The Dual Effect and Mechanism of (-)-epicatechin on Hypoxic-induced Proliferation and Apoptosis of Cardiac Fibroblasts

The Dual Effect and Mechanism of (-)-epicatechin on Hypoxic-induced Proliferation and Apoptosis of Cardiac Fibroblasts | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article The Dual Effect and Mechanism of (-)-epicatechin on Hypoxic-induced Proliferation and Apoptosis of Cardiac Fibroblasts Jiawen Li, Xingchang Zheng, Zuoming Guo, Ying Fan, Fang Tian, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-270657/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective: Cardiovascular diseases impose a considerable economic burden on health services and remain a threat to human being. (-)-Epicatechin [(-)-EPI], a traditional Chinese medicine is applied to treatment against the cardiovascular diseases. Herein, we aimed at investigating the underlying mechanism whereby (-)-EPI affects myocardial fibrosis (MF). Methods: The efficacy of (-)-EPI was determined in mouse models of acute myocardial infarction (AMI) and hypoxia-treated fibroblasts. Western blot and RT-qPCR analyses were conducted to determine TGF-β1, SMAD2 and SMAD3 expression, as collagen content was detected. CCK-8 assay and flow cytometry were carried out to detect fibroblast proliferation and apoptosis. HE and Masson staining reflected the histological change of myocardial tissues Results: Compared to sham-operated mice, AMI group exhibited MF and hypoxia-treated cardiac fibroblasts proliferation was restrained and apoptosis was increased. Treatment with (-)-EPI significantly attenuated the MF condition and restored fibroblast proliferation and apoptosis, whereas these effects were abrogated by the TGF-β1 agonist HY-100347A. (-)-EPI administration caused a decline in TGF-β1, SMAD2 and SMAD3 expression. Mechanistically, (-)-EPI targeting TGF-β signaling inhibits collagen deposition and attenuates MF. Conclusion: Collectively, (-)-EPI could improve MF following AMI through down-regulation of TGF-β1 signaling, providing a novel insight into treatment against the cardiovascular diseases. Cardiothoracic Surgery Acute myocardial infarction Myocardial fibrosis (-)-Epicatechin TGF-β1 Cardiovascular Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction With the increase in the aging population, cardiovascular disease has become a major disease seriously threatening human health (1). The elderly are susceptible to cardiovascular diseases such as hypertension, diabetes, stroke (2). It is estimated that millions of people die from cardiovascular disease every year, where heart failure and myocardial infarction are the main causes (3-6). From the perspective of the pathogenesis, MF is common feature of cardiovascular diseases such as hypertension and MI (7,8). MF characterized by significant increase in collagen content or accumulation of extracellular matrix (ECM) of the myocardium, affects cardiovascular functions (9). MF accelerates the progression of heart failure, even leading to sudden death (10). However, current clinical measures still fail to prevent this disease. The main reason is that the pathogenesis of MF is still unclear, restraining the administration of appropriate and timely measures. Therefore, investigating the underlying basis of MF and effective preventive and therapeutic measures are the focus of current researches. Traditional Chinese medicines are widely applied to the treatment for cardiovascular diseases, such as Myricetin (11), Scrophularia and Catechins (12). (-)-EPI, a kind of catechin compound, has antioxidant (13), enhances immune defense (14) and anti-tumor activity (15). The impact of (-)-EPI on oxidative damage has been studied previously and evidence notes that for cardiovascular system, administration of EPI reduces blood lipids, lowers blood pressure and inhibits thrombosis (12,16,17). Yamazaki KG et al. found that (-)-EPI alleviates myocardial ischemic damage through potentially protecting mitochondria (18). Also, treatment with (-)-EPI reduced the MI size by 50% in the rat model of ischemia-reperfusion injury. The protective effects are not related to hemodynamics changes and maintain over time, accompanied by a decrease in tissue damage indicators (19). Furthermore, Yamazaki KG has demonstrated that administration of (-)-EPI in advance in MI mice reduces the MI area and restrains left ventricular remodeling (20). A study by Prince P et al. unveils that (-)-EPI exerts anti-oxidative stress effect by scavenging free free radicals, thereby protecting the myocardial tissue of the isoproterenol-induced MI model (21,22). However, the mechanism underlying (-)-EPI preventing and treating MF remains unclear. Transforming growth factor beta (TGF-β) is a multifunctional cytokine promoting or inhibiting cell proliferation and differentiation as its effect depends on the target cells (23,24). TGF-β1 is known to associate with ECM deposition, and is recognized as a therapeutic target for organ fibrosis (25). In recent years, the role of TGF-β1 in myocardial tissue has received increasing attention. TGF-β1 and its receptors are expressed in cardiomyocytes and non-cardiomyocytes, whilst TGF-β1 is mainly produced by cardiac fibroblasts and myofibroblasts (26). Addition of TGF-β1 to cultured rabbit myocardial fibroblasts coincided with an increase in type I and type III collagen, and fibronectin mRNA and protein levels, as indicated by Eghbali et al. in 1991 (27). TGF-β1 inhibits the production of collagenase and elastase and stimulates the expression of plasminogen activator inhibitor-1 (PAI-1) and tissue inhibitors of matrix metalloproteinases (TIMP), thereby delaying degradation of ECM components such as type I collagen and promoting the process of MF (28). Collectively, the TGF-β/Smads signaling pathway is responsible for MF and TGF-β has been confirmed as an important factor for fibrosis, despite that the causality of TGF-β in MF has not been clarified. Therefore, in-depth studies on TGF-β/Smads signaling pathway will not only further elucidate the pathogenesis of MF, but also contribute to a novel treatment. Our study is the first to combine (-)-EPI with TGF-β signaling to explore the mechanism of (-)-EPI regulating MF after AMI. Methods Animal model A total of 24 healthy male C57BL/6 mice (8 weeks old, weight 25-30g), were maintained under a 12h/12h dark/light regime (7:00 a.m.-7:00 p.m.) at 21 ± 1℃ and at a humidity of 55%-60% with free access to food and water. After 7 days of adaptive feeding, all animals were randomly divided into four groups: (1) The sham-operated group (sham group, n = 6), mouse left anterior descending (LAD) coronary artery was subjected to suture without ligation; (2) AMI group, n = 6, the suture on needle was passed through mouse LAD coronary artery followed by ligation; (3) AMI + (-)-EPI group (n = 6), mouse received injection of (-)-EPI (1 mg/kg/day) for continuous 10 days followed by ligation of LAD coronary artery; (4) AMI + (-)-EPI + HY-100347A group (n = 6), mice were administrated (-)-EPI (1 mg/kg/day) for continuous 10 days after intraperitoneal injection of HY-100347A (10 mg/kg/day) for 30 min followed by LAD occlusion through ligation. Hematoxylin and eosin (HE) staining The sections were dewaxed with xylene Ⅰ for 10 min and xylene Ⅱ, Ⅲ for 5 min, followed by incubation in absolute ethanol and gradient ethanol (95%, 85%) for 1 min, respectively. After rinsing with tap water, sections were stained with hematoxylin for about 1-5 min, differentiated with 1%/0.5%/0.25% hydrochloric acid for 3-5 s, and stained with eosin for 20 s-2 min. After that, the sections were dehydrated with gradient ethanol from 85% to 100%, immersed in xylene Ⅰand Ⅱ, blocked with neutral gum, and finally sealed. hematoxylin stains the cell nuclei are stained with a blue or purplish-blue color, muscle, cytoplasm, red blood cells, and connective tissue with a pink color, and eosinophilic particles in cytoplasm with a bright red color; collagen fibers are stained light pink; elastic fibers are stained bright pink. Masson staining Myocardial tissues were cut into sections and deparaffinized in distilled water. The sections were stained with hematoxylin for 5-10 min, differentiated with hydrochloric acid and alcohol, and rinsed in running water. After washing, the sections were stained in acid fuchsin solution for 5-8 min, washed in distilled water, and stained with 1% phosphomolybdic acid for 1-3 min and with aniline blue solution or bright green solution for 5 min. Then the samples were dried in a 60℃ incubator, cleared with xylene, and sealed. Collagen fibers were counterstained with aniline blue (blue) or bright green (green), cytoplasm, muscle fibers and red blood cells were stained red, and nuclei were stained blue-brown. Fibroblast cell culture 1-2 day-old neonatal mouse hearts were extracted upon disinfection with 70% alcohol and placed on a DMEM petri dish. After removing blood and cutting off the aorta and atrium, the hearts were cut into pieces (2 mm). The sections were digested with 0.25% pancreatin at 37°C for 5 min, 6 to 8 times, and subjected to differential adhesion to to obtain fibroblasts. The cells were seeded in 30 mm culture flasks, 6-well plates or 96-well plates at a density of 10 6 cells/ml. The flasks and plates were placed in an incubator (37°C, 95% air and 5% CO 2 ) for 48-72 h and then transferred to serum-free DMEM for culturing for 24 h. The fibroblasts then were randomly divided into groups for various experiments. Cell Counting Kit-8 (CCK-8) assay Adherent cardiac fibroblasts in the logarithmic growth phase were seeded in a 96-well plate with 100 μl/well (5 × 10 3 cells), and cultured under normoxia or hypoxia for 24 h. The fibroblasts were incubated with different concentrations of (-)-EPI for 72 h and 10 µM CCK-8 solution was added to the cells every 24 h and cultured for 2 h. A microplate reader was used to detect optical density (OD) at 450 nm for subsequent analysis of viability. Flow cytometry Following washing cells in cold PBS buffer, the cells were suspended in Binding Buffer to prepare a suspension of 1 × 10 6 cells/ml. 100 μl of cell suspension was taken to mix with 5 μg of purified recombinant Annexin V-FITC, and incubated for 15 min at room temperature in the dark. Then the mixture was centrifuged at 1000 rpm for 5 min with the supernatant removed. 200 μl Binding Buffer was added to resuspend the cells with 5 μl PI, and a flow cytometer was used to evaluate the cell apoptosis. Reverse transcription polymerase chain reaction (RT-qPCR) Total RNA was extracted from cell and tissues using Trizol reagent (15596026, Invitrogen, USA) and reverse transcribed into cDNA according to the procedure of PrimeScript RT reagent Kit (RR047A, Takara, Japan). Then the cRNA was subjected to RT-qPCR using Fast SYBR Green PCR kit (Applied biosystems) and ABI PRISM 7300 RT-PCR system (Applied biosystems) to quantitatively analyze RNA in triple. With GAPDH as an internal reference, gene expression was calculated using the 2 - ΔΔ Ct method and the experiment was repeated for at least three times. The primer sequences were listed in table 1. Western blot Cardiac fibroblasts were incubated with 100 µl RIPA and 1 µl PMSF, and sonicated. Mouse myocardial tissues were grinded in 200 µl cell lysate and lysed on ice for 30 min. The above cell and tissue samples were centrifuged at 4°C, 13000 r/min for 30 min and the supernatant was collected, with protein concentration determined by Bicinchoninic Acid method. 100 µg of protein was mixed with 5 × loading buffer and denatured at 100°C for 5 min. After centrifugation, proteins were separated through SDS-PAGE and transferred to polyvinylidene fluoride membrane, blocked with 5% skim milk. The membrane was then incubated with the corresponding primary and secondary antibodies, and detected by an infrared fluorescence scanning system after incubation. With GAPDH as an internal reference, the samples were photographed, and analyzed the image analysis software odyssey1.2. Statistical analysis All statistics were analyzed using the SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). Measurement data was presented as mean ± standard deviation. Comparisons those among three or more groups were made by one-way analysis of variance (ANOVA), with Tukey post-hoc test. All tests were two-sided and P < 0.05 was considered statistically significant. Results (-)-EPI regulates MF following AMI in mice To investigate whether (-)-EPI regulates malignant arrhythmia, a mouse AMI model was established and the modeled mice were administered with (-)-EPI. Mouse heart samples were collected and subjected to HE and Masson staining to evaluate pathological changes in myocardial interstitium (Figure 1A, B). The results showed that compared with the sham-operated mice, the AMI mice had obvious MF in the marginal myocardial infarct tissue. But upon the treatment with (-)-EPI, the MF was significantly attenuated, indicating that (-)-EPI could improve MF in AMI mice. (-)-EPI increases hypoxia-induced cardiomyocyte proliferation and decreases apoptosis Apart from the in vivo function of (-)-EPI, myocardial fibroblasts from neonatal rats were taken for further identifying its impact on AMI in vitro . The fibroblasts were cultured under hypoxia to induce MI and establish cell model of AMI (Figure 2A). CCK-8 assay was initially performed to determine the effect of different concentrations of (-)-EPI treatment on cell proliferation. Our results indicated that hypoxia significantly inhibited cell proliferation, while (-)-EPI treatment promoted hypoxia-induced fibroblast proliferation (Figure 2B). Besides, (-)-EPI was indicated to attenuate hypoxia-induced apoptosis, according to the results from flow cytometry (Figure 2C). Taken altogether, these results indicate that (-)-EPI could enhance fibroblast proliferation and restrain apoptosis, prolonging the survival of cardiomyocytes. (-)-EPI down-regulates TGF- β 1 expression We then further explored the mechanism of (-)-EPI in the process of MF. TGF-β signaling is known to play a large role in MF. Herein, we examined the specific effect of (-)-EPI on TGF-β expression under different conditions by RT-qPCR and Western blot. Compared to control treatment, hypoxia treatment significantly promoted the expression of TGF-β1, SMAD2 and SMAD3, while (-)-EPI treatment restored their expression levels to that of the control group. Additionally, as HY-100347A is an agonist of TGF-β signaling, addition of HY-100347A only offset the effect of (-)-EPI to a certain extent (Figure 3A and B). As for the the impact of (-)-EPI on the collagen content in cells, the imaging of Sirius Red staining depicted increased collagen content in hypoxia-treated cells and that compared with the hypoxia group, (-)-EPI administration resulted in a decline in collagen content which could be reversed by addition of HY-100347A (Figure 3C). These above results elucidate that (-)-EPI could improve MF by down-regulating the expression of TGF-β1. (-)-EPI attenuates MF following AMI in mice by down-regulating the expression of TGF- β 1 To study whether and how (-)-EPI regulates MF in AMI mice through TGF-β1 signaling in vivo , (-)-EPI and HY-100347A were administered to AMI mice and control mice through intraperitoneal injection. (-)-EPI treatment alone inhibited the process of MF, but HY-100347A aggravated MF (Figure 4A, B). In a word, (-)-EPI could impair MF after AMI in mice by down-regulation of TGF-β1. Discussion MF, a typical symptom of myocardial remodeling, could contribute to increasing myocardial stiffness and deterioration of ventricular diastolic function, and a decline in coronary artery reserve (29,30). It has been proved that myocardial infarction always results in heart failure and both are often accompanied by severe MF (31). Previous studies mainly focused on the prevention and reversal of structural and functional myocardial abnormality. Recent investigators have gradually realized the importance of MF in the heart failure, so MF becomes a new target of cardiovascular disease. (-)-EPI has a wide range of effects. Its antioxidant and anti-inflammatory activity as well as regulatory impact on cardiovascular diseases have been elucidated in recent years (16,32). Accumulating evidence has reported that (-)-EPI directly chemically reacts with reactive oxygen species (ROS), or interact with signal pathways or enzymes regulating ROS to eliminate ROS S(13,33). In addition, pancreatic inflammatory cells infiltrate and release IL-1β during diabetes, whereas (-)-EPI inhibits the expression of IL-1β and iNOS through blocking the nuclear localization of the p65 subunit of NF-κB (34). In cardiovascular diseases, (-)-EPI could mitigate platelet function to allow fibrin clot dissolution, and play multifaceted roles in thromboembolic diseases (35,36). A short-term study on healthy people demonstrated that consumption of high-flavonoid dark chocolate containing 46 mg (-)-EPI for 2 weeks strengthens endothelial function and improves vascular endothelial-dependent blood flow-mediated dilation (37). Furthermore, (-)-EPI is confirmed to protect the heart against damage and promote heart growth. One study pointed out that (-)-EPI induces physiological cardiac growth through activation of PI3K/Akt pathway (38). Another study by Li JW et al. notices that (-)-EPI attenuates ischemia-induced heart damage targeting PTEN to regulate PI3K-AKT signaling (39). Besides, treatment with (-)-EPI effectively reduces cardiac fibrosis size in the sarcoglycan null mice (40). However, in spite of these findings, the interaction between (-)-EPI, MF and MI is still unclear, and therefore, we managed to further unravel the mechanism underlying (-)-EPI in MF after MI. Our findings depict the role of (-)-EPI in regulating MF and its underlying mechanism. (-)-EPI administration could significantly improve MF following AMI in vivo and effectively prolong the survival of cardiac fibroblast in vitro. Mechanistically, (-)-EPI targeting TGF-β signaling exerts its regulatory activity and thereby inhibits collagen deposition and MF. In cardiovascular disease, TGF-β signaling is closely related to several catechin compounds such as Epigallocatechin gallate (EGCG) which is reported to attenuate myocardial damage in mice with heart failure through the TGF-β1/Smad3 signaling pathway (41). EGCG effectively interferes with TGF-β1 signaling to decrease fibroblast proliferation and collagen production (42). But the relationship between (-)-EPI and TGF-β has not been fully elucidated, especially in cardiovascular diseases. Our study elucidates the TGF-β signaling mechanism how (-)-EPI regulates MF, serving to further understand the (-)-EPI and its function in MF. Limitations, certainly, still exist in the present study. We have not introduced how (-)-EPI is located on the TGF-β signal to perform its function. In addition, whether (-)-EPI also could effectively regulate the MF following MI in other animal models, such as pig models still requires more experiments, which are direction of our following investigation. Conclusion In conclusion, our study illustrates that (-)-EPI attenuates MF following MI by targeting TGF-β signals and underlies the causality of (-)-EPI in improving MF. Abbreviations (-)-EPI: (-)-Epicatechin MF: myocardial fibrosis AMI: acute myocardial infarction ECM: extracellular matrix TGF-β: Transforming growth factor beta PAI-1: plasminogen activator inhibitor-1 TIMP: tissue inhibitors of matrix metalloproteinases LAD: left anterior descending HE: Hematoxylin and eosin CCK-8: Cell Counting Kit-8 RT-qPCR: Reverse transcription polymerase chain reaction ROS: reactive oxygen species EGCG: Epigallocatechin gallate Declarations Ethics approval The study protocol was approved by the institutional ethics committee and research board of Harbin Medical University. Consent for publication Not applicable. Availability of data and material Not applicable. Disclosure statement The authors declare that they have no competing interests. Funding This study was supported by Nurture Research Fund from The Fourth Affiliated Hospital of Harbin Medical University (HYDSYPY201905). Authors' contributions JWL wrote and submitted the manuscript. XCZ and ZMG contributed to the conception and design of the study; JWL, YF and FT performed the experiments and collected the data; TL and QP performed the statistical analysis; FYL and XL completed data interpretation. All authors contributed to revising the manuscript and approved the submitted version. Acknowledgements Not applicable. References Jokinen E. Obesity and cardiovascular disease. Minerva Pediatr 2015;67:25-32. Lennon RP, Claussen KA, Kuersteiner KA. State of the Heart: An Overview of the Disease Burden of Cardiovascular Disease from an Epidemiologic Perspective. Prim Care 2018;45:1-15. Roth GA, Johnson C, Abajobir A, et al. Global, Regional, and National Burden of Cardiovascular Diseases for 10 Causes, 1990 to 2015. J Am Coll Cardiol 2017;70:1-25. Pollard TJ. The acute myocardial infarction. Prim Care 2000;27:631-49;vi. Xiong YY, Gong ZT, Tang RJ, et al. The pivotal roles of exosomes derived from endogenous immune cells and exogenous stem cells in myocardial repair after acute myocardial infarction. Theranostics 2021;11:1046-58. Jackson AO, Rahman GA, Yin K, et al. Enhancing Matured Stem-Cardiac Cell Generation and Transplantation: A Novel Strategy for Heart Failure Therapy. J Cardiovasc Transl Res 2020. Tomek J, Bub G. Hypertension-induced remodelling: on the interactions of cardiac risk factors. J Physiol 2017;595:4027-36. Prabhu SD, Frangogiannis NG. The Biological Basis for Cardiac Repair After Myocardial Infarction: From Inflammation to Fibrosis. Circ Res 2016;119:91-112. Gonzalez A, Schelbert EB, Diez J, et al. Myocardial Interstitial Fibrosis in Heart Failure: Biological and Translational Perspectives. J Am Coll Cardiol 2018;71:1696-706. Hoit BD, Takeishi Y, Cox MJ, et al. Remodeling of the left atrium in pacing-induced atrial cardiomyopathy. Mol Cell Biochem 2002;238:145-50. Song X, Tan L, Wang M, et al. Myricetin: A review of the most recent research. Biomed Pharmacother 2020;134:111017. Chen XQ, Hu T, Han Y, et al. Preventive Effects of Catechins on Cardiovascular Disease. Molecules 2016;21. Lee S, Yu JS, Phung HM, et al. Potential Anti-Skin Aging Effect of (-)-Catechin Isolated from the Root Bark of Ulmus davidiana var. japonica in Tumor Necrosis Factor-alpha-Stimulated Normal Human Dermal Fibroblasts. Antioxidants (Basel) 2020;9. Huang Z, Jing X, Sheng Y, et al. (-)-Epicatechin attenuates hepatic sinusoidal obstruction syndrome by inhibiting liver oxidative and inflammatory injury. Redox Biol 2019;22:101117. Pereyra-Vergara F, Olivares-Corichi IM, Perez-Ruiz AG, et al. Apoptosis Induced by (-)-Epicatechin in Human Breast Cancer Cells is Mediated by Reactive Oxygen Species. Molecules 2020;25. Qu Z, Liu A, Li P, et al. Advances in physiological functions and mechanisms of (-)-epicatechin. Crit Rev Food Sci Nutr 2021;61:211-33. Bernatova I. Biological activities of (-)-epicatechin and (-)-epicatechin-containing foods: Focus on cardiovascular and neuropsychological health. Biotechnol Adv 2018;36:666-81. Yamazaki KG, Andreyev AY, Ortiz-Vilchis P, et al. Intravenous (-)-epicatechin reduces myocardial ischemic injury by protecting mitochondrial function. Int J Cardiol 2014;175:297-306. Yamazaki KG, Romero-Perez D, Barraza-Hidalgo M, et al. Short- and long-term effects of (-)-epicatechin on myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol 2008;295:H761-7. Yamazaki KG, Taub PR, Barraza-Hidalgo M, et al. Effects of (-)-epicatechin on myocardial infarct size and left ventricular remodeling after permanent coronary occlusion. J Am Coll Cardiol 2010;55:2869-76. Prince PS. (-) Epicatechin prevents alterations in lysosomal glycohydrolases, cathepsins and reduces myocardial infarct size in isoproterenol-induced myocardial infarcted rats. Eur J Pharmacol 2013;706:63-9. Prince PS. A biochemical, electrocardiographic, electrophoretic, histopathological and in vitro study on the protective effects of (-)epicatechin in isoproterenol-induced myocardial infarcted rats. Eur J Pharmacol 2011;671:95-101. Huang SS, Huang JS. TGF-beta control of cell proliferation. J Cell Biochem 2005;96:447-62. Periyasamy S, Sanchez ER. Antagonism of glucocorticoid receptor transactivity and cell growth inhibition by transforming growth factor-beta through AP-1-mediated transcriptional repression. Int J Biochem Cell Biol 2002;34:1571-85. Xu F, Liu C, Zhou D, et al. TGF-beta/SMAD Pathway and Its Regulation in Hepatic Fibrosis. J Histochem Cytochem 2016;64:157-67. Tarbit E, Singh I, Peart JN, et al. Biomarkers for the identification of cardiac fibroblast and myofibroblast cells. Heart Fail Rev 2019;24:1-15. Eghbali M, Tomek R, Woods C, et al. Cardiac fibroblasts are predisposed to convert into myocyte phenotype: specific effect of transforming growth factor beta. Proc Natl Acad Sci U S A 1991;88:795-9. Li X, Han D, Tian Z, et al. Activation of Cannabinoid Receptor Type II by AM1241 Ameliorates Myocardial Fibrosis via Nrf2-Mediated Inhibition of TGF-beta1/Smad3 Pathway in Myocardial Infarction Mice. Cell Physiol Biochem 2016;39:1521-36. Mouton AJ, Rivera OJ, Lindsey ML. Myocardial infarction remodeling that progresses to heart failure: a signaling misunderstanding. Am J Physiol Heart Circ Physiol 2018;315:H71-H9. Talman V, Ruskoaho H. Cardiac fibrosis in myocardial infarction-from repair and remodeling to regeneration. Cell Tissue Res 2016;365:563-81. Jenca D, Melenovsky V, Stehlik J, et al. Heart failure after myocardial infarction: incidence and predictors. ESC Heart Fail 2020. Shay J, Elbaz HA, Lee I, et al. Molecular Mechanisms and Therapeutic Effects of (-)-Epicatechin and Other Polyphenols in Cancer, Inflammation, Diabetes, and Neurodegeneration. Oxid Med Cell Longev 2015;2015:181260. Jung HA, Jung MJ, Kim JY, et al. Inhibitory activity of flavonoids from Prunus davidiana and other flavonoids on total ROS and hydroxyl radical generation. Arch Pharm Res 2003;26:809-15. Kim MJ, Ryu GR, Kang JH, et al. Inhibitory effects of epicatechin on interleukin-1beta-induced inducible nitric oxide synthase expression in RINm5F cells and rat pancreatic islets by down-regulation of NF-kappaB activation. Biochem Pharmacol 2004;68:1775-85. Sinegre T, Milenkovic D, Teissandier D, et al. Impact of epicatechin on fibrin clot structure. Eur J Pharmacol 2020:173830. Sinegre T, Teissandier D, Milenkovic D, et al. Epicatechin influences primary hemostasis, coagulation and fibrinolysis. Food Funct 2019;10:7291-8. Engler MB, Engler MM, Chen CY, et al. Flavonoid-rich dark chocolate improves endothelial function and increases plasma epicatechin concentrations in healthy adults. J Am Coll Nutr 2004;23:197-204. De Los Santos S, Garcia-Perez V, Hernandez-Resendiz S, et al. (-)-Epicatechin induces physiological cardiac growth by activation of the PI3K/Akt pathway in mice. Mol Nutr Food Res 2017;61. Li JW, Wang XY, Zhang X, et al. ()Epicatechin protects against myocardial ischemiainduced cardiac injury via activation of the PTEN/PI3K/AKT pathway. Mol Med Rep 2018;17:8300-8. De Los Santos S, Palma-Flores C, Zentella-Dehesa A, et al. (-)-Epicatechin inhibits development of dilated cardiomyopathy in delta sarcoglycan null mouse. Nutr Metab Cardiovasc Dis 2018;28:1188-95. Cao B, Wang Q, Zhang H, et al. Two immune-enhanced molecular subtypes differ in inflammation, checkpoint signaling and outcome of advanced head and neck squamous cell carcinoma. Oncoimmunology 2018;7:e1392427. Sriram N, Kalayarasan S, Manikandan R, et al. Epigallocatechin gallate attenuates fibroblast proliferation and excessive collagen production by effectively intervening TGF-beta1 signalling. Clin Exp Pharmacol Physiol 2015;42:849-59. Tables Table 1 Sequence of primers for real-time PCR Primer Forward Sequence (5’ to 3’) Reverse Sequence (5’ to 3’) GAPDH CAGAAGGGGCGGAGATGAT AGGCCGGTGCTGAGTATGTC TGFβ1 SMAD2 CTAATGGTGGACCGCAACAAC ACGTTAACCGAAATGCCACT GCTTCCCGAATGTCTGACGTA ATGTAATACAAGCGCACTCCC SMAD3 ACTGTCCAATGTCAACCGGAA ATGTAGTAGAGCCGCACACC Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-270657","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":15178629,"identity":"05bfce9e-a233-4f5d-b55b-5d3c65eb9cfe","order_by":0,"name":"Jiawen Li","email":"","orcid":"","institution":"Fourth Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jiawen","middleName":"","lastName":"Li","suffix":""},{"id":15178630,"identity":"70310dcd-81b9-4a9a-ac5c-083efa2df596","order_by":1,"name":"Xingchang Zheng","email":"","orcid":"","institution":"Qingdao Women and Children's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xingchang","middleName":"","lastName":"Zheng","suffix":""},{"id":15178631,"identity":"7e3a277f-0458-48c2-b922-0b3c5b02140c","order_by":2,"name":"Zuoming Guo","email":"","orcid":"","institution":"Tumor Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zuoming","middleName":"","lastName":"Guo","suffix":""},{"id":15178632,"identity":"90281508-8495-4a7f-ac38-6fce992ada47","order_by":3,"name":"Ying Fan","email":"","orcid":"","institution":"First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Fan","suffix":""},{"id":15178633,"identity":"6c7030a8-8781-4129-a407-59dd7bc0f1b4","order_by":4,"name":"Fang Tian","email":"","orcid":"","institution":"First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Tian","suffix":""},{"id":15178634,"identity":"e3d4bf9f-c5fa-49c7-a61c-538693f233e6","order_by":5,"name":"Teng Li","email":"","orcid":"","institution":"First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Teng","middleName":"","lastName":"Li","suffix":""},{"id":15178635,"identity":"1ed3399d-736c-475f-a708-30522dbdf6d6","order_by":6,"name":"Qing Pan","email":"","orcid":"","institution":"First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Pan","suffix":""},{"id":15178636,"identity":"8dfffdb7-1eac-4b81-8e2f-d24bdc219ff1","order_by":7,"name":"Fengyu Liu","email":"","orcid":"","institution":"First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fengyu","middleName":"","lastName":"Liu","suffix":""},{"id":15178637,"identity":"7ed3d055-3191-4f2a-b2a6-a6d31692310a","order_by":8,"name":"Xiao Liang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAElEQVRIiWNgGAWjYDACZiB+YABi8TAwMP6zkWNjbz9AWEsCTAsDW5oxH8+ZBMI2QZSAtRxOnCfhYIBXtcFx5ocPEgrs8uQdeI9u5uE5nN4mATTiR8U2nFokm9mMDRIMkosND/Cl3eaRSM9tk248wNhz5jZOLfzMDGYSCQbMiRsbeMxu8xhY57bJHEhgZmzDrYWNmf0bUEs9VEsCczobyAR8WviZeUC2HE6czwDScsA5gaAWyWaeYqBfjiduAGq5ObchzbANGMgH8fnF4PzxjQ8+/KlOnA902I23DTby8u3tBx/8qMCtBaH3/gME5wBh9UAg30CUslEwCkbBKBiJAACHbFHSteP1DgAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, No. 23 Youzheng Street, Nangang District, Harbin, 150000, China","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Liang","suffix":""}],"badges":[],"createdAt":"2021-02-23 13:02:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-270657/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-270657/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":6863325,"identity":"d7fb9342-f953-43fd-b5fd-e390586d779a","added_by":"auto","created_at":"2021-03-11 21:36:59","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":943728,"visible":true,"origin":"","legend":"(-)-EPI attenuates MF of AMI mice. Mice were gavaged with or without (-)-EPI (1 mg/kg/day) for 10 days, and subjected to LAD occlusion to induce AMI models. After that, the mice were sacrificed and their hearts were taken out for staining. (A, B) Representative imaging of HE staining (A) and Masson staining (B) to assess the severity of MF (100 ×).","description":"","filename":"Figure1.eps.jpg","url":"https://assets-eu.researchsquare.com/files/rs-270657/v1/38c1449c2d510ee22682f5fb.jpg"},{"id":6863324,"identity":"10007ab8-ea67-4feb-9a19-0c98c8128b1a","added_by":"auto","created_at":"2021-03-11 21:36:59","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":590973,"visible":true,"origin":"","legend":"(-)-EPI regulates myocardial fibroblast proliferation and apoptosis. (A) Myocardial fibroblasts were cultured in hypoxic condition (2% O2) for 24 h. (B) For CCK8 assay, cells were treated with different concentrations of (-)-EPI and were placed back in the 5% carbon dioxide incubator for 72 h, and taken out every 24 h to detect cell proliferation; (C) For apoptosis assay, cells were treated with 20 µM (-)-EPI for 48 h and then used to calculate apoptotic ratio. Data represent the results of three independent experiments ± SD; ns non-significant, ##p \u003c 0.01, ###p \u003c 0.001, ####p \u003c 0.0001 vs. control; *p \u003c 0.05, **p \u003c 0.01, ***p \u003c 0.001, ****p \u003c 0.0001 vs. hypoxia.","description":"","filename":"Figure2.eps.jpg","url":"https://assets-eu.researchsquare.com/files/rs-270657/v1/4b03d246a532e7060a23386a.jpg"},{"id":6864524,"identity":"bc7553e4-49be-4d57-abb0-99da70c74787","added_by":"auto","created_at":"2021-03-11 21:42:59","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":585128,"visible":true,"origin":"","legend":"(-)-EPI down-regulates TGF-β signaling and inhibits collagen deposition. (A, B) RT-qPCR and Western blot of mRNA and protein expression of TGF-β1, SMAD2 and SMAD3 under normoxia or hypoxia with (-)-EPI and HY-100347A treatment; (C) Representative images of Sirius Red staining to reflect the collagen content under normoxia or hypoxia with (-)-EPI and HY-100347A treatment and corresponding quantification. Data represent the results of three independent experiments ± SD; ##p \u003c 0.01, ####p \u003c 0.0001 vs. control; *p \u003c 0.05, **p \u003c 0.01, ****p \u003c 0.0001 vs. hypoxia; ns non-significant, $p \u003c 0.05, $$$$p \u003c 0.0001 vs. (-)-EPI.","description":"","filename":"Figure3.eps.jpg","url":"https://assets-eu.researchsquare.com/files/rs-270657/v1/fbce8060312b093f386ba159.jpg"},{"id":6863831,"identity":"5494524e-0e73-493e-ba62-95cf0d11388d","added_by":"auto","created_at":"2021-03-11 21:39:59","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":876567,"visible":true,"origin":"","legend":"(-)-EPI inhibited MF of AMI mice by inactivation of TGF-β signaling. Mice were gavaged with or without HY-100347A (10 mg/kg/day) or (-)-EPI (1 mg/kg/day) for 10 days, and then used to construct AMI models. After that, the mice were sacrificed and their hearts were taken out for staining. (A, B) Representative imaging of HE staining (A) and Masson staining (B) to assess the severity of MF (100 ×)","description":"","filename":"Figure4.eps.jpg","url":"https://assets-eu.researchsquare.com/files/rs-270657/v1/6c91a89b48dfb52bd7b6bb6b.jpg"},{"id":15272328,"identity":"47ba298b-c987-4817-b0d2-47dfd8cf634b","added_by":"auto","created_at":"2021-11-06 09:16:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":938942,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-270657/v1/7d8e8293-9d2b-42d6-8202-86d9ef3fa4e6.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eThe Dual Effect and Mechanism of (-)-epicatechin on Hypoxic-induced Proliferation and Apoptosis of Cardiac Fibroblasts\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWith the increase in the aging population, cardiovascular disease has become a major disease seriously threatening human health (1). The elderly are susceptible to cardiovascular diseases such as hypertension, diabetes, stroke (2). It is estimated that millions of people die from cardiovascular disease every year, where heart failure and myocardial infarction are the main causes (3-6). From the perspective of the pathogenesis, MF is common feature of cardiovascular diseases such as hypertension and MI (7,8). MF characterized by significant increase in collagen content or accumulation of extracellular matrix (ECM) of the myocardium, affects cardiovascular functions (9). MF accelerates the progression of heart failure, even leading to sudden death (10). However, current clinical measures still fail to prevent this disease. The main reason is that the pathogenesis of MF is still unclear, restraining the administration of appropriate and timely measures. Therefore, investigating the underlying basis of MF and effective preventive and therapeutic measures are the focus of current researches.\u003c/p\u003e\n\u003cp\u003eTraditional Chinese medicines are widely applied to the treatment for cardiovascular diseases, such as Myricetin (11), Scrophularia and Catechins (12). (-)-EPI, a kind of catechin compound, has antioxidant (13), enhances immune defense (14) and anti-tumor activity (15). The impact of (-)-EPI on oxidative damage has been studied previously and evidence notes that for cardiovascular system, administration of EPI reduces blood lipids, lowers blood pressure and inhibits thrombosis (12,16,17). Yamazaki KG et al. found that (-)-EPI alleviates myocardial ischemic damage through potentially protecting mitochondria (18). Also, treatment with (-)-EPI reduced the MI size by 50% in the rat model of ischemia-reperfusion injury. The protective effects are not related to hemodynamics changes and maintain over time, accompanied by a decrease in tissue damage indicators (19). Furthermore, Yamazaki KG has demonstrated that administration of (-)-EPI in advance in MI mice reduces the MI area and restrains left ventricular remodeling (20). A study by Prince P et al. unveils that (-)-EPI exerts anti-oxidative stress effect by scavenging free free radicals, thereby protecting the myocardial tissue of the isoproterenol-induced MI model (21,22). However, the mechanism underlying (-)-EPI preventing and treating MF remains unclear.\u003c/p\u003e\n\u003cp\u003eTransforming growth factor beta (TGF-\u0026beta;) is a multifunctional cytokine promoting or inhibiting cell proliferation and differentiation as its effect depends on the target cells (23,24). TGF-\u0026beta;1 is known to associate with ECM deposition, and is recognized as a therapeutic target for organ fibrosis (25). In recent years, the role of TGF-\u0026beta;1 in myocardial tissue has received increasing attention. TGF-\u0026beta;1 and its receptors are expressed in cardiomyocytes and non-cardiomyocytes, whilst TGF-\u0026beta;1 is mainly produced by cardiac fibroblasts and myofibroblasts (26). Addition of TGF-\u0026beta;1 to cultured rabbit myocardial fibroblasts coincided with an increase in type I and type III collagen, and fibronectin mRNA and protein levels, as indicated by Eghbali et al. in 1991 (27). TGF-\u0026beta;1 inhibits the production of collagenase and elastase and stimulates the expression of plasminogen activator inhibitor-1 (PAI-1) and tissue inhibitors of matrix metalloproteinases (TIMP), thereby delaying degradation of ECM components such as type I collagen and promoting the process of MF (28). Collectively, the TGF-\u0026beta;/Smads signaling pathway is responsible for MF and TGF-\u0026beta; has been confirmed as an important factor for fibrosis, despite that the causality of TGF-\u0026beta; in MF has not been clarified. Therefore, in-depth studies on TGF-\u0026beta;/Smads signaling pathway will not only further elucidate the pathogenesis of MF, but also contribute to a novel treatment.\u003c/p\u003e\n\u003cp\u003eOur study is the first to combine (-)-EPI with TGF-\u0026beta; signaling to explore the mechanism of (-)-EPI regulating MF after AMI.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eAnimal model \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 24 healthy male C57BL/6 mice (8 weeks old, weight 25-30g), were maintained under a 12h/12h dark/light regime (7:00 a.m.-7:00 p.m.) at 21 \u0026plusmn; 1℃ and at a humidity of 55%-60% with free access to food and water. After 7 days of adaptive feeding, all animals were randomly divided into four groups: (1) The sham-operated group (sham group, n = 6), mouse left anterior descending (LAD) coronary artery was subjected to suture without ligation; (2) AMI group, n = 6, the suture on needle was passed through mouse LAD coronary artery followed by ligation; (3) AMI + (-)-EPI group (n = 6), mouse received injection of (-)-EPI (1 mg/kg/day) for continuous 10 days followed by ligation of LAD coronary artery; (4) AMI + (-)-EPI + HY-100347A group (n = 6), mice were administrated (-)-EPI (1 mg/kg/day) for continuous 10 days after intraperitoneal injection of HY-100347A (10 mg/kg/day) for 30 min followed by LAD occlusion through ligation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHematoxylin and eosin (HE) staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe sections were dewaxed with xylene Ⅰ for 10 min and xylene Ⅱ, Ⅲ for 5 min, followed by incubation in absolute ethanol and gradient ethanol (95%, 85%) for 1 min, respectively. After rinsing with tap water, sections were stained with hematoxylin for about 1-5 min, differentiated with 1%/0.5%/0.25% hydrochloric acid for 3-5 s, and stained with eosin for 20 s-2 min. After that, the sections were dehydrated with gradient ethanol from 85% to 100%, immersed in xylene Ⅰand Ⅱ, blocked with neutral gum, and finally sealed. hematoxylin stains the cell nuclei are stained with a blue or purplish-blue color, muscle, cytoplasm, red blood cells, and connective tissue with a pink color, and eosinophilic particles in cytoplasm with a bright red color; collagen fibers are stained light pink; elastic fibers are stained bright pink.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMasson staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMyocardial tissues were cut into sections and deparaffinized in distilled water. The sections were stained with hematoxylin for 5-10 min, differentiated with hydrochloric acid and alcohol, and rinsed in running water. After washing, the sections were stained in acid fuchsin solution for 5-8 min, washed in distilled water, and stained with 1% phosphomolybdic acid for 1-3 min and with aniline blue solution or bright green solution for 5 min. Then the samples were dried in a 60℃ incubator, cleared with xylene, and sealed. Collagen fibers were counterstained with aniline blue (blue) or bright green (green), cytoplasm, muscle fibers and red blood cells were stained red, and nuclei were stained blue-brown.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFibroblast cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1-2 day-old neonatal mouse hearts were extracted upon disinfection with 70% alcohol and placed on a DMEM petri dish. After removing blood and cutting off the aorta and atrium, the hearts were cut into pieces (2 mm). The sections were digested with 0.25% pancreatin at 37\u0026deg;C for 5 min, 6 to 8 times, and subjected to differential adhesion to to obtain fibroblasts. The cells were seeded in 30 mm culture flasks, 6-well plates or 96-well plates at a density of 10\u003csup\u003e6\u003c/sup\u003e cells/ml. The flasks and plates were placed in an incubator (37\u0026deg;C, 95% air and 5% CO\u003csub\u003e2\u003c/sub\u003e) for 48-72 h and then transferred to serum-free DMEM for culturing for 24 h. The fibroblasts then were randomly divided into groups for various experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Counting Kit-8 (CCK-8) assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAdherent cardiac fibroblasts in the logarithmic growth phase were seeded in a 96-well plate with 100 \u0026mu;l/well (5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells), and cultured under normoxia or hypoxia for 24 h. The fibroblasts were incubated with different concentrations of (-)-EPI for 72 h and 10 \u0026micro;M CCK-8 solution was added to the cells every 24 h and cultured for 2 h. A microplate reader was used to detect optical density (OD) at 450 nm for subsequent analysis of viability.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing washing cells in cold PBS buffer, the cells were suspended in Binding Buffer to prepare a suspension of 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/ml. 100 \u0026mu;l of cell suspension was taken to mix with 5 \u0026mu;g of purified recombinant Annexin V-FITC, and incubated for 15 min at room temperature in the dark. Then the mixture was centrifuged at 1000 rpm for 5 min with the supernatant removed. 200 \u0026mu;l Binding Buffer was added to resuspend the cells with 5 \u0026mu;l PI, and a flow cytometer was used to evaluate the cell apoptosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReverse transcription polymerase chain reaction (RT-qPCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cell and tissues using Trizol reagent (15596026, Invitrogen, USA) and reverse transcribed into cDNA according to the procedure of PrimeScript RT reagent Kit (RR047A, Takara, Japan). Then the cRNA was subjected to RT-qPCR using Fast SYBR Green PCR kit (Applied biosystems) and ABI PRISM 7300 RT-PCR system (Applied biosystems) to quantitatively analyze RNA in triple. With GAPDH as an internal reference, gene expression was calculated using the 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e\u0026Delta;\u0026Delta;\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e method and the experiment was repeated for at least three times. The primer sequences were listed in table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCardiac fibroblasts were incubated with 100 \u0026micro;l RIPA and 1 \u0026micro;l PMSF, and sonicated. Mouse myocardial tissues were grinded in 200 \u0026micro;l cell lysate and lysed on ice for 30 min. The above cell and tissue samples were centrifuged at 4\u0026deg;C, 13000 r/min for 30 min and the supernatant was collected, with protein concentration determined by Bicinchoninic Acid method. 100 \u0026micro;g of protein was mixed with 5 \u0026times; loading buffer and denatured at 100\u0026deg;C for 5 min. After centrifugation, proteins were separated through SDS-PAGE and transferred to polyvinylidene fluoride membrane, blocked with 5% skim milk. The membrane was then incubated with the corresponding primary and secondary antibodies, and detected by an infrared fluorescence scanning system after incubation. With GAPDH as an internal reference, the samples were photographed, and analyzed the image analysis software odyssey1.2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll statistics were analyzed using\u0026nbsp;the SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). Measurement data was\u0026nbsp;presented as mean \u0026plusmn; standard deviation. Comparisons those among three\u0026nbsp;or more\u0026nbsp;groups were made by one-way analysis of variance\u0026nbsp;(ANOVA), with\u0026nbsp;Tukey\u0026nbsp;post-hoc test. \u0026nbsp;All tests were two-sided\u0026nbsp;and\u0026nbsp;P \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e(-)-EPI regulates MF following AMI in mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate whether (-)-EPI regulates malignant arrhythmia, a mouse AMI model was established and the modeled mice were administered with (-)-EPI. Mouse heart samples were collected and subjected to HE and Masson staining to evaluate pathological changes in myocardial interstitium (Figure 1A, B). The results showed that compared with the sham-operated mice, the AMI mice had obvious MF in the marginal myocardial infarct tissue. But upon the treatment with (-)-EPI, the MF was significantly attenuated, indicating that (-)-EPI could improve MF in AMI mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(-)-EPI increases hypoxia-induced cardiomyocyte proliferation and decreases apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApart from the \u003cem\u003ein vivo\u003c/em\u003e function of (-)-EPI, myocardial fibroblasts from neonatal rats were taken for further identifying its impact on AMI \u003cem\u003ein vitro\u003c/em\u003e. The fibroblasts were cultured under hypoxia to induce MI and establish cell model of AMI (Figure 2A). CCK-8 assay was initially performed to determine the effect of different concentrations of (-)-EPI treatment on cell proliferation. Our results indicated that hypoxia significantly inhibited cell proliferation, while (-)-EPI treatment promoted hypoxia-induced fibroblast proliferation (Figure 2B). Besides, (-)-EPI was indicated to attenuate hypoxia-induced apoptosis, according to the results from flow cytometry (Figure 2C). Taken altogether, these results indicate that (-)-EPI could enhance fibroblast proliferation and restrain apoptosis, prolonging the survival of cardiomyocytes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(-)-EPI down-regulates TGF-\u003c/strong\u003e\u003cstrong\u003e\u0026beta;\u003c/strong\u003e\u003cstrong\u003e1 expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe then further explored the mechanism of (-)-EPI in the process of MF. TGF-\u0026beta; signaling is known to play a large role in MF. Herein, we examined the specific effect of (-)-EPI on TGF-\u0026beta; expression under different conditions by RT-qPCR and Western blot. Compared to control treatment, hypoxia treatment significantly promoted the expression of TGF-\u0026beta;1, SMAD2 and SMAD3, while (-)-EPI treatment restored their expression levels to that of the control group. Additionally, as HY-100347A is an agonist of TGF-\u0026beta; signaling, addition of HY-100347A only offset the effect of (-)-EPI to a certain extent (Figure 3A and B). As for the the impact of (-)-EPI on the collagen content in cells, the imaging of Sirius Red staining depicted increased collagen content in hypoxia-treated cells and that compared with the hypoxia group, (-)-EPI administration resulted in a decline in collagen content which could be reversed by addition of HY-100347A (Figure 3C). These above results elucidate that (-)-EPI could improve MF by down-regulating the expression of TGF-\u0026beta;1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(-)-EPI attenuates MF following AMI in mice by down-regulating the expression of TGF-\u003c/strong\u003e\u003cstrong\u003e\u0026beta;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo study whether and how (-)-EPI regulates MF in AMI mice through TGF-\u0026beta;1 signaling \u003cem\u003ein vivo\u003c/em\u003e, (-)-EPI and HY-100347A were administered to AMI mice and control mice through intraperitoneal injection. (-)-EPI treatment alone inhibited the process of MF, but HY-100347A aggravated MF (Figure 4A, B). In a word, (-)-EPI could impair MF after AMI in mice by down-regulation of TGF-\u0026beta;1.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eMF, a typical symptom of myocardial remodeling, could contribute to increasing myocardial stiffness and deterioration of ventricular diastolic function, and a decline in coronary artery reserve (29,30). It has been proved that myocardial infarction always results in heart failure and both are often accompanied by severe MF (31). Previous studies mainly focused on the prevention and reversal of structural and functional myocardial abnormality. Recent investigators have gradually realized the importance of MF in the heart failure, so MF becomes a new target of cardiovascular disease.\u003c/p\u003e\n\u003cp\u003e(-)-EPI has a wide range of effects. Its antioxidant and anti-inflammatory activity as well as regulatory impact on cardiovascular diseases have been elucidated in recent years (16,32). Accumulating evidence has reported that (-)-EPI directly chemically reacts with reactive oxygen species (ROS), or interact with signal pathways or enzymes regulating ROS to eliminate ROS S(13,33). In addition, pancreatic inflammatory cells infiltrate and release IL-1\u0026beta; during diabetes, whereas (-)-EPI inhibits the expression of IL-1\u0026beta; and iNOS through blocking the nuclear localization of the p65 subunit of NF-\u0026kappa;B (34). In cardiovascular diseases, (-)-EPI could mitigate platelet function to allow fibrin clot dissolution, and play multifaceted roles in thromboembolic diseases (35,36). A short-term study on healthy people demonstrated that consumption of high-flavonoid dark chocolate containing 46 mg (-)-EPI for 2 weeks strengthens endothelial function and improves vascular endothelial-dependent blood flow-mediated dilation (37). Furthermore, (-)-EPI is confirmed to protect the heart against damage and promote heart growth. One study pointed out that (-)-EPI induces physiological cardiac growth through activation of PI3K/Akt pathway (38). Another study by Li JW et al. notices that (-)-EPI attenuates ischemia-induced heart damage targeting PTEN to regulate PI3K-AKT signaling (39). Besides, treatment with (-)-EPI effectively reduces cardiac fibrosis size in the sarcoglycan null mice (40). However, in spite of these findings, the interaction between (-)-EPI, MF and MI is still unclear, and therefore, we managed to further unravel the mechanism underlying (-)-EPI in MF after MI.\u003c/p\u003e\n\u003cp\u003eOur findings depict the role of (-)-EPI in regulating MF and its underlying mechanism. (-)-EPI administration could significantly improve MF following AMI\u003cem\u003e in vivo\u003c/em\u003e and effectively prolong the survival of cardiac fibroblast \u003cem\u003ein vitro.\u003c/em\u003e Mechanistically, (-)-EPI targeting TGF-\u0026beta; signaling exerts its regulatory activity and thereby inhibits collagen deposition and MF.\u003c/p\u003e\n\u003cp\u003eIn cardiovascular disease, TGF-\u0026beta; signaling is closely related to several catechin compounds such as Epigallocatechin gallate (EGCG) which is reported to attenuate myocardial damage in mice with heart failure through the TGF-\u0026beta;1/Smad3 signaling pathway (41). EGCG effectively interferes with TGF-\u0026beta;1 signaling to decrease fibroblast proliferation and collagen production (42). But the relationship between (-)-EPI and TGF-\u0026beta; has not been fully elucidated, especially in cardiovascular diseases. Our study elucidates the TGF-\u0026beta; signaling mechanism how (-)-EPI regulates MF, serving to further understand the (-)-EPI and its function in MF.\u003c/p\u003e\n\u003cp\u003eLimitations, certainly, still exist in the present study. We have not introduced how (-)-EPI is located on the TGF-\u0026beta; signal to perform its function. In addition, whether (-)-EPI also could effectively regulate the MF following MI in other animal models, such as pig models still requires more experiments, which are direction of our following investigation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our study illustrates that (-)-EPI attenuates MF following MI by targeting TGF-\u0026beta; signals and underlies the causality of (-)-EPI in improving MF.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e(-)-EPI: (-)-Epicatechin\u003c/p\u003e\n\u003cp\u003eMF: myocardial fibrosis\u003c/p\u003e\n\u003cp\u003eAMI: acute myocardial infarction\u003c/p\u003e\n\u003cp\u003eECM: extracellular matrix\u003c/p\u003e\n\u003cp\u003eTGF-\u0026beta;: Transforming growth factor beta\u003c/p\u003e\n\u003cp\u003ePAI-1: plasminogen activator inhibitor-1\u003c/p\u003e\n\u003cp\u003eTIMP: tissue inhibitors of matrix metalloproteinases\u003c/p\u003e\n\u003cp\u003eLAD: left anterior descending\u003c/p\u003e\n\u003cp\u003eHE: Hematoxylin and eosin\u003c/p\u003e\n\u003cp\u003eCCK-8: Cell Counting Kit-8\u003c/p\u003e\n\u003cp\u003eRT-qPCR: Reverse transcription polymerase chain reaction\u003c/p\u003e\n\u003cp\u003eROS: reactive oxygen species\u003c/p\u003e\n\u003cp\u003eEGCG: Epigallocatechin gallate\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study protocol was approved by the institutional ethics committee and research board of Harbin Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Nurture Research Fund from The Fourth Affiliated Hospital of Harbin Medical University (HYDSYPY201905).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJWL wrote and submitted the manuscript. XCZ and ZMG contributed to the conception and design of the study; JWL, YF and FT performed the experiments and collected the data; TL and QP performed the statistical analysis; FYL and XL completed data interpretation. All authors contributed to revising the manuscript and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eJokinen E. Obesity and cardiovascular disease. Minerva Pediatr 2015;67:25-32.\u003c/li\u003e\n\u003cli\u003eLennon RP, Claussen KA, Kuersteiner KA. State of the Heart: An Overview of the Disease Burden of Cardiovascular Disease from an Epidemiologic Perspective. Prim Care 2018;45:1-15.\u003c/li\u003e\n\u003cli\u003eRoth GA, Johnson C, Abajobir A, et al. Global, Regional, and National Burden of Cardiovascular Diseases for 10 Causes, 1990 to 2015. J Am Coll Cardiol 2017;70:1-25.\u003c/li\u003e\n\u003cli\u003ePollard TJ. The acute myocardial infarction. Prim Care 2000;27:631-49;vi.\u003c/li\u003e\n\u003cli\u003eXiong YY, Gong ZT, Tang RJ, et al. The pivotal roles of exosomes derived from endogenous immune cells and exogenous stem cells in myocardial repair after acute myocardial infarction. Theranostics 2021;11:1046-58.\u003c/li\u003e\n\u003cli\u003eJackson AO, Rahman GA, Yin K, et al. Enhancing Matured Stem-Cardiac Cell Generation and Transplantation: A Novel Strategy for Heart Failure Therapy. J Cardiovasc Transl Res 2020.\u003c/li\u003e\n\u003cli\u003eTomek J, Bub G. Hypertension-induced remodelling: on the interactions of cardiac risk factors. J Physiol 2017;595:4027-36.\u003c/li\u003e\n\u003cli\u003ePrabhu SD, Frangogiannis NG. The Biological Basis for Cardiac Repair After Myocardial Infarction: From Inflammation to Fibrosis. Circ Res 2016;119:91-112.\u003c/li\u003e\n\u003cli\u003eGonzalez A, Schelbert EB, Diez J, et al. Myocardial Interstitial Fibrosis in Heart Failure: Biological and Translational Perspectives. J Am Coll Cardiol 2018;71:1696-706.\u003c/li\u003e\n\u003cli\u003eHoit BD, Takeishi Y, Cox MJ, et al. Remodeling of the left atrium in pacing-induced atrial cardiomyopathy. Mol Cell Biochem 2002;238:145-50.\u003c/li\u003e\n\u003cli\u003eSong X, Tan L, Wang M, et al. Myricetin: A review of the most recent research. Biomed Pharmacother 2020;134:111017.\u003c/li\u003e\n\u003cli\u003eChen XQ, Hu T, Han Y, et al. Preventive Effects of Catechins on Cardiovascular Disease. Molecules 2016;21.\u003c/li\u003e\n\u003cli\u003eLee S, Yu JS, Phung HM, et al. Potential Anti-Skin Aging Effect of (-)-Catechin Isolated from the Root Bark of Ulmus davidiana var. japonica in Tumor Necrosis Factor-alpha-Stimulated Normal Human Dermal Fibroblasts. Antioxidants (Basel) 2020;9.\u003c/li\u003e\n\u003cli\u003eHuang Z, Jing X, Sheng Y, et al. (-)-Epicatechin attenuates hepatic sinusoidal obstruction syndrome by inhibiting liver oxidative and inflammatory injury. Redox Biol 2019;22:101117.\u003c/li\u003e\n\u003cli\u003ePereyra-Vergara F, Olivares-Corichi IM, Perez-Ruiz AG, et al. Apoptosis Induced by (-)-Epicatechin in Human Breast Cancer Cells is Mediated by Reactive Oxygen Species. Molecules 2020;25.\u003c/li\u003e\n\u003cli\u003eQu Z, Liu A, Li P, et al. Advances in physiological functions and mechanisms of (-)-epicatechin. Crit Rev Food Sci Nutr 2021;61:211-33.\u003c/li\u003e\n\u003cli\u003eBernatova I. Biological activities of (-)-epicatechin and (-)-epicatechin-containing foods: Focus on cardiovascular and neuropsychological health. Biotechnol Adv 2018;36:666-81.\u003c/li\u003e\n\u003cli\u003eYamazaki KG, Andreyev AY, Ortiz-Vilchis P, et al. Intravenous (-)-epicatechin reduces myocardial ischemic injury by protecting mitochondrial function. Int J Cardiol 2014;175:297-306.\u003c/li\u003e\n\u003cli\u003eYamazaki KG, Romero-Perez D, Barraza-Hidalgo M, et al. Short- and long-term effects of (-)-epicatechin on myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol 2008;295:H761-7.\u003c/li\u003e\n\u003cli\u003eYamazaki KG, Taub PR, Barraza-Hidalgo M, et al. Effects of (-)-epicatechin on myocardial infarct size and left ventricular remodeling after permanent coronary occlusion. J Am Coll Cardiol 2010;55:2869-76.\u003c/li\u003e\n\u003cli\u003ePrince PS. (-) Epicatechin prevents alterations in lysosomal glycohydrolases, cathepsins and reduces myocardial infarct size in isoproterenol-induced myocardial infarcted rats. Eur J Pharmacol 2013;706:63-9.\u003c/li\u003e\n\u003cli\u003ePrince PS. A biochemical, electrocardiographic, electrophoretic, histopathological and in vitro study on the protective effects of (-)epicatechin in isoproterenol-induced myocardial infarcted rats. Eur J Pharmacol 2011;671:95-101.\u003c/li\u003e\n\u003cli\u003eHuang SS, Huang JS. TGF-beta control of cell proliferation. J Cell Biochem 2005;96:447-62.\u003c/li\u003e\n\u003cli\u003ePeriyasamy S, Sanchez ER. Antagonism of glucocorticoid receptor transactivity and cell growth inhibition by transforming growth factor-beta through AP-1-mediated transcriptional repression. Int J Biochem Cell Biol 2002;34:1571-85.\u003c/li\u003e\n\u003cli\u003eXu F, Liu C, Zhou D, et al. TGF-beta/SMAD Pathway and Its Regulation in Hepatic Fibrosis. J Histochem Cytochem 2016;64:157-67.\u003c/li\u003e\n\u003cli\u003eTarbit E, Singh I, Peart JN, et al. Biomarkers for the identification of cardiac fibroblast and myofibroblast cells. Heart Fail Rev 2019;24:1-15.\u003c/li\u003e\n\u003cli\u003eEghbali M, Tomek R, Woods C, et al. Cardiac fibroblasts are predisposed to convert into myocyte phenotype: specific effect of transforming growth factor beta. Proc Natl Acad Sci U S A 1991;88:795-9.\u003c/li\u003e\n\u003cli\u003eLi X, Han D, Tian Z, et al. Activation of Cannabinoid Receptor Type II by AM1241 Ameliorates Myocardial Fibrosis via Nrf2-Mediated Inhibition of TGF-beta1/Smad3 Pathway in Myocardial Infarction Mice. Cell Physiol Biochem 2016;39:1521-36.\u003c/li\u003e\n\u003cli\u003eMouton AJ, Rivera OJ, Lindsey ML. Myocardial infarction remodeling that progresses to heart failure: a signaling misunderstanding. Am J Physiol Heart Circ Physiol 2018;315:H71-H9.\u003c/li\u003e\n\u003cli\u003eTalman V, Ruskoaho H. Cardiac fibrosis in myocardial infarction-from repair and remodeling to regeneration. Cell Tissue Res 2016;365:563-81.\u003c/li\u003e\n\u003cli\u003eJenca D, Melenovsky V, Stehlik J, et al. Heart failure after myocardial infarction: incidence and predictors. ESC Heart Fail 2020.\u003c/li\u003e\n\u003cli\u003eShay J, Elbaz HA, Lee I, et al. Molecular Mechanisms and Therapeutic Effects of (-)-Epicatechin and Other Polyphenols in Cancer, Inflammation, Diabetes, and Neurodegeneration. Oxid Med Cell Longev 2015;2015:181260.\u003c/li\u003e\n\u003cli\u003eJung HA, Jung MJ, Kim JY, et al. Inhibitory activity of flavonoids from Prunus davidiana and other flavonoids on total ROS and hydroxyl radical generation. Arch Pharm Res 2003;26:809-15.\u003c/li\u003e\n\u003cli\u003eKim MJ, Ryu GR, Kang JH, et al. Inhibitory effects of epicatechin on interleukin-1beta-induced inducible nitric oxide synthase expression in RINm5F cells and rat pancreatic islets by down-regulation of NF-kappaB activation. Biochem Pharmacol 2004;68:1775-85.\u003c/li\u003e\n\u003cli\u003eSinegre T, Milenkovic D, Teissandier D, et al. Impact of epicatechin on fibrin clot structure. Eur J Pharmacol 2020:173830.\u003c/li\u003e\n\u003cli\u003eSinegre T, Teissandier D, Milenkovic D, et al. Epicatechin influences primary hemostasis, coagulation and fibrinolysis. Food Funct 2019;10:7291-8.\u003c/li\u003e\n\u003cli\u003eEngler MB, Engler MM, Chen CY, et al. Flavonoid-rich dark chocolate improves endothelial function and increases plasma epicatechin concentrations in healthy adults. J Am Coll Nutr 2004;23:197-204.\u003c/li\u003e\n\u003cli\u003eDe Los Santos S, Garcia-Perez V, Hernandez-Resendiz S, et al. (-)-Epicatechin induces physiological cardiac growth by activation of the PI3K/Akt pathway in mice. Mol Nutr Food Res 2017;61.\u003c/li\u003e\n\u003cli\u003eLi JW, Wang XY, Zhang X, et al. ()Epicatechin protects against myocardial ischemiainduced cardiac injury via activation of the PTEN/PI3K/AKT pathway. Mol Med Rep 2018;17:8300-8.\u003c/li\u003e\n\u003cli\u003eDe Los Santos S, Palma-Flores C, Zentella-Dehesa A, et al. (-)-Epicatechin inhibits development of dilated cardiomyopathy in delta sarcoglycan null mouse. Nutr Metab Cardiovasc Dis 2018;28:1188-95.\u003c/li\u003e\n\u003cli\u003eCao B, Wang Q, Zhang H, et al. Two immune-enhanced molecular subtypes differ in inflammation, checkpoint signaling and outcome of advanced head and neck squamous cell carcinoma. Oncoimmunology 2018;7:e1392427.\u003c/li\u003e\n\u003cli\u003eSriram N, Kalayarasan S, Manikandan R, et al. Epigallocatechin gallate attenuates fibroblast proliferation and excessive collagen production by effectively intervening TGF-beta1 signalling. Clin Exp Pharmacol Physiol 2015;42:849-59.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1 \u003c/strong\u003e\u003cstrong\u003eSequence of primers for \u003c/strong\u003e\u003cstrong\u003ereal-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" width=\"100%\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd width=\"13%\"\u003e\n\u003cp\u003ePrimer\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"45%\"\u003e\n\u003cp\u003eForward Sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41%\"\u003e\n\u003cp\u003eReverse Sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"13%\"\u003e\n\u003cp\u003eGAPDH\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"45%\"\u003e\n\u003cp\u003eCAGAAGGGGCGGAGATGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41%\"\u003e\n\u003cp\u003eAGGCCGGTGCTGAGTATGTC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"13%\"\u003e\n\u003cp\u003eTGF\u0026beta;1\u003c/p\u003e\n\u003cp\u003eSMAD2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"45%\"\u003e\n\u003cp\u003eCTAATGGTGGACCGCAACAAC\u003c/p\u003e\n\u003cp\u003eACGTTAACCGAAATGCCACT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41%\"\u003e\n\u003cp\u003eGCTTCCCGAATGTCTGACGTA\u003c/p\u003e\n\u003cp\u003eATGTAATACAAGCGCACTCCC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"13%\"\u003e\n\u003cp\u003eSMAD3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"45%\"\u003e\n\u003cp\u003eACTGTCCAATGTCAACCGGAA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"41%\"\u003e\n\u003cp\u003eATGTAGTAGAGCCGCACACC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Acute myocardial infarction, Myocardial fibrosis, (-)-Epicatechin, TGF-β1, Cardiovascular","lastPublishedDoi":"10.21203/rs.3.rs-270657/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-270657/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eObjective:\u003c/strong\u003e Cardiovascular diseases impose a considerable economic burden on health services and remain a threat to human being. (-)-Epicatechin [(-)-EPI], a traditional Chinese medicine is applied to treatment against the cardiovascular diseases. Herein, we aimed at investigating the underlying mechanism whereby (-)-EPI affects myocardial fibrosis (MF).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e The efficacy of (-)-EPI was determined in mouse models of acute myocardial infarction (AMI) and hypoxia-treated fibroblasts. Western blot and RT-qPCR analyses were conducted to determine TGF-β1, SMAD2 and SMAD3 expression, as collagen content was detected. CCK-8 assay and flow cytometry were carried out to detect fibroblast proliferation and apoptosis. HE and Masson staining reflected the histological change of myocardial tissues\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eCompared to sham-operated mice, AMI group exhibited MF and hypoxia-treated cardiac fibroblasts proliferation was restrained and apoptosis was increased. Treatment with (-)-EPI significantly attenuated the MF condition and restored fibroblast proliferation and apoptosis, whereas these effects were abrogated by the TGF-β1 agonist HY-100347A. (-)-EPI administration caused a decline in TGF-β1, SMAD2 and SMAD3 expression. Mechanistically, (-)-EPI targeting TGF-β signaling inhibits collagen deposition and attenuates MF.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eCollectively, (-)-EPI could improve MF following AMI through down-regulation of TGF-β1 signaling, providing a novel insight into treatment against the cardiovascular diseases.\u003c/p\u003e","manuscriptTitle":"The Dual Effect and Mechanism of (-)-epicatechin on Hypoxic-induced Proliferation and Apoptosis of Cardiac Fibroblasts","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-03-11 21:36:57","doi":"10.21203/rs.3.rs-270657/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9ae482c7-943e-4ec9-bcb9-0bb84bf78bb5","owner":[],"postedDate":"March 11th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":2909659,"name":"Cardiothoracic Surgery"}],"tags":[],"updatedAt":"2021-11-06T09:16:51+00:00","versionOfRecord":[],"versionCreatedAt":"2021-03-11 21:36:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-270657","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-270657","identity":"rs-270657","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}