Construction of eukaryotic expression vector of Apoptin-etag and TAT-Apoptin-etag and their effects on human esophageal squamous cell carcinoma in vitro | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Construction of eukaryotic expression vector of Apoptin-etag and TAT-Apoptin-etag and their effects on human esophageal squamous cell carcinoma in vitro Jin-xiang Zhu, Ming-xin Zhang, Su-na Zhou, Zhang jia, Jian-sheng Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3992497/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Esophageal carcinoma is one of the six most common carcinomas in the world, known for its late clinical presentation, rapid progression and poor survival. Compared with developed countries, the prevalence of esophageal cancer has significant differences in pathology, with significantly higher mortality and regional incidence. Esophageal squamous cell carcinoma (ESCC) is the most common type in China and in recent years, the incidence has shown an upward trend in the county. Considering the characteristics of esophageal cancer in China, seeking new treatments for esophageal squamous cell carcinoma is of great concern to clinicians. Apoptin, which is derived from chicken anemia, and has tumor-specific killing effects, is composed of 121 amino acids. Although the mechanism is not yet explained, it has been extensively studied and used in the treatment of malignant tumors. Here, we selected two human squamous cell carcinoma lines and constructed eukaryotic expression vectors of apoptin and TAT-apoptin fusion protein to investigate their effect on cell proliferation and cell cycle in transfection cells. Apoptin TAT-Apoptin eukaryotic expression vector ESCC Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Esophageal squamous cell carcinoma (ESCC) is one of the six most common carcinomas in the world, [1] with a very high incidence in China. It is known for its late clinical presentation, rapid progression, and poor survival. Despite improvements in diagnosis, surgical techniques, and chemoradiotherapy, treatment of ESCC remains rather poor worldwide. [2] Therefore, new treatment strategies are being sought after worldwide and apoptin may be a viable method. Recently, a group of vital and cellular proteins that can selectively kill tumor cells has been described and has attracted the attention of researchers. Apoptin derived from chicken anemia virus, is just one of them. [3–4] Composed of 121 amino acids, apoptin showed insignificant sequence homology with established cellular proteins. To date, more than 70 different tumor cell lines have been reported to be sensitive to apoptin induced apoptosis. [3–5] The cellular mechanisms of apoptin induce apoptosis still recalls unclear. Evidence has demonstrated that nuclear localization plays a key role in apoptin induced apoptosis. Apoptin can induce apoptosis in human tumor cells but cannot penetrate the membrane itself. [5] There are two basic strategies for using apoptin in vitro. One is to obtain fusing proteins that contain cell-penetrating peptides (CPPs) and apoptin by constructing a prokaryotic expression vector. [6–10] . CPPs play a role to translocate apoptin into cells, after which apoptin can function in the nucleus. [11–13] A typical example of CPPs is TAT, a transcription regulator protein of HIV-1. [12] The other commonly used way is what we do here. In this study, we constructed eukaryotic expression vectors of pIRES2- TAT-Apoptin- etag-EGFP, pIRES2-Apoptin-etag-EGFP and pIRES2-TAT-etag-EGFP. When transferred into esophageal carcinoma cell lines, the recombinant can express TAT-Apoptin-etag, Apoptin-etag and TAT-etag under fluorescence microscopy. This method is different from fused proteins migration into cells. The recombinant foreign gene is translocated into cells and secretes proteins that can function in cells. The effects of Apoptin and TAT-apoptin on esophageal carcinoma cells are tested by MTT assay and flow cytometry. The localization of Apoptin will also be tested by indirect immunofluorescence method. 2. Materials and methods 2.1 Bacterial stain, plasmids and media Competent DH5α, which was used as the host strain for plasmids manipulation and amplification, was prepared in our library. The template plasmid pEHLYA2-SD-TAT-Apoptin was constructed by Dr. Suna Zhou, Medical College of Xi’an Jiaotong University, China. [12] The cloning vector pMD18-T was purchased from TaKaRa (Dalian, China), and the plasmid pIRES2-EGFP was kindly provided by Dr. Wenjuan Wang, Medical College of Xi’an Jiaotong University, China. The culture media LB was prepared as tryptone 10 g/l, yeast extract 5 g/l, NaCl 10 g/l. 2.2 Enzymes and primiers The restriction enzymes of EcoRⅠ and XhoLⅠ, T4DNA ligase and DNA polymerase were purchased from TaKaRa (Dalian, China). The primiers used were synthesized by Shanghai xuguan Biotechnological Development Co., Ltd. The TAT-etag sequence (sense: XhoLI5'- CTCGAG ATGTATGGCAGGAAGAAGCGTAGACAGAGACGTAGAGGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGAT GAATTC -3' EcoRI) was synthesized by Shanghai xuguan Biotechnological Development Co., Ltd. 2.3 Cell lines and cell culture Eca109 and Te-1 (human esophageal carcinoma cell line) were obtained from the Basic Medicine Cell Center of The Chinese Academy of Medical Sciences. Cells were maintained in RPMI 1640 medium, supplemented with 10% newborn calf serum (NCF), 1mMol/L sodium pyruvate, 100kU/L penicillin, 100kU/L streptomycin. Cells were grown in a 95% air, 5%CO2 humidified incubator at 37℃. 2.4 The construction of eukaryotic expression vectors of TAT-etag, TAT-Apoptin-etag, Apoptin-etag. 2.4.1 Prepared of eukaryotic expression vector of pIRES2-EGFP Circular vector of pIRES2-EGFP turned into linear form with digestion of XholI and EcoRI. 2.4.2 Construction of expression vector of TAT-etag The TAT-etag sequence, which was synthesized by Shanghai xuguan Biotechnological Development Co., Ltd., was initially contained in the PUC19 vector. To obtain TAT-etag sequence, the PUC19 vector was digested with XholI and EcoRI. The enzyme cut products were purified using the EZ splinclomn Page Gel Oligo Extraction Kit (BBI, Canada). The purified enzyme products were then ligated to the multi-cloning sites of pIRES2-EGFP, which was also digested with XholI and EcoRI, at a ratio of 10:1 using T4 DNA Ligase (TaKaRa). Finally, DNA sequencing was performed by Beijing Genomics Institute (Beijing, China). 2.4.3 Construction of expression vector of TAT-Apoptin-etag and Apoptin-etag The template plasmid pEHLYA2-SD-TAT-Apoptin containing TAT-apoptin sequence was constructed by Dr. Suna Zhou. Two pairs of primers were used: TAT-apoptin primers (sense:5' CTCGAG ATGAACGCTCTCCA3' XhoLI, antisense:5' GAATTC ATCGGTTCCAGCGGAT3' EcoRI) and Apoptin primers (sense:5' CTCGAG ATGGCTTATGGCAG3’XhoLI, antisense5' GAATTC ATCGGTTCCAGCGGAT3' EcoRI), which were synthesized by Shanghai xuguan Biotechnological Development Co., Ltd. The DNA sequences TAT-Apoptin and Apoptin, both appended with XholI and EcoRI enzyme sites, were PCR-amplified from the template plasmid pEHLYA2-SD-TAT-Apoptin using rTaq PCR PreMix (TaKaRa, Dalian, China) and the aforementioned primer pairs in a Mastercycler gradient PCR system (Eppendorf, USA). A temperature profile was programmed as follows: an initial denaturation step for 5 minutes at 94℃, 30 cycles of 30 seconds at 94℃, 30 seconds at 55℃, 1 minute at 72 minutes, and a final extension at 60℃. The PCR products were gel-purified using the EZ splinclomn Page Gel Oligo Extraction Kit (BBI, Canada) and cloned into pMD-18T(TaKaRa). DNA sequencing was performed by Beijing Genomics Institute (Beijing, China) to ensure no mutations occurred in the PCR. Recombinant pMD-18T ligated with TAT-apoptin or Apoptin sequence was transformed into competent bacterial DH5α. The transformed competent bacterial DH5α was transferred to LB medium, containing anti-aminobenzylpenicillin and cultured for 12–14 hours in an incubator at 37℃. Two clones were selected, maintained in LB medium, and shaken for 12–14 hours at 37℃, 170-180R in the incubator. 5ml of LB medium was collected and plasmids were extracted according to the EZNA Plasmid Miniprep Kit (Omega). The recombinant plasmids of pMD-18T ligated with TAT-Apoptin or Apoptin sequence were digested with XholI and EcoRI to attain TAT-Apoptin or Apoptin sequence. Enzyme cut products were gel-purified using EZ splinclomn Page Gel Oligo Extraction Kit (BBI, Canada). The retrieved enzyme products were ligated to the multi-cloning sites of pIRES2-EGFP digested with XholI and EcoRI at a ratio of 10:1 with T4 DNA ligase (TaKaRa). DNA sequencing was performed by Beijing Genomics Institute (Beijing, China) to demonstrate that the expression vector of TAT-Apoptin-etag and Apoptin-etag was finally successfully constructed. 2.5 Amplification of recombinant eukaryotic expression vector of TAT-etag, TAT- Apoptin-etag, Apoptin- etag. The transformed competent bacterial DH5α which was carried out with recombinant eukaryotic expression vector of TAT-etag, TAT-Apoptin-etag or Apoptin-etag, was maintained in 5ml LB medium containing kanamycin (50ug/ml) and incubated at 37 ℃ Overnight. Then, recombinant plasmids were harvested following the procedures of EZNA Plasmid Miniprep Kit (Omega). 2.6 Transfections of Eca109 and Te-1 cells and group of experiments Eca109 and te-1 cells were transiently transfected with recombinant plasmids pIRES2-TAT-Apoptin-etag-EGFP, pIRES2-Apoptin-etag-EGFP and pIRES2-TAT- etag-EGFP by liposome, lipofectamine2000 (Gibco). Eca109 and Te-1 cells also were also transfected with pIRES2-EGFP as a control. At the same time, liposome alone incubated with cells also served as a control. Cells were detected 24h later under a fluorescence microscope (Olympus, Tokyo, Japan) to examine the efficiency of transfection. 2.7 Detection of Apoptin expression and subcellular localization by immuno- fluorescence In the beginning, small coverslips were placed in 24-well plates. Then 1×10^5 /well Eca109 cells were plated into 24-well plate. After 24 hours, recombinant plasmids mixed with liposome (lipofectamine 2000, Gibco) were added to the 24-well plate. 48 hours later, the cells were washed 3 times with PBS and fixed with paraformaldehyde for 10 minutes. Then they were permeabilized with 0.5% Triton100 for 15minuteutes. After washing with PBS, the antibodies were blocked with 1% BSA for 30minuteutes. The cells were then washed again with PBS and incubated with Rabbit anti-etag monoclonal antibody (Abcam, USA) overnight. Then washing with PBS, the cells were incubated with the secondary goat anti-Rabbit antibody with TRITC (TaKaRa, China) for 1 hour at 37℃. After washing with PBS, the cells were stained with DAPI (0.5ng/ml) for 2 minutes, then washed with PBS 3 times and treated with RNAse for 5 minutes. Then the coverslips were placed on glass slides that were fixed with 50% Glycerin. Finally, the results were observed under the fluorescence microscope (Olympus, Tokyo, Japan). 2.8 Detection of human esophageal carcinoma cell (Eca109 and Te-1) viability by MTT assay Eca109 and Te-1 cells were subjected to apoptosis. Eca109 and Te-1 cells were plated in 96–cell plates at approximately 2×10 4 /well respectively. After 24 hours, the cells were transfected, and the experimental group was described in 2.6. Cell viability was measured by colorimetric MTT assay 24 or 48 hours after transfection. 2.9 Cell cycle and apoptosis analysis by flow cytometry Eca109 and Te-1 cells were plated into 6-well plates respectively. After 24 hours, the cells were transfected and of the experimental group was the same as mentioned above. 48 hours later, at least 1×10 6 /well cells were collected by digesting with pancreatic enzymes. After collection, the cells were washed 3 times with pre-cool PBS and then fixed in 70% ethanol at 4℃ overnight. Centrifuged at 800 rpm for 5 minutes to collect cells and discard the supernatant. The cells were washed twice with PBS and then resuspended in 0.5ml PBS. Propidium iodide and RNAse were used to treat the cells or stained with Armexin V-PE and 7-Aad. The cells were then analyzed using a FACScan (Becton-Dickinson, USA) by Teacher Zhang, the MOE key laboratory of Environment and Health, Medical College of Xi'an Jiaotong University. 3. Results 3.1 Construction of expression vector of pIRES2-TAT-apoptin-EGFP, pIRES2 -apoptin-EGFP and pIPRES2-TAT-EGFP Apoptin, derived from chicken anemia virus, can successfully induce apoptosis in a wide range of human tumor cell lines. In contrast, normal cells are not affected when coexisting with apoptin protein. Thus, Apoptin is regarded as a potential anti-tumor gene drug to be used by transfection into tumor cells or fused with some CPPs such as TAT a transcriptional regulator protein of HIV-1. In the present study, expression vectors of pIRES2-TAT-Apoptin-EGFP, pIRES2- Apoptin-EGFP and pIPRES2-TAT-EGFP were constructed and transfected into esophageal carcinoma cell lines. The construction progress was mentioned (Fig.1). DNA sequencing results showed that the recombinant plasmids were in accordance with the results as designed before. 3.2 Expression and subcellular localization of Apoptin and TAT-Apoptin After transfection, Eca109 cells stained green fluorescence, indicating successful transfection of the recombinant vectors and expression within the cells. Following incubation with Rabbit anti-etag monoclonal antibody and the secondary goat anti-Rabbit antibody labeled with TRITC, Eca109 cells gave out red, which means the expression of Apoptin-etag and TAT-Apoptin-etag. As shown in Figure 2, Eca109 cells transfected with pIRES2-Apoptin-Etag-EGFP emitted both green and red, suggesting expression of both Apoptin and TAT-Apoptin and they were mainly located in the nucleus. 3.3 Inhibition effects of TAT-Apoptin and Apoptin on eca109 and te-1 cells Eca109 and Te-1 cells were plated into 96-cell plates, and the DNA (ug): lipofectamine 2000 (ul) ratio was maintained at 1:1.5. As shown in Figure. 3A, the transfection efficiency was approximately 70%-80%. The corresponding MTT assay results were shown in Figure. 3B. After 24 or 48 hours of transfection, the viability of eca109 and te-1 cells treated with pIRES2-Apoptin-etag-EGFP and pIRES2-TAT-apoptin-etag-EGFP was significantly decreased compared to the cells treated with pIRES2-TAT-etag-EGFP, pIRES2-EGFP vector, and lipofectamine 2000 alone ( p 0.05) after 24h. However, after 48 hours, the viability of cells treated with pIRES2-TAT-Apoptin-etag-EGFP was significantly decreased compared to cells treated with pIRES2-Apoptin-etag-EGFP ( p <0.05). Fig.2 t-a-e-p: pIRES2-TAT-apoptin-etag- EGFP; a-e-p: pIRES2-apoptin-etag- EGFP; t-e-p: pIRES2-TAT--etag- EGFP; v-p: pIRES2-EGFP; lipo: lipofectamine2000 only. 3.4 Cell cycle distribution and apoptosis after transfection. As shown in Fig. 4 and Fig. 5, both pIRES2-apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP can induce G0/G1 in Eca109 and Te-1 cell lines after transfection. As shown in Fig. 4, Te-1 and Eca109 cells treated with pIRES2-Apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP resulted in a significant increase in G0/G1 arrest, up to more than 50%, but there were no significant differences between the pIRES2-Apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP groups. As shown in Fig. 7, after transfection, both pIRES2-Apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP can induce apoptosis in Eca109 cells. There were also no obvious differences between the two groups in apoptosis. This shows that both Apoptin and TAT-Apoptin both can induce apoptosis of esophageal tumor cells in vitro. 4. Discussion Esophageal squamous cell carcinoma (ESCC) is one of the six most common carcinomas in the world, and surgery, radiation and chemotherapy still play a crucial role in its treatment. [14] However, there is an urgent need for new treatment strategies. In recent years, a group of proteins, both cellular and viral origin, including apoptin, TRAIL, MDA-7 and HAMLET, have shown the ability to selectively kill cancer cells, offering potential as anticancer therapies. Among these proteins, apoptin is of particular interest. [5] TAT, which is derived from the transcriptional regulator protein of HIV-1, is commonly used in intracellular delivery. [11–13] In this study, we constructed the eukaryotic expression vectors of pIRES2-TAT- Apoptin-etag-EGFP, pIRES2-Apoptin-etag-EGFP and pIPRES2-TAT-etag-EGFP. After transfection into Eca109 and Te-1 cells, Apoptin-etag and TAT- Apoptin-etag were expressed and mainly located in the nucleus. Both pIRES2-Apoptin- etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP could significantly reduce the viability of human esophageal carcinoma cells after transfection ( p < 0.05), but pIRES2-TAT-Apoptin-etag- EGFP was more effective ( p < 0.05). This could be attributed to the TAT sequence, which can deliver Apoptin into cancer cells after being released by apoptosis cells that were successfully transfected. Apoptin-etag and TAT-Apoptin-etag both can induce G0/G1 arrest in Eca109 and Te-1 cells. In this paper, it is demonstrated that Apoptin has the ability to induce Eca109 and Te-1 cells apoptosis, whereas TAT-Apoptin exhibits a para-killing effect after being released from Apoptosis cells. Those findings provide a potential method for treating human esophageal carcinoma. However, further research is required to fully investigate the different killing effects between pIRES2 -TAT-Apoptin-etag-EGFP and pIRES2-Apoptin-etag-EGFP, as well as their vitro effects. Declarations Author Contribution Guarantor of integrity of entire study ___Jin-xiang Zhu1, Ming-xin Zhang2, Jian-sheng Wang4,________Study concepts __Jin-xiang Zhu1, Ming-xin Zhang2,__Jian-sheng Wang4_________________________________Study design _ Jin-xiang Zhu1, Ming-xin Zhang2, Su-na Zhou3, _____________________________________________________________Literature research __Jin-xiang Zhu1, Ming-xin Zhang2, Su-na Zhou3, Zhang jia4__________________________________experimental studies _Jin-xiang Zhu1, Ming-xin Zhang2, Su-na Zhou3_________________________________________________Data acquisition ___Jin-xiang Zhu1___ Zhang jia4_____________________________________________________Data analysis/interpretation _____Jin-xiang Zhu1, Ming-xin Zhang2_____________________________________________Statistical analysis _______Jin-xiang Zhu1, Ming-xin Zhang2____________________________________________________ References Jemal A, Bray F, Center MM, et al. Global cancer statistics[J]. CA Cancer J Clin, 2011, 61(2):69-90. Yang L, Parkin DM, Ferlay J, et al. Estimates of cancer incidence in China for 2000 and projections for 2005 [J]. Cancer Epidemiol Biomarkers Prev, 2005, 14(1):243-50. Los M, Panigrahi S, Rashedi I, et al. Apoptin, a tumor-selective killer[J]. Biochim Biophys Acta. 2009 Aug;1793(8):1335-42. Tavassoli M, Guelen L, Luxon BA, et al.Apoptin: Specific killer of tumor cells? [J].Apoptosis 2005, 10:717–724. Argiris K, Panethymitaki C, Tavassoli M. Naturally occurring, tumor specific, therapeutic proteins[J]. Exp Biol Med (Maywood). 2011 May 1;236(5):524-36. Chu CY, Xu BN, Huang WQ. A study on expression of FSH and its effects on the secretion of insulin and glucagon in rat pancreas[J]. Tissue and Cell, 2010, 42 :370–375. Olijslagers SJ, Zhang YH, Backendorf C, et al. Additive Cytotoxic Effect of Apoptin and Chemotherapeutic Agents Paclitaxel and Etoposide on Human Tumour Cells[J]. Basic Clinical Pharmacology Toxicology, 2006, 100127–131. Pan YF, Fang LR, Fan HY, et al. Antitumor effects of a recombinant pseudotype baculovirus expressing Apoptin in vitro and in vivo[J]. J. Cancer, 2010, 126:2741-2751. Remilio ALS, Elizabeth MEV, Robert J. et al. Apoptin enhances radiation induced cell death in poorly responding head and neck squamous cell carcinoma cells[J]. Basic Clinical Pharmacology Toxicology, 2009, 42-56. Zhu JH, Li X, Sun LL. Anti-tumor Effects of a Recombinant Fowlpox Virus Expressing Apoptin on Human Cervical Carcinoma in Vivo and in Vitro[J]. CHEM. RES. CHINESE UNIVERSITIES, 2011, 27(4):646-650. Wang H, Zhong CY, Wu JF, et al. Enhancement of TAT cell membrane penetration efficiency by dimethyl sulphoxide[J]. Journal of Controlled Release, 2010, 143:64-70. Zhou S, Zhang MX, Wang JS. Tumor-targeted delivery of TAT-Apoptin fusion gene using Escherichia coli Nissle 1917 to colorectal cancer[J]. Medical Hypotheses, 2011, (76):533–534. Zhao J, Peng G, Wei Xi, et al. A novel human derived cell-penetrating peptide in drug delivery[J]. Mol Biol Rep, 2011, 38:2649–2656. Ajani J, Bekaii-Saab T, D'Amico TA, et al. Esophageal Cancer Clinical Practice Guidelines[J]. J Natl Compr Canc Netw, 2006, 4(4):328-47. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3992497","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":275167231,"identity":"4e8349e7-3307-4e23-8c70-05855b103404","order_by":0,"name":"Jin-xiang Zhu","email":"","orcid":"","institution":"The First people ’s Hospital of Xian’yang","correspondingAuthor":false,"prefix":"","firstName":"Jin-xiang","middleName":"","lastName":"Zhu","suffix":""},{"id":275167232,"identity":"bb785123-7c38-4645-92fb-4a19a311da10","order_by":1,"name":"Ming-xin Zhang","email":"","orcid":"","institution":"the First Affiliated Hospital of Xi’an Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ming-xin","middleName":"","lastName":"Zhang","suffix":""},{"id":275167233,"identity":"bb202f72-05da-40fc-8f30-95d3f7906cb2","order_by":2,"name":"Su-na Zhou","email":"","orcid":"","institution":"Taizhou Hospital, Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Su-na","middleName":"","lastName":"Zhou","suffix":""},{"id":275167234,"identity":"34b76eeb-6227-426c-bcf4-f30b3e9f0dc9","order_by":3,"name":"Zhang jia","email":"","orcid":"","institution":"The First Affiliated Hospital of Xi’an Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Zhang","middleName":"","lastName":"jia","suffix":""},{"id":275167235,"identity":"43a95d15-cb9e-45c8-bafc-353f3baa5af0","order_by":4,"name":"Jian-sheng Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAklEQVRIiWNgGAWjYLACCQYbBgZm5gYGBh4w34AYLWlALYwgLQZEamFgOAzEIC0MRGgxOH728AuLP+ej+dsZG5h5ZP4kNrA3b5NgqLmDW8uZvDQLybbbuTMOMzYwzuAxSGzgOVYmwXDsGU4tZgdyzAwkG27nNgC1MHwAaZHIMZNgbDiMW8v5N2YGEn/O5c4HaUkAaZF/Q0DLjRzjBxJsB3I3IGzhwa/F/sYbMwbJtuTcjUAtB2fwGBu38aQVWyQcw61Fsj/H+LPEH7vceecPH3zM2yMn289+eOONDzW4tQABm7QElHWAsQfIBbES8GkARvvHD3D2D/xKR8EoGAWjYGQCAMezVYJYioBhAAAAAElFTkSuQmCC","orcid":"","institution":"The First Affiliated Hospital of Xi’an Jiaotong University","correspondingAuthor":true,"prefix":"","firstName":"Jian-sheng","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-02-27 02:29:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3992497/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3992497/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51829229,"identity":"c86b4b89-0edf-4c3d-afcb-f53f113fb9c6","added_by":"auto","created_at":"2024-02-29 17:42:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":70369,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of recombinant expression vectors. (A) pIRES2-TAT-Apoptin- etag-EGFP (B) pIRES2-Apoptin-Etag-EGFP (C) pIRES2-TAT-Etag-EGFP\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3992497/v1/b246e973e56b7beaf4ffe71a.png"},{"id":51828617,"identity":"3ac07f84-497a-4de7-b473-39f489a8e254","added_by":"auto","created_at":"2024-02-29 17:34:55","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":41532,"visible":true,"origin":"","legend":"\u003cp\u003eResults after Eca109 transfected by Apoptin-etag vector\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3992497/v1/7f37122403f25dd7ea4f231c.jpg"},{"id":51828618,"identity":"b0be0c7f-ee8c-4136-976d-0c326694bbb4","added_by":"auto","created_at":"2024-02-29 17:34:55","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":56695,"visible":true,"origin":"","legend":"\u003cp\u003eA The transfection efficiency of Eca109 under fluorescence microscope\u003c/p\u003e\n\u003cp\u003eB Effects on proliferation of tumor cells\u003c/p\u003e\n\u003cp\u003et-a-e-p: pIRES2-TAT-apoptin-etag- EGFP; a-e-p: pIRES2-apoptin-etag- EGFP; t-e-p: pIRES2-TAT--etag- EGFP; v-p: pIRES2-EGFP; lipo: lipofectamine2000 only.\u003c/p\u003e\n\u003cp\u003eOD data: Absorbance at 490nm\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3992497/v1/271ca7ff9e53a0939b0545f0.jpg"},{"id":51828622,"identity":"f9d4fa84-73af-4d8b-bffd-0dbc98a3e88d","added_by":"auto","created_at":"2024-02-29 17:34:55","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":157418,"visible":true,"origin":"","legend":"\u003cp\u003eCell cycle distribution of Eca109\u003c/p\u003e\n\u003cp\u003eA Mock group of Eca109 Fig.\u003c/p\u003e\n\u003cp\u003eB Apoptin-etag group of Eca109\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3992497/v1/f34b037805408658b04287a2.jpg"},{"id":51829230,"identity":"6157c82c-761f-4a51-a125-34f5e8be121b","added_by":"auto","created_at":"2024-02-29 17:42:55","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":129082,"visible":true,"origin":"","legend":"\u003cp\u003eCell cycle distribution of tumor cells after transfection\u003c/p\u003e\n\u003cp\u003eA The effects of different groups on cell cycle of Eca109\u003c/p\u003e\n\u003cp\u003eB The effects of different groups on cell cycle of Te-1\u003c/p\u003e\n\u003cp\u003eblank:control;t-a-e-p: pIRES2-TAT-apoptin-etag- EGFP; a-e-p: pIRES2-apoptin-etag-EGFP; t-e-p: pIRES2-TAT--etag-EGFP; p: pIRES2-EGFP; L: lipofectamine2000 only.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3992497/v1/6f4e854a4d0a8961df823c52.jpg"},{"id":51828623,"identity":"e01f6b80-a6fd-4a1b-9ae5-6713da7ddf88","added_by":"auto","created_at":"2024-02-29 17:34:56","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":234178,"visible":true,"origin":"","legend":"\u003cp\u003eFig. 7A Apoptosis of Eca109 by flow cytometry (mock group).\u003c/p\u003e\n\u003cp\u003eFig. 7B Apoptosis of Eca109 by flow cytometry (Apoptin-etag group).\u003c/p\u003e\n\u003cp\u003eFig. 7B Apoptosis of Eca109 by flow cytometry (TAT-Apoptin-etag group).\u003c/p\u003e","description":"","filename":"7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3992497/v1/1e4971789a9f68f764f3d7c0.jpg"},{"id":52383172,"identity":"398dca1c-fa75-47ac-8110-aeb6714f857a","added_by":"auto","created_at":"2024-03-10 18:32:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":691598,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3992497/v1/21e6d649-7d05-414c-a554-de87036ac53f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Construction of eukaryotic expression vector of Apoptin-etag and TAT-Apoptin-etag and their effects on human esophageal squamous cell carcinoma in vitro","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eEsophageal squamous cell carcinoma (ESCC) is one of the six most common carcinomas in the world, \u003csup\u003e[1]\u003c/sup\u003e with a very high incidence in China. It is known for its late clinical presentation, rapid progression, and poor survival. Despite improvements in diagnosis, surgical techniques, and chemoradiotherapy, treatment of ESCC remains rather poor worldwide. \u003csup\u003e[2]\u003c/sup\u003e Therefore, new treatment strategies are being sought after worldwide and apoptin may be a viable method.\u003c/p\u003e \u003cp\u003eRecently, a group of vital and cellular proteins that can selectively kill tumor cells has been described and has attracted the attention of researchers. Apoptin derived from chicken anemia virus, is just one of them. \u003csup\u003e[3\u0026ndash;4]\u003c/sup\u003e Composed of 121 amino acids, apoptin showed insignificant sequence homology with established cellular proteins. To date, more than 70 different tumor cell lines have been reported to be sensitive to apoptin induced apoptosis. \u003csup\u003e[3\u0026ndash;5]\u003c/sup\u003e The cellular mechanisms of apoptin induce apoptosis still recalls unclear. Evidence has demonstrated that nuclear localization plays a key role in apoptin induced apoptosis. Apoptin can induce apoptosis in human tumor cells but cannot penetrate the membrane itself. \u003csup\u003e[5]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eThere are two basic strategies for using apoptin in vitro. One is to obtain fusing proteins that contain cell-penetrating peptides (CPPs) and apoptin by constructing a prokaryotic expression vector. \u003csup\u003e[6\u0026ndash;10]\u003c/sup\u003e. CPPs play a role to translocate apoptin into cells, after which apoptin can function in the nucleus. \u003csup\u003e[11\u0026ndash;13]\u003c/sup\u003e A typical example of CPPs is TAT, a transcription regulator protein of HIV-1. \u003csup\u003e[12]\u003c/sup\u003e The other commonly used way is what we do here.\u003c/p\u003e \u003cp\u003eIn this study, we constructed eukaryotic expression vectors of pIRES2- TAT-Apoptin- etag-EGFP, pIRES2-Apoptin-etag-EGFP and pIRES2-TAT-etag-EGFP. When transferred into esophageal carcinoma cell lines, the recombinant can express TAT-Apoptin-etag, Apoptin-etag and TAT-etag under fluorescence microscopy. This method is different from fused proteins migration into cells. The recombinant foreign gene is translocated into cells and secretes proteins that can function in cells. The effects of Apoptin and TAT-apoptin on esophageal carcinoma cells are tested by MTT assay and flow cytometry. The localization of Apoptin will also be tested by indirect immunofluorescence method.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Bacterial stain, plasmids and media\u003c/h2\u003e \u003cp\u003eCompetent DH5α, which was used as the host strain for plasmids manipulation and amplification, was prepared in our library. The template plasmid pEHLYA2-SD-TAT-Apoptin was constructed by Dr. Suna Zhou, Medical College of Xi\u0026rsquo;an Jiaotong University, China. \u003csup\u003e[12]\u003c/sup\u003e The cloning vector pMD18-T was purchased from TaKaRa (Dalian, China), and the plasmid pIRES2-EGFP was kindly provided by Dr. Wenjuan Wang, Medical College of Xi\u0026rsquo;an Jiaotong University, China. The culture media LB was prepared as tryptone 10 g/l, yeast extract 5 g/l, NaCl 10 g/l.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Enzymes and primiers\u003c/h2\u003e \u003cp\u003eThe restriction enzymes of EcoRⅠ and XhoLⅠ, T4DNA ligase and DNA polymerase were purchased from TaKaRa (Dalian, China). The primiers used were synthesized by Shanghai xuguan Biotechnological Development Co., Ltd. The TAT-etag sequence (sense: XhoLI5'-\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCTCGAG\u003c/span\u003eATGTATGGCAGGAAGAAGCGTAGACAGAGACGTAGAGGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGAT\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGAATTC\u003c/span\u003e-3' EcoRI) was synthesized by Shanghai xuguan Biotechnological Development Co., Ltd.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cell lines and cell culture\u003c/h2\u003e \u003cp\u003eEca109 and Te-1 (human esophageal carcinoma cell line) were obtained from the Basic Medicine Cell Center of The Chinese Academy of Medical Sciences. Cells were maintained in RPMI 1640 medium, supplemented with 10% newborn calf serum (NCF), 1mMol/L sodium pyruvate, 100kU/L penicillin, 100kU/L streptomycin. Cells were grown in a 95% air, 5%CO2 humidified incubator at 37℃.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 The construction of eukaryotic expression vectors of TAT-etag, TAT-Apoptin-etag, Apoptin-etag.\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1 Prepared of eukaryotic expression vector of pIRES2-EGFP\u003c/h2\u003e \u003cp\u003eCircular vector of pIRES2-EGFP turned into linear form with digestion of XholI and EcoRI.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2 Construction of expression vector of TAT-etag\u003c/h2\u003e \u003cp\u003eThe TAT-etag sequence, which was synthesized by Shanghai xuguan Biotechnological Development Co., Ltd., was initially contained in the PUC19 vector. To obtain TAT-etag sequence, the PUC19 vector was digested with XholI and EcoRI. The enzyme cut products were purified using the EZ splinclomn Page Gel Oligo Extraction Kit (BBI, Canada). The purified enzyme products were then ligated to the multi-cloning sites of pIRES2-EGFP, which was also digested with XholI and EcoRI, at a ratio of 10:1 using T4 DNA Ligase (TaKaRa). Finally, DNA sequencing was performed by Beijing Genomics Institute (Beijing, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.4.3 Construction of expression vector of TAT-Apoptin-etag and Apoptin-etag\u003c/h2\u003e \u003cp\u003eThe template plasmid pEHLYA2-SD-TAT-Apoptin containing TAT-apoptin sequence was constructed by Dr. Suna Zhou. Two pairs of primers were used: TAT-apoptin primers (sense:5' \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCTCGAG\u003c/span\u003e ATGAACGCTCTCCA3' XhoLI, antisense:5' \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGAATTC\u003c/span\u003e ATCGGTTCCAGCGGAT3' EcoRI) and Apoptin primers (sense:5' \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCTCGAG\u003c/span\u003e ATGGCTTATGGCAG3\u0026rsquo;XhoLI, antisense5' \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGAATTC\u003c/span\u003eATCGGTTCCAGCGGAT3' EcoRI), which were synthesized by Shanghai xuguan Biotechnological Development Co., Ltd. The DNA sequences TAT-Apoptin and Apoptin, both appended with XholI and EcoRI enzyme sites, were PCR-amplified from the template plasmid pEHLYA2-SD-TAT-Apoptin using rTaq PCR PreMix (TaKaRa, Dalian, China) and the aforementioned primer pairs in a Mastercycler gradient PCR system (Eppendorf, USA). A temperature profile was programmed as follows: an initial denaturation step for 5 minutes at 94℃, 30 cycles of 30 seconds at 94℃, 30 seconds at 55℃, 1 minute at 72 minutes, and a final extension at 60℃. The PCR products were gel-purified using the EZ splinclomn Page Gel Oligo Extraction Kit (BBI, Canada) and cloned into pMD-18T(TaKaRa). DNA sequencing was performed by Beijing Genomics Institute (Beijing, China) to ensure no mutations occurred in the PCR.\u003c/p\u003e \u003cp\u003eRecombinant pMD-18T ligated with TAT-apoptin or Apoptin sequence was transformed into competent bacterial DH5α. The transformed competent bacterial DH5α was transferred to LB medium, containing anti-aminobenzylpenicillin and cultured for 12\u0026ndash;14 hours in an incubator at 37℃. Two clones were selected, maintained in LB medium, and shaken for 12\u0026ndash;14 hours at 37℃, 170-180R in the incubator.\u003c/p\u003e \u003cp\u003e5ml of LB medium was collected and plasmids were extracted according to the EZNA Plasmid Miniprep Kit (Omega). The recombinant plasmids of pMD-18T ligated with TAT-Apoptin or Apoptin sequence were digested with XholI and EcoRI to attain TAT-Apoptin or Apoptin sequence. Enzyme cut products were gel-purified using EZ splinclomn Page Gel Oligo Extraction Kit (BBI, Canada). The retrieved enzyme products were ligated to the multi-cloning sites of pIRES2-EGFP digested with XholI and EcoRI at a ratio of 10:1 with T4 DNA ligase (TaKaRa).\u003c/p\u003e \u003cp\u003eDNA sequencing was performed by Beijing Genomics Institute (Beijing, China) to demonstrate that the expression vector of TAT-Apoptin-etag and Apoptin-etag was finally successfully constructed.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Amplification of recombinant eukaryotic expression vector of TAT-etag, TAT- Apoptin-etag, Apoptin- etag.\u003c/h2\u003e \u003cp\u003eThe transformed competent bacterial DH5α which was carried out with recombinant eukaryotic expression vector of TAT-etag, TAT-Apoptin-etag or Apoptin-etag, was maintained in 5ml LB medium containing kanamycin (50ug/ml) and incubated at 37 ℃ Overnight. Then, recombinant plasmids were harvested following the procedures of EZNA Plasmid Miniprep Kit (Omega).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Transfections of Eca109 and Te-1 cells and group of experiments\u003c/h2\u003e \u003cp\u003eEca109 and te-1 cells were transiently transfected with recombinant plasmids pIRES2-TAT-Apoptin-etag-EGFP, pIRES2-Apoptin-etag-EGFP and pIRES2-TAT- etag-EGFP by liposome, lipofectamine2000 (Gibco). Eca109 and Te-1 cells also were also transfected with pIRES2-EGFP as a control. At the same time, liposome alone incubated with cells also served as a control. Cells were detected 24h later under a fluorescence microscope (Olympus, Tokyo, Japan) to examine the efficiency of transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Detection of Apoptin expression and subcellular localization by immuno- fluorescence\u003c/h2\u003e \u003cp\u003eIn the beginning, small coverslips were placed in 24-well plates. Then 1\u0026times;10^5 /well Eca109 cells were plated into 24-well plate. After 24 hours, recombinant plasmids mixed with liposome (lipofectamine 2000, Gibco) were added to the 24-well plate. 48 hours later, the cells were washed 3 times with PBS and fixed with paraformaldehyde for 10 minutes. Then they were permeabilized with 0.5% Triton100 for 15minuteutes. After washing with PBS, the antibodies were blocked with 1% BSA for 30minuteutes. The cells were then washed again with PBS and incubated with Rabbit anti-etag monoclonal antibody (Abcam, USA) overnight. Then washing with PBS, the cells were incubated with the secondary goat anti-Rabbit antibody with TRITC (TaKaRa, China) for 1 hour at 37℃. After washing with PBS, the cells were stained with DAPI (0.5ng/ml) for 2 minutes, then washed with PBS 3 times and treated with RNAse for 5 minutes. Then the coverslips were placed on glass slides that were fixed with 50% Glycerin. Finally, the results were observed under the fluorescence microscope (Olympus, Tokyo, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Detection of human esophageal carcinoma cell (Eca109 and Te-1) viability by MTT assay\u003c/h2\u003e \u003cp\u003eEca109 and Te-1 cells were subjected to apoptosis. Eca109 and Te-1 cells were plated in 96\u0026ndash;cell plates at approximately 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e/well respectively. After 24 hours, the cells were transfected, and the experimental group was described in 2.6. Cell viability was measured by colorimetric MTT assay 24 or 48 hours after transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Cell cycle and apoptosis analysis by flow cytometry\u003c/h2\u003e \u003cp\u003eEca109 and Te-1 cells were plated into 6-well plates respectively. After 24 hours, the cells were transfected and of the experimental group was the same as mentioned above. 48 hours later, at least 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e/well cells were collected by digesting with pancreatic enzymes. After collection, the cells were washed 3 times with pre-cool PBS and then fixed in 70% ethanol at 4℃ overnight. Centrifuged at 800 rpm for 5 minutes to collect cells and discard the supernatant. The cells were washed twice with PBS and then resuspended in 0.5ml PBS. Propidium iodide and RNAse were used to treat the cells or stained with Armexin V-PE and 7-Aad. The cells were then analyzed using a FACScan (Becton-Dickinson, USA) by Teacher Zhang, the MOE key laboratory of Environment and Health, Medical College of Xi'an Jiaotong University.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e3.1 Construction of expression vector of pIRES2-TAT-apoptin-EGFP, pIRES2 -apoptin-EGFP and pIPRES2-TAT-EGFP\u003c/p\u003e\n\u003cp\u003eApoptin, derived from chicken anemia virus, can successfully induce apoptosis in a wide range of human tumor cell lines. In contrast, normal cells are not affected when coexisting with apoptin protein. Thus, Apoptin is regarded as a potential anti-tumor gene drug to be used by transfection into tumor cells or fused with some CPPs such as TAT a transcriptional regulator protein of HIV-1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the present study, expression vectors of pIRES2-TAT-Apoptin-EGFP, pIRES2- Apoptin-EGFP and pIPRES2-TAT-EGFP were constructed and transfected into esophageal carcinoma cell lines. The construction progress was mentioned (Fig.1). DNA sequencing results showed that the recombinant plasmids were in accordance with the results as designed before.\u003c/p\u003e\n\u003cp\u003e3.2 Expression and subcellular localization of Apoptin and TAT-Apoptin\u003c/p\u003e\n\u003cp\u003eAfter transfection, Eca109 cells stained green fluorescence, indicating successful transfection of the recombinant vectors and expression within the cells. Following incubation with Rabbit anti-etag monoclonal antibody and the secondary goat anti-Rabbit antibody labeled with TRITC, Eca109 cells gave out red, which means the expression of Apoptin-etag and TAT-Apoptin-etag. As shown in Figure 2, Eca109 cells transfected with pIRES2-Apoptin-Etag-EGFP emitted both green and red, suggesting expression of both Apoptin and TAT-Apoptin and they were mainly located in the nucleus.\u003c/p\u003e\n\u003cp\u003e3.3 Inhibition effects of TAT-Apoptin and Apoptin on eca109 and te-1 cells\u003c/p\u003e\n\u003cp\u003eEca109 and Te-1 cells were plated into 96-cell plates, and the DNA (ug):\u0026nbsp;lipofectamine 2000 (ul) ratio was maintained at 1:1.5. As shown in Figure. 3A, the transfection efficiency was approximately 70%-80%. The corresponding MTT assay results were shown in Figure. 3B. After 24 or 48 hours of transfection, the viability of eca109 and te-1 cells treated with pIRES2-Apoptin-etag-EGFP and pIRES2-TAT-apoptin-etag-EGFP was significantly decreased compared to the cells treated with pIRES2-TAT-etag-EGFP, pIRES2-EGFP vector, and lipofectamine 2000 alone (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05). The viability of cells treated with pIRES2-TAT-Apoptin-etag-EGFP was not different from that of cells treated with pIRES2-Apoptin-etag-EGFP (\u003cem\u003ep\u003c/em\u003e\u0026gt;0.05) after 24h. However, after 48 hours, the viability of cells treated with pIRES2-TAT-Apoptin-etag-EGFP was significantly decreased compared to cells treated with pIRES2-Apoptin-etag-EGFP (\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e\n\u003cp\u003eFig.2 t-a-e-p: pIRES2-TAT-apoptin-etag- EGFP; a-e-p: pIRES2-apoptin-etag- EGFP; t-e-p: pIRES2-TAT--etag- EGFP; v-p: pIRES2-EGFP; lipo: lipofectamine2000 only.\u003c/p\u003e\n\u003cp\u003e3.4 Cell cycle distribution and apoptosis after transfection.\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. 4 and Fig. 5, both pIRES2-apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP can induce G0/G1 in Eca109 and Te-1 cell lines after transfection. As shown in Fig. 4, Te-1 and Eca109 cells treated with pIRES2-Apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP resulted in a significant increase in G0/G1 arrest, up to more than 50%, but there were no significant differences between the pIRES2-Apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP groups.\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. 7, after transfection, both pIRES2-Apoptin-etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP can induce apoptosis in Eca109 cells. There were also no obvious differences between the two groups in apoptosis. This shows that both Apoptin and TAT-Apoptin both can induce apoptosis of esophageal tumor cells in vitro.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eEsophageal squamous cell carcinoma (ESCC) is one of the six most common carcinomas in the world, and surgery, radiation and chemotherapy still play a crucial role in its treatment. \u003csup\u003e[14]\u003c/sup\u003e However, there is an urgent need for new treatment strategies. In recent years, a group of proteins, both cellular and viral origin, including apoptin, TRAIL, MDA-7 and HAMLET, have shown the ability to selectively kill cancer cells, offering potential as anticancer therapies. Among these proteins, apoptin is of particular interest. \u003csup\u003e[5]\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eTAT, which is derived from the transcriptional regulator protein of HIV-1, is commonly used in intracellular delivery. \u003csup\u003e[11\u0026ndash;13]\u003c/sup\u003e In this study, we constructed the eukaryotic expression vectors of pIRES2-TAT- Apoptin-etag-EGFP, pIRES2-Apoptin-etag-EGFP and pIPRES2-TAT-etag-EGFP. After transfection into Eca109 and Te-1 cells, Apoptin-etag and TAT- Apoptin-etag were expressed and mainly located in the nucleus. Both pIRES2-Apoptin- etag-EGFP and pIRES2- TAT-Apoptin-etag-EGFP could significantly reduce the viability of human esophageal carcinoma cells after transfection (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but pIRES2-TAT-Apoptin-etag- EGFP was more effective (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). This could be attributed to the TAT sequence, which can deliver Apoptin into cancer cells after being released by apoptosis cells that were successfully transfected. Apoptin-etag and TAT-Apoptin-etag both can induce G0/G1 arrest in Eca109 and Te-1 cells.\u003c/p\u003e \u003cp\u003eIn this paper, it is demonstrated that Apoptin has the ability to induce Eca109 and Te-1 cells apoptosis, whereas TAT-Apoptin exhibits a para-killing effect after being released from Apoptosis cells. Those findings provide a potential method for treating human esophageal carcinoma. However, further research is required to fully investigate the different killing effects between pIRES2 -TAT-Apoptin-etag-EGFP and pIRES2-Apoptin-etag-EGFP, as well as their vitro effects.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eGuarantor of integrity of entire study ___Jin-xiang Zhu1, Ming-xin Zhang2, Jian-sheng Wang4,________Study concepts __Jin-xiang Zhu1, Ming-xin Zhang2,__Jian-sheng Wang4_________________________________Study design _ Jin-xiang Zhu1, Ming-xin Zhang2, Su-na Zhou3, _____________________________________________________________Literature research __Jin-xiang Zhu1, Ming-xin Zhang2, Su-na Zhou3, Zhang jia4__________________________________experimental studies _Jin-xiang Zhu1, Ming-xin Zhang2, Su-na Zhou3_________________________________________________Data acquisition ___Jin-xiang Zhu1___ Zhang jia4_____________________________________________________Data analysis/interpretation _____Jin-xiang Zhu1, Ming-xin Zhang2_____________________________________________Statistical analysis _______Jin-xiang Zhu1, Ming-xin Zhang2____________________________________________________\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eJemal A, Bray F, Center MM, et al. Global cancer statistics[J]. CA Cancer J Clin, 2011, 61(2):69-90.\u003c/li\u003e\n\u003cli\u003eYang L, Parkin DM, Ferlay J, et al. Estimates of cancer incidence in China for 2000 and projections for 2005 [J]. Cancer Epidemiol Biomarkers Prev, 2005, 14(1):243-50.\u003c/li\u003e\n\u003cli\u003eLos M, Panigrahi S, Rashedi I, et al. Apoptin, a tumor-selective killer[J]. Biochim Biophys Acta. 2009 Aug;1793(8):1335-42.\u003c/li\u003e\n\u003cli\u003eTavassoli M, Guelen L, Luxon BA, et al.Apoptin: Specific killer of tumor cells? [J].Apoptosis 2005, 10:717–724.\u003c/li\u003e\n\u003cli\u003eArgiris K, Panethymitaki C, Tavassoli M. Naturally occurring, tumor specific, therapeutic proteins[J]. Exp Biol Med (Maywood). 2011 May 1;236(5):524-36. \u003c/li\u003e\n\u003cli\u003eChu CY, Xu BN, Huang WQ. A study on expression of FSH and its effects on the secretion of insulin and glucagon in rat pancreas[J]. Tissue and Cell, 2010, 42 :370–375.\u003c/li\u003e\n\u003cli\u003eOlijslagers SJ, Zhang YH, Backendorf C, et al. Additive Cytotoxic Effect of Apoptin and Chemotherapeutic Agents Paclitaxel and Etoposide on Human Tumour Cells[J]. Basic Clinical Pharmacology Toxicology, 2006, 100127–131.\u003c/li\u003e\n\u003cli\u003ePan YF, Fang LR, Fan HY, et al. Antitumor effects of a recombinant pseudotype baculovirus expressing Apoptin in vitro and in vivo[J]. J. Cancer, 2010, 126:2741-2751.\u003c/li\u003e\n\u003cli\u003eRemilio ALS, Elizabeth MEV, Robert J. et al. Apoptin enhances radiation induced cell death in poorly responding head and neck squamous cell carcinoma cells[J]. Basic Clinical Pharmacology Toxicology, 2009, 42-56.\u003c/li\u003e\n\u003cli\u003eZhu JH, Li X, Sun LL. Anti-tumor Effects of a Recombinant Fowlpox Virus Expressing Apoptin on Human Cervical Carcinoma in Vivo and in Vitro[J]. CHEM. RES. CHINESE UNIVERSITIES, 2011, 27(4):646-650.\u003c/li\u003e\n\u003cli\u003eWang H, Zhong CY, Wu JF, et al. Enhancement of TAT cell membrane penetration efficiency by dimethyl sulphoxide[J]. Journal of Controlled Release, 2010, 143:64-70.\u003c/li\u003e\n\u003cli\u003eZhou S, Zhang MX, Wang JS. Tumor-targeted delivery of TAT-Apoptin fusion gene using Escherichia coli Nissle 1917 to colorectal cancer[J]. Medical Hypotheses, 2011, (76):533–534.\u003c/li\u003e\n\u003cli\u003eZhao J, Peng G, Wei Xi, et al. A novel human derived cell-penetrating peptide in drug delivery[J]. Mol Biol Rep, 2011, 38:2649–2656.\u003c/li\u003e\n\u003cli\u003eAjani J, Bekaii-Saab T, D'Amico TA, et al. Esophageal Cancer Clinical Practice Guidelines[J]. J Natl Compr Canc Netw, 2006, 4(4):328-47.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Apoptin, TAT-Apoptin, eukaryotic expression vector, ESCC","lastPublishedDoi":"10.21203/rs.3.rs-3992497/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3992497/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEsophageal carcinoma is one of the six most common carcinomas in the world, known for its late clinical presentation, rapid progression and poor survival. Compared with developed countries, the prevalence of esophageal cancer has significant differences in pathology, with significantly higher mortality and regional incidence. Esophageal squamous cell carcinoma (ESCC) is the most common type in China and in recent years, the incidence has shown an upward trend in the county. Considering the characteristics of esophageal cancer in China, seeking new treatments for esophageal squamous cell carcinoma is of great concern to clinicians. Apoptin, which is derived from chicken anemia, and has tumor-specific killing effects, is composed of 121 amino acids. Although the mechanism is not yet explained, it has been extensively studied and used in the treatment of malignant tumors. Here, we selected two human squamous cell carcinoma lines and constructed eukaryotic expression vectors of apoptin and TAT-apoptin fusion protein to investigate their effect on cell proliferation and cell cycle in transfection cells.\u003c/p\u003e","manuscriptTitle":"Construction of eukaryotic expression vector of Apoptin-etag and TAT-Apoptin-etag and their effects on human esophageal squamous cell carcinoma in vitro","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-29 17:34:50","doi":"10.21203/rs.3.rs-3992497/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"16b5e740-c8f5-4bda-a348-314f5ce3675a","owner":[],"postedDate":"February 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-10T18:32:41+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-29 17:34:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3992497","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3992497","identity":"rs-3992497","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.