11 ( 3 ): p. 204 ā 20 . OpenUrl CrossRef PubMed Web of Science 4. āµ Stroud , H. , et al. , Non-CG methylation patterns shape the epigenetic landscape in Arabidopsis . Nat Struct Mol Biol , 2014 . 21 ( 1 ): p. 64 ā 72 . OpenUrl CrossRef PubMed 5. āµ Cao , X. , et al. , Role of the DRM and CMT3 methyltransferases in RNA-directed DNA methylation . Curr Biol , 2003 . 13 ( 24 ): p. 2212 ā 7 . OpenUrl CrossRef PubMed Web of Science 6. āµ Zemach , A. , et al. , The Arabidopsis nucleosome remodeler DDM1 allows DNA methyltransferases to access H1-containing heterochromatin . Cell , 2013 . 153 ( 1 ): p. 193 ā 205 . OpenUrl CrossRef PubMed Web of Science 7. āµ Lyons , D.B. and D. Zilberman , DDM1 and Lsh remodelers allow methylation of DNA wrapped in nucleosomes . Elife , 2017 . 6 . 8. Choi , J. , et al. , DNA Methylation and Histone H1 Jointly Repress Transposable Elements and Aberrant Intragenic Transcripts . Mol Cell , 2020 . 77 ( 2 ): p. 310 ā 323 e7 . OpenUrl CrossRef PubMed 9. āµ Harris , C.J. , et al. , H1 restricts euchromatin-associated methylation pathways from heterochromatic encroachment . Elife , 2024 . 12 . 10. āµ Osakabe , A. , et al. , Molecular and structural basis of the chromatin remodeling activity by Arabidopsis DDM1 . Nat Commun , 2024 . 15 ( 1 ): p. 5187 . OpenUrl CrossRef PubMed 11. āµ Lee , S.C. , et al. , Chromatin remodeling of histone H3 variants by DDM1 underlies epigenetic inheritance of DNA methylation . Cell , 2023 . 186 ( 19 ): p. 4100 ā 4116 e15 . OpenUrl CrossRef PubMed 12. āµ Osakabe , A. , et al. , The chromatin remodeler DDM1 prevents transposon mobility through deposition of histone variant H2A.W . Nat Cell Biol , 2021 . 23 ( 4 ): p. 391 ā 400 . OpenUrl CrossRef PubMed 13. āµ Jenness , C. , et al. , HELLS and CDCA7 comprise a bipartite nucleosome remodeling complex defective in ICF syndrome . Proc Natl Acad Sci U S A , 2018 . 115 ( 5 ): p. E876 ā E885 . OpenUrl Abstract / FREE Full Text 14. āµ Funabiki , H. , et al. , Coevolution of the CDCA7-HELLS ICF-related nucleosome remodeling complex and DNA methyltransferases . Elife , 2023 . 12 . 15. āµ Wassing , I.E. , et al. , CDCA7 is an evolutionarily conserved hemimethylated DNA sensor in eukaryotes . Sci Adv , 2024 . 10 ( 34 ): p. eadp5753 . OpenUrl PubMed 16. āµ Shinkai , A. , et al. , The C-terminal 4CXXC-type zinc finger domain of CDCA7 recognizes hemimethylated DNA and modulates activities of chromatin remodeling enzyme HELLS . Nucleic Acids Res , 2024 . 52 ( 17 ): p. 10194 ā 10219 . OpenUrl PubMed 17. āµ Hardikar , S. , et al. , The ICF syndrome protein CDCA7 harbors a unique DNA binding domain that recognizes a CpG dyad in the context of a non-B DNA . Sci Adv , 2024 . 10 ( 34 ): p. eadr0036 . OpenUrl PubMed 18. āµ Han , M. , et al. , A role for LSH in facilitating DNA methylation by DNMT1 through enhancing UHRF1 chromatin association . Nucleic Acids Res , 2020 . 48 ( 21 ): p. 12116 ā 12134 . OpenUrl CrossRef PubMed 19. āµ Tachiwana , H. , et al. , Crystal structure of the human centromeric nucleosome containing CENP-A . Nature , 2011 . 476 ( 7359 ): p. 232 ā 5 . OpenUrl CrossRef PubMed Web of Science 20. Thakur , J. , J. Packiaraj , and S. Henikoff , Sequence, Chromatin and Evolution of Satellite DNA . Int J Mol Sci , 2021 . 22 ( 9 ). 21. Logsdon , G.A. , et al. , The variation and evolution of complete human centromeres . Nature , 2024 . 62G ( 8010 ): p. 136 ā 145 . OpenUrl 22. āµ Altemose , N. , et al. , Complete genomic and epigenetic maps of human centromeres . Science , 2022 . 376 ( 6588 ): p. eabl4178 . OpenUrl CrossRef PubMed 23. āµ Naish , M. , et al. , The genetic and epigenetic landscape of the Arabidopsis centromeres . Science , 2021 . 374 ( 6569 ): p. eabi7489 . OpenUrl CrossRef PubMed 24. Wlodzimierz , P. , et al. , Cycles of satellite and transposon evolution in Arabidopsis centromeres . Nature , 2023 . 618 ( 7965 ): p. 557 ā 565 . OpenUrl CrossRef PubMed 25. āµ Hou , X. , et al. , A near-complete assembly of an Arabidopsis thaliana genome . Mol Plant , 2022 . 15 ( 8 ): p. 1247 ā 1250 . OpenUrl CrossRef PubMed 26. āµ Brzeski , J. and A. Jerzmanowski , Deficient in DNA methylation 1 (DDM1) defines a novel family of chromatin-remodeling factors . J Biol Chem , 2003 . 278 ( 2 ): p. 823 ā 8 . OpenUrl Abstract / FREE Full Text 27. āµ Abramson , J. , et al. , Accurate structure prediction of biomolecular interactions with AlphaFold 3 . Nature , 2024 . 630 ( 8016 ): p. 493 ā 500 . OpenUrl CrossRef PubMed 28. āµ Kankel , M.W. , et al. , Arabidopsis MET1 cytosine methyltransferase mutants . Genetics , 2003 . 163 ( 3 ): p. 1109 ā 22 . OpenUrl Abstract / FREE Full Text 29. āµ Wang , Z.P. , et al. , Egg cell-specific promoter-controlled CRISPR/CasS efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation . Genome Biol , 2015 . 16 ( 1 ): p. 144 . OpenUrl CrossRef PubMed 30. āµ Krueger , F. and S.R. Andrews , Bismark: a ffexible aligner and methylation caller for Bisulfite-Seq applications . Bioinformatics , 2011 . 27 ( 11 ): p. 1571 ā 2 . OpenUrl CrossRef PubMed Web of Science 31. āµ Huang , X. , et al. , ViewBS: a powerful toolkit for visualization of high-throughput bisulfite sequencing data . Bioinformatics , 2018 . 34 ( 4 ): p. 708 ā 709 . OpenUrl CrossRef PubMed 32. āµ Dobin , A. , et al. , STAR: ultrafast universal RNA-seq aligner . Bioinformatics , 2013 . 2G ( 1 ): p. 15 ā 21 . OpenUrl CrossRef 33. āµ Ramirez , F. , et al. , deepTools2: a next generation web server for deep-sequencing data analysis . Nucleic Acids Res , 2016 . 44 ( W1 ): p. W160 ā 5 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted September 22, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following CDCA7 facilitates MET1-mediated CG DNA methylation maintenance in centromeric heterochromatin via histone H1 Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share CDCA7 facilitates MET1-mediated CG DNA methylation maintenance in centromeric heterochromatin via histone H1 Shuya Wang , Tong Li , Matthew Naish , Russell Chuang , Evan K. Lin , Christian Fonkalsrud , He Yan , Suhua Feng , Ian R. Henderson , Steven E. Jacobsen bioRxiv 2025.09.22.677529; doi: https://doi.org/10.1101/2025.09.22.677529 Share This Article: Copy Citation Tools CDCA7 facilitates MET1-mediated CG DNA methylation maintenance in centromeric heterochromatin via histone H1 Shuya Wang , Tong Li , Matthew Naish , Russell Chuang , Evan K. Lin , Christian Fonkalsrud , He Yan , Suhua Feng , Ian R. Henderson , Steven E. Jacobsen bioRxiv 2025.09.22.677529; doi: https://doi.org/10.1101/2025.09.22.677529 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Molecular Biology Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17691) Bioengineering (13892) Bioinformatics (41936) Biophysics (21452) Cancer Biology (18588) Cell Biology (25504) Clinical Trials (138) Developmental Biology (13378) Ecology (19899) Epidemiology (2067) Evolutionary Biology (24320) Genetics (15609) Genomics (22506) Immunology (17736) Microbiology (40394) Molecular Biology (17181) Neuroscience (88605) Paleontology (666) Pathology (2832) Pharmacology and Toxicology (4824) Physiology (7641) Plant Biology (15153) Scientific Communication and Education (2045) Synthetic Biology (4294) Systems Biology (9825) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source ā PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.