Combination Treatment with Docetaxel and Phytol or Thymol additively Inhibits Proliferation of Breast Cancer Cells and Down Regulate Expression of Cancer Stem Cell Markers

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Breast cancer stem cells are responsible for breast cancer tumorigenesis, metastasis, drug resistance and relapse. Involvement of phytochemicals in targeting breast cancer stem cells provides significant contribution in treatment of breast cancer. We evaluated inhibitory effects of docetaxel and its combination with phytol or thymol on proliferation of breast cancer MCF-7 cells and down-regulation of some cancer stem cell markers. Using MTT assay, docetaxel, phytol and thymol showed cytotoxic activity with IC50 values 20.88, 39 and 642 µM respectively. In the presence of phytol and thymol, IC50 of docetaxel was diminished to 11.30 and 12.1 µM. Combination index calculation and isobologram analysis using CompuSyn software indicated that combination of docetaxel and thymol or phytol at IC50 concentration of each drug generated additive anticancer effect. Real-time quantitative PCR results showed that simultaneous treatment of MCF-7 cells with docetaxel and thymol or phytol showed more efficacy in down-regulation of CD133, CD44, and ABCB1 when compared with docetaxel alone. Moreover, expressions of OCT4 and SOX2 reduced significantly following co- treatment with docetaxel and thymol. In conclusion, purpose of applying multi-drug (Chemotherapy drugs and phytochemical compounds) combinations is to obtain the greatest anti-cancer therapeutic benefit while minimizing toxic side effects. Combination of docetaxel with phytol or thymol evaluated in this study potentiates the cytotoxic properties of docetaxel to kill MCF-7 cancer cells and showed greater effect on reducing expression of CSC markers than docetaxel alone and thus could enhance chemosensitivity to docetaxel and protect cancer patients from cancer recurrence.
Full text 199,112 characters · extracted from preprint-html · click to expand
Combination Treatment with Docetaxel and Phytol or Thymol additively Inhibits Proliferation of Breast Cancer Cells and Down Regulate Expression of Cancer Stem Cell Markers | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Combination Treatment with Docetaxel and Phytol or Thymol additively Inhibits Proliferation of Breast Cancer Cells and Down Regulate Expression of Cancer Stem Cell Markers Narjes Eslami shoabjereh, sara soltanian This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6269654/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Jul, 2025 Read the published version in Revista Brasileira de Farmacognosia → Version 1 posted 5 You are reading this latest preprint version Abstract Breast cancer stem cells are responsible for breast cancer tumorigenesis, metastasis, drug resistance and relapse. Involvement of phytochemicals in targeting breast cancer stem cells provides significant contribution in treatment of breast cancer. We evaluated inhibitory effects of docetaxel and its combination with phytol or thymol on proliferation of breast cancer MCF-7 cells and down-regulation of some cancer stem cell markers. Using MTT assay, docetaxel, phytol and thymol showed cytotoxic activity with IC 50 values 20.88, 39 and 642 µM respectively. In the presence of phytol and thymol, IC 50 of docetaxel was diminished to 11.30 and 12.1 µM. Combination index calculation and isobologram analysis using CompuSyn software indicated that combination of docetaxel and thymol or phytol at IC 50 concentration of each drug generated additive anticancer effect. Real-time quantitative PCR results showed that simultaneous treatment of MCF-7 cells with docetaxel and thymol or phytol showed more efficacy in down-regulation of CD133, CD44, and ABCB1 when compared with docetaxel alone. Moreover, expressions of OCT4 and SOX2 reduced significantly following co- treatment with docetaxel and thymol. In conclusion, purpose of applying multi-drug (Chemotherapy drugs and phytochemical compounds) combinations is to obtain the greatest anti-cancer therapeutic benefit while minimizing toxic side effects. Combination of docetaxel with phytol or thymol evaluated in this study potentiates the cytotoxic properties of docetaxel to kill MCF-7 cancer cells and showed greater effect on reducing expression of CSC markers than docetaxel alone and thus could enhance chemosensitivity to docetaxel and protect cancer patients from cancer recurrence. Breast cancer stem cell Cytotoxicity Phytol Thymol Docetaxel Drug combination Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Breast cancer is the most diagnosed cancer in women, affecting over 1.5 million women annually and causing the highest number of cancer-related deaths among women. Docetaxel (Taxotere), a cytotoxic taxane, is an antimicrotubular agent that effectively treats patients with breast cancer (Lyseng-Williamson and Fenton 2005 ). Although, surgery, radiotherapy, and chemotherapy constitute the main approaches to breast cancer treatment (Lyseng-Williamson and Fenton 2005 ), high incidence of tumor recurrence and disease progression and numerous side effects lead to treatment failure (Ju et al. 2018 ). Substantial evidence suggests that breast cancer stem cells (CSCs) comprise a small population within tumors which are highly resistant to standard conventional chemotherapy and radiotherapy, playing key roles in malignant progression, metastasis, and cancer recurrence (Velasco-Velázquez et al. 2012). Therefore, concurrently targeting both CSCs and non-CSCs in tumors presents a promising strategy for achieving long-lasting anticancer effectiveness. Involvement of dietary phytochemicals in targeting breast CSCs and lowering their stemness and self-renewal properties may provide significant contribution in prevention and treatment of breast cancer (Prajapati et al. 2022 ). Another advantage of various phytochemicals is their minimal toxicity and side effects, high bioavailability, and cost-effectiveness, which enhance their credibility as potent anti-cancer agents when combined with chemotherapy drugs (Kumar and Gupta 2021 ). Phytol and thymol are classified in terpenoids group of phytochemicals (de Moraes et al. 2014 ). Phytol is a diterpene alcohol naturally found in chlorophyll, the green pigment in plants, algae and cyanobacteria. It is released when chlorophyll is broken down, making green leafy vegetable, algae and plant-based oils good sources of phytol (Islam et al. 2018 ). Thymol is a monoterpenoid phenol that is the main active ingredient of oil extracted from species Thymus vulgaris L., Lamiaceae, commonly known as thyme, and other plants such as Ocimum gratissimum L., (syn.: Coleus yemenensis A.J.Paton), Carum copticum L., Oliveria decumbens Vent, Apiaceae, and different species of the genera Origanum , Satureja L., and many others (Escobar et al. 2020 ). Among many medicinal uses that have been reported for thymol and phytol, anti-cancer activities of these two terpenoids have been proven in several research (Bouhtit et al. 2021 ; Chauhan et al. 2017 ; De La Chapa et al. 2018 ; Deb et al. 2011 ; Elshafie et al. 2017 ; Günes-Bayir et al. 2019; Horváthová et al. 2006; Islam et al. 2019 ; Jamali et al. 2018 ; Kang et al. 2016 ; Li et al. 2017 ; Nagoor Meeran et al. 2017 ; Sampaio et al. 2021 ; Satooka and Kubo 2012 ; Yeh et al. 2017 ). Furthermore, inhibitory effect of thymol and phytol on epithelial–mesenchymal transition (EMT) process, invasion, migration, and metastasis of cancer cells were documented in some studies (Kim et al. 2015 ; Lee et al. 2016 ; Lv and Chen 2017 ; Nadir et al. 2023 ; Ohno et al. 2003 ; Pathania et al. 2013 ; Sakthivel et al. 2018 ; Zeng et al. 2020 ). Epithelial–mesenchymal transition is a complex process in which epithelial cells lose cell-cell adhesion and acquire an invasive mesenchymal phenotype. This transformation contributes to the development of invasive properties essential for metastasis (Tsuji et al. 2009 ). There is a direct connection between EMT and the acquisition of CSC properties. Cells that have undergone EMT exhibit several characteristics similar to CSCs, including a drug-resistant phenotype and the expression of stem cell markers (Du and Shim 2016 ; Phi et al. 2018 ; Shibue and Weinberg 2017 ). Conclusively, due to the suppressive effect of thymol and phytol on EMT and cell migration, it is likely that these two agents have an inhibitory effect on CSCs. To the best of our knowledge, no published work has studied the inhibitory effect of phytol and thymol on expression of CSCs markers in MCF-7 cells. In the current in vitro study, at first, we have examined the cytotoxic effects of docetaxel, phytol and thymol used as a single agent against breast cancer MCF-7 cell line. Then, combined cytotoxic effects of docetaxel and phytol or thymol were evaluated by calculating combination indexes (CI) and dose reduction indexes (DRI) values using CompuSyn software. We also compared inhibitory effects of docetaxel and its combination with phytol or thymol on expression of some CSCs markers. Materials and Methods Cell Culture and Treatments We obtained MCF-7 human breast carcinoma cells from the Iranian Biological Resource Center (IBRC, Tehran, Iran). The cells were cultured in DMEM medium (Gibco, Grand Island, USA) supplemented with 10% heat-inactivated FBS (PAN Biotech, South America), 100 U/ml penicillin, 100 µg/ml Streptomycin (PAN-Biotech) in a humidified incubator at 37°C with 5% CO 2 . Phytol (purity ≥ 97%; Lot number. SHBR8604l) was purchased from Sigma-Aldrich. Thymol (purity ≥ 97%; Lot number. Th971010) purchased from golexir company (School of pharmacy, Ferdowsi campus, Azadi Blv., Mashhad, Iran). Docetaxel (purity ≥ 99%; Batch number. 5F219A) purchased from Sanofi company. Cytotoxicity Assays Cell viability was assessed using the MTT assay. The cells were seeded in 96-well microtiter plates at a density of 10⁴ cells per well and allowed to adhere overnight. Subsequently, they were treated with different concentrations of docetaxel (2.5, 5, 10, 20, 40, 80, 160 µM), phytol (10, 15, 20, 25, 30, 35, 40 µM) and thymol (400, 500, 600, 700, 800, 900, 1000 µM), and incubated for 48 h. Next, 10 µl of MTT stock solution (5 mg/ml) was added to each well, and the cells were incubated for 3 h at 37°C. The intracellular formazan products were then dissolved in 100 µl of DMSO with shaking for 10 min. Absorbance was measured at 540 nm using a microplate reader (BioTek, USA). The cytotoxicity of the various drugs was expressed as the Inhibitory Concentration (IC50) value, which represents the drug concentration needed to inhibit cell growth by 50% compared to the control. The IC 50 values of docetaxel, thymol, and phytol as single drugs were calculated using CompuSyn software (Biosoft, Cambridge, United Kingdom). All treatments were performed in triplicate. Drug Combination Assays The IC 50 values obtained from single-drug cell viability assays were used to plan subsequent drug combination experiments. Finally, cytotoxicity of docetaxel/ phytol combination in molar ratio 1/2 and concentration ranges of 5/10, 7.5/15, 10/20, 12.5/25, 15/30, 17.5/35, 20/40, 22.5/45 µM and cytotoxicity of docetaxel/thymol combination in molar ratio 1/25 and concentration ranges of 2/50, 4/100, 8/200, 12/300, 20/500, 24/600 µM were tested. All treatments were performed in triplicate. The cytotoxicity was determined using the MTT assay as described above. Analysis of drug combination In order to analyze the type of interaction between docetaxel and phytol or thymol, CI and DRI values were determined using Compusyn software (Version 1.0, Compusyn, Inc., and Paramus, NJ, USA) (Chou 2006 ) and these values were used to generate Fa-CI, Fa-DRI and isobologram plot. The combination index plot is also called the CI-Fa (combination-index vs. fraction affected) Plot. Combinatorial effects were evaluated using CI. When CI value is 1.1 indicate antagonism, CI values ranging from 0.9 to 1.10 indicate a near-additive effect (Meng et al. 2016 ). DRI plot is the plot of DRI as a function of Fa. DRI indicates magnitude of dose reduction in drug dose needed to achieve a given effect in combination setting as compared to each drug alone. In the Fa-DRI plot, data points below the no dose reduction line (DRI = 1) indicate a favorable dose reduction, whereas those above the line indicate an unfavorable dose reduction (Chou 2006 ). To draw an isobologram plot, The IC 50 values of docetaxel are plotted on the x-axis and The IC 50 values of phytol or thymol are plotted on y-axis. The diagonal line connecting these IC 50 values on the X and Y axes reflects the line of additivity. Any point below the additivity line indicates a synergistic interaction between the drugs at those specific concentrations. A point above the line signifies an antagonistic effect, while a point on the line represents an additive effect. Experimental groups and drug treatment MCF-7 cells were seeded in 6-cm dishes and cultured until they reached 80% confluence. In our experiment, four groups were considered. Untreated cells were served as a control group. Docetaxel group, in which cells were incubated with docetaxel alone at IC 50 concentrations. For another two groups, cells were treated with docetaxel/phytol or docetaxel/thymol at IC 50 concentration of each drug in combined form. Cells in each group were treated for 48 h. Each treatment wan repeated at least three times. Quantitative Real-time Polymerase Chain Reaction Assessments The expression levels of OCT4, NANOG, SOX2, ALDH1A1, ABCB1, CD133 and CD44 were determined by real-time PCR. Total RNA in all the groups was extracted using RAN extraction DENAzist kit according to the manufacturer’s protocol. RNA concentrations were determined using a NanoDrop spectrophotometer (Thermo Scientific), and RNA integrity and quality were assessed through capillary electrophoresis. cDNA was synthesized using M-MuLV reverse transcriptase (Cat. No. EP0441; Thermo Scientific, Wilmington, USA) following the manufacturer’s instructions and the mRNA expression level of target genes was estimated using SYBR Green qPCR master mix (Cat. No. C101021; Parstous, Iran) and real-time PCR system (QIAGEN Rotor Gene Q). The initial denaturation was performed at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 20 s, annealing at 62°C for 20 s, and extension at 72°C for 10 s. B2µ gene was used as an internal control and the data evaluated by the comparative 2 −ΔΔCt method. The experiments were conducted in triplicate and independently repeated at least twice. Gene-specific primer sequences are listed in Table 1 . Table 1 List of different PCR primers used in the study Gene name Sequence (5´ to 3´) Product size (bp) Octamer-binding transcription factor 4 (OCT4) F:CCGAAAGAGAAAGCGAACCAGTAT R: CCACACTCGGACCACATCCTTC 145 Nanog homeobox (NANOG) F: AATACCTCAGCCTCCAGCAGATG R: CTGCGTCACACCATTGCTATTCT 149 ATP Binding Cassette Subfamily B Member 1 (ABCB1) F: CACCACTGGAGCATTGACTR R: CAGTGTTAGTTGCCAACCAT 151 Aldehyde dehydrogenase 1 family, member A1 ( ALDH1A1 ) SRY-box (SOX2) Prominin 1 (CD133) CD44 F: TCAGCAGGAGTGTTTACCAA R: CTTACCACGCCATAGCAA F: GGGAAATGGGAGGGGTGCAAAAGAGG R: TTGCGTGAGTGTGGATGGGATTGGTG F: ACCGACTGAGACCCAACATC R: GGTGCTGTTCATGTTCTCCA F: AAGGTGGAGCAAACACAACC R: AACTGCAATGCAAACTGCAAG 98 151 101 116 Beta-2-Microglobulin ( β2M ) F: CTCCGTGGCCTTAGCTGTG R: TTTGGAGTACGCTGGATAGCCT 69 Flow Cytometry Analysis Flow cytometry analysis was conducted on untreated control cells, as well as docetaxel- and docetaxel/thymol-treated cells. Briefly, the cells were trypsinized and washed with PBS containing 2% FBS. One million cells were suspended in 100 µl of PBS/2% FBS containing 10 µl of PE anti- Human CD133/2 or 20 µl of FITC anti-Human CD44, antibody. Cells were incubated at dark for 30 min in presence of antibody. After washing, cells were suspended in 0.5 ml of PBS/2% FBS and propidium iodide (PI) (Sigma-Aldrich) and 7-amino-actinomycin D (7-AAD) (Cat. No. 559763; B.D Bioscience) were added for detection of dead cells in FITC and PE-conjugated antibody- treated cells respectively. Finally, the cells were analyzed using a flow cytometer, with CD44 + cells detected through the FL1 channel and CD133 + cells detected through the FL2 channel. Statistical Analysis We used GraphPad prism 5 software for data analysis. Data are expressed as the mean ± standard deviation of triplicate measurements. One-way ANOVA was performed to assess significant differences among treatments compared to their respective untreated controls, with p < 0.05 indicating statistical significance between the mean values of triplicates. Results Growth inhibitory effects of single agents on MCF-7 cells To determine the inhibitory effect of docetaxel, phytol, and thymol as single agent on MCF-7, we first performed MTT assay. The MTT results showed that treatment with docetaxel, phytol and thymol resulted in decreased cell viability in MCF-7 cell line compared to the untreated control in a dose-dependent manner with IC 50 value 20.88 µM for docetaxel, 39 µM for phytol and 642 µM for thymol (Fig. 1 a, 1 b and 1 c) (Table 2 ). Table 2 The 50% inhibitory concentration (IC 50 ) of docetaxel, phytol and thymol alone and in combination against MCF-7 cells after 48 h incubation Data represents the mean ± SD IC 50 Sample Docetaxel Phytol Thymol Docetaxel 20.88±0.46 - - Phytol - 39±0.36 - Thymol - - 642±0.28 Docetaxel/Phytol 11.30±0.29 22.5±0.48 - Docetaxel/ Thymol 12.1±0.1 - 302±0.19 Growth inhibitory effects of docetaxel in combination with phytol or thymol on MCF-7 cells To evaluate combination cytotoxic effects of docetaxel/phytol and docetaxel/thymol against MCF-7 cells, we performed a combination study. Figure 2 a and 2 b showed the dose-response curve for MCF-7 cell line exposed to docetaxel/phytol and docetaxel/thymol combination treatment. According to the results, in the presence of phytol, IC 50 of docetaxel was diminished to ∼ 1.8-fold and in the presence of thymol, IC 50 of docetaxel was diminished to ∼ 1.7-fold in MCF-7 cells (Table 2 ). Interaction of docetaxel and phytol or thymol CI and DRI were determined for combination of docetaxel and phytol and combination of docetaxel and thymol. An isobologram analysis was also employed to analyze the nature of the interaction between drugs. Figure 2 c indicates that docetaxel/phytol are antagonism with CI value > 1.1 for 0.05 < Fa < 0.5, while they are synergism with CI value 0.6. Interaction of docetaxel and thymol are almost additive. CI 50 for both combinations (when combination drugs affect 50% cells; Fa: 0.5) were calculated between 0.9 and 1.1, indicating additive effect. These conclusions are summarized in Table 3 for the concise format of presentation. Isobologram presents graphically the nature of interaction between docetaxel and phytol or thymol. The experiment isoeffect data point for docetaxel/phytol fell to the left side of the line suggesting synergistic interaction between drugs when percentage of cell viability is 75% (Fa = 0.75) and 90% (Fa = 0.9). When 50% cells are affected (Fa = 0.5), the point is near the line, which shows additive interaction of docetaxel and phytol (Fig. 3 a). For combination of docetaxel and thymol, all points are near the line which shows additive interaction of docetaxel and thymol when Fa = 0.5, 0.75 and 0.9 (Fig. 3 b). Therefore, as was shown in CI-Fa plot and Isobologram plot, both combinations showed additive interaction when 50% cells are affected. In combination of docetaxel and phytol, DRI indicate favorable dose reduction (DR I > 1) for all concentration of docetaxel and for phytol when cell viability percentage is more than 30% (Fa > 0.3) (Fig. 4 a). In combination of docetaxel and thymol, DRI indicate favorable dose reduction (DRI > 1) for all concentration of thymol and for docetaxel when cell viability percentage is less than 75% (Fig. 4 b). Table 3 Combination indices (CIs) for combination of docetaxel/phytol and docetaxel/thymol at different fraction of affected cells Combination Drugs Fa CIs CI 50 0.05 < Fa 1.1 Docetaxel + Phytol 0.5 ≤ Fa ≤ 0.6 Fa > 0.6 CI = 0.9–1.1 CI 0.65 CI > 1.1 1.0 0.05 < Fa ≤ 0.65 CI = 0.9–1.1 Fa: Fraction of affected cells CI: Combination indices CI 1.1, antagonistic Expression analysis of CSC-related markers following MCF-7 treatment QRT-PCR was performed to compare expression of some important breast CSC markers at mRNA level between different experimental groups. As shown in Fig. 5 , expression of CD44 and CD133 genes significantly downregulated after co-treatment of MCF-7 cells with docetaxel and phytol or thymol (CD44: 40% and CD133: 57% in docetaxel/phytol; CD44: 38% and CD133: 88% in docetaxel/thymol), while expression of these two genes didn’t change after treatment with docetaxel alone. Expression of ABCB1 also reduced significantly after co-treatment with docetaxel and phytol (62%) or thymol (83%), while treatment with docetaxel reduced its expression only 18%. As shown in Fig. 6 , transcript of OCT4 showed around 4-fold drop after treatment of MCF-7 cells with docetaxel/thymol, but no significant change was detected after treatment with docetaxel/phytol or docetaxel alone. Expression level of NANOG showed 1.5-fold decrease after treatment with docetaxel combined with phytol or thymol, whereas exposure of MCF-7 cells to docetaxel alone increased its expression to around 1.7-fold when compared to untreated MCF-7. Finaly, according to our results, MCF-7 treatment with docetaxel alone or combined treatment of docetaxel and phytol or thymol significantly decreased expression of SOX2 (80% in docetaxel, 60% in docetaxel/phytol and 91% in docetaxel/ thymol) and ALDH1 (74% in docetaxel, 63% in docetaxel/ phytol and 64% in docetaxel/thymol) when compared to untreated MCF-7 cells. Flow cytometry analysis of CSC surface markers Using flow cytometry, we determined the percentage of CD44 and CD133 positive cells in untreated, docetaxel and docetaxel/thymol treated MCF-7 cells. Results indicated that 2.5% and 6.1% of cell population are CD44 and CD133 positive in untreated cells. This proportion increased to 3.6 and 10.3% after treatment with docetaxel. However, treatment with docetaxel/thymol reduced percentage of CD44 + and CD133 + cell population in MCF-7 cells to 1.7% and 2.9% respectively (Fig. 7 ). Discussion The present study demonstrated the additive effect of phytol and thymol on cytotoxicity of docetaxel when MCF-7 cells were treated at IC 50 concentration of each drug in combination mode. In addition, combination treatment with docetaxel/phytol or docetaxel/thymol was more effective in reducing the expression of the CSC markers in MCF-7 cells than the treatment with docetaxel alone. Docetaxel, as an antineoplastic agent, is a semisynthetic member of the taxoid class. It is a very effective chemotherapeutic agent for the treatment of metastatic or locally advanced breast cancer both as a single chemotherapeutic agent or in combination with other chemotherapeutic agents (Dumontet and Sikic 1999 ; Ho and Mackey 2014 ). Docetaxel promotes the assembly of tubulin into stable microtubules and prevents their disassembly, which results in the inhibition of mitosis in cells. Despite the positive effects of docetaxel in breast cancer therapy, a major problem in docetaxel chemotherapy is its side effects, including temporary hair loss, nausea, vomiting, diarrhea, constipation, loss of appetite, respiratory reactions, optic neurotoxicity and nervous system disorders, ocular, hematological, cardiac and gastrointestinal reactions (Stoicescu et al. 2021 ). Furthermore, although chemotherapy reduces bulk tumour burden, but resistant breast CSCs survive and it often leads to cancer recurrence, ultimately resulting in treatment failure and increased mortality among cancer patients. The high drug resistance of CSCs is mediated by various cellular processes, including entry into a quiescent state, enhanced DNA damage repair, overexpression of anti-apoptotic proteins, and increased activity of detoxifying enzymes such as aldehyde dehydrogenases (ALDHs). Additionally, rapid drug efflux is facilitated by adenosine triphosphate-binding cassette (ABC) transporters, including P-glycoprotein (MDR1 or ABCB1), multidrug resistance-associated protein (MRP1 or ABCC1), and breast cancer resistance protein (BCRP1 or ABCG2) (Clark and Palle 2016 ; Ginestier et al. 2007 ; Goebel et al. 2021 ). Therefore, for effective treatment of breast cancers, there is a urgent need to identify novel compounds targeting breast CSCs and their drug- resistance mechanisms (Longley and Johnston 2005 ; Phi, Sari, Yang, Lee, Jun, Kim, Lee and Kwon 2018). Recently, interests in the use of medicinal plants have increased significantly. Combination therapy with standard chemotherapy drugs and natural products can reduce the adverse side effect of chemotherapy drug and help to improve cancer treatment efficiency through the elimination of CSCs and thus help to prolong patient survival (Ben-Arye et al. 2017 ; Crystal et al. 2014 ; Mokhtari et al. 2017 ; Sugahara et al. 2010 ). Various natural products can re-sensitize CSCs to chemotherapeutic drugs by inhibiting efflux activity of the ABC transporters or alternatively by reducing the expression of genes that code for ABC transporters and thus maintain optimum concentration of the drug (Chang et al. 2019 ; Mollazadeh et al. 2018 ; Wu et al. 2008 ). The ALDH family enzymes play a critical functional role in drug detoxification in CSCs. Natural products can inhibit ALDH1 activity and sensitize CSCs to chemotherapeutic drugs (Charafe-Jauffret et al. 2010 ; Koppaka et al. 2012 ). They also induce differentiation, apoptotic and non-apoptotic cell death in cancer cells (Ramos et al. 2021 ). Finally, natural products can target key signaling pathways involved in maintaining the CSC phenotype, including the WNT, Hedgehog, Notch, and PI3K/Akt/mTOR pathways (Pezzani et al. 2019 ). In this study we selected phytol and thymol as natural derivatives. Thymol, chemically known as 2-isopropyl-5-methylphenol is a colourless crystalline monoterpene phenol commonly found in the essential oils of Thymus vulgaris (thyme) and other plants (Nagoor Meeran, Javed, Al Taee, Azimullah and Ojha 2017 ; Salehi et al. 2018 ). Phytol, a precursor of vitamin E and K1, is a chlorophyll‑derived acyclic diterpene alcohol (Verhoeven et al. 1998 ). For centuries, thymol and phytol has been used in traditional medicine and has been shown to possess various pharmacological properties and broad range of biological activities (Anoor et al. 2022 ; Botelho et al. 2016 ; Carvalho et al. 2020 ; de Moraes, de Oliveira, Costa, Junior, de Sousa, Freitas, Allegretti and Pinto 2014; Deng et al. 2015 ; Islam, Ali, Uddin, Shaw, Islam, Ahmed, Shill, Karmakar, Yarla and Khan 2018; Islam, Khalipha, Bagchi, Mondal, Smrity, Uddin, Shilpi and Rouf 2019; Nagoor Meeran, Javed, Al Taee, Azimullah and Ojha 2017 ; Okhale et al. 2021; Pejin et al. 2014b ; Santos et al. 2013 ; Saravanan and Pari 2015 ; Silva et al. 2014 ; Sobczak et al. 2014 ; Zhang et al. 2015 ). Anticancer activity of thymol and phytol on various types of cancers like glioblastoma, breast cancer, leukemia, osteosarcoma, hepatocellular carcinoma, cervical cancer, laryngeal carcinoma, gastric carcinoma cells, prostate adenocarcinoma, cervical, lung, colorectal and melanoma and acute myeloid leukemia has been documented (Bouhtit, Najar, Moussa Agha, Melki, Najimi, Sadki, Boukhatem, Bron, Meuleman and Hamal 2021; Chauhan, Bahuguna, Paul and Kang 2017 ; de Alencar et al. 2019; De La Chapa, Singha, Lee and Gonzales 2018 ; Elshafie, Armentano, Carmosino, Bufo, De Feo and Camele 2017 ; Günes-Bayir, Kocyigit and Kiziltan 2019; Horváthová, Sramková, Lábaj and Slamenová 2006; Islam et al. 2017 ; Jamali, Kavoosi, Safavi and Ardestani 2018 ; Kang, Kim, Kim, Hwang, Jeong, Dong, Lee, Moon, Jeon and Park 2016; Komiya et al. 1999 ; Pejin et al. 2014a ; Sakthivel, Malar and Devi 2018 ; Sampaio, Pina, Serafini, Tavares and Guimaraes 2021 ; Satooka and Kubo 2012 ; Song and Cho 2015 ; Yeh, Chou, Chen, Lu, Lin, Yu, Liang, Chang, Kuo and Ho 2017). The major mechanisms for anticancer actions of thymol and phytol include induction of apoptosis and cell cycle arrest, suppressing cell proliferation, angiogenesis and migration (Chang et al. 2011 ; Chauhan, Bahuguna, Paul and Kang 2017 ; Deb, Parimala, Devi and Chakraborty 2011 ; Hassan et al. 2021 ; Islam, Ali, Uddin, Shaw, Islam, Ahmed, Shill, Karmakar, Yarla and Khan 2018; Itoh et al. 2018 ; Jamali, Kavoosi, Safavi and Ardestani 2018 ; Kang, Kim, Kim, Hwang, Jeong, Dong, Lee, Moon, Jeon and Park 2016; Khadir et al. 2016 ; Kim, Lee, Jung, Kim, Jung, Sohn, Lee, Woo, Baek and Kim 2015; Li, Wen, Du, Hu, Chen, Zhang, Zhang, Gao, Li and Mao 2017; Pathania, Guru, Verma, Sharma, Abdullah, Malik, Chandra, Katoch and Bhushan 2013; Sakthivel, Malar and Devi 2018 ; Sampaio, Pina, Serafini, Tavares and Guimaraes 2021 ; Song and Cho 2015 ; Yin et al. 2010 ). Therefore, combination treatment in our study includes docetaxel as a common chemo drug and phytol or thymol as naturel derived phytochemical compounds. Since multi-drug and multi-component combinations interact at various levels, their overall effect can be synergistic, additive, or antagonistic. In pharmacology, an additive effect occurs when the combined effects of two drugs are equal to the sum of their individual effects. A drug combination is considered synergistic when the combined effect exceeds the additive effect of each drug alone, whereas it is antagonistic when the combined effect is less than the additive effect of the individual drugs (Gilad et al. 2021 ). Our results demonstrated that docetaxel combined with phytol or thymol elicits an additive anticancer effect at IC 50 concentration in breast cancer MCF-7 cells. However, docetaxel/thymol combination showed antagonism interaction at lower concentration. Moreover, docetaxel/phytol combination showed antagonism effect when cell viability is less than 50% and this combination showed synergism effect when more than 65% cells are viable. Therefore, combination effects of drugs in different concentration and cell viability are different. According to other researches, combination of various chemotherapeutic agents with thymol or phytol minimize their side effect on normal cells and improve the effectiveness of cancer treatment (Arab et al. 2015 ). For example, in a study by Jaafari et.al., synergistic effect of the thymol used in combination with two anticancer drugs (methotréxate and cis-platin) were demonstrated (Jaafari et al. 2012 ). In a study by Bouhtit el al., carvacrol can act synergistically with thymol to induce cell death in myeloid leukemia cell (Bouhtit, Najar, Moussa Agha, Melki, Najimi, Sadki, Boukhatem, Bron, Meuleman and Hamal 2021). Labbozzetta at el., indicated that phytol could suppress the expression of P-gp. By this mechanism, it could be used in combination with different anticancer chemotherapy drugs such as doxorubicin to enhance their cytotoxic effects and improve their effectiveness in patients with multi drug resistance (Labbozzetta et al. 2022 ). The combination effects of other phytochemicals and docetaxel have also been investigated in some studies. For example, combination of platycodin D, triterpenoid saponin abundant in Platycodon grandiflorum, with docetaxel synergistically inhibited cell growth in DU-145 by promoting apoptosis and reducing autophagy (Jin et al. 2021 ). Tricin, isolated from Allium atroviolaceum , enhanced the inhibitory effect of docetaxel on PC3 cell proliferation and can be effective to reduce metastasis and overcome drug resistance (Ghasemi et al. 2019 ). The combination of capsaicin, the active component of hot chili peppers, and docetaxel synergistically induces cell death in human prostate cancer cells by activating the metabolic regulator AMP-activated kinase (Sánchez et al. 2019). Honokiol, a soluble and non-toxic natural compound derived from Magnolia spp., exhibited additive effects with docetaxel, inhibiting tumor growth without causing systemic toxicity (Shigemura et al. 2007 ). The inhibitory effect of thymol and phytol on migration and metastasis was also shown in some studies. For example, C6 glioma cells treatment with thymol inhibited the migration through the phosphorylation of PKCα and ERK1/2, leading to a reduced expression of MMP-9 and MMP-2 (Lee, Kim, Park and Hong 2016 ). According to another study, thymol suppressed EMT, invasion, and metastasis of colorectal cancer cells by suppressing the Wnt/β-catenin pathway and down regulation of EMT markers, including vimentin, Snail, and N-cadherin and up regulation of E-cadherin (Zeng, Che, Zhang, Chen, Guo and Zhang 2020 ). Moreover, it was indicated that thymol inhibits cell migration and invasion via inhibiting PI3K/AKT and ERK pathways and decreasing activity of MMP-2 and MMP-9 in human colon cancer cells and human leukemia cells (Lv and Chen 2017 ; Pathania, Guru, Verma, Sharma, Abdullah, Malik, Chandra, Katoch and Bhushan 2013). Furthermore, treatment with phytol resulted in decreased expression of angiogenesis markers. Because of the role of angiogenesis in tumor growth, invasion, and metastasis, inhibitory effect of phytol in migration can be concluded (Nadir, Shteinfer-Kuzmine, Pandey, Ortas, Kerekes and Shoshan-Barmatz 2023 ; Sakthivel, Malar and Devi 2018 ). Phytol also inhibited key morphological changes associated with EMT, such as loss of cell adhesion and the transition to fibroblast-like mesenchymal cells in HepG2 cells. This effect was achieved by reversing the loss of E-cadherin and overexpression of p-smad2/3, alpha-smooth muscle actin, and Snail (Kim, Lee, Jung, Kim, Jung, Sohn, Lee, Woo, Baek and Kim 2015). It has been shown that cells undergoing EMT exhibit characteristics similar to stem cells derived from both normal and neoplastic cell populations, express stem cell markers and show drug resistant phenotype (Mani et al. 2008 ). Therefore, it is likely that thymol and phytol with anti-metastatic and anti-invasion activities have anti-CSC properties and resist CSC-like characters. The present study is the first to demonstrate that in comparison with individual docetaxel, combination of docetaxel and thymol or phytol exhibited stronger inhibitory effect on expression of CSC markers in MCF-7 breast cancer cells. CD44 and CD133 are the most widely used markers for the identification of CSCs in the breast cancer (Croker et al. 2009 ; Schmohl and Vallera 2016 ; Wood and Alsawy 2018 ; Zhao et al. 2017 ). Croker el al., report subpopulations of cells expressing CD133 together with CD44/CD24 and ALDH showed colony formation ability, migration and invasion capacity (Croker, Goodale, Chu, Postenka, Hedley, Hess and Allan 2009). According to other researches, ESA+/CD44+/CD24−/low cells and CD133 + tumor cells exhibit stem cell-specific properties, including self-renewal, differentiation, and tumor formation in the NOD-SCID mouse model and show chemo- and radio-resistance property (Al-Hajj et al. 2003 ; Singh et al. 2004 ; Tume et al. 2016 ; Xia 2017 ). We showed that expression of these two markers dropped sharply after co-treatment with docetaxel and phytol or thymol compared to docetaxel alone. Furthermore, ABCB1 gene expression in MCF-7 cells decreased significantly following treatment with docetaxel/thymol or docetaxel/phytol. As key stem cell-related transcription factors, octamer-binding transcription factor 4 (OCT4), sex-determining region Y-box 2 (SOX2), and Nanog homeobox (NANOG) are recognized as essential regulators of self-renewal and pluripotency in both embryonic stem cells and CSCs. These stemness-related transcription factor markers play a key role in tumorigenesis and CSC characteristics and mediate tumor proliferation and differentiation (Kumar et al. 2012 ; Rasti et al. 2018 ). We observed that MCF-7 treatment with docetaxel/thymol has the most significant effect on down regulation of these pluripotency-related genes. On the opposite side, docetaxel treatment didn’t decrease expression of OCT4 and NANOG. Therefore, simultaneous treatment of MCF-7 cells with docetaxel and thymol or phytol showed more efficacy in reducing the expression of CSCs-related markers when compared with docetaxel alone. Because docetaxel/thymol treatment had the most inhibitory effect on CSC-related markers at transcript level, we compared percentage of CD44 and CD133-positive cells after treatment with docetaxel and docetaxel/thymol by flow cytometry analysis and results indicated that while docetaxel alone cannot reduce CD44 + and CD133 + cells percentage, co-treatment with docetaxel/thymol can reduce them. There is other evidence regarding the possible inhibitory effects of phytol on CSCs. One study showed that expression of Sox2 and Nestin as two glioma stem cell CSC markers were highly reduced after phytol treatment in glioblastoma (Nadir, Shteinfer-Kuzmine, Pandey, Ortas, Kerekes and Shoshan-Barmatz 2023 ). Soltanian at el., demonstrated that phytol was more effective than cisplatin in downregulating CSC markers, including OCT4, NANOG, SOX2, ALDH1, ABCB1, CD44, and CD133, in NCCIT cells (Soltanian et al. 2021 ). Unlike chemotherapy drugs, inhibitory effect of many phytochemicals such as menadione, kaempferol, curcumin, berberine, baicalein, β-carotene, oxymatrine, resveratrol, quercetin, apigenin, baicalein and sulforaphane on the expression of various CSCs markers and eliminating CSC population in multiple cancers have been shown in many studies (Almanaa et al. 2012 ; Fahey et al. 1997 ; Gu et al. 2014 ; Kanwar et al. 2011 ; Kim et al. 2016 ; Kim et al. 2008 ; Li et al. 2010 ; Lim et al. 2014 ; Shankar et al. 2011 ; Soltanian et al. 2018 ; Soltanian et al. 2017 ; Soltanian and Sheikhbahaei 2021 ; Zhang et al. 2011 ; Zhou et al. 2010 ). In conclusion, our results showed that thymol and phytol could play an additive role with docetaxel at IC 50 concentration against breast cancer MCF-7 cells. Therefore, phytol or thymol improves the effectiveness of docetaxel against breast cancer cells. To the best of my knowledge, this study is the first that showed concomitant treatment of breast human cancer MCF-7 cells with docetaxel and phytol, or thymol resulted in reduction of CSCs, as indicated by the decreased expression of specific CSC markers. Taken together, these results may contribute to the efforts in developing a safe and efficient anti-breast cancer strategy based on combination of thymol and phytol with chemotherapy drugs such as docetaxel. Combination therapy with standard chemotherapy drugs and natural products can mitigate the adverse side effects of chemotherapy drugs and enhance cancer treatment efficacy by targeting and eliminating CSCs, thus help to prolong patient survival. Although more studies are still needed, including in vivo animal and clinical studies, to verify further whether thymol and phytol treatment along with chemotherapy drugs is effective against CSCs. Declarations Competing interests: The authors have no conflicts of interest to declare that are relevant to the content of this article. Funding: This work was supported by a grant from Vice Chancellor for Research and Technology, Shahid Bahonar University of Kerman, Kerman, Iran (Grant number: 1402) Authors' contributions: NES has contributed significantly to acquisition of data and SS has contributed significantly to design of the study, analysis and interpretation of data and writing the manuscript. Acknowledgements: The authors thank Vice Chancellor for Research and Technology, Shahid Bahonar University of Kerman, Kerman, Iran for financial support References Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF (2003) Prospective identification of tumorigenic breast cancer cells. P Natl Sci 100:3983–3988. https://doi.org/10.1073/pnas.0530291100 Almanaa TN, Geusz ME, Jamasbi RJ (2012) Effects of curcumin on stem-like cells in human esophageal squamous carcinoma cell lines. Bmc Complem Altern M 12:195. https://doi.org/10.1186/1472-6882-12-195 Anoor PK, Yadav AN, Rajkumar K, Kande R, Tripura C, Naik KS, Burgula S (2022) Methanol extraction revealed anticancer compounds quinic acid, 2 (5h)–furanone and phytol in andrographis paniculata. Mol Clin Oncol 17:1–13. https://doi.org/10.3892/mco.2022.2584 Arab H-A, Fathi M, Mortezai E, Hosseinimehr SJ (2015) Chemoprotective effect of thymol against genotoxicity induced by bleomycin in human lymphocytes. Pharm Biomedical Res 1:26–31. https://doi.org/10.18869/acadpub.pbr.1.1.26 Ben-Arye E, Lavie O, Samuels N, Khamaisie H, Schiff E (2017) Safety of herbal medicine use during chemotherapy in patients with ovarian cancer: A bedside-to-bench approach. Med Oncol 34:1–6. https://doi.org/10.1007/s12032-017-0910-9 Botelho MA, Barros G, Queiroz DB, Carvalho CF, Gouvea J, Patrus L, Bannet M, Patrus D, Rego A, Silva I (2016) Nanotechnology in phytotherapy: Antiinflammatory effect of a nanostructured thymol gel from lippia sidoides in acute periodontitis in rats. Phtother Res 30:152–159. https://doi.org/10.1002/ptr.5516 Bouhtit F, Najar M, Moussa Agha D, Melki R, Najimi M, Sadki K, Boukhatem N, Bron D, Meuleman N, Hamal A (2021) New anti-leukemic effect of carvacrol and thymol combination through synergistic induction of different cell death pathways. Molecules 26:410. https://doi.org/10.3390/molecules26020410 Carvalho AM, Heimfarth L, Pereia EWM, Oliveira FS, Menezes IR, Coutinho HD, Picot L, Antoniolli AR, Quintans JS, Quintans-Junior LJ (2020) Phytol, a chlorophyll component, produces antihyperalgesic, anti-inflammatory, and antiarthritic effects: Possible nfκb pathway involvement and reduced levels of the proinflammatory cytokines tnf-α and il-6. J Nat Prod 83:1107–1117. https://doi.org/10.1021/acs.jnatprod.9b01116 Chang H-T, Hsu S-S, Chou C-T, Cheng J-S, Wang J-L, Lin K-L, Fang Y-C, Chen W-C, Chien J-M, Lu T (2011) Effect of thymol on ca2 + homeostasis and viability in mg63 human osteosarcoma cells. Pharmacology 88:201–212. https://doi.org/10.1159/000331864 Chang Y-T, Wang CC, Wang J-Y, Lee T-E, Cheng Y-Y, Morris-Natschke SL, Lee K-H, Hung C-C (2019) Tenulin and isotenulin inhibit p-glycoprotein function and overcome multidrug resistance in cancer cells. Phytomedicine 53:252–262. https://doi.org/10.1016/j.phymed.2018.09.008 Charafe-Jauffret E, Ginestier C, Iovino F, Tarpin C, Diebel M, Esterni B, Houvenaeghel G, Extra J-M, Bertucci F, Jacquemier J (2010) Aldehyde dehydrogenase 1–positive cancer stem cells mediate metastasis and poor clinical outcome in inflammatory breast cancer. Clin Cancer Res 16:45–55. https://doi.org/10.1158/1078-0432.CCR-09-1630 Chauhan AK, Bahuguna A, Paul S, Kang SC (2017) Thymol elicits hct-116 colorectal carcinoma cell death through induction of oxidative stress. Anti-Cancer Agent Me 17:1942–1950 https://doi.org/10.2174/1871520617666170327121228 Chou T-C (2006) Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev 58:621–681. https://doi.org/10.1124/pr.58.3.10 Clark DW, Palle K (2016) Aldehyde dehydrogenases in cancer stem cells: Potential as therapeutic targets. Ann Transl Med 4:518. https://doi.org/10.21037/atm.2016.11.82 Croker AK, Goodale D, Chu J, Postenka C, Hedley BD, Hess DA, Allan AL (2009) High aldehyde dehydrogenase and expression of cancer stem cell markers selects for breast cancer cells with enhanced malignant and metastatic ability. J Cell Mol Med 13:2236–2252. https://doi.org/10.1111/j.1582-4934.2008.00455.x Crystal AS, Shaw AT, Sequist LV, Friboulet L, Niederst MJ, Lockerman EL, Frias RL, Gainor JF, Amzallag A, Greninger P (2014) Patient-derived models of acquired resistance can identify effective drug combinations for cancer. Science 346:1480–1486. http://doi:10.1126/science.1254721 Torres RM, Correia MF, Paz J, Campinho A, Oliveira AM, da Mata F, Gomes JW, Santos G (2019) Phytol as an anticarcinogenic and antitumoral agent: An in vivo study in swiss mice with dmba-induced breast cancer. IUBMB Life 71:200–212. https://doi.org/10.1002/iub.1952 De La Chapa JJ, Singha PK, Lee DR, Gonzales CB (2018) Thymol inhibits oral squamous cell carcinoma growth via mitochondria-mediated apoptosis. J Oral Pathol Med 47:674–682. https://doi.org/10.1111/jop.12735 De Moraes J, De Oliveira RN, Costa JP, Junior AL, De Sousa DP, Freitas RM, Allegretti SM, Pinto PL (2014) Phytol, a diterpene alcohol from chlorophyll, as a drug against neglected tropical disease schistosomiasis mansoni. Plos Negl Trop D 8:e2617. https://doi.org/10.1371/journal.pntd.0002617 Deb DD, Parimala G, Devi SS, Chakraborty T (2011) Effect of thymol on peripheral blood mononuclear cell pbmc and acute promyelotic cancer cell line hl-60. Chem-Biol Interact 193:97–106. https://doi.org/10.1016/j.cbi.2011.05.009 Deng L, Taxipalati M, Sun P, Que F, Zhang H (2015) Phase behavior, microstructural transition, antimicrobial and antioxidant activities of a water-dilutable thymol microemulsion. Colloid Surf B 136:859–866. https://doi.org/10.1016/j.colsurfb.2015.10.031 Du B, Shim JS (2016) Targeting epithelial–mesenchymal transition (emt) to overcome drug resistance in cancer. Molecules 21:965. https://doi.org/10.3390/molecules21070965 Dumontet C, Sikic BI (1999) Mechanisms of action of and resistance to antitubulin agents: Microtubule dynamics, drug transport, and cell death. J Clin Oncol 17:1061–1061. https://doi.org/10.1200/JCO.1999.17.3.1061 Elshafie HS, Armentano MF, Carmosino M, Bufo SA, De Feo V, Camele I (2017) Cytotoxic activity of origanum vulgare l. On hepatocellular carcinoma cell line hepg2 and evaluation of its biological activity. Molecules 22:1435. https://doi.org/10.3390/molecules22091435 Escobar A, Perez M, Romanelli G, Blustein G (2020) Thymol bioactivity: A review focusing on practical applications. Arab J Chem 13:9243–9269. https://doi.org/10.1016/j.arabjc.2020.11.009 Fahey JW, Zhang Y, Talalay P (1997) Broccoli sprouts: An exceptionally rich source of inducers of enzymes that protect against chemical carcinogens. P Natl Sci 94:10367–10372. https://doi.org/10.1073/pnas.94.19.10367 Ghasemi S, Lorigooini Z, Wibowo J, Amini-Khoei H (2019) Tricin isolated from allium atroviolaceum potentiated the effect of docetaxel on pc3 cell proliferation: Role of mir-21. Nat Prod Res 33:1828–1831. https://doi.org/10.1080/14786419.2018.1437439 Gilad Y, Gellerman G, Lonard DM, Omalley BW (2021) Drug combination in cancer treatment—from cocktails to conjugated combinations. Cancers 13:669. https://doi.org/10.3390/cancers13040669 Ginestier C, Hur MH, Charafe-Jauffret E, Monville F, Dutcher J, Brown, Jacquemier J, Viens P, Kleer CG, Liu S (2007) Aldh1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell 1:555–567. 10.1016/j.stem.2007.08.014 Goebel J, Chmielewski J, Hrycyna CA (2021) The roles of the human atp-binding cassette transporters p-glycoprotein and abcg2 in multidrug resistance in cancer and at endogenous sites: Future opportunities for structure-based drug design of inhibitors. Cancer Drug Resist 4:784. 10.20517/cdr.2021.19 Gu Y-Y, Liu L-P, Qin J, Zhang M, Chen Y, Wang D, Li Z, Tang J-Z, Mo S-L (2014) Baicalein decreases side population proportion via inhibition of abcg2 in multiple myeloma cell line rpmi 8226 in vitro. Fitoterapia 94:21–28. https://doi.org/10.1016/j.fitote.2014.01.019 Gunes-Bayir A, Kocyigit A, Kiziltzn HS (2019) Effects of thymol, a natural phenolic compound, on human gastric adenocarcinoma cells in vitro. Altern Ther Health M 25:12–21. http://doi: 0.3390/molecules25143270 Hassan HFH, Mansour AM, Salama SA, El-Sayed E-S (2021) The chemopreventive effect of thymol against dimethylhydrazine and/or high fat diet-induced colon cancer in rats: Relevance to nf-κb. Life Sci 274:119335. https://doi.org/10.1016/j.lfs.2021.119335 Ho MY, Mackey JR (2014) Presentation and management of docetaxel-related adverse effects in patients with breast cancer. Cancer Manage Res 253–259. https://doi.org/10.2147/CMAR.S40601 Horvathova E, Sramkova M, Labaj J, Slamenova D (2006) Study of cytotoxic, genotoxic and DNA-protective effects of selected plant essential oils on human cells cultured in vitro. Neuro Endocrinol Lett 27:44–47 Islam MT, Khalipha AB, Bagchi R, Mondal M, Smrity SZ, Uddin SJ, Shilpi JA, Rouf R (2019) Anticancer activity of thymol: A literature-based review and docking study with emphasis on its anticancer mechanisms. IUBMB Life 71:9–19. https://doi.org/10.1002/iub.1935 Islam MT, Streck L, De Mvob A, Silva SWC, Da Concelcao Machado K, Da Conceicao Machado K, Junior ALG, Paz MFCJ, Da MATAAMOF, Sousa E JMDC (2017) Evaluation of toxic, cytotoxic and genotoxic effects of phytol and its nanoemulsion. Chemosphere 177:93–101. https://doi.org/10.1016/j.chemosphere.2017.02.145 Islam MT, Ali ES, Uddin SJ, Shaw S, Islam MA, Ahmed MI, Shill MC, Karmakar UK, Yarla NS, Khan IN (2018) Phytol: A review of biomedical activities. Food Chem Toxicol 121:82–94. https://doi.org/10.1016/j.fct.2018.08.032 Itoh T, Ono A, Kawaguchi K, Teraoka S, Harada M, Sumi K, Ando M, Tsukamasa Y, Ninomiya M, Koketu M (2018) Phytol isolated from watermelon (citrullus lanatus) sprouts induces cell death in human t-lymphoid cell line jurkat cells via s-phase cell cycle arrest. Food Chem Toxicol 115:425–435. https://doi.org/10.1016/j.fct.2018.03.033 Jaafari A, Tilaoui M, Mouse HA, Mbark LA, Aboufatima R, Chait A, Lepoivre M, Zyad A (2012) Comparative study of the antitumor effect of natural monoterpenes: Relationship to cell cycle analysis. Rev Bras Farmacogn 22:534–540. https://doi.org/10.1590/S0102-695X2012005000021 Jamali T, Kavoosi G, Safavi M, Ardestani SK (2018) In-vitro evaluation of apoptotic effect of oeo and thymol in 2d and 3d cell cultures and the study of their interaction mode with DNA. Sci Rep 8:15787. https://doi.org/10.1038/s41598-018-34055-w Jin Y-Y, Li Y-J, Ge D-S, Zhu L-L, Wang Y-Y, Luo J, Shen B-Y, Jia Q-Q, Cao C-Y, Wang W-B (2021) Combination of platycodin d with docetaxel synergistically suppressed cell growth in du-145 by enhancing apoptosis and alleviating autophagy. Eur J Integr Med 42:101302. https://doi.org/10.1016/j.eujim.2021.101302 Ju J, Zhu A-J, Yuan P (2018) Progress in targeted therapy for breast cancer. Chron Dis Transl Med 4:164–175. https://doi.org/10.1016/j.cdtm.2018.04.002 Kang S-H, Kim Y-S, Kim E-K, Hwang J-W, Jeong J-H, Dong X, Lee J-W, Moon S-H, Jeon B-T, Park P-J (2016) Anticancer effect of thymol on ags human gastric carcinoma cells. J Microbiol Biotechn 26:28–37. http://dx.doi.org/10.4014/jmb.1506.06073 Kanwar SS, Yu Y, Nautiyal J, Patel BB, Padhye S, Sarkar FH, Majumdar AP (2011) Difluorinated-curcumin (cdf): A novel curcumin analog is a potent inhibitor of colon cancer stem-like cells. Pharm Res 28:827–838. https://doi.org/10.1007/s11095-010-0336-y Khadir A, Sobeh M, Gad HA, Benbelaid F, Bendahou M, Peixoto H, Sporer F, Ashour ML, Wink M (2016) Chemical composition and biological activity of the essential oil from thymus lanceolatus. Z Naturforsch C 71:155–163. https://doi.org/10.1515/znc-2016-0005 Kim B, Jung N, Lee S, Sohng JK, Jung HJ (2016) Apigenin inhibits cancer stem cell-like phenotypes in human glioblastoma cells via suppression of c‐met signaling. Phytoher Res 30:1833–1840. https://doi.org/10.1002/ptr.5689 Kim CW, Lee HJ, Jung JH, Kim YH, Jung DB, Sohn EJ, Lee JH, Woo HJ, Baek NI, Kim YC (2015) Activation of caspase-9/3 and inhibition of epithelial mesenchymal transition are critically involved in antitumor effect of phytol in hepatocellular carcinoma cells. Phytoher Res 29:1026–1031. https://doi.org/10.1002/ptr.5342 Kim JB, Ko E, Han W, Shin I, Park SY, Noh D-Y (2008) Berberine diminishes the side population and abcg2 transporter expression in mcf-7 breast cancer cells. Panta Med 74:1693–1700. 10.1055/s-0028-1088313 Komiya T, Kyohkon M, Ohwaki S, Eto J, Katsuzaki H, Imai K, Kataoka T, Yoshioka K, Ishii Y, Hibasami H (1999) Phytol induces programmed cell death in human lymphoid leukemia molt 4b cells. Int J Mol Med 4:377–457. https://doi.org/10.3892/ijmm.4.4.377 Koppaka V, Thompon DC, Chen Y, Ellermann M, Nicolaou KC, Juvonen RO, Petersen D, Deitrich RA, Hurley TD, Vasiliou V (2012) Aldehyde dehydrogenase inhibitors: A comprehensive review of the pharmacology, mechanism of action, substrate specificity, and clinical application. Pharmacol Rev 4:520–539. https://doi.org/10.1124/pr.111.005538 Kumar S, Gupta S (2021) Dietary phytochemicals and their role in cancer chemoprevention. J Cancer Metastasis Treat 7:1–4. https://doi.org/10.20517/2394-4722.2021.125 Kumar SM, Liu S, Lu H, Zhang H, Zhang PJ, Gimotty PA, Guerra M, Guo W, Xu X (2012) Acquired cancer stem cell phenotypes through oct4-mediated dedifferentiation. Oncogene 31:4898–4911. https://doi.org/10.1038/onc.2011.656 Labbozzetta M, Poma P, Tutone M, Mccubrey JA, Sajeva M, Notarbartolo M (2022) Phytol and heptacosane are possible tools to overcome multidrug resistance in an in vitro model of acute myeloid leukemia. Pharmaceuticals 15:356. https://doi.org/10.3390/ph15030356 Lee KP, Kim JE, Park WH, Hong H (2016) Regulation of c6 glioma cell migration by thymol. Oncol Lett 11:2619–2624. https://doi.org/10.3892/ol.2016.4237 Li Y, Zhang T, Korkaya H, Liu S, Lee H-F, Newman B, Yu Y, Clouthier SG, Schwartz SJ, Wicha MS (2010) Sulforaphane, a dietary component of broccoli/broccoli sprouts, inhibits breast cancer stem cells. Clin Cancer Res 16:2580–2590. https://doi.org/10.1158/1078-0432.CCR-09-2937 Li Y, Wen J-M, Du C-J, Hu S-M, Chen J-X, Zhng S-G, Zhang N, Gao F, Li S-J, Mao X-W (2017) Thymol inhibits bladder cancer cell proliferation via inducing cell cycle arrest and apoptosis. Biochem Bioph Res Co 491:530–536. https://doi.org/10.1016/j.bbrc.2017.04.009 Lim JY, Kim Y-S, Kim K-M, Min SJ, Kim Y (2014) Β-carotene inhibits neuroblastoma tumorigenesis by regulating cell differentiation and cancer cell stemness. Biochem Bioph Res Co 450:1475–1480. https://doi.org/10.1016/j.bbrc.2014.07.021 Longley D, Johnston P (2005) Molecular mechanisms of drug resistance. J Pathol 205:275–292. https://doi.org/10.1002/path.1706 Lv R, Chen Z (2017) Thymol inhibits cell migration and invasion by downregulating the activation of pi3k/akt and erk pathways in human colon cancer cells. Trop J Pharm Res 16:2895–2901. 10.4314/tjpr.v16i12.13 Lyseng-Williamson KA, Fenton C (2005) Docetaxel: A review of its use in metastatic breast cancer. Drugs 65:2513–2531. https://doi.org/10.2165/00003495-200565170-00007 Mani SA, Guo W, Liao M-J, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M (2008) The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 133:704–715. http://doi:10.1016/j.cell.2008.03.027 Meng L, Xia X, Yang Y, Ye J, Dong W, Ma P, Jin Y, Liu Y (2016) Co-encapsulation of paclitaxel and baicalein in nanoemulsions to overcome multidrug resistance via oxidative stress augmentation and p-glycoprotein inhibition. I Int J Pharm 513:8–16. https://doi.org/10.1016/j.ijpharm.2016.09.001 Mokhtari RB, Homayouni TS, Baluch N, Morgatskaya E, Kumar S, Das B, Yeger H (2017) Combination therapy in combating cancer. Oncotarget 8:38022. https://doi:10.18632/oncotarget.16723 Mollazadeh S, Sahebkar A, Hadizadeh F, Behravan J, Arabzadeh S (2018) Structural and functional aspects of p-glycoprotein and its inhibitors. Life Sci 214:118–123. https://doi.org/10.1016/j.lfs.2018.10.048 Nadir A, Shteinfer-Kuzmine A, Pandey SK, Ortas J, Kerekes D, Shoshan-Barmatz V (2023) Pro-apoptotic and anti-cancer activity of the vernonanthura nudiflora hydroethanolic extract. Cancers 15:1627. https://doi.org/10.3390/cancers15051627 Nagoor Meeran MF, Javed H, Al Taee H, Azimullah S, Ojha SK (2017) Pharmacological properties and molecular mechanisms of thymol: Prospects for its therapeutic potential and pharmaceutical development. Front Pharmacol 8:380. https://doi.org/10.3389/fphar.2017.00380 Ohno R, Asou N, Ohnishi K (2003) Treatment of acute promyelocytic leukemia: Strategy toward further increase of cure rate. Leukemia 17:1454–1463. https://doi.org/10.1038/sj.leu.2403031 Okhale Se, Chinyere I, Fidelis SA, Aboh MI (2021) Antiproliferative, growth inhibitory and antibacterial activities of thymol isolated from the leaf of ocimum gratissimum l. Life Sci J 18:67–76. http://doi:10.7537/marslsj181121.06 Pathania AS, Guru SK, Verma M, Sharma C, Abdullah ST, Malik F, Chandra S, Katoch M, Bhushan S (2013) Disruption of the pi3k/akt/mtor signaling cascade and induction of apoptosis in hl-60 cells by an essential oil from monarda citriodora. Food Chem Toxicol 62:246–254. https://doi.org/10.1016/j.fct.2013.08.037 Pejin B, Kojic V, Bogdanovic G (2014a) An insight into the cytotoxic activity of phytol at in vitro conditions. Nat Prod Res 28:2053–2056. https://doi.org/10.1080/14786419.2014.921686 Pejin B, Savic A, Sokovic M, Glamoclija J, Ciric A, Nikolic M, Radotic K, Mojovic M (2014b) Further in vitro evaluation of antiradical and antimicrobial activities of phytol. Nat Prod Res 28:372–376. https://doi.org/10.1080/14786419.2013.869692 Pezzani R, Salehi B, Vitalini S, Iriti M, Zuniga FA, Sharifi-Rad J, Martorell M, Martins N (2019) Synergistic effects of plant derivatives and conventional chemotherapeutic agents: An update on the cancer perspective. Medicina 55:110. https://doi.org/10.3390/medicina55040110 Phi LTH, Sari IN, Yang Y-G, Lee S-H, Jun N, Kim KS, Lee YK, Kwon HY (2018) Cancer stem cells (cscs) in drug resistance and their therapeutic implications in cancer treatment. Stem Cells Int 2018: 1–16. https://doi.org/10.1155/2018/5416923 Prajapati KS, Gupta S, Kumar S (2022) Targeting breast cancer-derived stem cells by dietary phytochemicals: A strategy for cancer prevention and treatment. Cancers 14:2864. https://doi.org/10.3390/cancers14122864 Ramos A, Sadeghi S, Tabatabaeian H (2021) Battling chemoresistance in cancer: Root causes and strategies to uproot them. Int J Mol Sci 22:9451. https://doi.org/10.3390/ijms22179451 Rasti A, Mehrazma M, Madjd Z, Abolhasani M, Saeednejad Zanjani L, Asgari M (2018) Co-expression of cancer stem cell markers oct4 and nanog predicts poor prognosis in renal cell carcinomas. Sci Rep 8:11739 Sakthivel R, Malar DS, Devi KP (2018) Phytol shows anti-angiogenic activity and induces apoptosis in a549 cells by depolarizing the mitochondrial membrane potential. Biomed Pharmacother 105:742–752. https://doi.org/10.1016/j.biopha.2018.06.035 Salehi B, Mishra AP, Shukla I, Sharifi-RAD M, Contreras MDM, Segura‐Carretero A, Fathi H, Nasrabadi NN, Kobarfard F, Sharifi‐RadJ (2018) Thymol, thyme, and other plant sources: Health and potential uses. Phytother Res 32:1688–1706. https://doi.org/10.1016/j.biopha.2018.06.035 Sampaio LA, Pina LTS, Serafini MR, Tavares DDS, Guimaraes AG (2021) Antitumor effects of carvacrol and thymol: A systematic review. Front Pharmacol 12:702487. https://doi.org/10.3389/fphar.2021.702487 Sanchez BG, Bort A, Mateos-Gomez PA, Rodriguez-Henche N, Diaz-Laviada I (2019) Combination of the natural product capsaicin and docetaxel synergistically kills human prostate cancer cells through the metabolic regulator amp-activated kinase. Cancer Cell Int 19:1–14. https://doi.org/10.1186/s12935-019-0769-2 Santos CCDMP, Salvadori MS, Mota VG, Costa LM, De Almeida AAC, De Oliveira GAL, Costa JP, De Sousa DP, De Freitas RM, De Almeida RN (2013) Antinociceptive and antioxidant activities of phytol in vivo and in vitro models. Neuroscience Journal 2013. https://doi.org/10.1155/2013/949452 Saravanan S, Pari L (2015) Role of thymol on hyperglycemia and hyperlipidemia in high fat diet-induced type 2 diabetic c57bl/6j mice. Eur J Pharmacol 761:279–287. https://doi.org/10.1016/j.ejphar.2015.05.034 Satooka H, Kubo I (2012) Effects of thymol on b16-f10 melanoma cells. J Agr Food Chem 60:2746–2752. https://doi.org/10.1021/jf204525b Schmohl JU, Vallera DA (2016) Cd133, selectively targeting the root of cancer. Toxins 8:165 SHANKAR S, NALL D, TANG S-N MEEKERD, PASSARINI J, SHARMA J and SRIVASTAVA RK (2011) Resveratrol inhibits pancreatic cancer stem cell characteristics in human and kras g12d transgenic mice by inhibiting pluripotency maintaining factors and epithelial-mesenchymal transition. PLoS ONE 6:e16530. https://doi.org/10.3390/toxins8060165 Shibue T, Weinberg RA (2017) EMT, CSCs, and drug resistance: The mechanistic link and clinical implications. Nat Rev Clin Oncol 14:611–629. https://doi.org/10.1038/nrclinonc.2017.44 Shigemura K, Arbiser JL, Sun SY, Zayzafoon M, Johnstone PA, Fujisawa M, Gotoh A, Weksler B, Zhau HE, Chung LW (2007) Honokiol, a natural plant product, inhibits the bone metastatic growth of human prostate cancer cells. Cancer: Interdisciplinary Int J Am Cancer Soc 109:1279–1289. https://doi.org/10.1002/cncr.22551 Silva RO, Sousa FBM, Damasceno SR, Carvalho NS, Silva VG, Oliveira FR, Sousa DP, Aragao KS, Barbosa AL, Freitas RM (2014) Phytol, a diterpene alcohol, inhibits the inflammatory response by reducing cytokine production and oxidative stress. Fund Clin Pharmacol 28:455–464. https://doi.org/10.1111/fcp.12049 Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD, Dirks PB (2004) Identification of human brain tumour initiating cells. Nature 432:396. https://doi.org/10.1038/nature03128 Sobczak M, Kalemba D, Ferencn B, Zylinska L (2014) Limited protective properties of thymol and thyme oil on differentiated pc12 cells with downregulated mgst1. J Appl Biomed 12:235–243. https://doi.org/10.1016/j.jab.2014.08.002 Soltanian S, Sheikhbahaei M (2021) Effect of menadione and combination of gemcitabine and cisplatin on cancer stem cells in human non-small cell lung cancer (nsclc) cell line a549. IJPR 20:105. http://doi:10.22037/ijpr.2020.112373.13715 Soltanian S, Shekhbahaei M, Ziasistani M (2021) Phytol down-regulates expression of some cancer stem cell markers and decreases side population proportion in human embryonic carcinoma nccit cells. Nutr Cancer 73:1520–1533. https://doi.org/10.1080/01635581.2020.1795695 Soltanian S, Riahirad H, Pabarja A, Karimzadeh MR, Saeidi K (2017) Kaempferol and docetaxel diminish side population and down-regulate some cancer stem cell markers in breast cancer cell line mcf-7. Biocell 41:33. https://doi.org/10.32604/biocell.2017.41.033 Soltanian S, Riahirad H, Pabarja A, Jafari E, Khandani BK (2018) Effect of cinnamic acid and folfox in diminishing side population and downregulating cancer stem cell markers in colon cancer cell line ht-29. DARU 26:19–29. https://doi.org/10.1007/s40199-018-0210-8 Song Y, Cho SK (2015) Phytol induces apoptosis and ros-mediated protective autophagy in human gastric adenocarcinoma ags cells. Biochem Anal Biochem 4:1. https://doi:10.4172/2161-1009.1000211 Stoicescu EA, Burcea M, Iancu RC, Zivari M, Popa Cherecheanu A, Bujor IA, Rastoaca C, Iancu G (2021) Docetaxel for breast cancer treatment-side effects on ocular surface, a systematic review. Processes 9:1086. https://doi.org/10.3390/pr9071086 Sugahara KN, Teesaau T, Karmali PP, Kotamraju VR, Agemy L, Greenwald DR, Ruoslahti E (2010) Coadministration of a tumor-penetrating peptide enhances the efficacy of cancer drugs. Science 328:1031–1035 Tsuji T, Ibaragi S, Hu G-F (2009) Epithelial-mesenchymal transition and cell cooperativity in metastasis. Cancer Res 69:7135–7139. http://doi:10.1126/science.1183057 Tume L, Paco K, Ubidia-Incio R, Moya J (2016) Cd133 in breast cancer cells and in breast cancer stem cells as another target for immunotherapy. Gaceta Mexicana de Oncología 15:22–30. https://doi.org/10.1016/j.gamo.2016.01.003 Velasco-Velazquez MA, Homsi N, De La Fuente M, Pestell RG (2012) Breast cancer stem cells. Int J Biochem Cell Biol 44:573–577. https://doi.org/10.1016/j.biocel.2011.12.020 Verhoeven N, Wanders R, Poll-The B, Saudubray J-M, Jakob C (1998) The metabolism of phytanic acid and pristanic acid in man: A review. J Inherit Metab Dis 21:697–728. http://doi:10.1023/a:1005476631419 Wood L, Alsawy S (2018) Recovery in psychosis from a service user perspective: A systematic review and thematic synthesis of current qualitative evidence. Community Ment Hlt J 54:793–804. https://doi.org/10.1007/s10597-017-0185-9 Wu C-P, Calcagno AM, Ambudkar SV (2008) Reversal of abc drug transporter-mediated multidrug resistance in cancer cells: Evaluation of current strategies. Curr Mol Pharmacol 1:93–105. https://doi.org/10.2174/1874467210801020093 Xia P (2017) Cd133 mrna may be a suitable prognostic marker for human breast cancer. Stem cell Invest 4. http://doi:10.21037/sci.2017.10.03 Yeh J-H, Chou C-T, Chen I-S, Lu T, Lin K-L, Yu C-C, Liang W-Z, Chang H-T, Kuo C-C, Ho C-M (2017) Effect of thymol on ca^(2+) homeostasis and viability in pc3 human prostate cancer cells. Chin J Physiol 60:32–40. http://doi:10.4077/CJP.2017.BAF447 Yin Q, Zhuang Y, Yan F (2010) Antitumor efficacy of thymol. Progress Mod Biomed 10:2073–2075. http:// Zeng Q, Che Y, Zhang Y, Chen M, Guo Q, Zhang W (2020) Thymol isolated from thymus vulgaris l. Inhibits colorectal cancer cell growth and metastasis by suppressing the wnt/β-catenin pathway. Drug Des Dev Ther 14:2535–2547. https://doi.org/10.2147/DDDT.S254218 Zhang W, Zhu X-L, Ding W, Shi X-X (2015) A novel stereoselective synthesis of (–)-quinic acid starting from the naturally abundant (–)-shikimic acid. Tetrahedron: Asymmetry 26:1375–1381. https://doi.org/10.1016/j.tetasy.2015.10.008 Zhang Y, Piao B, Zhang Y, Hua B, Hou W, Xu W, Qi X, Zhu X, Pei Y, LIin H (2011) Oxymatrine diminishes the side population and inhibits the expression of β-catenin in mcf-7 breast cancer cells. Med Onc 28:99–107. https://doi.org/10.1007/s12032-010-9721-y Zhao W, Li Y, Zhang X (2017) Stemness-related markers in cancer. Cancer translational Med 3:87 Zhou W, Kallifatidis G, Baumann B, Rausch V, Mattern J, Gladkich J, Giese N, Moldenhauer G, Wirth T, Buchler MW (2010) Dietary polyphenol quercetin targets pancreatic cancer stem cells. I Int J Oncol 37:551. http://doi:10.4103/ctm.ctm_69_16 Supplementary Files GraphicalAbstract.pdf Cite Share Download PDF Status: Published Journal Publication published 15 Jul, 2025 Read the published version in Revista Brasileira de Farmacognosia → Version 1 posted Reviewers agreed at journal 31 Mar, 2025 Reviewers invited by journal 31 Mar, 2025 Editor assigned by journal 31 Mar, 2025 First submitted to journal 31 Mar, 2025 Editorial decision: Major revisions 25 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6269654","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":436400218,"identity":"b5b302cb-dabc-49fe-9466-846b08383849","order_by":0,"name":"Narjes Eslami shoabjereh","email":"","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":false,"prefix":"","firstName":"Narjes","middleName":"Eslami","lastName":"shoabjereh","suffix":""},{"id":436400219,"identity":"45f3d76e-580a-4e49-b909-f665cff9c1dd","order_by":1,"name":"sara soltanian","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYNACAwYeefnDBx8wMBwgUscBAwYZwxlsyQYkaGFgsGG4wWMmQZQWeffeg48/FNjxMM7uMavmqbkjx8/A/PDRDTxaDM+cSzY4YJDMwy5zrOw2z7FnxpINbMbGOfi0zMgxkzhgcICHsSF5220etsOJGw7wsEnj1TL/jfkPkBaGAwlmxTz/iNAiL8FjxgDWciPFjJm3jQgtBjw5xhJngH4x7DmWLDm377CxZDMBv8i3nzH8UPHHzl6evfnghzffDsvxszc/fIzXlgNIHCYeEMmMRznYlgYkDuMPAqpHwSgYBaNgZAIA3SZPUHgUNSgAAAAASUVORK5CYII=","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":true,"prefix":"","firstName":"sara","middleName":"","lastName":"soltanian","suffix":""}],"badges":[],"createdAt":"2025-03-20 12:31:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6269654/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6269654/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s43450-025-00670-8","type":"published","date":"2025-07-15T15:56:51+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82071883,"identity":"aeae1b3f-4002-40ff-8a53-b7ac5149a318","added_by":"auto","created_at":"2025-05-06 13:23:04","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":183742,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth inhibition of MCF-7 after treatment with increasing concentrations of docetaxel (a), phytol (b) and thymol (c) for 48h. Data are represented by means ± SD of three independent experiments\u003c/p\u003e","description":"","filename":"image1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/7248ba2218ac363955168b2f.jpeg"},{"id":82073595,"identity":"2d0e2bc2-88e5-4dad-9bd0-859ea89fbd64","added_by":"auto","created_at":"2025-05-06 13:31:04","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":217987,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of combined cytotoxicity of docetaxel/phytol and docetaxel/thymol in MCF-7 cells. Dose–response curve of docetaxel/phytol (a) and docetaxel/thymol (b); The combination index plot (F\u003csub\u003ea\u003c/sub\u003e-CI) plot with x=fraction affected (F\u003csub\u003ea\u003c/sub\u003e) \u003cem\u003evs\u003c/em\u003e. y=combination index (CI) \u0026nbsp;for combination of docetaxel with phytol or thymol. CI\u0026lt;0.9, = 0.9-1.1, and \u0026gt;1.1 indicates synergism, additive effect and antagonism, respectively (the Chou-Talalay plot) (c). The Cells were incubated with drugs for 48 h. The results are expressed as the mean values of three independent experiments\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/73bfd2f8ff32fc22772ea40f.jpeg"},{"id":82071909,"identity":"fe652d7c-f0b6-4a8f-a0b3-65db5a6e9226","added_by":"auto","created_at":"2025-05-06 13:23:05","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":90245,"visible":true,"origin":"","legend":"\u003cp\u003eIsobologram\u003cstrong\u003e \u003c/strong\u003eto evaluate the type of interaction between docetaxel and phytol (a) and docetaxel and thymol (b). The combination data points that fall near or on the line of additivity represents an additive drug-drug interaction, that fall on the low-left indicate synergism, and that fall on the upper-right indicate antagonism\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/0ca37b0e13ace68ead1bc7ce.jpeg"},{"id":82071891,"identity":"bf36ee16-7f2b-4d3d-9087-7974612fbba6","added_by":"auto","created_at":"2025-05-06 13:23:04","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":84174,"visible":true,"origin":"","legend":"\u003cp\u003eF\u003csub\u003ea\u003c/sub\u003e-DRI plot for combination of docetaxel and phytol (a) and docetaxel and thymol (b). F\u003csub\u003ea\u003c/sub\u003e-DRI plot is the plot of the dose-reduction index as a function of the fraction affected. DRI is folds of dose-reduction allowed for each drug, at a given degree of effect, in drug combination studies. DRI \u0026gt;1, =1, and \u0026lt;1 indicate favorable dose reduction, no dose-reduction, and negative dose-reduction, respectively\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/d45106ad3161637a938aef9e.jpeg"},{"id":82071886,"identity":"acec1719-d0df-4e82-b177-3c9a53a48d5f","added_by":"auto","created_at":"2025-05-06 13:23:04","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":169068,"visible":true,"origin":"","legend":"\u003cp\u003eqRT-PCR analysis of CD44, CD133, ABCB1 and ALDH1 gene expression after treatment of MCF-7 with docetaxel, docetaxel/phytol and docetaxel/thymol. Results were expressed as mean ± standard error of the mean (SEM) at least three independent experiments, and significant differences were compared to the untreated MCF-7 control cells (designated as 1.0). The asterisk indicates a significant (p \u0026lt; 0.05) difference in mRNA expression in comparison with untreated cells\u003c/p\u003e","description":"","filename":"image5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/a2d9947ca729563636c230e5.jpeg"},{"id":82074784,"identity":"b285baa2-4c06-478a-80fd-32f1f1991c54","added_by":"auto","created_at":"2025-05-06 13:39:04","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":145181,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of pluripotency- associated genes (OCT4, NANOG and SOX2) after treatment of MCF-7 with docetaxel, docetaxel/phytol and docetaxel/ thymol was measured by quantitative real-time PCR and compared to untreated cells as control designated as 1.0. Results were expressed as mean ± standard error of the mean (SEM) at least three independent experiments. The asterisk indicates a significant (p \u0026lt; 0.05) difference in mRNA expression in comparison with untreated cells\u003c/p\u003e","description":"","filename":"image6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/69135aa43d9019404ca5656d.jpeg"},{"id":82071906,"identity":"8da772ee-466c-4ed9-b487-d59ec877ce79","added_by":"auto","created_at":"2025-05-06 13:23:05","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":500945,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of CD44 and CD133 positive cells in untreated control MCF-7 cells and following MCF-7 treatment with docetaxel and docetaxel/thymol by flow cytometry. The cell population represented in the right low quadrants are considered positive live cells for each marker\u003c/p\u003e","description":"","filename":"image7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/853440551fdcefd8efecb80b.jpeg"},{"id":87219198,"identity":"00ace8e2-eed3-47ca-94f7-2b3ff62545e3","added_by":"auto","created_at":"2025-07-21 15:59:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2368294,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/a5834e0a-7b27-49a2-94f7-f70d559bbbdb.pdf"},{"id":82071889,"identity":"0789c422-167f-4a37-bc60-5b868629ff63","added_by":"auto","created_at":"2025-05-06 13:23:04","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":30294,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6269654/v1/ecbd0ca20df165ec3bf2a98b.pdf"}],"financialInterests":"","formattedTitle":"Combination Treatment with Docetaxel and Phytol or Thymol additively Inhibits Proliferation of Breast Cancer Cells and Down Regulate Expression of Cancer Stem Cell Markers","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBreast cancer is the most diagnosed cancer in women, affecting over 1.5\u0026nbsp;million women annually and causing the highest number of cancer-related deaths among women. Docetaxel (Taxotere), a cytotoxic taxane, is an antimicrotubular agent that effectively treats patients with breast cancer (Lyseng-Williamson and Fenton \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Although, surgery, radiotherapy, and chemotherapy constitute the main approaches to breast cancer treatment (Lyseng-Williamson and Fenton \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), high incidence of tumor recurrence and disease progression and numerous side effects lead to treatment failure (Ju et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Substantial evidence suggests that breast cancer stem cells (CSCs) comprise a small population within tumors which are highly resistant to standard conventional chemotherapy and radiotherapy, playing key roles in malignant progression, metastasis, and cancer recurrence (Velasco-Vel\u0026aacute;zquez et al. 2012). Therefore, concurrently targeting both CSCs and non-CSCs in tumors presents a promising strategy for achieving long-lasting anticancer effectiveness.\u003c/p\u003e \u003cp\u003eInvolvement of dietary phytochemicals in targeting breast CSCs and lowering their stemness and self-renewal properties may provide significant contribution in prevention and treatment of breast cancer (Prajapati et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Another advantage of various phytochemicals is their minimal toxicity and side effects, high bioavailability, and cost-effectiveness, which enhance their credibility as potent anti-cancer agents when combined with chemotherapy drugs (Kumar and Gupta \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePhytol and thymol are classified in terpenoids group of phytochemicals (de Moraes et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Phytol is a diterpene alcohol naturally found in chlorophyll, the green pigment in plants, algae and cyanobacteria. It is released when chlorophyll is broken down, making green leafy vegetable, algae and plant-based oils good sources of phytol (Islam et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Thymol is a monoterpenoid phenol that is the main active ingredient of oil extracted from species \u003cem\u003eThymus vulgaris\u003c/em\u003e L., Lamiaceae, commonly known as thyme, and other plants such as \u003cem\u003eOcimum gratissimum\u003c/em\u003e L., (syn.: \u003cem\u003eColeus yemenensis\u003c/em\u003e A.J.Paton), \u003cem\u003eCarum copticum\u003c/em\u003e L., \u003cem\u003eOliveria decumbens\u003c/em\u003e Vent, Apiaceae, and different species of the genera \u003cem\u003eOriganum\u003c/em\u003e, Satureja L., and many others (Escobar et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAmong many medicinal uses that have been reported for thymol and phytol, anti-cancer activities of these two terpenoids have been proven in several research (Bouhtit et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Chauhan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; De La Chapa et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Deb et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Elshafie et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; G\u0026uuml;nes-Bayir et al. 2019; Horv\u0026aacute;thov\u0026aacute; et al. 2006; Islam et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Jamali et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kang et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Nagoor Meeran et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Sampaio et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Satooka and Kubo \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Yeh et al. \u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Furthermore, inhibitory effect of thymol and phytol on epithelial\u0026ndash;mesenchymal transition (EMT) process, invasion, migration, and metastasis of cancer cells were documented in some studies (Kim et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Lee et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Lv and Chen \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Nadir et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Ohno et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Pathania et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Sakthivel et al. \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zeng et al. \u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Epithelial\u0026ndash;mesenchymal transition is a complex process in which epithelial cells lose cell-cell adhesion and acquire an invasive mesenchymal phenotype. This transformation contributes to the development of invasive properties essential for metastasis (Tsuji et al. \u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). There is a direct connection between EMT and the acquisition of CSC properties. Cells that have undergone EMT exhibit several characteristics similar to CSCs, including a drug-resistant phenotype and the expression of stem cell markers (Du and Shim \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Phi et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Shibue and Weinberg \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eConclusively, due to the suppressive effect of thymol and phytol on EMT and cell migration, it is likely that these two agents have an inhibitory effect on CSCs. To the best of our knowledge, no published work has studied the inhibitory effect of phytol and thymol on expression of CSCs markers in MCF-7 cells. In the current in vitro study, at first, we have examined the cytotoxic effects of docetaxel, phytol and thymol used as a single agent against breast cancer MCF-7 cell line. Then, combined cytotoxic effects of docetaxel and phytol or thymol were evaluated by calculating combination indexes (CI) and dose reduction indexes (DRI) values using CompuSyn software. We also compared inhibitory effects of docetaxel and its combination with phytol or thymol on expression of some CSCs markers.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture and Treatments\u003c/h2\u003e \u003cp\u003eWe obtained MCF-7 human breast carcinoma cells from the Iranian Biological Resource Center (IBRC, Tehran, Iran). The cells were cultured in DMEM medium (Gibco, Grand Island, USA) supplemented with 10% heat-inactivated FBS (PAN Biotech, South America), 100 U/ml penicillin, 100 \u0026micro;g/ml Streptomycin (PAN-Biotech) in a humidified incubator at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. Phytol (purity\u0026thinsp;\u0026ge;\u0026thinsp;97%; Lot number. SHBR8604l) was purchased from Sigma-Aldrich. Thymol (purity\u0026thinsp;\u0026ge;\u0026thinsp;97%; Lot number. Th971010) purchased from golexir company (School of pharmacy, Ferdowsi campus, Azadi Blv., Mashhad, Iran). Docetaxel (purity\u0026thinsp;\u0026ge;\u0026thinsp;99%; Batch number. 5F219A) purchased from Sanofi company.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCytotoxicity Assays\u003c/h3\u003e\n\u003cp\u003eCell viability was assessed using the MTT assay. The cells were seeded in 96-well microtiter plates at a density of 10⁴ cells per well and allowed to adhere overnight. Subsequently, they were treated with different concentrations of docetaxel (2.5, 5, 10, 20, 40, 80, 160 \u0026micro;M), phytol (10, 15, 20, 25, 30, 35, 40 \u0026micro;M) and thymol (400, 500, 600, 700, 800, 900, 1000 \u0026micro;M), and incubated for 48 h. Next, 10 \u0026micro;l of MTT stock solution (5 mg/ml) was added to each well, and the cells were incubated for 3 h at 37\u0026deg;C. The intracellular formazan products were then dissolved in 100 \u0026micro;l of DMSO with shaking for 10 min. Absorbance was measured at 540 nm using a microplate reader (BioTek, USA). The cytotoxicity of the various drugs was expressed as the Inhibitory Concentration (IC50) value, which represents the drug concentration needed to inhibit cell growth by 50% compared to the control. The IC\u003csub\u003e50\u003c/sub\u003e values of docetaxel, thymol, and phytol as single drugs were calculated using CompuSyn software (Biosoft, Cambridge, United Kingdom). All treatments were performed in triplicate.\u003c/p\u003e\n\u003ch3\u003eDrug Combination Assays\u003c/h3\u003e\n\u003cp\u003eThe IC\u003csub\u003e50\u003c/sub\u003e values obtained from single-drug cell viability assays were used to plan subsequent drug combination experiments. Finally, cytotoxicity of docetaxel/ phytol combination in molar ratio 1/2 and concentration ranges of 5/10, 7.5/15, 10/20, 12.5/25, 15/30, 17.5/35, 20/40, 22.5/45 \u0026micro;M and cytotoxicity of docetaxel/thymol combination in molar ratio 1/25 and concentration ranges of 2/50, 4/100, 8/200, 12/300, 20/500, 24/600 \u0026micro;M were tested. All treatments were performed in triplicate. The cytotoxicity was determined using the MTT assay as described above.\u003c/p\u003e\n\u003ch3\u003eAnalysis of drug combination\u003c/h3\u003e\n\u003cp\u003eIn order to analyze the type of interaction between docetaxel and phytol or thymol, CI and DRI values were determined using Compusyn software (Version 1.0, Compusyn, Inc., and Paramus, NJ, USA) (Chou \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) and these values were used to generate Fa-CI, Fa-DRI and isobologram plot. The combination index plot is also called the CI-Fa (combination-index vs. fraction affected) Plot. Combinatorial effects were evaluated using CI. When CI value is \u0026lt;\u0026thinsp;0.9, it defines synergy and CI\u0026thinsp;\u0026gt;\u0026thinsp;1.1 indicate antagonism, CI values ranging from 0.9 to 1.10 indicate a near-additive effect (Meng et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). DRI plot is the plot of DRI as a function of Fa. DRI indicates magnitude of dose reduction in drug dose needed to achieve a given effect in combination setting as compared to each drug alone. In the Fa-DRI plot, data points below the no dose reduction line (DRI\u0026thinsp;=\u0026thinsp;1) indicate a favorable dose reduction, whereas those above the line indicate an unfavorable dose reduction (Chou \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo draw an isobologram plot, The IC\u003csub\u003e50\u003c/sub\u003e values of docetaxel are plotted on the x-axis and The IC\u003csub\u003e50\u003c/sub\u003e values of phytol or thymol are plotted on y-axis. The diagonal line connecting these IC\u003csub\u003e50\u003c/sub\u003e values on the X and Y axes reflects the line of additivity. Any point below the additivity line indicates a synergistic interaction between the drugs at those specific concentrations. A point above the line signifies an antagonistic effect, while a point on the line represents an additive effect.\u003c/p\u003e\n\u003ch3\u003eExperimental groups and drug treatment\u003c/h3\u003e\n\u003cp\u003eMCF-7 cells were seeded in 6-cm dishes and cultured until they reached 80% confluence. In our experiment, four groups were considered. Untreated cells were served as a control group. Docetaxel group, in which cells were incubated with docetaxel alone at IC\u003csub\u003e50\u003c/sub\u003e concentrations. For another two groups, cells were treated with docetaxel/phytol or docetaxel/thymol at IC\u003csub\u003e50\u003c/sub\u003e concentration of each drug in combined form. Cells in each group were treated for 48 h. Each treatment wan repeated at least three times.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative Real-time Polymerase Chain Reaction Assessments\u003c/h2\u003e \u003cp\u003eThe expression levels of OCT4, NANOG, SOX2, ALDH1A1, ABCB1, CD133 and CD44 were determined by real-time PCR. Total RNA in all the groups was extracted using RAN extraction DENAzist kit according to the manufacturer\u0026rsquo;s protocol. RNA concentrations were determined using a NanoDrop spectrophotometer (Thermo Scientific), and RNA integrity and quality were assessed through capillary electrophoresis.\u003c/p\u003e \u003cp\u003ecDNA was synthesized using M-MuLV reverse transcriptase (Cat. No. EP0441; Thermo Scientific, Wilmington, USA) following the manufacturer\u0026rsquo;s instructions and the mRNA expression level of target genes was estimated using SYBR Green qPCR master mix (Cat. No. C101021; Parstous, Iran) and real-time PCR system (QIAGEN Rotor Gene Q). The initial denaturation was performed at 95\u0026deg;C for 15 min, followed by 40 cycles of denaturation at 95\u0026deg;C for 20 s, annealing at 62\u0026deg;C for 20 s, and extension at 72\u0026deg;C for 10 s. B2\u0026micro; gene was used as an internal control and the data evaluated by the comparative 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. The experiments were conducted in triplicate and independently repeated at least twice. Gene-specific primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of different PCR primers used in the study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026acute; to 3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eOctamer-binding transcription factor 4 (OCT4)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:CCGAAAGAGAAAGCGAACCAGTAT\u003c/p\u003e \u003cp\u003eR: CCACACTCGGACCACATCCTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e145\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNanog homeobox (NANOG)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: AATACCTCAGCCTCCAGCAGATG\u003c/p\u003e \u003cp\u003eR: CTGCGTCACACCATTGCTATTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e149\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eATP Binding Cassette Subfamily B Member 1 (ABCB1)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CACCACTGGAGCATTGACTR\u003c/p\u003e \u003cp\u003eR: CAGTGTTAGTTGCCAACCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAldehyde dehydrogenase 1 family, member A1 (\u003c/b\u003e\u003cb\u003eALDH1A1\u003c/b\u003e\u003cem\u003e)\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eSRY-box (SOX2)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eProminin 1 (CD133)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eCD44\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCAGCAGGAGTGTTTACCAA\u003c/p\u003e \u003cp\u003eR: CTTACCACGCCATAGCAA\u003c/p\u003e \u003cp\u003eF: GGGAAATGGGAGGGGTGCAAAAGAGG\u003c/p\u003e \u003cp\u003eR: TTGCGTGAGTGTGGATGGGATTGGTG\u003c/p\u003e \u003cp\u003eF: ACCGACTGAGACCCAACATC\u003c/p\u003e \u003cp\u003eR: GGTGCTGTTCATGTTCTCCA\u003c/p\u003e \u003cp\u003eF: AAGGTGGAGCAAACACAACC\u003c/p\u003e \u003cp\u003eR: AACTGCAATGCAAACTGCAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e98\u003c/p\u003e \u003cp\u003e151\u003c/p\u003e \u003cp\u003e101\u003c/p\u003e \u003cp\u003e116\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBeta-2-Microglobulin (\u003c/b\u003e\u003cb\u003eβ2M\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTCCGTGGCCTTAGCTGTG\u003c/p\u003e \u003cp\u003eR: TTTGGAGTACGCTGGATAGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e69\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFlow Cytometry Analysis\u003c/h3\u003e\n\u003cp\u003eFlow cytometry analysis was conducted on untreated control cells, as well as docetaxel- and docetaxel/thymol-treated cells. Briefly, the cells were trypsinized and washed with PBS containing 2% FBS. One million cells were suspended in 100 \u0026micro;l of PBS/2% FBS containing 10 \u0026micro;l of PE anti- Human CD133/2 or 20 \u0026micro;l of FITC anti-Human CD44, antibody. Cells were incubated at dark for 30 min in presence of antibody. After washing, cells were suspended in 0.5 ml of PBS/2% FBS and propidium iodide (PI) (Sigma-Aldrich) and 7-amino-actinomycin D (7-AAD) (Cat. No. 559763; B.D Bioscience) were added for detection of dead cells in FITC and PE-conjugated antibody- treated cells respectively. Finally, the cells were analyzed using a flow cytometer, with CD44\u0026thinsp;+\u0026thinsp;cells detected through the FL1 channel and CD133\u0026thinsp;+\u0026thinsp;cells detected through the FL2 channel.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eWe used GraphPad prism 5 software for data analysis. Data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation of triplicate measurements. One-way ANOVA was performed to assess significant differences among treatments compared to their respective untreated controls, with p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 indicating statistical significance between the mean values of triplicates.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eGrowth inhibitory effects of single agents on MCF-7 cells\u003c/h2\u003e\n \u003cp\u003eTo determine the inhibitory effect of docetaxel, phytol, and thymol as single agent on MCF-7, we first performed MTT assay. The MTT results showed that treatment with docetaxel, phytol and thymol resulted in decreased cell viability in MCF-7 cell line compared to the untreated control in a dose-dependent manner with IC\u003csub\u003e50\u003c/sub\u003e value 20.88 \u0026micro;M for docetaxel, 39 \u0026micro;M for phytol and 642 \u0026micro;M for thymol (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea, \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec) (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eThe 50% inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e) of docetaxel, phytol and thymol alone and in combination against MCF-7 cells after 48 h incubation Data represents the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" style=\"width: 37.7246%;\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 22.7545%;\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 20.3593%;\"\u003e\n \u003cp\u003eIC\u003csub\u003e50\u003c/sub\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 19.1617%;\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 37.7246%;\"\u003e\n \u003cp\u003eSample\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.7545%;\"\u003e\n \u003cp\u003eDocetaxel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 20.3593%;\"\u003e\n \u003cp\u003ePhytol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 19.1617%;\"\u003e\n \u003cp\u003eThymol\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 37.7246%;\"\u003e\n \u003cp\u003eDocetaxel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.7545%;\"\u003e\n \u003cp\u003e20.88\u0026plusmn;0.46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 20.3593%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 19.1617%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 37.7246%;\"\u003e\n \u003cp\u003ePhytol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.7545%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 20.3593%;\"\u003e\n \u003cp\u003e39\u0026plusmn;0.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 19.1617%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 37.7246%;\"\u003e\n \u003cp\u003eThymol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.7545%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 20.3593%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 19.1617%;\"\u003e\n \u003cp\u003e642\u0026plusmn;0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 37.7246%;\"\u003e\n \u003cp\u003eDocetaxel/Phytol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.7545%;\"\u003e\n \u003cp\u003e11.30\u0026plusmn;0.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 20.3593%;\"\u003e\n \u003cp\u003e22.5\u0026plusmn;0.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 19.1617%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 37.7246%;\"\u003e\n \u003cp\u003eDocetaxel/ Thymol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 22.7545%;\"\u003e\n \u003cp\u003e12.1\u0026plusmn;0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 20.3593%;\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 19.1617%;\"\u003e\n \u003cp\u003e302\u0026plusmn;0.19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eGrowth inhibitory effects of docetaxel in combination with phytol or thymol on MCF-7 cells\u003c/h2\u003e\n \u003cp\u003eTo evaluate combination cytotoxic effects of docetaxel/phytol and docetaxel/thymol against MCF-7 cells, we performed a combination study. Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea and \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb showed the dose-response curve for MCF-7 cell line exposed to docetaxel/phytol and docetaxel/thymol combination treatment. According to the results, in the presence of phytol, IC\u003csub\u003e50\u003c/sub\u003e of docetaxel was diminished to \u0026sim; 1.8-fold and in the presence of thymol, IC\u003csub\u003e50\u003c/sub\u003e of docetaxel was diminished to \u0026sim; 1.7-fold in MCF-7 cells (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eInteraction of docetaxel and phytol or thymol\u003c/h2\u003e\n \u003cp\u003eCI and DRI were determined for combination of docetaxel and phytol and combination of docetaxel and thymol. An isobologram analysis was also employed to analyze the nature of the interaction between drugs. Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec indicates that docetaxel/phytol are antagonism with CI value\u0026thinsp;\u0026gt;\u0026thinsp;1.1 for 0.05\u0026thinsp;\u0026lt;\u0026thinsp;Fa\u0026thinsp;\u0026lt;\u0026thinsp;0.5, while they are synergism with CI value\u0026thinsp;\u0026lt;\u0026thinsp;0.9 for Fa\u0026thinsp;\u0026gt;\u0026thinsp;0.6. Interaction of docetaxel and thymol are almost additive. CI\u003csub\u003e50\u003c/sub\u003e for both combinations (when combination drugs affect 50% cells; Fa: 0.5) were calculated between 0.9 and 1.1, indicating additive effect. These conclusions are summarized in Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e for the concise format of presentation. Isobologram presents graphically the nature of interaction between docetaxel and phytol or thymol. The experiment isoeffect data point for docetaxel/phytol fell to the left side of the line suggesting synergistic interaction between drugs when percentage of cell viability is 75% (Fa\u0026thinsp;=\u0026thinsp;0.75) and 90% (Fa\u0026thinsp;=\u0026thinsp;0.9). When 50% cells are affected (Fa\u0026thinsp;=\u0026thinsp;0.5), the point is near the line, which shows additive interaction of docetaxel and phytol (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). For combination of docetaxel and thymol, all points are near the line which shows additive interaction of docetaxel and thymol when Fa\u0026thinsp;=\u0026thinsp;0.5, 0.75 and 0.9 (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb). Therefore, as was shown in CI-Fa plot and Isobologram plot, both combinations showed additive interaction when 50% cells are affected. In combination of docetaxel and phytol, DRI indicate favorable dose reduction (DR I\u0026thinsp;\u0026gt;\u0026thinsp;1) for all concentration of docetaxel and for phytol when cell viability percentage is more than 30% (Fa\u0026thinsp;\u0026gt;\u0026thinsp;0.3) (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea). In combination of docetaxel and thymol, DRI indicate favorable dose reduction (DRI\u0026thinsp;\u0026gt;\u0026thinsp;1) for all concentration of thymol and for docetaxel when cell viability percentage is less than 75% (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"char\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\u0026nbsp;\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eCombination indices (CIs) for combination of docetaxel/phytol and docetaxel/thymol at different fraction of affected cells\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCombination Drugs\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFa\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCIs\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCI\u003csub\u003e50\u003c/sub\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.05 \u0026lt; Fa \u0026lt; 0.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCI \u0026gt;1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDocetaxel\u0026thinsp;+\u0026thinsp;Phytol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.5 \u0026le; Fa \u0026le; 0.6\u003c/p\u003e\n \u003cp\u003eFa \u0026gt; 0.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCI\u0026thinsp;=\u0026thinsp;0.9\u0026ndash;1.1\u003c/p\u003e\n \u003cp\u003eCI \u0026lt; 0.9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDocetaxel\u0026thinsp;+\u0026thinsp;Thymol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFa\u0026thinsp;\u0026gt;\u0026thinsp;0.65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCI\u0026thinsp;\u0026gt;\u0026thinsp;1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.05 \u0026lt; Fa \u0026le; 0.65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCI\u0026thinsp;=\u0026thinsp;0.9\u0026ndash;1.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003eFa: Fraction of affected cells\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003eCI: Combination indices\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003eCI\u0026thinsp;\u0026lt;\u0026thinsp;0.9, synergistic; CI\u0026thinsp;=\u0026thinsp;1.1\u0026ndash;0.9, additive; CI\u0026thinsp;\u0026gt;\u0026thinsp;1.1, antagonistic\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eExpression analysis of CSC-related markers following MCF-7 treatment\u003c/h2\u003e\n \u003cp\u003eQRT-PCR was performed to compare expression of some important breast CSC markers at mRNA level between different experimental groups. As shown in Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, expression of CD44 and CD133 genes significantly downregulated after co-treatment of MCF-7 cells with docetaxel and phytol or thymol (CD44: 40% and CD133: 57% in docetaxel/phytol; CD44: 38% and CD133: 88% in docetaxel/thymol), while expression of these two genes didn\u0026rsquo;t change after treatment with docetaxel alone. Expression of ABCB1 also reduced significantly after co-treatment with docetaxel and phytol (62%) or thymol (83%), while treatment with docetaxel reduced its expression only 18%.\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003eAs shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, transcript of OCT4 showed around 4-fold drop after treatment of MCF-7 cells with docetaxel/thymol, but no significant change was detected after treatment with docetaxel/phytol or docetaxel alone. Expression level of NANOG showed 1.5-fold decrease after treatment with docetaxel combined with phytol or thymol, whereas exposure of MCF-7 cells to docetaxel alone increased its expression to around 1.7-fold when compared to untreated MCF-7. Finaly, according to our results, MCF-7 treatment with docetaxel alone or combined treatment of docetaxel and phytol or thymol significantly decreased expression of SOX2 (80% in docetaxel, 60% in docetaxel/phytol and 91% in docetaxel/ thymol) and ALDH1 (74% in docetaxel, 63% in docetaxel/ phytol and 64% in docetaxel/thymol) when compared to untreated MCF-7 cells.\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eFlow cytometry analysis of CSC surface markers\u003c/h2\u003e\n \u003cp\u003eUsing flow cytometry, we determined the percentage of CD44 and CD133 positive cells in untreated, docetaxel and docetaxel/thymol treated MCF-7 cells. Results indicated that 2.5% and 6.1% of cell population are CD44 and CD133 positive in untreated cells. This proportion increased to 3.6 and 10.3% after treatment with docetaxel. However, treatment with docetaxel/thymol reduced percentage of CD44\u003csup\u003e+\u003c/sup\u003e and CD133\u003csup\u003e+\u003c/sup\u003e cell population in MCF-7 cells to 1.7% and 2.9% respectively (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study demonstrated the additive effect of phytol and thymol on cytotoxicity of docetaxel when MCF-7 cells were treated at IC\u003csub\u003e50\u003c/sub\u003e concentration of each drug in combination mode. In addition, combination treatment with docetaxel/phytol or docetaxel/thymol was more effective in reducing the expression of the CSC markers in MCF-7 cells than the treatment with docetaxel alone.\u003c/p\u003e \u003cp\u003eDocetaxel, as an antineoplastic agent, is a semisynthetic member of the taxoid class. It is a very effective chemotherapeutic agent for the treatment of metastatic or locally advanced breast cancer both as a single chemotherapeutic agent or in combination with other chemotherapeutic agents (Dumontet and Sikic \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Ho and Mackey \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Docetaxel promotes the assembly of tubulin into stable microtubules and prevents their disassembly, which results in the inhibition of mitosis in cells. Despite the positive effects of docetaxel in breast cancer therapy, a major problem in docetaxel chemotherapy is its side effects, including temporary hair loss, nausea, vomiting, diarrhea, constipation, loss of appetite, respiratory reactions, optic neurotoxicity and nervous system disorders, ocular, hematological, cardiac and gastrointestinal reactions (Stoicescu et al. \u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Furthermore, although chemotherapy reduces bulk tumour burden, but resistant breast CSCs survive and it often leads to cancer recurrence, ultimately resulting in treatment failure and increased mortality among cancer patients. The high drug resistance of CSCs is mediated by various cellular processes, including entry into a quiescent state, enhanced DNA damage repair, overexpression of anti-apoptotic proteins, and increased activity of detoxifying enzymes such as aldehyde dehydrogenases (ALDHs). Additionally, rapid drug efflux is facilitated by adenosine triphosphate-binding cassette (ABC) transporters, including P-glycoprotein (MDR1 or ABCB1), multidrug resistance-associated protein (MRP1 or ABCC1), and breast cancer resistance protein (BCRP1 or ABCG2) (Clark and Palle \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ginestier et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Goebel et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTherefore, for effective treatment of breast cancers, there is a urgent need to identify novel compounds targeting breast CSCs and their drug- resistance mechanisms (Longley and Johnston \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Phi, Sari, Yang, Lee, Jun, Kim, Lee and Kwon 2018). Recently, interests in the use of medicinal plants have increased significantly. Combination therapy with standard chemotherapy drugs and natural products can reduce the adverse side effect of chemotherapy drug and help to improve cancer treatment efficiency through the elimination of CSCs and thus help to prolong patient survival (Ben-Arye et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Crystal et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Mokhtari et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Sugahara et al. \u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Various natural products can re-sensitize CSCs to chemotherapeutic drugs by inhibiting efflux activity of the ABC transporters or alternatively by reducing the expression of genes that code for ABC transporters and thus maintain optimum concentration of the drug (Chang et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Mollazadeh et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Wu et al. \u003cspan citationid=\"CR105\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The ALDH family enzymes play a critical functional role in drug detoxification in CSCs. Natural products can inhibit ALDH1 activity and sensitize CSCs to chemotherapeutic drugs (Charafe-Jauffret et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Koppaka et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). They also induce differentiation, apoptotic and non-apoptotic cell death in cancer cells (Ramos et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Finally, natural products can target key signaling pathways involved in maintaining the CSC phenotype, including the WNT, Hedgehog, Notch, and PI3K/Akt/mTOR pathways (Pezzani et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study we selected phytol and thymol as natural derivatives. Thymol, chemically known as 2-isopropyl-5-methylphenol is a colourless crystalline monoterpene phenol commonly found in the essential oils of \u003cem\u003eThymus vulgaris\u003c/em\u003e (thyme) and other plants (Nagoor Meeran, Javed, Al Taee, Azimullah and Ojha \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Salehi et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Phytol, a precursor of vitamin E and K1, is a chlorophyll‑derived acyclic diterpene alcohol (Verhoeven et al. \u003cspan citationid=\"CR103\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). For centuries, thymol and phytol has been used in traditional medicine and has been shown to possess various pharmacological properties and broad range of biological activities (Anoor et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Botelho et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Carvalho et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; de Moraes, de Oliveira, Costa, Junior, de Sousa, Freitas, Allegretti and Pinto 2014; Deng et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Islam, Ali, Uddin, Shaw, Islam, Ahmed, Shill, Karmakar, Yarla and Khan 2018; Islam, Khalipha, Bagchi, Mondal, Smrity, Uddin, Shilpi and Rouf 2019; Nagoor Meeran, Javed, Al Taee, Azimullah and Ojha \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Okhale et al. 2021; Pejin et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2014b\u003c/span\u003e; Santos et al. \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Saravanan and Pari \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Silva et al. \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Sobczak et al. \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR110\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Anticancer activity of thymol and phytol on various types of cancers like glioblastoma, breast cancer, leukemia, osteosarcoma, hepatocellular carcinoma, cervical cancer, laryngeal carcinoma, gastric carcinoma cells, prostate adenocarcinoma, cervical, lung, colorectal and melanoma and acute myeloid leukemia has been documented (Bouhtit, Najar, Moussa Agha, Melki, Najimi, Sadki, Boukhatem, Bron, Meuleman and Hamal 2021; Chauhan, Bahuguna, Paul and Kang \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; de Alencar et al. 2019; De La Chapa, Singha, Lee and Gonzales \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Elshafie, Armentano, Carmosino, Bufo, De Feo and Camele \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; G\u0026uuml;nes-Bayir, Kocyigit and Kiziltan 2019; Horv\u0026aacute;thov\u0026aacute;, Sramkov\u0026aacute;, L\u0026aacute;baj and Slamenov\u0026aacute; 2006; Islam et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Jamali, Kavoosi, Safavi and Ardestani \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kang, Kim, Kim, Hwang, Jeong, Dong, Lee, Moon, Jeon and Park 2016; Komiya et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Pejin et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2014a\u003c/span\u003e; Sakthivel, Malar and Devi \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Sampaio, Pina, Serafini, Tavares and Guimaraes \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Satooka and Kubo \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Song and Cho \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Yeh, Chou, Chen, Lu, Lin, Yu, Liang, Chang, Kuo and Ho 2017). The major mechanisms for anticancer actions of thymol and phytol include induction of apoptosis and cell cycle arrest, suppressing cell proliferation, angiogenesis and migration (Chang et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Chauhan, Bahuguna, Paul and Kang \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Deb, Parimala, Devi and Chakraborty \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Hassan et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Islam, Ali, Uddin, Shaw, Islam, Ahmed, Shill, Karmakar, Yarla and Khan 2018; Itoh et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Jamali, Kavoosi, Safavi and Ardestani \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kang, Kim, Kim, Hwang, Jeong, Dong, Lee, Moon, Jeon and Park 2016; Khadir et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kim, Lee, Jung, Kim, Jung, Sohn, Lee, Woo, Baek and Kim 2015; Li, Wen, Du, Hu, Chen, Zhang, Zhang, Gao, Li and Mao 2017; Pathania, Guru, Verma, Sharma, Abdullah, Malik, Chandra, Katoch and Bhushan 2013; Sakthivel, Malar and Devi \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Sampaio, Pina, Serafini, Tavares and Guimaraes \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Song and Cho \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Yin et al. \u003cspan citationid=\"CR108\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Therefore, combination treatment in our study includes docetaxel as a common chemo drug and phytol or thymol as naturel derived phytochemical compounds. Since multi-drug and multi-component combinations interact at various levels, their overall effect can be synergistic, additive, or antagonistic. In pharmacology, an additive effect occurs when the combined effects of two drugs are equal to the sum of their individual effects. A drug combination is considered synergistic when the combined effect exceeds the additive effect of each drug alone, whereas it is antagonistic when the combined effect is less than the additive effect of the individual drugs (Gilad et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Our results demonstrated that docetaxel combined with phytol or thymol elicits an additive anticancer effect at IC\u003csub\u003e50\u003c/sub\u003e concentration in breast cancer MCF-7 cells. However, docetaxel/thymol combination showed antagonism interaction at lower concentration. Moreover, docetaxel/phytol combination showed antagonism effect when cell viability is less than 50% and this combination showed synergism effect when more than 65% cells are viable. Therefore, combination effects of drugs in different concentration and cell viability are different.\u003c/p\u003e \u003cp\u003eAccording to other researches, combination of various chemotherapeutic agents with thymol or phytol minimize their side effect on normal cells and improve the effectiveness of cancer treatment (Arab et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). For example, in a study by Jaafari et.al., synergistic effect of the thymol used in combination with two anticancer drugs (methotr\u0026eacute;xate and cis-platin) were demonstrated (Jaafari et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). In a study by Bouhtit el al., carvacrol can act synergistically with thymol to induce cell death in myeloid leukemia cell (Bouhtit, Najar, Moussa Agha, Melki, Najimi, Sadki, Boukhatem, Bron, Meuleman and Hamal 2021). Labbozzetta at el., indicated that phytol could suppress the expression of P-gp. By this mechanism, it could be used in combination with different anticancer chemotherapy drugs such as doxorubicin to enhance their cytotoxic effects and improve their effectiveness in patients with multi drug resistance (Labbozzetta et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The combination effects of other phytochemicals and docetaxel have also been investigated in some studies. For example, combination of platycodin D, triterpenoid saponin abundant in \u003cem\u003ePlatycodon\u003c/em\u003e grandiflorum, with docetaxel synergistically inhibited cell growth in DU-145 by promoting apoptosis and reducing autophagy (Jin et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Tricin, isolated from \u003cem\u003eAllium atroviolaceum\u003c/em\u003e, enhanced the inhibitory effect of docetaxel on PC3 cell proliferation and can be effective to reduce metastasis and overcome drug resistance (Ghasemi et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The combination of capsaicin, the active component of hot chili peppers, and docetaxel synergistically induces cell death in human prostate cancer cells by activating the metabolic regulator AMP-activated kinase (S\u0026aacute;nchez et al. 2019). Honokiol, a soluble and non-toxic natural compound derived from \u003cem\u003eMagnolia\u003c/em\u003e spp., exhibited additive effects with docetaxel, inhibiting tumor growth without causing systemic toxicity (Shigemura et al. \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The inhibitory effect of thymol and phytol on migration and metastasis was also shown in some studies. For example, C6 glioma cells treatment with thymol inhibited the migration through the phosphorylation of PKCα and ERK1/2, leading to a reduced expression of MMP-9 and MMP-2 (Lee, Kim, Park and Hong \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). According to another study, thymol suppressed EMT, invasion, and metastasis of colorectal cancer cells by suppressing the Wnt/β-catenin pathway and down regulation of EMT markers, including vimentin, Snail, and N-cadherin and up regulation of E-cadherin (Zeng, Che, Zhang, Chen, Guo and Zhang \u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Moreover, it was indicated that thymol inhibits cell migration and invasion via inhibiting PI3K/AKT and ERK pathways and decreasing activity of MMP-2 and MMP-9 in human colon cancer cells and human leukemia cells (Lv and Chen \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Pathania, Guru, Verma, Sharma, Abdullah, Malik, Chandra, Katoch and Bhushan 2013). Furthermore, treatment with phytol resulted in decreased expression of angiogenesis markers. Because of the role of angiogenesis in tumor growth, invasion, and metastasis, inhibitory effect of phytol in migration can be concluded (Nadir, Shteinfer-Kuzmine, Pandey, Ortas, Kerekes and Shoshan-Barmatz \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Sakthivel, Malar and Devi \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Phytol also inhibited key morphological changes associated with EMT, such as loss of cell adhesion and the transition to fibroblast-like mesenchymal cells in HepG2 cells. This effect was achieved by reversing the loss of E-cadherin and overexpression of p-smad2/3, alpha-smooth muscle actin, and Snail (Kim, Lee, Jung, Kim, Jung, Sohn, Lee, Woo, Baek and Kim 2015).\u003c/p\u003e \u003cp\u003eIt has been shown that cells undergoing EMT exhibit characteristics similar to stem cells derived from both normal and neoplastic cell populations, express stem cell markers and show drug resistant phenotype (Mani et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Therefore, it is likely that thymol and phytol with anti-metastatic and anti-invasion activities have anti-CSC properties and resist CSC-like characters.\u003c/p\u003e \u003cp\u003eThe present study is the first to demonstrate that in comparison with individual docetaxel, combination of docetaxel and thymol or phytol exhibited stronger inhibitory effect on expression of CSC markers in MCF-7 breast cancer cells. CD44 and CD133 are the most widely used markers for the identification of CSCs in the breast cancer (Croker et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Schmohl and Vallera \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Wood and Alsawy \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR112\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Croker el al., report subpopulations of cells expressing CD133 together with CD44/CD24 and ALDH showed colony formation ability, migration and invasion capacity (Croker, Goodale, Chu, Postenka, Hedley, Hess and Allan 2009). According to other researches, ESA+/CD44+/CD24\u0026minus;/low cells and CD133\u0026thinsp;+\u0026thinsp;tumor cells exhibit stem cell-specific properties, including self-renewal, differentiation, and tumor formation in the NOD-SCID mouse model and show chemo- and radio-resistance property (Al-Hajj et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Tume et al. \u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Xia \u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). We showed that expression of these two markers dropped sharply after co-treatment with docetaxel and phytol or thymol compared to docetaxel alone. Furthermore, ABCB1 gene expression in MCF-7 cells decreased significantly following treatment with docetaxel/thymol or docetaxel/phytol.\u003c/p\u003e \u003cp\u003eAs key stem cell-related transcription factors, octamer-binding transcription factor 4 (OCT4), sex-determining region Y-box 2 (SOX2), and Nanog homeobox (NANOG) are recognized as essential regulators of self-renewal and pluripotency in both embryonic stem cells and CSCs. These stemness-related transcription factor markers play a key role in tumorigenesis and CSC characteristics and mediate tumor proliferation and differentiation (Kumar et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Rasti et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). We observed that MCF-7 treatment with docetaxel/thymol has the most significant effect on down regulation of these pluripotency-related genes. On the opposite side, docetaxel treatment didn\u0026rsquo;t decrease expression of OCT4 and NANOG. Therefore, simultaneous treatment of MCF-7 cells with docetaxel and thymol or phytol showed more efficacy in reducing the expression of CSCs-related markers when compared with docetaxel alone. Because docetaxel/thymol treatment had the most inhibitory effect on CSC-related markers at transcript level, we compared percentage of CD44 and CD133-positive cells after treatment with docetaxel and docetaxel/thymol by flow cytometry analysis and results indicated that while docetaxel alone cannot reduce CD44\u003csup\u003e+\u003c/sup\u003e and CD133\u003csup\u003e+\u003c/sup\u003e cells percentage, co-treatment with docetaxel/thymol can reduce them.\u003c/p\u003e \u003cp\u003eThere is other evidence regarding the possible inhibitory effects of phytol on CSCs. One study showed that expression of Sox2 and Nestin as two glioma stem cell CSC markers were highly reduced after phytol treatment in glioblastoma (Nadir, Shteinfer-Kuzmine, Pandey, Ortas, Kerekes and Shoshan-Barmatz \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Soltanian at el., demonstrated that phytol was more effective than cisplatin in downregulating CSC markers, including OCT4, NANOG, SOX2, ALDH1, ABCB1, CD44, and CD133, in NCCIT cells (Soltanian et al. \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eUnlike chemotherapy drugs, inhibitory effect of many phytochemicals such as menadione, kaempferol, curcumin, berberine, baicalein, β-carotene, oxymatrine, resveratrol, quercetin, apigenin, baicalein and sulforaphane on the expression of various CSCs markers and eliminating CSC population in multiple cancers have been shown in many studies (Almanaa et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Fahey et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Gu et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kanwar et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Lim et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Shankar et al. \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Soltanian et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Soltanian et al. \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Soltanian and Sheikhbahaei \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR111\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Zhou et al. \u003cspan citationid=\"CR113\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn conclusion, our results showed that thymol and phytol could play an additive role with docetaxel at IC\u003csub\u003e50\u003c/sub\u003e concentration against breast cancer MCF-7 cells. Therefore, phytol or thymol improves the effectiveness of docetaxel against breast cancer cells. To the best of my knowledge, this study is the first that showed concomitant treatment of breast human cancer MCF-7 cells with docetaxel and phytol, or thymol resulted in reduction of CSCs, as indicated by the decreased expression of specific CSC markers. Taken together, these results may contribute to the efforts in developing a safe and efficient anti-breast cancer strategy based on combination of thymol and phytol with chemotherapy drugs such as docetaxel. Combination therapy with standard chemotherapy drugs and natural products can mitigate the adverse side effects of chemotherapy drugs and enhance cancer treatment efficacy by targeting and eliminating CSCs, thus help to prolong patient survival. Although more studies are still needed, including in vivo animal and clinical studies, to verify further whether thymol and phytol treatment along with chemotherapy drugs is effective against CSCs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eCompeting interests:\u003c/strong\u003e \u003cp\u003eThe authors have no conflicts of interest to declare that are relevant to the content of this article.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eThis work was supported by a grant from Vice Chancellor for Research and Technology, Shahid Bahonar University of Kerman, Kerman, Iran (Grant number: 1402)\u003c/p\u003e\u003ch2\u003eAuthors' contributions:\u003c/h2\u003e \u003cp\u003eNES has contributed significantly to acquisition of data and SS has contributed significantly to design of the study, analysis and interpretation of data and writing the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements:\u003c/h2\u003e \u003cp\u003eThe authors thank Vice Chancellor for Research and Technology, Shahid Bahonar University of Kerman, Kerman, Iran for financial support\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAl-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF (2003) Prospective identification of tumorigenic breast cancer cells. P Natl Sci 100:3983\u0026ndash;3988. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0530291100\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0530291100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmanaa TN, Geusz ME, Jamasbi RJ (2012) Effects of curcumin on stem-like cells in human esophageal squamous carcinoma cell lines. Bmc Complem Altern M 12:195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1472-6882-12-195\u003c/span\u003e\u003cspan address=\"10.1186/1472-6882-12-195\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnoor PK, Yadav AN, Rajkumar K, Kande R, Tripura C, Naik KS, Burgula S (2022) Methanol extraction revealed anticancer compounds quinic acid, 2 (5h)\u0026ndash;furanone and phytol in andrographis paniculata. Mol Clin Oncol 17:1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/mco.2022.2584\u003c/span\u003e\u003cspan address=\"10.3892/mco.2022.2584\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArab H-A, Fathi M, Mortezai E, Hosseinimehr SJ (2015) Chemoprotective effect of thymol against genotoxicity induced by bleomycin in human lymphocytes. Pharm Biomedical Res 1:26\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18869/acadpub.pbr.1.1.26\u003c/span\u003e\u003cspan address=\"10.18869/acadpub.pbr.1.1.26\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBen-Arye E, Lavie O, Samuels N, Khamaisie H, Schiff E (2017) Safety of herbal medicine use during chemotherapy in patients with ovarian cancer: A bedside-to-bench approach. Med Oncol 34:1\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12032-017-0910-9\u003c/span\u003e\u003cspan address=\"10.1007/s12032-017-0910-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBotelho MA, Barros G, Queiroz DB, Carvalho CF, Gouvea J, Patrus L, Bannet M, Patrus D, Rego A, Silva I (2016) Nanotechnology in phytotherapy: Antiinflammatory effect of a nanostructured thymol gel from lippia sidoides in acute periodontitis in rats. Phtother Res 30:152\u0026ndash;159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ptr.5516\u003c/span\u003e\u003cspan address=\"10.1002/ptr.5516\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBouhtit F, Najar M, Moussa Agha D, Melki R, Najimi M, Sadki K, Boukhatem N, Bron D, Meuleman N, Hamal A (2021) New anti-leukemic effect of carvacrol and thymol combination through synergistic induction of different cell death pathways. Molecules 26:410. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules26020410\u003c/span\u003e\u003cspan address=\"10.3390/molecules26020410\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarvalho AM, Heimfarth L, Pereia EWM, Oliveira FS, Menezes IR, Coutinho HD, Picot L, Antoniolli AR, Quintans JS, Quintans-Junior LJ (2020) Phytol, a chlorophyll component, produces antihyperalgesic, anti-inflammatory, and antiarthritic effects: Possible nfκb pathway involvement and reduced levels of the proinflammatory cytokines tnf-α and il-6. J Nat Prod 83:1107\u0026ndash;1117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.jnatprod.9b01116\u003c/span\u003e\u003cspan address=\"10.1021/acs.jnatprod.9b01116\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang H-T, Hsu S-S, Chou C-T, Cheng J-S, Wang J-L, Lin K-L, Fang Y-C, Chen W-C, Chien J-M, Lu T (2011) Effect of thymol on ca2\u0026thinsp;+\u0026thinsp;homeostasis and viability in mg63 human osteosarcoma cells. Pharmacology 88:201\u0026ndash;212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000331864\u003c/span\u003e\u003cspan address=\"10.1159/000331864\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang Y-T, Wang CC, Wang J-Y, Lee T-E, Cheng Y-Y, Morris-Natschke SL, Lee K-H, Hung C-C (2019) Tenulin and isotenulin inhibit p-glycoprotein function and overcome multidrug resistance in cancer cells. Phytomedicine 53:252\u0026ndash;262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phymed.2018.09.008\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2018.09.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCharafe-Jauffret E, Ginestier C, Iovino F, Tarpin C, Diebel M, Esterni B, Houvenaeghel G, Extra J-M, Bertucci F, Jacquemier J (2010) Aldehyde dehydrogenase 1\u0026ndash;positive cancer stem cells mediate metastasis and poor clinical outcome in inflammatory breast cancer. Clin Cancer Res 16:45\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/1078-0432.CCR-09-1630\u003c/span\u003e\u003cspan address=\"10.1158/1078-0432.CCR-09-1630\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChauhan AK, Bahuguna A, Paul S, Kang SC (2017) Thymol elicits hct-116 colorectal carcinoma cell death through induction of oxidative stress. Anti-Cancer Agent Me 17:1942\u0026ndash;1950\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1871520617666170327121228\u003c/span\u003e\u003cspan address=\"10.2174/1871520617666170327121228\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChou T-C (2006) Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev 58:621\u0026ndash;681. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1124/pr.58.3.10\u003c/span\u003e\u003cspan address=\"10.1124/pr.58.3.10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClark DW, Palle K (2016) Aldehyde dehydrogenases in cancer stem cells: Potential as therapeutic targets. Ann Transl Med 4:518. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21037/atm.2016.11.82\u003c/span\u003e\u003cspan address=\"10.21037/atm.2016.11.82\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCroker AK, Goodale D, Chu J, Postenka C, Hedley BD, Hess DA, Allan AL (2009) High aldehyde dehydrogenase and expression of cancer stem cell markers selects for breast cancer cells with enhanced malignant and metastatic ability. J Cell Mol Med 13:2236\u0026ndash;2252. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1582-4934.2008.00455.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1582-4934.2008.00455.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrystal AS, Shaw AT, Sequist LV, Friboulet L, Niederst MJ, Lockerman EL, Frias RL, Gainor JF, Amzallag A, Greninger P (2014) Patient-derived models of acquired resistance can identify effective drug combinations for cancer. Science 346:1480\u0026ndash;1486. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.1126/science.1254721\u003c/span\u003e\u003cspan address=\"http://doi:10.1126/science.1254721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorres RM, Correia MF, Paz J, Campinho A, Oliveira AM, da Mata F, Gomes JW, Santos G (2019) Phytol as an anticarcinogenic and antitumoral agent: An in vivo study in swiss mice with dmba-induced breast cancer. IUBMB Life 71:200\u0026ndash;212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/iub.1952\u003c/span\u003e\u003cspan address=\"10.1002/iub.1952\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe La Chapa JJ, Singha PK, Lee DR, Gonzales CB (2018) Thymol inhibits oral squamous cell carcinoma growth via mitochondria-mediated apoptosis. J Oral Pathol Med 47:674\u0026ndash;682. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jop.12735\u003c/span\u003e\u003cspan address=\"10.1111/jop.12735\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Moraes J, De Oliveira RN, Costa JP, Junior AL, De Sousa DP, Freitas RM, Allegretti SM, Pinto PL (2014) Phytol, a diterpene alcohol from chlorophyll, as a drug against neglected tropical disease schistosomiasis mansoni. Plos Negl Trop D 8:e2617. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pntd.0002617\u003c/span\u003e\u003cspan address=\"10.1371/journal.pntd.0002617\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeb DD, Parimala G, Devi SS, Chakraborty T (2011) Effect of thymol on peripheral blood mononuclear cell pbmc and acute promyelotic cancer cell line hl-60. Chem-Biol Interact 193:97\u0026ndash;106. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbi.2011.05.009\u003c/span\u003e\u003cspan address=\"10.1016/j.cbi.2011.05.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng L, Taxipalati M, Sun P, Que F, Zhang H (2015) Phase behavior, microstructural transition, antimicrobial and antioxidant activities of a water-dilutable thymol microemulsion. Colloid Surf B 136:859\u0026ndash;866. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.colsurfb.2015.10.031\u003c/span\u003e\u003cspan address=\"10.1016/j.colsurfb.2015.10.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu B, Shim JS (2016) Targeting epithelial\u0026ndash;mesenchymal transition (emt) to overcome drug resistance in cancer. Molecules 21:965. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules21070965\u003c/span\u003e\u003cspan address=\"10.3390/molecules21070965\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDumontet C, Sikic BI (1999) Mechanisms of action of and resistance to antitubulin agents: Microtubule dynamics, drug transport, and cell death. J Clin Oncol 17:1061\u0026ndash;1061. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1200/JCO.1999.17.3.1061\u003c/span\u003e\u003cspan address=\"10.1200/JCO.1999.17.3.1061\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElshafie HS, Armentano MF, Carmosino M, Bufo SA, De Feo V, Camele I (2017) Cytotoxic activity of origanum vulgare l. On hepatocellular carcinoma cell line hepg2 and evaluation of its biological activity. Molecules 22:1435. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules22091435\u003c/span\u003e\u003cspan address=\"10.3390/molecules22091435\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEscobar A, Perez M, Romanelli G, Blustein G (2020) Thymol bioactivity: A review focusing on practical applications. Arab J Chem 13:9243\u0026ndash;9269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arabjc.2020.11.009\u003c/span\u003e\u003cspan address=\"10.1016/j.arabjc.2020.11.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFahey JW, Zhang Y, Talalay P (1997) Broccoli sprouts: An exceptionally rich source of inducers of enzymes that protect against chemical carcinogens. P Natl Sci 94:10367\u0026ndash;10372. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.94.19.10367\u003c/span\u003e\u003cspan address=\"10.1073/pnas.94.19.10367\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhasemi S, Lorigooini Z, Wibowo J, Amini-Khoei H (2019) Tricin isolated from allium atroviolaceum potentiated the effect of docetaxel on pc3 cell proliferation: Role of mir-21. Nat Prod Res 33:1828\u0026ndash;1831. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/14786419.2018.1437439\u003c/span\u003e\u003cspan address=\"10.1080/14786419.2018.1437439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilad Y, Gellerman G, Lonard DM, Omalley BW (2021) Drug combination in cancer treatment\u0026mdash;from cocktails to conjugated combinations. Cancers 13:669. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cancers13040669\u003c/span\u003e\u003cspan address=\"10.3390/cancers13040669\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGinestier C, Hur MH, Charafe-Jauffret E, Monville F, Dutcher J, Brown, Jacquemier J, Viens P, Kleer CG, Liu S (2007) Aldh1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome. Cell Stem Cell 1:555\u0026ndash;567. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.stem.2007.08.014\u003c/span\u003e\u003cspan address=\"10.1016/j.stem.2007.08.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoebel J, Chmielewski J, Hrycyna CA (2021) The roles of the human atp-binding cassette transporters p-glycoprotein and abcg2 in multidrug resistance in cancer and at endogenous sites: Future opportunities for structure-based drug design of inhibitors. Cancer Drug Resist 4:784. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.20517/cdr.2021.19\u003c/span\u003e\u003cspan address=\"10.20517/cdr.2021.19\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu Y-Y, Liu L-P, Qin J, Zhang M, Chen Y, Wang D, Li Z, Tang J-Z, Mo S-L (2014) Baicalein decreases side population proportion via inhibition of abcg2 in multiple myeloma cell line rpmi 8226 in vitro. Fitoterapia 94:21\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fitote.2014.01.019\u003c/span\u003e\u003cspan address=\"10.1016/j.fitote.2014.01.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGunes-Bayir A, Kocyigit A, Kiziltzn HS (2019) Effects of thymol, a natural phenolic compound, on human gastric adenocarcinoma cells in vitro. Altern Ther Health M 25:12\u0026ndash;21. http://doi: 0.3390/molecules25143270\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassan HFH, Mansour AM, Salama SA, El-Sayed E-S (2021) The chemopreventive effect of thymol against dimethylhydrazine and/or high fat diet-induced colon cancer in rats: Relevance to nf-κb. Life Sci 274:119335. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lfs.2021.119335\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2021.119335\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHo MY, Mackey JR (2014) Presentation and management of docetaxel-related adverse effects in patients with breast cancer. Cancer Manage Res 253\u0026ndash;259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2147/CMAR.S40601\u003c/span\u003e\u003cspan address=\"10.2147/CMAR.S40601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorvathova E, Sramkova M, Labaj J, Slamenova D (2006) Study of cytotoxic, genotoxic and DNA-protective effects of selected plant essential oils on human cells cultured in vitro. Neuro Endocrinol Lett 27:44\u0026ndash;47\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam MT, Khalipha AB, Bagchi R, Mondal M, Smrity SZ, Uddin SJ, Shilpi JA, Rouf R (2019) Anticancer activity of thymol: A literature-based review and docking study with emphasis on its anticancer mechanisms. IUBMB Life 71:9\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/iub.1935\u003c/span\u003e\u003cspan address=\"10.1002/iub.1935\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam MT, Streck L, De Mvob A, Silva SWC, Da Concelcao Machado K, Da Conceicao Machado K, Junior ALG, Paz MFCJ, Da MATAAMOF, Sousa E JMDC (2017) Evaluation of toxic, cytotoxic and genotoxic effects of phytol and its nanoemulsion. Chemosphere 177:93\u0026ndash;101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.chemosphere.2017.02.145\u003c/span\u003e\u003cspan address=\"10.1016/j.chemosphere.2017.02.145\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam MT, Ali ES, Uddin SJ, Shaw S, Islam MA, Ahmed MI, Shill MC, Karmakar UK, Yarla NS, Khan IN (2018) Phytol: A review of biomedical activities. Food Chem Toxicol 121:82\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fct.2018.08.032\u003c/span\u003e\u003cspan address=\"10.1016/j.fct.2018.08.032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItoh T, Ono A, Kawaguchi K, Teraoka S, Harada M, Sumi K, Ando M, Tsukamasa Y, Ninomiya M, Koketu M (2018) Phytol isolated from watermelon (citrullus lanatus) sprouts induces cell death in human t-lymphoid cell line jurkat cells via s-phase cell cycle arrest. Food Chem Toxicol 115:425\u0026ndash;435. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fct.2018.03.033\u003c/span\u003e\u003cspan address=\"10.1016/j.fct.2018.03.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaafari A, Tilaoui M, Mouse HA, Mbark LA, Aboufatima R, Chait A, Lepoivre M, Zyad A (2012) Comparative study of the antitumor effect of natural monoterpenes: Relationship to cell cycle analysis. Rev Bras Farmacogn 22:534\u0026ndash;540. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/S0102-695X2012005000021\u003c/span\u003e\u003cspan address=\"10.1590/S0102-695X2012005000021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJamali T, Kavoosi G, Safavi M, Ardestani SK (2018) In-vitro evaluation of apoptotic effect of oeo and thymol in 2d and 3d cell cultures and the study of their interaction mode with DNA. Sci Rep 8:15787. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-018-34055-w\u003c/span\u003e\u003cspan address=\"10.1038/s41598-018-34055-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin Y-Y, Li Y-J, Ge D-S, Zhu L-L, Wang Y-Y, Luo J, Shen B-Y, Jia Q-Q, Cao C-Y, Wang W-B (2021) Combination of platycodin d with docetaxel synergistically suppressed cell growth in du-145 by enhancing apoptosis and alleviating autophagy. Eur J Integr Med 42:101302. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.eujim.2021.101302\u003c/span\u003e\u003cspan address=\"10.1016/j.eujim.2021.101302\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJu J, Zhu A-J, Yuan P (2018) Progress in targeted therapy for breast cancer. Chron Dis Transl Med 4:164\u0026ndash;175. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cdtm.2018.04.002\u003c/span\u003e\u003cspan address=\"10.1016/j.cdtm.2018.04.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang S-H, Kim Y-S, Kim E-K, Hwang J-W, Jeong J-H, Dong X, Lee J-W, Moon S-H, Jeon B-T, Park P-J (2016) Anticancer effect of thymol on ags human gastric carcinoma cells. J Microbiol Biotechn 26:28\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.4014/jmb.1506.06073\u003c/span\u003e\u003cspan address=\"10.4014/jmb.1506.06073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanwar SS, Yu Y, Nautiyal J, Patel BB, Padhye S, Sarkar FH, Majumdar AP (2011) Difluorinated-curcumin (cdf): A novel curcumin analog is a potent inhibitor of colon cancer stem-like cells. Pharm Res 28:827\u0026ndash;838. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11095-010-0336-y\u003c/span\u003e\u003cspan address=\"10.1007/s11095-010-0336-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhadir A, Sobeh M, Gad HA, Benbelaid F, Bendahou M, Peixoto H, Sporer F, Ashour ML, Wink M (2016) Chemical composition and biological activity of the essential oil from thymus lanceolatus. Z Naturforsch C 71:155\u0026ndash;163. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1515/znc-2016-0005\u003c/span\u003e\u003cspan address=\"10.1515/znc-2016-0005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim B, Jung N, Lee S, Sohng JK, Jung HJ (2016) Apigenin inhibits cancer stem cell-like phenotypes in human glioblastoma cells via suppression of c‐met signaling. Phytoher Res 30:1833\u0026ndash;1840. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ptr.5689\u003c/span\u003e\u003cspan address=\"10.1002/ptr.5689\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim CW, Lee HJ, Jung JH, Kim YH, Jung DB, Sohn EJ, Lee JH, Woo HJ, Baek NI, Kim YC (2015) Activation of caspase-9/3 and inhibition of epithelial mesenchymal transition are critically involved in antitumor effect of phytol in hepatocellular carcinoma cells. Phytoher Res 29:1026\u0026ndash;1031. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ptr.5342\u003c/span\u003e\u003cspan address=\"10.1002/ptr.5342\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JB, Ko E, Han W, Shin I, Park SY, Noh D-Y (2008) Berberine diminishes the side population and abcg2 transporter expression in mcf-7 breast cancer cells. Panta Med 74:1693\u0026ndash;1700. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1055/s-0028-1088313\u003c/span\u003e\u003cspan address=\"10.1055/s-0028-1088313\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKomiya T, Kyohkon M, Ohwaki S, Eto J, Katsuzaki H, Imai K, Kataoka T, Yoshioka K, Ishii Y, Hibasami H (1999) Phytol induces programmed cell death in human lymphoid leukemia molt 4b cells. Int J Mol Med 4:377\u0026ndash;457. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/ijmm.4.4.377\u003c/span\u003e\u003cspan address=\"10.3892/ijmm.4.4.377\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoppaka V, Thompon DC, Chen Y, Ellermann M, Nicolaou KC, Juvonen RO, Petersen D, Deitrich RA, Hurley TD, Vasiliou V (2012) Aldehyde dehydrogenase inhibitors: A comprehensive review of the pharmacology, mechanism of action, substrate specificity, and clinical application. Pharmacol Rev 4:520\u0026ndash;539. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1124/pr.111.005538\u003c/span\u003e\u003cspan address=\"10.1124/pr.111.005538\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Gupta S (2021) Dietary phytochemicals and their role in cancer chemoprevention. J Cancer Metastasis Treat 7:1\u0026ndash;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20517/2394-4722.2021.125\u003c/span\u003e\u003cspan address=\"10.20517/2394-4722.2021.125\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar SM, Liu S, Lu H, Zhang H, Zhang PJ, Gimotty PA, Guerra M, Guo W, Xu X (2012) Acquired cancer stem cell phenotypes through oct4-mediated dedifferentiation. Oncogene 31:4898\u0026ndash;4911. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/onc.2011.656\u003c/span\u003e\u003cspan address=\"10.1038/onc.2011.656\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLabbozzetta M, Poma P, Tutone M, Mccubrey JA, Sajeva M, Notarbartolo M (2022) Phytol and heptacosane are possible tools to overcome multidrug resistance in an in vitro model of acute myeloid leukemia. Pharmaceuticals 15:356. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ph15030356\u003c/span\u003e\u003cspan address=\"10.3390/ph15030356\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee KP, Kim JE, Park WH, Hong H (2016) Regulation of c6 glioma cell migration by thymol. Oncol Lett 11:2619\u0026ndash;2624. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/ol.2016.4237\u003c/span\u003e\u003cspan address=\"10.3892/ol.2016.4237\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Zhang T, Korkaya H, Liu S, Lee H-F, Newman B, Yu Y, Clouthier SG, Schwartz SJ, Wicha MS (2010) Sulforaphane, a dietary component of broccoli/broccoli sprouts, inhibits breast cancer stem cells. Clin Cancer Res 16:2580\u0026ndash;2590. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1158/1078-0432.CCR-09-2937\u003c/span\u003e\u003cspan address=\"10.1158/1078-0432.CCR-09-2937\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Wen J-M, Du C-J, Hu S-M, Chen J-X, Zhng S-G, Zhang N, Gao F, Li S-J, Mao X-W (2017) Thymol inhibits bladder cancer cell proliferation via inducing cell cycle arrest and apoptosis. Biochem Bioph Res Co 491:530\u0026ndash;536. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2017.04.009\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2017.04.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim JY, Kim Y-S, Kim K-M, Min SJ, Kim Y (2014) Β-carotene inhibits neuroblastoma tumorigenesis by regulating cell differentiation and cancer cell stemness. Biochem Bioph Res Co 450:1475\u0026ndash;1480. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2014.07.021\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2014.07.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLongley D, Johnston P (2005) Molecular mechanisms of drug resistance. J Pathol 205:275\u0026ndash;292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/path.1706\u003c/span\u003e\u003cspan address=\"10.1002/path.1706\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv R, Chen Z (2017) Thymol inhibits cell migration and invasion by downregulating the activation of pi3k/akt and erk pathways in human colon cancer cells. Trop J Pharm Res 16:2895\u0026ndash;2901. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4314/tjpr.v16i12.13\u003c/span\u003e\u003cspan address=\"10.4314/tjpr.v16i12.13\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLyseng-Williamson KA, Fenton C (2005) Docetaxel: A review of its use in metastatic breast cancer. Drugs 65:2513\u0026ndash;2531. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2165/00003495-200565170-00007\u003c/span\u003e\u003cspan address=\"10.2165/00003495-200565170-00007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMani SA, Guo W, Liao M-J, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M (2008) The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 133:704\u0026ndash;715. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.1016/j.cell.2008.03.027\u003c/span\u003e\u003cspan address=\"http://doi:10.1016/j.cell.2008.03.027\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng L, Xia X, Yang Y, Ye J, Dong W, Ma P, Jin Y, Liu Y (2016) Co-encapsulation of paclitaxel and baicalein in nanoemulsions to overcome multidrug resistance via oxidative stress augmentation and p-glycoprotein inhibition. I Int J Pharm 513:8\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijpharm.2016.09.001\u003c/span\u003e\u003cspan address=\"10.1016/j.ijpharm.2016.09.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMokhtari RB, Homayouni TS, Baluch N, Morgatskaya E, Kumar S, Das B, Yeger H (2017) Combination therapy in combating cancer. Oncotarget 8:38022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.18632/oncotarget.16723\u003c/span\u003e\u003cspan address=\"https://doi:10.18632/oncotarget.16723\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMollazadeh S, Sahebkar A, Hadizadeh F, Behravan J, Arabzadeh S (2018) Structural and functional aspects of p-glycoprotein and its inhibitors. Life Sci 214:118\u0026ndash;123. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lfs.2018.10.048\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2018.10.048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNadir A, Shteinfer-Kuzmine A, Pandey SK, Ortas J, Kerekes D, Shoshan-Barmatz V (2023) Pro-apoptotic and anti-cancer activity of the vernonanthura nudiflora hydroethanolic extract. Cancers 15:1627. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cancers15051627\u003c/span\u003e\u003cspan address=\"10.3390/cancers15051627\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagoor Meeran MF, Javed H, Al Taee H, Azimullah S, Ojha SK (2017) Pharmacological properties and molecular mechanisms of thymol: Prospects for its therapeutic potential and pharmaceutical development. Front Pharmacol 8:380. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2017.00380\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2017.00380\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhno R, Asou N, Ohnishi K (2003) Treatment of acute promyelocytic leukemia: Strategy toward further increase of cure rate. Leukemia 17:1454\u0026ndash;1463. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.leu.2403031\u003c/span\u003e\u003cspan address=\"10.1038/sj.leu.2403031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkhale Se, Chinyere I, Fidelis SA, Aboh MI (2021) Antiproliferative, growth inhibitory and antibacterial activities of thymol isolated from the leaf of ocimum gratissimum l. Life Sci J 18:67\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.7537/marslsj181121.06\u003c/span\u003e\u003cspan address=\"http://doi:10.7537/marslsj181121.06\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePathania AS, Guru SK, Verma M, Sharma C, Abdullah ST, Malik F, Chandra S, Katoch M, Bhushan S (2013) Disruption of the pi3k/akt/mtor signaling cascade and induction of apoptosis in hl-60 cells by an essential oil from monarda citriodora. Food Chem Toxicol 62:246\u0026ndash;254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fct.2013.08.037\u003c/span\u003e\u003cspan address=\"10.1016/j.fct.2013.08.037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePejin B, Kojic V, Bogdanovic G (2014a) An insight into the cytotoxic activity of phytol at in vitro conditions. Nat Prod Res 28:2053\u0026ndash;2056. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/14786419.2014.921686\u003c/span\u003e\u003cspan address=\"10.1080/14786419.2014.921686\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePejin B, Savic A, Sokovic M, Glamoclija J, Ciric A, Nikolic M, Radotic K, Mojovic M (2014b) Further in vitro evaluation of antiradical and antimicrobial activities of phytol. Nat Prod Res 28:372\u0026ndash;376. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/14786419.2013.869692\u003c/span\u003e\u003cspan address=\"10.1080/14786419.2013.869692\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePezzani R, Salehi B, Vitalini S, Iriti M, Zuniga FA, Sharifi-Rad J, Martorell M, Martins N (2019) Synergistic effects of plant derivatives and conventional chemotherapeutic agents: An update on the cancer perspective. Medicina 55:110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/medicina55040110\u003c/span\u003e\u003cspan address=\"10.3390/medicina55040110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhi LTH, Sari IN, Yang Y-G, Lee S-H, Jun N, Kim KS, Lee YK, Kwon HY (2018) Cancer stem cells (cscs) in drug resistance and their therapeutic implications in cancer treatment. Stem Cells Int 2018: 1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2018/5416923\u003c/span\u003e\u003cspan address=\"10.1155/2018/5416923\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrajapati KS, Gupta S, Kumar S (2022) Targeting breast cancer-derived stem cells by dietary phytochemicals: A strategy for cancer prevention and treatment. Cancers 14:2864. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cancers14122864\u003c/span\u003e\u003cspan address=\"10.3390/cancers14122864\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamos A, Sadeghi S, Tabatabaeian H (2021) Battling chemoresistance in cancer: Root causes and strategies to uproot them. Int J Mol Sci 22:9451. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms22179451\u003c/span\u003e\u003cspan address=\"10.3390/ijms22179451\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRasti A, Mehrazma M, Madjd Z, Abolhasani M, Saeednejad Zanjani L, Asgari M (2018) Co-expression of cancer stem cell markers oct4 and nanog predicts poor prognosis in renal cell carcinomas. Sci Rep 8:11739\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakthivel R, Malar DS, Devi KP (2018) Phytol shows anti-angiogenic activity and induces apoptosis in a549 cells by depolarizing the mitochondrial membrane potential. Biomed Pharmacother 105:742\u0026ndash;752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2018.06.035\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2018.06.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalehi B, Mishra AP, Shukla I, Sharifi-RAD M, Contreras MDM, Segura‐Carretero A, Fathi H, Nasrabadi NN, Kobarfard F, Sharifi‐RadJ (2018) Thymol, thyme, and other plant sources: Health and potential uses. Phytother Res 32:1688\u0026ndash;1706. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2018.06.035\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2018.06.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampaio LA, Pina LTS, Serafini MR, Tavares DDS, Guimaraes AG (2021) Antitumor effects of carvacrol and thymol: A systematic review. Front Pharmacol 12:702487. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2021.702487\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2021.702487\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanchez BG, Bort A, Mateos-Gomez PA, Rodriguez-Henche N, Diaz-Laviada I (2019) Combination of the natural product capsaicin and docetaxel synergistically kills human prostate cancer cells through the metabolic regulator amp-activated kinase. Cancer Cell Int 19:1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12935-019-0769-2\u003c/span\u003e\u003cspan address=\"10.1186/s12935-019-0769-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantos CCDMP, Salvadori MS, Mota VG, Costa LM, De Almeida AAC, De Oliveira GAL, Costa JP, De Sousa DP, De Freitas RM, De Almeida RN (2013) Antinociceptive and antioxidant activities of phytol in vivo and in vitro models. Neuroscience Journal 2013. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2013/949452\u003c/span\u003e\u003cspan address=\"10.1155/2013/949452\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaravanan S, Pari L (2015) Role of thymol on hyperglycemia and hyperlipidemia in high fat diet-induced type 2 diabetic c57bl/6j mice. Eur J Pharmacol 761:279\u0026ndash;287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejphar.2015.05.034\u003c/span\u003e\u003cspan address=\"10.1016/j.ejphar.2015.05.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSatooka H, Kubo I (2012) Effects of thymol on b16-f10 melanoma cells. J Agr Food Chem 60:2746\u0026ndash;2752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/jf204525b\u003c/span\u003e\u003cspan address=\"10.1021/jf204525b\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmohl JU, Vallera DA (2016) Cd133, selectively targeting the root of cancer. Toxins 8:165\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSHANKAR S, NALL D, TANG S-N MEEKERD, PASSARINI J, SHARMA J and SRIVASTAVA RK (2011) Resveratrol inhibits pancreatic cancer stem cell characteristics in human and kras g12d transgenic mice by inhibiting pluripotency maintaining factors and epithelial-mesenchymal transition. PLoS ONE 6:e16530. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/toxins8060165\u003c/span\u003e\u003cspan address=\"10.3390/toxins8060165\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShibue T, Weinberg RA (2017) EMT, CSCs, and drug resistance: The mechanistic link and clinical implications. Nat Rev Clin Oncol 14:611\u0026ndash;629. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrclinonc.2017.44\u003c/span\u003e\u003cspan address=\"10.1038/nrclinonc.2017.44\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShigemura K, Arbiser JL, Sun SY, Zayzafoon M, Johnstone PA, Fujisawa M, Gotoh A, Weksler B, Zhau HE, Chung LW (2007) Honokiol, a natural plant product, inhibits the bone metastatic growth of human prostate cancer cells. Cancer: Interdisciplinary Int J Am Cancer Soc 109:1279\u0026ndash;1289. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/cncr.22551\u003c/span\u003e\u003cspan address=\"10.1002/cncr.22551\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva RO, Sousa FBM, Damasceno SR, Carvalho NS, Silva VG, Oliveira FR, Sousa DP, Aragao KS, Barbosa AL, Freitas RM (2014) Phytol, a diterpene alcohol, inhibits the inflammatory response by reducing cytokine production and oxidative stress. Fund Clin Pharmacol 28:455\u0026ndash;464. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/fcp.12049\u003c/span\u003e\u003cspan address=\"10.1111/fcp.12049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD, Dirks PB (2004) Identification of human brain tumour initiating cells. Nature 432:396. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature03128\u003c/span\u003e\u003cspan address=\"10.1038/nature03128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSobczak M, Kalemba D, Ferencn B, Zylinska L (2014) Limited protective properties of thymol and thyme oil on differentiated pc12 cells with downregulated mgst1. J Appl Biomed 12:235\u0026ndash;243. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jab.2014.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.jab.2014.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoltanian S, Sheikhbahaei M (2021) Effect of menadione and combination of gemcitabine and cisplatin on cancer stem cells in human non-small cell lung cancer (nsclc) cell line a549. IJPR 20:105. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.22037/ijpr.2020.112373.13715\u003c/span\u003e\u003cspan address=\"http://doi:10.22037/ijpr.2020.112373.13715\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoltanian S, Shekhbahaei M, Ziasistani M (2021) Phytol down-regulates expression of some cancer stem cell markers and decreases side population proportion in human embryonic carcinoma nccit cells. Nutr Cancer 73:1520\u0026ndash;1533. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/01635581.2020.1795695\u003c/span\u003e\u003cspan address=\"10.1080/01635581.2020.1795695\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoltanian S, Riahirad H, Pabarja A, Karimzadeh MR, Saeidi K (2017) Kaempferol and docetaxel diminish side population and down-regulate some cancer stem cell markers in breast cancer cell line mcf-7. Biocell 41:33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.32604/biocell.2017.41.033\u003c/span\u003e\u003cspan address=\"10.32604/biocell.2017.41.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoltanian S, Riahirad H, Pabarja A, Jafari E, Khandani BK (2018) Effect of cinnamic acid and folfox in diminishing side population and downregulating cancer stem cell markers in colon cancer cell line ht-29. DARU 26:19\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s40199-018-0210-8\u003c/span\u003e\u003cspan address=\"10.1007/s40199-018-0210-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Y, Cho SK (2015) Phytol induces apoptosis and ros-mediated protective autophagy in human gastric adenocarcinoma ags cells. Biochem Anal Biochem 4:1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.4172/2161-1009.1000211\u003c/span\u003e\u003cspan address=\"https://doi:10.4172/2161-1009.1000211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStoicescu EA, Burcea M, Iancu RC, Zivari M, Popa Cherecheanu A, Bujor IA, Rastoaca C, Iancu G (2021) Docetaxel for breast cancer treatment-side effects on ocular surface, a systematic review. Processes 9:1086. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pr9071086\u003c/span\u003e\u003cspan address=\"10.3390/pr9071086\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugahara KN, Teesaau T, Karmali PP, Kotamraju VR, Agemy L, Greenwald DR, Ruoslahti E (2010) Coadministration of a tumor-penetrating peptide enhances the efficacy of cancer drugs. Science 328:1031\u0026ndash;1035\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuji T, Ibaragi S, Hu G-F (2009) Epithelial-mesenchymal transition and cell cooperativity in metastasis. Cancer Res 69:7135\u0026ndash;7139. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.1126/science.1183057\u003c/span\u003e\u003cspan address=\"http://doi:10.1126/science.1183057\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTume L, Paco K, Ubidia-Incio R, Moya J (2016) Cd133 in breast cancer cells and in breast cancer stem cells as another target for immunotherapy. Gaceta Mexicana de Oncolog\u0026iacute;a 15:22\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.gamo.2016.01.003\u003c/span\u003e\u003cspan address=\"10.1016/j.gamo.2016.01.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVelasco-Velazquez MA, Homsi N, De La Fuente M, Pestell RG (2012) Breast cancer stem cells. Int J Biochem Cell Biol 44:573\u0026ndash;577. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biocel.2011.12.020\u003c/span\u003e\u003cspan address=\"10.1016/j.biocel.2011.12.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerhoeven N, Wanders R, Poll-The B, Saudubray J-M, Jakob C (1998) The metabolism of phytanic acid and pristanic acid in man: A review. J Inherit Metab Dis 21:697\u0026ndash;728. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.1023/a:1005476631419\u003c/span\u003e\u003cspan address=\"http://doi:10.1023/a:1005476631419\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWood L, Alsawy S (2018) Recovery in psychosis from a service user perspective: A systematic review and thematic synthesis of current qualitative evidence. Community Ment Hlt J 54:793\u0026ndash;804. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10597-017-0185-9\u003c/span\u003e\u003cspan address=\"10.1007/s10597-017-0185-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu C-P, Calcagno AM, Ambudkar SV (2008) Reversal of abc drug transporter-mediated multidrug resistance in cancer cells: Evaluation of current strategies. Curr Mol Pharmacol 1:93\u0026ndash;105. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/1874467210801020093\u003c/span\u003e\u003cspan address=\"10.2174/1874467210801020093\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia P (2017) Cd133 mrna may be a suitable prognostic marker for human breast cancer. Stem cell Invest 4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.21037/sci.2017.10.03\u003c/span\u003e\u003cspan address=\"http://doi:10.21037/sci.2017.10.03\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYeh J-H, Chou C-T, Chen I-S, Lu T, Lin K-L, Yu C-C, Liang W-Z, Chang H-T, Kuo C-C, Ho C-M (2017) Effect of thymol on ca^(2+) homeostasis and viability in pc3 human prostate cancer cells. Chin J Physiol 60:32\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.4077/CJP.2017.BAF447\u003c/span\u003e\u003cspan address=\"http://doi:10.4077/CJP.2017.BAF447\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin Q, Zhuang Y, Yan F (2010) Antitumor efficacy of thymol. Progress Mod Biomed 10:2073\u0026ndash;2075. http://\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng Q, Che Y, Zhang Y, Chen M, Guo Q, Zhang W (2020) Thymol isolated from thymus vulgaris l. Inhibits colorectal cancer cell growth and metastasis by suppressing the wnt/β-catenin pathway. Drug Des Dev Ther 14:2535\u0026ndash;2547. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2147/DDDT.S254218\u003c/span\u003e\u003cspan address=\"10.2147/DDDT.S254218\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Zhu X-L, Ding W, Shi X-X (2015) A novel stereoselective synthesis of (\u0026ndash;)-quinic acid starting from the naturally abundant (\u0026ndash;)-shikimic acid. Tetrahedron: Asymmetry 26:1375\u0026ndash;1381. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tetasy.2015.10.008\u003c/span\u003e\u003cspan address=\"10.1016/j.tetasy.2015.10.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Piao B, Zhang Y, Hua B, Hou W, Xu W, Qi X, Zhu X, Pei Y, LIin H (2011) Oxymatrine diminishes the side population and inhibits the expression of β-catenin in mcf-7 breast cancer cells. Med Onc 28:99\u0026ndash;107. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12032-010-9721-y\u003c/span\u003e\u003cspan address=\"10.1007/s12032-010-9721-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao W, Li Y, Zhang X (2017) Stemness-related markers in cancer. Cancer translational Med 3:87\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou W, Kallifatidis G, Baumann B, Rausch V, Mattern J, Gladkich J, Giese N, Moldenhauer G, Wirth T, Buchler MW (2010) Dietary polyphenol quercetin targets pancreatic cancer stem cells. I Int J Oncol 37:551. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://doi:10.4103/ctm.ctm_69_16\u003c/span\u003e\u003cspan address=\"http://doi:10.4103/ctm.ctm_69_16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"revista-brasileira-de-farmacognosia","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rbfa","sideBox":"Learn more about [Revista Brasileira de Farmacognosia](https://www.springer.com/journal/43450)","snPcode":"43450","submissionUrl":"https://www.editorialmanager.com/rbfa/default2.aspx","title":"Revista Brasileira de Farmacognosia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Breast cancer stem cell, Cytotoxicity, Phytol, Thymol, Docetaxel, Drug combination","lastPublishedDoi":"10.21203/rs.3.rs-6269654/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6269654/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBreast cancer stem cells are responsible for breast cancer tumorigenesis, metastasis, drug resistance and relapse. Involvement of phytochemicals in targeting breast cancer stem cells provides significant contribution in treatment of breast cancer. We evaluated inhibitory effects of docetaxel and its combination with phytol or thymol on proliferation of breast cancer MCF-7 cells and down-regulation of some cancer stem cell markers. Using MTT assay, docetaxel, phytol and thymol showed cytotoxic activity with IC\u003csub\u003e50\u003c/sub\u003e values 20.88, 39 and 642 \u0026micro;M respectively. In the presence of phytol and thymol, IC\u003csub\u003e50\u003c/sub\u003e of docetaxel was diminished to 11.30 and 12.1 \u0026micro;M. Combination index calculation and isobologram analysis using CompuSyn software indicated that combination of docetaxel and thymol or phytol at IC\u003csub\u003e50\u003c/sub\u003e concentration of each drug generated additive anticancer effect. Real-time quantitative PCR results showed that simultaneous treatment of MCF-7 cells with docetaxel and thymol or phytol showed more efficacy in down-regulation of CD133, CD44, and ABCB1 when compared with docetaxel alone. Moreover, expressions of OCT4 and SOX2 reduced significantly following co- treatment with docetaxel and thymol. In conclusion, purpose of applying multi-drug (Chemotherapy drugs and phytochemical compounds) combinations is to obtain the greatest anti-cancer therapeutic benefit while minimizing toxic side effects. Combination of docetaxel with phytol or thymol evaluated in this study potentiates the cytotoxic properties of docetaxel to kill MCF-7 cancer cells and showed greater effect on reducing expression of CSC markers than docetaxel alone and thus could enhance chemosensitivity to docetaxel and protect cancer patients from cancer recurrence.\u003c/p\u003e","manuscriptTitle":"Combination Treatment with Docetaxel and Phytol or Thymol additively Inhibits Proliferation of Breast Cancer Cells and Down Regulate Expression of Cancer Stem Cell Markers","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-06 13:22:59","doi":"10.21203/rs.3.rs-6269654/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-03-31T14:49:30+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-03-31T14:31:15+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-03-31T10:43:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Revista Brasileira de Farmacognosia","date":"2025-03-31T06:43:03+00:00","index":"","fulltext":""},{"type":"decision","content":"Major revisions","date":"2025-03-25T12:48:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"revista-brasileira-de-farmacognosia","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"rbfa","sideBox":"Learn more about [Revista Brasileira de Farmacognosia](https://www.springer.com/journal/43450)","snPcode":"43450","submissionUrl":"https://www.editorialmanager.com/rbfa/default2.aspx","title":"Revista Brasileira de Farmacognosia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"004e916d-7e77-441c-9a42-9357a3064ea3","owner":[],"postedDate":"May 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-07-21T15:58:13+00:00","versionOfRecord":{"articleIdentity":"rs-6269654","link":"https://doi.org/10.1007/s43450-025-00670-8","journal":{"identity":"revista-brasileira-de-farmacognosia","isVorOnly":false,"title":"Revista Brasileira de Farmacognosia"},"publishedOn":"2025-07-15 15:56:51","publishedOnDateReadable":"July 15th, 2025"},"versionCreatedAt":"2025-05-06 13:22:59","video":"","vorDoi":"10.1007/s43450-025-00670-8","vorDoiUrl":"https://doi.org/10.1007/s43450-025-00670-8","workflowStages":[]},"version":"v1","identity":"rs-6269654","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6269654","identity":"rs-6269654","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00