Interference with HMGB1 inhibits neuronal ferroptosis following spinal cord injury through targeting ACSL4

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-03 · read from full text

The paper studied whether HMGB1 regulates neuronal ferroptosis after spinal cord injury (SCI) in female Sprague–Dawley rats and tested the mechanism involving ACSL4. Using time-course measurements of iron deposition, MDA, GSH, and protein expression (HMGB1, ACSL4, SLC7A11, GPX4) after contusion injury, plus an in vitro neuronal ferroptosis model induced by erastin with lentiviral HMGB1 knockdown or ACSL4 overexpression, the authors found that SCI increased iron deposition, MDA, HMGB1 and ACSL4 while decreasing GSH, GPX4, and SLC7A11 in a time-dependent manner, and that inhibiting HMGB1 with glycyrrhizic acid reduced these ferroptosis markers; in vitro, HMGB1 interference attenuated ferroptosis via suppressing ACSL4 (including co-immunoprecipitation evidence of HMGB1–ACSL4 interaction). A major stated limitation is that the work is a preprint and not peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Spinal cord injury (SCI) refers to structural and functional impairments of the spinal cord resulting from various etiologies. Ferroptosis has been increasingly recognized as a critical contributor to neuronal damage following SCI. Therefore, this study aims to investigate the regulatory role of HMGB1 in neuronal ferroptosis of SCI rats and to explore its underlying mechanisms. Iron ion deposition, MDA and GSH levels, as well as the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 in spinal cord tissue of SCI rats were measured at 24 h, 72 h and 1 week post-injury. Then, an in vitro neuronal ferroptosis model was established by treating primary rat spinal cord neurons with Erastin. Neuronal cells were transfected with lentiviral vectors for HMGB1 interference or ACSL4 overexpression. Iron ion levels, MDA content, GSH activity, and the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 were measured. The interaction between HMGB1 and ACSL4 was assessed by co-immunoprecipitation assays. Finally, SCI rats were administered the HMGB1 inhibitor glycyrrhizic acid (GA) and the effects GA on the iron ion deposition, MDA and SOD levels, as well as the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 in spinal cord tissues were evaluated. Iron ion deposition was observed in the spinal cord tissue of SCI rats, accompanied by increased levels of MDA, HMGB1 and ACSL4, as well as decreased levels of GSH, GPX4, and SLC7A11. These alterations exhibited a time-dependent pattern. The administration of GA in SCI rats significantly reduces iron ion deposition, decreases the levels of MDA, HMGB1 and ACSL4, and increases the levels of GSH, GPX4, and SLC7A11. Furthermore, cellular-level results demonstrated that interfering with HMGB1 could attenuate ferroptosis in rat spinal cord neurons through targeted suppression of ACSL4. Targeted suppression of ACSL4 expression through interference with HMGB1 inhibits neuronal ferroptosis in SCI rats.
Full text 126,901 characters · extracted from preprint-html · click to expand
Interference with HMGB1 inhibits neuronal ferroptosis following spinal cord injury through targeting ACSL4 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Interference with HMGB1 inhibits neuronal ferroptosis following spinal cord injury through targeting ACSL4 Zhiwu Wu, Qinglin Zhong, Tao Li, Helan Yuan, Tianxiang Zeng, Jinshi Zhang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7833607/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Spinal cord injury (SCI) refers to structural and functional impairments of the spinal cord resulting from various etiologies. Ferroptosis has been increasingly recognized as a critical contributor to neuronal damage following SCI. Therefore, this study aims to investigate the regulatory role of HMGB1 in neuronal ferroptosis of SCI rats and to explore its underlying mechanisms. Iron ion deposition, MDA and GSH levels, as well as the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 in spinal cord tissue of SCI rats were measured at 24 h, 72 h and 1 week post-injury. Then, an in vitro neuronal ferroptosis model was established by treating primary rat spinal cord neurons with Erastin. Neuronal cells were transfected with lentiviral vectors for HMGB1 interference or ACSL4 overexpression. Iron ion levels, MDA content, GSH activity, and the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 were measured. The interaction between HMGB1 and ACSL4 was assessed by co-immunoprecipitation assays. Finally, SCI rats were administered the HMGB1 inhibitor glycyrrhizic acid (GA) and the effects GA on the iron ion deposition, MDA and SOD levels, as well as the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 in spinal cord tissues were evaluated. Iron ion deposition was observed in the spinal cord tissue of SCI rats, accompanied by increased levels of MDA, HMGB1 and ACSL4, as well as decreased levels of GSH, GPX4, and SLC7A11. These alterations exhibited a time-dependent pattern. The administration of GA in SCI rats significantly reduces iron ion deposition, decreases the levels of MDA, HMGB1 and ACSL4, and increases the levels of GSH, GPX4, and SLC7A11. Furthermore, cellular-level results demonstrated that interfering with HMGB1 could attenuate ferroptosis in rat spinal cord neurons through targeted suppression of ACSL4. Targeted suppression of ACSL4 expression through interference with HMGB1 inhibits neuronal ferroptosis in SCI rats. HMGB1 spinal cord injury ACSL4 ferroptosis neuron Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Spinal cord injury (SCI) is a severe neurological disorder characterized by damage to the central nervous system, typically resulting from traumatic or non-traumatic events that cause structural or functional impairment of the spinal cord [ 1 , 2 ]. It often leads to significant dysfunction in motor, sensory, and autonomic nervous systems, and is associated with high rates of disability and mortality [ 3 ]. SCI is classified into primary and secondary injures. The primary injury refers to the immediate mechanical disruption of neural tissues and cells, which compromises local microcirculation and results in hemorrhage and necrosis. Current evidence indicates that primary injury is irreversible. The secondary injury follows the initial insult and involves a cascade of pathological processes, including inflammatory responses, oxidative stress mediated by oxygen free radicals, lipid peroxidation, and programmed cell death [ 4 – 6 ]. This secondary damage evolves over an extended period, leading to progressive expansion of the lesion area and causing neural damage that surpasses the extent of the primary injury [ 7 ]. Therefore, understanding the molecular mechanisms underlying the onset and progression of secondary injury after SCI holds critical importance for developing effective therapeutic strategies. Ferroptosis is a form of regulated cell death characterized by iron dependency and lipid peroxidation, with hallmark features including intracellular iron accumulation, depletion of GSH, and excessive production of lipid ROS, ultimately leading to oxidative damage and disruption of the cellular membrane system [ 8 – 10 ]. Accumulating evidence indicates that ferroptosis contributes to the progression of secondary injury following SCI [ 11 , 12 ]. Notably, Ryan et al. demonstrated that administration of the ferroptosis inhibitor UAMC-3203-HCl in murine models of SCI significantly restored motor function and mitigated secondary tissue damage [ 13 ]. High mobility group protein B1 (HMGB1), a highly conserved non-histone chromosomal binding protein, plays a critical role not only in cellular processes such as growth, development and differentiation, but also in pathological and physiological responses including inflammation, immune regulation and neural injury repair [ 14 – 16 ]. Accumulating evidence indicates that HMGB1 is upregulated following SCI and has been implicated in the regulation of ferroptosis across various cell types [ 17 , 18 ]. Nevertheless, to date, no study has reported the regulatory role of HMGB1 in neuronal ferroptosis after SCI in rats or elucidated its underlying molecular mechanisms. Therefore, the present study aimed to investigate the regulatory role of HMGB1 in neuronal ferroptosis of SCI rats and to explore its underlying molecular mechanisms. Materials and methods Materials. The CCK-8 cell proliferation and cytotoxicity assay kit and the prussian blue iron stain kit were purchased from Solaibao Technology Co., Ltd. The antibodies against β-Actin, HMGB1, ACSL4, GPX4, SLC7A11 and NeuN were from Abcam. The FerroOrange probe, Glycyrrhizic acid (GA), Fer-1 and Erastin were purchased from MedChemExpress LLC. MDA assay kit and GSH assay kit were purchased from Nanjing Jiancheng Bioengineering Institute. Total iron assay kit was obtained from Servicebio. Sh-HMGB1-1, sh-HMGB1-2, sh-HMGB1-3, sh-NC, ACSL4 overexpression (OE-ACSL4) lentiviral vector and OE-NC were obtained from GeneUniversal‌. Animals. Ninety SPF female SD rats aged 6–8 weeks were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd. (license No. SCXK (Zhe) 2024-0001). All experiments followed ethical guidelines approved by the Ganzhou People's Hospital (No. D2025-009). Spinal cord injury model. After 7 days of adaptive feeding, the rats were anesthetized via inhalation of sevoflurane. The dorsal and lumbar fur was completely shaved, and the animals were positioned in the prone position and secured on the surgical board. The surgical site was disinfected with iodophor. A 2–3 cm longitudinal incision was made with the tenth thoracic vertebra as the central landmark. The paraspinal muscles were dissected bilaterally using scissors until the lamina was exposed. The interspinous ligaments between the ninth, tenth, and eleventh spinous processes were carefully transected to isolate the tenth spinous process. Once isolated, the vertebral junctions became clearly visible. A small incision was made at the intervertebral space, and fine scissors were inserted through the opening. The scissors were first advanced along the lamina to the right side and used to perform a laminectomy; the same procedure was repeated on the left side. Following complete bilateral laminectomy, the vertebral segment corresponding to the tenth spinous process was gently removed with forceps, thereby exposing the underlying spinal cord. The dura was then trimmed to create an opening sufficient to allow unimpeded passage of a 15 g Kirschner wire. A custom-made guiding tube was placed to ensure accurate positioning, and the 15 g Kirschner wire was dropped freely from a height of 6 cm through the tube to deliver a standardized contusion injury to the spinal cord. The rats exhibited a distinct tail-flick reflex, followed by twitching of the hind limbs and subsequent paralysis. The spinal cord displayed congestion without complete transection, indicating successful model establishment. Following the surgical procedure, an electric blanket was utilized to maintain normothermia. Cefuroxime sodium was administered via intramuscular injection for three consecutive days postoperatively to prevent surgical site infection. Urination was facilitated three times daily during the postoperative period. In the sham group, the rats underwent surgical exposure of the spinal cord without receiving any impact intervention. Experimental design. First, the rats were divided into six groups: sham-24h, SCI-24h, sham-72h, SCI-72h, sham-1w, SCI-1w. Rats in both the SCI model group and the sham group were euthanized at predetermined time (24h, 72h and 1week) points post-modeling to collect spinal cord tissue samples for subsequent analysis. Then, the rats were divided into four groups: sham, SCI, SCI + phosphate-buffered saline (PBS), SCI + GA. The SCI model in rats was established according to the aforementioned method. Prior to model induction, rats in the SCI + GA group received an intravenous injection of 6 mg/kg glycyrrhizic acid (an antagonist of HMGB1) via the tail vein for therapeutic intervention, while those in the SCI + PBS group were administered an equivalent volume of PBS. Reverse transcription quantitative PCR (RT-qPCR). The samples were collected and total RNA was isolated using a Total RNA Miniprep Kit. Subsequently, cDNA synthesis was carried out following the instructions provided by the manufacturer. A RT-qPCR analysis was conducted under the following conditions: Initial denaturation at 95˚C for 5 min, followed by denaturation at 95˚C for 10 sec, annealing at 60˚C for 30 sec, extension from 65 to 95˚C with a temperature increment of 0.5˚C every 5 sec. Following completion of the reaction, the average cycle threshold (Ct) values were determined for each gene as well as for the reference gene. The relative expression levels of genes were evaluated using the widely accepted method known of 2 − ΔΔCT . The sequences of the primers are shown in Table 1 . Table 1 Primer sequences Gene symbol Forward Primer Reverse primer HMGB1 AAAGGAGATCCTAAGAAGCCGA TCATAACGAGCCTTGTCAGCC ACSL4 TCAAGCATTCCTCCAAGTAGACC CAGCCGTAGGTAAAGCAGGAG GPX4 AGGCAGGAGCCAGGAAGTAATC ACCACGCAGCCGTTCTTATC SLC7A11 GCTGGCTGGTTTTACCTCAACT CCTCGGCGCTAATGGTTGTA GAPDH CTGGAGAAACCTGCCAAGTATG GGTGGAAGAATGGGAGTTGCT Western blotting. Total protein was extracted and the content was assessed using a bicinchoninc assay protein assay kit. Subsequently, the protein (30 mg) was separated by 10% SDS-PAGE and transferred onto a polyvinylidene difluoride membrane. The membranes used for the target protein (and β-actin) were blocked with 5% skimmed milk at 25˚C for 1 h. The corresponding membranes were incubated with the following primary antibodies: HMGB1 (1:1,000), ACSL4 (1:1,000), GPX4 (1:1,000) and SLC7A11 (1:1,000), followed by incubation with a secondary antibody for 1 h. Finally, the protein bands were assessed by an ECL-detecting kit and β-actin was used as a loading control. Detection MDA and GSH levels. Spinal cord or cell samples were collected, and the levels of MDA and GSH were determined in accordance with the protocols outlined in the respective kit instructions. Iron content assay. Rat spinal cord tissues were collected, and the iron ion content in the tissues from each experimental group was measured according to the protocol provided in the total iron ion detection kit instructions. Prussian blue staining. The spinal cord tissues of rats were first fixed and embedded in paraffin, followed by sectioning. The tissue sections were then deparaffinized and rehydrated through a graded ethanol series to distilled water. Subsequently, the sections were incubated in a freshly prepared staining solution containing equal volumes of 2% potassium ferrocyanide and 2% hydrochloric acid for 30 minutes, followed by two washes with distilled water. Thereafter, DAB chromogenic solution was applied to the sections for approximately 10 minutes. The reaction was terminated by removing the DAB solution, after which the sections were rinsed once with 0.01 mol/L PBS and three times with distilled water. Nuclei were counterstained with hematoxylin. Finally, the sections were dehydrated through an ascending alcohol series, cleared in xylene, mounted with neutral balsam, and examined under a light microscope for imaging. Following staining, iron-rich regions in the tissue appeared brown, while nuclei were stained light blue. Isolation of primary spinal cord neuron. Primary rat spinal cord neurons were isolated according to the method described by Guo et al [ 19 ]. Pregnant SD rats at 14 days of gestation were anesthetized, and fetal rat spinal cords were aseptically dissected, minced, and digested with 0.125% trypsin at 37°C for 15 min. The enzymatic digestion was terminated by the addition of an equal volume of neuron-specific complete culture medium. The cell suspension was centrifuged, and the supernatant was discarded. Fresh complete culture medium was added, and the pellet was gently resuspended by pipetting, followed by a 10 min settling period to allow large tissue fragments to settle. The upper fraction containing single cells was collected and seeded into poly-L-lysine-coated sterile 6-well plates at a density of 1 × 10⁵ cells/mL. The plates were incubated at 37°C in a humidified atmosphere of 5% CO₂ and 95% air for 4 hours, after which the medium was replaced with serum-free neuronal culture medium. After 24 hours in culture, cytarabine was added to a final concentration of 10 µmol/L to inhibit glial cell proliferation. Neuronal identity was confirmed on day 7 via immunofluorescent staining for NeuN. Cell culture, treatment and transfection. Primary rat spinal cord neurons were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C in an atmosphere containing 5% CO 2 . To establish an in vitro neuronal ferroptosis model, neurons were exposed to varying concentrations of the ferroptosis inducer Erastin (0, 2, 5 and 10 µM) for 24 and 48 h. The optimal concentration and treatment duration were determined based on assessments of neuron viability and the expression levels of ferroptosis-related markers (ACSL4, GPX4 and SLC7A11). As for cell transfection, neurons were prepared when the density of the cells reached 70%. Rat spinal cord neurons were transfected with different lentiviral vector for 48 h by using lipofectamine 3000. RNA and proteins were isolated from neurons across different treatment groups to assess transfection efficiency following transfection. Cell Counting Kit-8 (CCK-8). Cell proliferation was determined by Cell Counting Kit-8 assay (CCK-8). The cells were cultured in 96-well plates. Following the replacement of the culture medium, 10 µL of CCK-8 reagent was added to each well and incubated in a controlled environment for 2 hours. The absorbance value at a wavelength of 450nm was determined through enzymatic labeling for each well. FerroOrange staining. Neurons were seeded into fluorescent culture dishes and incubated overnight under controlled conditions at 37°C in a humidified atmosphere with 5% CO 2 . Following incubation, the supernatant was carefully removed, and cells were rinsed three times with serum-free medium to ensure removal of residual components. Subsequently, 1 µM FerroOrange working solution was added to the cells, which were then incubated in the dark at 37°C for 30 minutes. Fluorescence imaging was performed using a fluorescence microscope equipped with excitation at 543 nm and emission detection at 580 nm. Transmission electron microscopy (TEM). The cells were fixed in electron microscope fixation solution for about 30 min. The cells were double stained with 3% uranium acetate and lead citrate. The ultrastructure of the cells was observed by transmission electron microscope and photographed for preservation. Co-immunoprecipitation (Co-IP) assay. Neuronal cell samples were collected and lysed, followed by centrifugation to obtain the supernatant. One microgram of the corresponding antibody (HMGB1 or ACSL4 antibody) was added to the cell lysate and incubated at 4°C overnight with gentle agitation. 10 µL protein A/G agarose beads were prepared by washing three times with an appropriate volume of lysis buffer via centrifugation at 3,000 rpm for 3 minutes per wash. The pre-washed protein A/G agarose beads (10 µL) were then added to the lysate that had been incubated with the antibody, and the mixture was incubated at 4°C for 4 hours under gentle shaking to facilitate antibody-bead conjugation. Following incubation, the sample was centrifuged at 3,000 rpm for 3 minutes at 4°C to pellet the agarose beads. The supernatant was carefully removed, and the beads were washed 3–4 times with 1 mL of lysis buffer. Finally, 15 µL of 2× SDS loading buffer was added to the beads, and the samples were boiled for 5 minutes to elute bound proteins. Subsequent analysis was performed using SDS-PAGE and Western blotting to detect the immunoprecipitated proteins. Statistical analyses. SPSS 22.0 (IBM Corp.) was applied for statistical analysis and the experimental data were expressed as mean ± standard deviation (x ± s). One-Way ANOVA was used for comparison between the groups and the t-test was selected for a two-way comparison. P < 0.05 was considered to indicate a statistically significant difference. Results HMGB1 and ferroptosis are up-regelated in the spinal cord tissues of rats following spinal cord injury. As shown in Fig. 1 A-I, the mRNA and protein expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 were detected by RT-qPCR and western blotting, respectively. Compared with the sham group, the mRNA and protein expression levels of HMGB1 and ACSL4 were significantly elevated at 24 h, 48 h, and 1 week after SCI in rats, whereas the mRNA and protein expression levels of GPX4 and SLC7A11 were markedly reduced at the same time points. Moreover, the variation in expression levels shows a certain time-dependent characteristic. Then, we detected the levels of MDA and GSH in the spinal cord tissues of different groups of rats (Fig. 1 J-K). Compared with the sham group, the MDA level was significantly elevated at 24 h, 48 h, and 1 week following SCI in rats, while the GSH level was markedly reduced at the same time points. As shown in Fig. 1 L, we used Prussian blue staining to observe the iron deposition in the spinal cord tissues of rats in different groups. No iron deposition was observed in the sham group at different time points, while in the SCI group, obvious iron deposition could only be observed in rats 1 week after injury. Furthermore, a total iron ion detection kit was employed to assess the variations in iron ion levels within spinal cord tissues across different rat groups (Fig. 1 M). Compared with the sham group, a significant elevation in iron ion levels was observed in the spinal cord 1 week after injury. However, no significant differences were detected at 24 h or 48 h post-injury. Establish a ferroptosis model of rat spinal cord neurons. Immunofluorescence was used to identify the marker proteins (NeuN) of rat spinal cord neurons (Fig. 2 A). The results indicated that NeuN was highly expressed in rat spinal cord neurons. As shown in Fig. 2 B, the cell viability of neurons exposed to various concentrations of Erastin for 24 and 48 hours was assessed using the CCK-8 assay. Compared with the 0 µM group, only the 10 µM Erastin treatment for 48 hours significantly decreased the cell viability of neurons. Subsequently, the mRNA and protein expression levels of ACSL4, GPX4 and SLC7A11 were detected by RT-qPCR and western blotting (Fig. 2 C-I). Compared with the 0 µM group, the mRNA and protein expression levels of ACSL4 were significantly increased in the 2 µM, 5 µM and 10 µM group, whereas the mRNA and protein expression levels of GPX4 and SLC7A11 were markedly reduced in the 2 µM, 5 µM and 10 µM group. Based on the above results, we chose to treat rat spinal cord neurons with 10 µM Erastin for 48 hours to simulate an in vitro neuronal ferroptosis model. Inhibition of HMGB1 suppresses neuronal ferroptosis via regulation of ACSL4. As shown in Fig. 3 A-C, RT-qPCR and Western blotting were employed to assess the transfection efficiency of three distinct sh-HMGB1 lentiviral vectors in rat spinal cord neurons. Compared with the sh-NC group, the mRNA and protein expression levels of HMGB1 in the sh-HMGB1-1, sh-HMGB1-2 and sh-HMGB1-3 groups were significantly decreased in rat spinal cord neurons. Among these lentiviral vectors, sh-HMGB1-3 demonstrated the most pronounced knockdown efficacy and was therefore selected for subsequent cellular experiments. In addition, RT-qPCR and Western blotting were also employed to assess the transfection efficiency of ACSL4 overexpression lentiviral vectors in rat spinal cord neurons (Fig. 3 D-F). Compared with the OE-NC group, the mRNA and protein expression levels of ACSL4 in the OE-ACSL4 group were significantly increased in rat spinal cord neurons. Then, we detected the levels of MDA and GSH in different treatment neurons (Fig. 3 G-H). Compared with the control group, the MDA level was significantly increased in the Erastin group, and the GSH level was significantly decreased in the Erastin group. Compared with the Erastin group, the MDA level was significantly decreased in the Erastin + Fer-1 group and Erastin + shHMGB1 group, while the GSH level was significantly increased in the Erastin + Fer-1 group and Erastin + shHMGB1 group. Compared with the Erastin + shHMGB1 group, the MDA level was significantly increased in the Erastin + shHMGB1 + OE-ACSL4 group, and the GSH level was significantly decreased in the Erastin + shHMGB1 + OE-ACSL4 group. Subsequently, FerroOrange staining was used to observe the differences in ferrous ion levels among neurons in different treatment groups (Fig. 3 I). Compared with the control group, the Erastin group exhibited elevated levels of ferrous ions. In contrast, treatment with Fer-1 or sh-HMGB1 significantly reduced ferrous ion levels in neurons relative to the Erastin group. Furthermore, when compared with the Erastin + shHMGB1 group, neuronal ferrous ion levels were further increased in the Erastin + shHMGB1 + OE-ACSL4 group. As shown in Fig. 3 J, TEM was subsequently employed to examine the microstructural alterations in neurons across the various treatment groups. Compared with the control group, neurons in the Erastin group exhibited smaller mitochondria and loss of mitochondrial cristae. In contrast, mitochondrial morphology in the Erastin + Fer-1 and Erastin + sh-HMGB1 groups was largely restored to normal relative to the Erastin group. Furthermore, compared with the Erastin + sh-HMGB1 group, neurons in the Erastin + sh-HMGB1 + OE-ACSL4 group displayed further mitochondrial shrinkage, complete absence of mitochondrial cristae, and rupture of the plasma membrane. HMGB1 regulates neuronal ferroptosis through targeted modulation of ACSL4. To further validate the regulatory role of HMGB1 in neuronal ferroptosis, we used RT-qPCR and Western blotting to assess the mRNA and protein expression levels of ACSL4, GPX4, and SLC7A11 in neurons across different treatment groups (Fig. 4 A-G). Compared with the Erastin group, the mRNA and protein expression levels of ACSL4 was significantly decreased in the Erastin + Fer-1 group and Erastin + shHMGB1 group, while the mRNA and protein expression levels of GPX4 and SLC7A11 were significantly increased in the Erastin + Fer-1 group and Erastin + shHMGB1 group. Moreover, Compared with the Erastin + shHMGB1 group, the mRNA and protein expression levels of ACSL4 was significantly increased in the Erastin + shHMGB1 + OE-ACSL4 group, and the mRNA and protein expression levels of GPX4 and SLC7A11 were significantly decreased in the Erastin + shHMGB1 + OE-ACSL4 group. To further verify the targeted interaction between HMGB1 and ACSL4 in rat spinal cord neurons, we conducted a Co-IP experiment and the results were shown in Fig. 4 H-I. These results confirm a direct targeted interaction between HMGB1 and ACSL4 in rat spinal cord neurons. Glycyrrhizic acid treatment effectively reverses neuronal ferroptosis following SCI in rats. To further validate the impact of HMGB1 inhibition on ferroptosis in a rat model of SCI at the in vivo level, we administered the HMGB1 inhibitor glycyrrhizin (GA) to SCI rats. As shown in Fig. 5 A-B, Compared with the SCI + PBS group, the MDA level was significantly decreased in the SCI + GA group, while the GSH level was significantly increased in the SCI + GA group. As shown in Fig. 5 C, a total iron ion detection kit was employed to assess the variations in iron ion levels within spinal cord tissues across different rat groups. Compared with the SCI + PBS group, the iron ion level was significantly decreased in the SCI + GA group. In addition, prussian blue staining was employed to assess iron deposition in spinal cord tissues across different rat groups (Fig. 5 D). Compared with the SCI + PBS group, the iron deposition in the spinal cord tissue of the SCI + GA group rats was significantly reduced. Finally, the mRNA and protein expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 in the spinal cord tissues of different groups of rats were detected by RT-qPCR and western blotting, respectively (Fig. 5 E-M). Compared with the SCI + PBS group, the mRNA and protein expression levels of HMGB1 and ACSL4 were significantly decreased in the SCI + GA group, while the mRNA and protein expression levels of GPX4 and SLC7A11 were significantly increased in the SCI + GA group. Discussion Spinal cord injury (SCI) is a severe form of central nervous system trauma that results in significant motor, sensory, and autonomic dysfunction [ 20 ]. Currently, this complex condition lacks effective therapeutic interventions and has emerged as a growing global health concern. Secondary injury following SCI is potentially reversible [ 21 ]. Accumulating evidence indicates that ferroptosis plays a critical role in modulating the physiological and pathological processes associated with secondary injury after SCI [ 22 – 24 ]. Following SCI, substantial alterations occur in the local microenvironment, including extensive intramedullary hemorrhage, red blood cell accumulation, cellular rupture, and hemolysis, leading to iron overload in the injured tissue. Additionally, oxidative stress triggers a cascade of lipid peroxidation reactions. These pathological changes collectively contribute to the induction of ferroptosis post-SCI [ 25 ]. Our experimental results demonstrate that, compared with the sham-operated group, SCI rats exhibit significantly elevated levels of MDA, iron ions and ACSL4 in spinal cord tissues, accompanied by marked reductions in GSH, GPX4, and SLC7A11. HMGB1 is an intracellular protein predominantly localized in the cell nucleus and peripheral blood, with widespread distribution throughout the body, including various neural cell types such as neurons, microglia, and astrocytes [ 26 – 28 ]. Upon cellular stress, innate immune cells actively secrete HMGB1, while necrotic cells release it passively, establishing HMGB1 as a key pathophysiological mediator in autoimmune disorders and neuroinflammatory conditions [ 29 ]. Accumulating evidence indicates that HMGB1 expression is upregulated in SCI patient tissues [ 30 , 31 ]. Consistently, our experimental results demonstrate a significantly elevated expression level of HMGB1 in the spinal cord tissues of SCI-induced rats compared to the sham group. Furthermore, HMGB1 has been implicated in the progression of diverse pathological conditions through its regulation of ferroptosis. Liu et al. reported that suppression of HMGB1 mitigates blood-brain barrier dysfunction following intravenous thrombolysis by inhibiting endothelial cell ferroptosis [ 32 ]. Davaanyam et al. demonstrated that HMGB1 induces ferroptosis in astrocytes via upregulation of hepcidin, thereby exacerbating ischemic acute brain injury [ 33 ]. Notably, our results indicate that sh-HMGB1 intervention at the cellular level reduces the expression of ferroptosis-related markers in rat spinal cord neurons, while pharmacological inhibition of HMGB1 using GA in animal models likewise attenuates ferroptosis-related marker expression in SCI rats. ACSL4 is a critical enzyme involved in lipid metabolism, and phospholipid peroxidation represents a hallmark feature of ferroptosis [ 34 ]. Upregulation of ACSL4 promotes the accumulation of lipid peroxides, thereby inducing ferroptotic cell death. Conversely, inhibition of ACSL4 activity or reduction of lipid peroxidation can effectively mitigate ferroptosis-associated cellular damage and related pathological manifestations [ 35 – 37 ]. Previous studies have demonstrated that HMGB1 regulates ACSL4 expression in various cell types, including trophoblast cells [ 38 ], leukemia cells [ 39 ], and renal tubular epithelial cells [ 40 ]. In the present study, we found that, compared with the Erastin group, sh-HMGB1 significantly reduced both mRNA and protein levels of ACSL4 in rat spinal cord neurons. In rescue experiments, overexpression of ACSL4 in the Erastin + shHMGB1 + OE-ACSL4 group markedly restored ACSL4 expression at both the mRNA and protein levels, relative to the Erastin + shHMGB1 group. Furthermore, Co-IP assays confirmed a direct physical interaction between HMGB1 and ACSL4 in rat spinal cord neurons. Based on the results of the present study, it can be concluded that targeted suppression of ACSL4 through interference with HMGB1 inhibits neuronal ferroptosis in SCI rats. However, the present study exhibits certain limitations. At the animal level, only a single HMGB1 inhibitor, GA, was employed for intervention, and no comparative analysis of the effects of multiple inhibitors was conducted. Furthermore, no reverse validation experiment involving ACSL4 overexpression was performed in vivo. In future studies, we aim to address these limitations through additional experimental investigations. Conclusion In conclusion, SCI rats exhibit significantly elevated levels of MDA, iron ions, HMGB1 and ACSL4 in spinal cord tissues, accompanied by marked reductions in GSH, GPX4, and SLC7A11. Interference with HMGB1 inhibits neuronal ferroptosis through targeted suppression of ACSL4. Besides, pharmacological inhibition of HMGB1 using GA in animal models likewise attenuates ferroptosis-related marker expression in SCI rats. Declarations Data share statement: The data that support the findings of this study are available from the corresponding author upon reasonable request. Ethical Approval: This article does not contain any studies with human participants (Clinical trial number: not applicable). Besides, animals were housed and operated in strict compliance with the ethical principles of animal experimentation, and the operations were ratified by the Ganzhou People's Hospital (No. D2025-009). All animal experiments complied with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. Besides, all animal experiments as in accordance with the ARRIVE guidelines. Consent to participate: Not applicable. Consent for publication: Not applicable. Disclosure: The authors declare no competing financial interest. Funding: This work was supported by the Science and Technology Plan project of Ganzhou City (NO. 2023NS127385) and the Natural Science Foundation of Jiangxi Province (NO. 20242BAB20380). Author Contribution Zhiwu Wu drafted the manuscript and conducted the experiments. Qinglin Zhong, Tao Li, Helan Yuan,Tianxiang Zeng, Jinshi Zhang, Kaiming Feng, Xinyun Ye and Qiuhua Jiang conducted the experiments and performed data analysis. Qianliang Huang designed the experiments and revised the manuscript. All authors reviewed the manuscript. Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request. References Trueblood CT, Singh A, Cusimano MA, Hou S (2024) Autonomic Dysreflexia in Spinal Cord Injury: Mechanisms and Prospective Therapeutic Targets. Neuroscientist 30(5):597–611. 10.1177/10738584231217455 Baroudi M, Rezk A, Daher M, Balmaceno-Criss M, Gregoryczyk JG, Sharma Y, McDonald CL, Diebo BG, Daniels AH (2024) Management of traumatic spinal cord injury: A current concepts review of contemporary and future treatment. Injury 55(6):111472. 10.1016/j.injury.2024.111472 Singh G, Sharma P, Forrest G, Harkema S, Behrman A, Gerasimenko Y (2024) Spinal Cord Transcutaneous Stimulation in Cervical Spinal Cord Injury: A Review Examining Upper Extremity Neuromotor Control, Recovery Mechanisms, and Future Directions. J Neurotrauma 41(17–18):2056–2074. 10.1089/neu.2023.0438 Migliorini F, Cocconi F, Schäfer L, Simeone F, Jeyaraman M, Maffulli N (2024) Pharmacological management of secondary chronic spinal cord injury: a systematic review. Br Med Bull 151(1):49–68. 10.1093/bmb/ldae009 Ferber GA, Anderson KD (2025) Recovery Insights Following Spinal Cord Injury: A Consumer's Perspective. Phys Med Rehabil Clin N Am 36(1):139–154. 10.1016/j.pmr.2024.08.002 Anjum A, Yazid MD, Fauzi Daud M, Idris J, Ng AMH, Selvi Naicker A, Ismail OHR, Athi Kumar RK, Lokanathan Y (2020) Spinal Cord Injury: Pathophysiology, Multimolecular Interactions, and Underlying Recovery Mechanisms. Int J Mol Sci 21(20):7533. 10.3390/ijms21207533 Zhang Y, Al Mamun A, Yuan Y, Lu Q, Xiong J, Yang S, Wu C, Wu Y, Wang J (2021) Acute spinal cord injury: Pathophysiology and pharmacological intervention (Review). Mol Med Rep 23(6):417. 10.3892/mmr.2021.12056 Zheng J, Conrad M (2025) Ferroptosis: when metabolism meets cell death. Physiol Rev 105(2):651–706. 10.1152/physrev.00031.2024 He N, Yuan D, Luo M, Xu Q, Wen Z, Wang Z, Zhao J, Liu Y (2025) Ferroptosis contributes to immunosuppression. Front Med 19(1):1–22. 10.1007/s11684-024-1080-8 Zeng W, Wang F, Cui Z, Zhang Y, Li Y, Li N, Mao Z, Zhang H, Liu Y, Miao Y, Sun S, Cai Y, Xiong B (2025) Inhibition of ferroptosis counteracts the advanced maternal age-induced oocyte deterioration. Cell Death Differ 32(6):1071–1085. 10.1038/s41418-025-01519-2 Huang Y, Bai J (2024) Ferroptosis in the neurovascular unit after spinal cord injury. Exp Neurol 381:114943. 10.1016/j.expneurol.2024.114943 Yao S, Pang M, Wang Y, Wang X, Lin Y, Lv Y, Xie Z, Hou J, Du C, Qiu Y, Guan Y, Liu B, Wang J, Xiang AP, Rong L (2023) Mesenchymal stem cell attenuates spinal cord injury by inhibiting mitochondrial quality control-associated neuronal ferroptosis. Redox Biol 67:102871. 10.1016/j.redox.2023.102871 Ryan F, Blex C, Ngo TD, Kopp MA, Michalke B, Venkataramani V, Curran L, Schwab JM, Ruprecht K, Otto C, Jhelum P, Kroner A, David S (2024) Ferroptosis inhibitor improves outcome after early and delayed treatment in mild spinal cord injury. Acta Neuropathol 147(1):106. 10.1007/s00401-024-02758-2 Fan J, He K, Zhang Y, Li R, Yi X, Li S (2025) HMGB1: new biomarker and therapeutic target of autoimmune and autoinflammatory skin diseases. Front Immunol 16:1569632. 10.3389/fimmu.2025.1569632 Passali D, Bellussi LM, Santantonio M, Passali GC (2025) HMGB1 as a Key Modulator in Nasal Inflammatory Disorders: A Narrative Review. J Clin Med 14(15):5392. 10.3390/jcm14155392 Vladimirova D, Staneva S, Ugrinova I (2025) Multifaceted role of HMGB1: From nuclear functions to cytoplasmic and extracellular signaling in inflammation and cancer-Review. Adv Protein Chem Struct Biol 143:271–300. 10.1016/bs.apcsb.2024.09.014 Wu Z, Li M (2023) High-Mobility Group Box 1 in Spinal Cord Injury and Its Potential Role in Brain Functional Remodeling After Spinal Cord Injury. Cell Mol Neurobiol 43(3):1005–1017. 10.1007/s10571-022-01240-5 Fang P, Pan HC, Lin SL, Zhang WQ, Rauvala H, Schachner M, Shen YQ (2014) HMGB1 contributes to regeneration after spinal cord injury in adult zebrafish. Mol Neurobiol 49(1):472–483. 10.1007/s12035-013-8533-4 Guo L, Zhang D, Ren X, Liu D (2023) SYVN1 attenuates ferroptosis and alleviates spinal cord ischemia-reperfusion injury in rats by regulating the HMGB1/NRF2/HO-1 axis. Int Immunopharmacol 123:110802. 10.1016/j.intimp.2023.110802 Hersh AM, Weber-Levine C, Jiang K, Theodore N (2024) Spinal Cord Injury: Emerging Technologies. Neurosurg Clin N Am 35(2):243–251. 10.1016/j.nec.2023.10.001 Wang W, Zhang L, Liu X, Guo Q, Jiang X, Wu J, Zhu Y, Gu Y, Chen L, Xi K (2025) Punicalagin inhibits neuron ferroptosis and secondary neuroinflammation to promote spinal cord injury recovery. Int Immunopharmacol 148:114048. 10.1016/j.intimp.2025.114048 Li D, Lu X, Xu G, Liu S, Gong Z, Lu F, Xia X, Jiang J, Wang H, Zou F, Ma X (2023) Dihydroorotate dehydrogenase regulates ferroptosis in neurons after spinal cord injury via the P53-ALOX15 signaling pathway. CNS Neurosci Ther 29(7):1923–1939. 10.1111/cns.14150 Li QS, Jia YJ (2023) Ferroptosis: a critical player and potential therapeutic target in traumatic brain injury and spinal cord injury. Neural Regen Res 18(3):506–512. 10.4103/1673-5374.350187 Zhang Y, Sun C, Zhao C, Hao J, Zhang Y, Fan B, Li B, Duan H, Liu C, Kong X, Wu P, Yao X, Feng S (2019) Ferroptosis inhibitor SRS 16–86 attenuates ferroptosis and promotes functional recovery in contusion spinal cord injury. Brain Res 1706:48–57. 10.1016/j.brainres.2018.10.023 Vahabi A, Öztürk AM, Kılıçlı B, Birim D, Kaftan Öcal G, Dağcı T, Armağan G (2024) Silibinin promotes healing in spinal cord injury through anti-ferroptotic mechanisms. JOR Spine 7(3):e1344. 10.1002/jsp2.1344 Wu Z, Wang Z, Xie Z, Zhu H, Li C, Xie S, Zhou W, Zhang Z, Li M (2022) Glycyrrhizic Acid Attenuates the Inflammatory Response After Spinal Cord Injury by Inhibiting High Mobility Group Box-1 Protein Through the p38/Jun N-Terminal Kinase Signaling Pathway. World Neurosurg 158:e856–e864. 10.1016/j.wneu.2021.11.085 Yuan J, Guo L, Ma J, Zhang H, Xiao M, Li N, Gong H, Yan M (2024) HMGB1 as an extracellular pro-inflammatory cytokine: Implications for drug-induced organic damage. Cell Biol Toxicol 15(1):55. 10.1007/s10565-024-09893-2 Shen P, Zhang L, Jiang X, Yu B, Zhang J (2024) Targeting HMGB1 and Its Interaction with Receptors: Challenges and Future Directions. J Med Chem 67(24):21671–21694. 10.1021/acs.jmedchem.4c01912 Li J, Wang Z, Li J, Zhao H, Ma Q (2025) HMGB1: A New Target for Ischemic Stroke and Hemorrhagic Transformation. Transl Stroke Res 16(3):990–1015. 10.1007/s12975-024-01258-5 Kikuchi K, Uchikado H, Miura N, Morimoto Y, Ito T, Tancharoen S, Miyata K, Sakamoto R, Kikuchi C, Iida N, Shiomi N, Kuramoto T, Miyagi N, Kawahara KI (2011) HMGB1 as a therapeutic target in spinal cord injury: A hypothesis for novel therapy development. Exp Ther Med 2(5):767–770. 10.3892/etm.2011.310 Sun L, Zhao L, Li P, Liu X, Liang F, Jiang Y, Kang N, Gao C, Yang J (2019) Effect of hyperbaric oxygen therapy on HMGB1/NF-κB expression and prognosis of acute spinal cord injury: A randomized clinical trial. Neurosci Lett 692:47–52. 10.1016/j.neulet.2018.10.059 Liu J, Pang SY, Zhou SY, He QY, Zhao RY, Qu Y, Yang Y, Guo ZN (2024) Lipocalin-2 aggravates blood-brain barrier dysfunction after intravenous thrombolysis by promoting endothelial cell ferroptosis via regulating the HMGB1/Nrf2/HO-1 pathway. Redox Biol 76:103342. 10.1016/j.redox.2024.103342 Davaanyam D, Lee H, Seol SI, Oh SA, Kim SW, Lee JK (2023) HMGB1 induces hepcidin upregulation in astrocytes and causes an acute iron surge and subsequent ferroptosis in the postischemic brain. Exp Mol Med 55(11):2402–2416. 10.1038/s12276-023-01111-z Zhuo B, Qin C, Deng S, Jiang H, Si S, Tao F, Cai F, Meng Z (2025) The role of ACSL4 in stroke: mechanisms and potential therapeutic target. Mol Cell Biochem 480(4):2223–2246. 10.1007/s11010-024-05150-6 Jiang Y, Zhang M, Sun M (2025) ACSL4 at the helm of the lipid peroxidation ship: a deep-sea exploration towards ferroptosis. Front Pharmacol 16:1594419. 10.3389/fphar.2025.1594419 Tuo QZ, Liu Y, Xiang Z, Yan HF, Zou T, Shu Y, Ding XL, Zou JJ, Xu S, Tang F, Gong YQ, Li XL, Guo YJ, Zheng ZY, Deng AP, Yang ZZ, Li WJ, Zhang ST, Ayton S, Bush AI, Xu H, Dai L, Dong B, Lei P (2022) Thrombin induces ACSL4-dependent ferroptosis during cerebral ischemia/reperfusion. Signal Transduct Target Ther 7(1):59. 10.1038/s41392-022-00917-z Cui J, Chen Y, Yang Q, Zhao P, Yang M, Wang X, Mang G, Yan X, Wang D, Tong Z, Wang P, Kong Y, Wang N, Wang D, Dong N, Liu M, E M, Zhang M, Yu B (2024) Protosappanin A Protects DOX-Induced Myocardial Injury and Cardiac Dysfunction by Targeting ACSL4/FTH1 Axis-Dependent Ferroptosis. Adv Sci (Weinh) 11(34):e2310227. 10.1002/advs.202310227 Dong Y, Li Y, Tang W, Chen Q, Kong C (2025) Increased Trophoblast Cell Ferroptosis via HMGB1/ACSL4 Pathway Is Associated with Spontaneous Abortion. Reprod Sci 32(5):1713–1722. 10.1007/s43032-025-01817-7 Kong Q, Liang Q, Tan Y, Luo X, Ling Y, Li X, Cai Y, Chen H (2025) Induction of ferroptosis by SIRT1 knockdown alleviates cytarabine resistance in acute myeloid leukemia by activating the HMGB1/ACSL4 pathway. Int J Oncol 66(1):2. 10.3892/ijo.2024.5708 Zhao Z, Li G, Wang Y, Li Y, Xu H, Liu W, Hao W, Yao Y, Zeng R (2023) Cytoplasmic HMGB1 induces renal tubular ferroptosis after ischemia/reperfusion. Int Immunopharmacol 116:109757. 10.1016/j.intimp.2023.109757 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 12 Nov, 2025 Reviews received at journal 04 Nov, 2025 Reviews received at journal 31 Oct, 2025 Reviews received at journal 21 Oct, 2025 Reviewers agreed at journal 21 Oct, 2025 Reviewers agreed at journal 20 Oct, 2025 Reviewers agreed at journal 16 Oct, 2025 Reviewers agreed at journal 14 Oct, 2025 Reviewers invited by journal 13 Oct, 2025 Editor assigned by journal 13 Oct, 2025 Submission checks completed at journal 11 Oct, 2025 First submitted to journal 11 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7833607","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":534231701,"identity":"9d6c1ca0-3918-41bc-85c2-276a3f50e397","order_by":0,"name":"Zhiwu Wu","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhiwu","middleName":"","lastName":"Wu","suffix":""},{"id":534231702,"identity":"86e22b2b-fa3e-4a0b-ac93-ae70844b6314","order_by":1,"name":"Qinglin Zhong","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qinglin","middleName":"","lastName":"Zhong","suffix":""},{"id":534231703,"identity":"f0f7cd4b-1ea9-4ddb-99c8-d1646c6ec38a","order_by":2,"name":"Tao Li","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Li","suffix":""},{"id":534231704,"identity":"24615a19-d636-4e88-a1f5-5f6fa2c70e4a","order_by":3,"name":"Helan Yuan","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Helan","middleName":"","lastName":"Yuan","suffix":""},{"id":534231705,"identity":"e0245f74-21ba-495c-978e-032ace9e3653","order_by":4,"name":"Tianxiang Zeng","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tianxiang","middleName":"","lastName":"Zeng","suffix":""},{"id":534231706,"identity":"49553d03-eceb-47b4-bf71-0a0eefa93e95","order_by":5,"name":"Jinshi Zhang","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jinshi","middleName":"","lastName":"Zhang","suffix":""},{"id":534231707,"identity":"6eef435d-f9ea-4851-b410-d3f54e2ab299","order_by":6,"name":"Kaiming Feng","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Kaiming","middleName":"","lastName":"Feng","suffix":""},{"id":534231708,"identity":"b4602e42-8e1a-47d3-8be5-31a19e5cb0ae","order_by":7,"name":"Xinyun Ye","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xinyun","middleName":"","lastName":"Ye","suffix":""},{"id":534231709,"identity":"886ad671-533a-44f6-9cf4-c71e26a4e4e8","order_by":8,"name":"Qiuhua Jiang","email":"","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qiuhua","middleName":"","lastName":"Jiang","suffix":""},{"id":534231710,"identity":"25043697-b886-4c0e-99cf-a62495a82746","order_by":9,"name":"Qianliang Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABKklEQVRIiWNgGAWjYBACAwglwcDAztgAZNjw8PM3Hzjw4QcxWpjBWtLkJGccSzw4s4egFiBgBpOHjQ0O5Bgf5mDDrcVcIvnZwy9lFvLmzMyNnwt+MSc2HDjz4TADD4M8v9gBrFosZ6SZG8uckzDc2czYLD2zjy2xsbl3w+ECCwbDmbMTsDvsRoKZtGSbBOOGw4wN0rw9PInNDGc3HJ7Bw5BgcBuXlvRvIC32QC3Nv3l7JBLbGHIeHOZhw6clx0zyY5tEIlBLmzTPDwNjHoYcBvxazrwpk2Y4J5EM0mLN25AgJyFxzAAYyBK4/XI8fZvkj7I62w3H2x/f5vnzn8f+fPPjDx9+2MjzS2PXAgLMPLBYYGyDC0rgVA5W+AMecX/wKhwFo2AUjIIRCgBJRWXKgXOP5AAAAABJRU5ErkJggg==","orcid":"","institution":"Ganzhou People's Hospital, Ganzhou Hospital-Nanfang Hospital, Southern Medical University","correspondingAuthor":true,"prefix":"","firstName":"Qianliang","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2025-10-11 08:53:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7833607/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7833607/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94598430,"identity":"a33f96c3-a702-464c-aafc-e489c924d0cc","added_by":"auto","created_at":"2025-10-28 18:53:04","extension":"doc","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10757602,"visible":true,"origin":"","legend":"","description":"","filename":"ManuscriptZW.doc","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/4eefab228ae32c43f5bfc0c5.doc"},{"id":94597857,"identity":"34466e30-7d4f-4b75-9f7c-3ccbeb011106","added_by":"auto","created_at":"2025-10-28 18:50:06","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10718,"visible":true,"origin":"","legend":"","description":"","filename":"9e59f91c6b004d4884e8c54ea41c6f8a.json","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/8b4ccf55718323c12c93d160.json"},{"id":94597814,"identity":"1c0618fb-2cea-4bff-8879-b4570fd185ca","added_by":"auto","created_at":"2025-10-28 18:49:28","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127018,"visible":true,"origin":"","legend":"","description":"","filename":"9e59f91c6b004d4884e8c54ea41c6f8a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/c31aa1d5588e75093196214d.xml"},{"id":94598421,"identity":"21afe26e-2bb6-4768-9a83-bfec638e0eea","added_by":"auto","created_at":"2025-10-28 18:52:58","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140502,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/a20b9e5b8d45305b9ed36441.png"},{"id":94598266,"identity":"ae18e7db-9713-4367-b05c-f2eaff379986","added_by":"auto","created_at":"2025-10-28 18:52:08","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":86410,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/49289af1216620e3c7736b80.png"},{"id":94597442,"identity":"0abbd8c7-d7af-4224-8f71-9d4dfd6b7225","added_by":"auto","created_at":"2025-10-28 18:47:37","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":584923,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/b483ab073aed60ca571cd6cd.png"},{"id":94598150,"identity":"42d3f4c8-2d23-4811-8e19-5d78a4710912","added_by":"auto","created_at":"2025-10-28 18:51:31","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":65611,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/6f5640f7d7f07263718ec339.png"},{"id":94598403,"identity":"55159dfa-e74b-4a2e-bcab-7ecfd48764b5","added_by":"auto","created_at":"2025-10-28 18:52:46","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":291825,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/ea0e5b9c5b87c5459b384acc.png"},{"id":94598015,"identity":"ee01ddf5-c4d7-46ec-9778-3ab379599578","added_by":"auto","created_at":"2025-10-28 18:50:53","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124643,"visible":true,"origin":"","legend":"","description":"","filename":"9e59f91c6b004d4884e8c54ea41c6f8a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/666be48d8d8814aa8ccc5d9c.xml"},{"id":94597849,"identity":"72dae2b2-0d4f-4cf3-943e-01787c36e4c6","added_by":"auto","created_at":"2025-10-28 18:49:56","extension":"html","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134240,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/fa6462797706ecbdc20595cb.html"},{"id":94598152,"identity":"18dae2b7-76a9-4217-827d-e6b265898982","added_by":"auto","created_at":"2025-10-28 18:51:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1678819,"visible":true,"origin":"","legend":"\u003cp\u003eThe levels of HMGB1, ACSL4 and ferroptosis significantly elevated in the spinal cord tissues of rats following spinal cord injury. (\u003cstrong\u003eA-D\u003c/strong\u003e) The mRNA expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 in rat spinal cord tissue were detected by RT-qPCR. (\u003cstrong\u003eE-I\u003c/strong\u003e) The protein expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 in rat spinal cord tissue were detected by western blotting. (\u003cstrong\u003eJ-K\u003c/strong\u003e) The concentrations of MDA and GSH in rat spinal cord tissue were measured using biochemical assay kits. (\u003cstrong\u003eL\u003c/strong\u003e) Prussian blue staining was employed to assess iron deposition in spinal cord tissues of rats. (\u003cstrong\u003eM\u003c/strong\u003e) The total iron assay kit was employed to measure the iron content in rat spinal cord tissue. The data are presented as mean ± SD. *P\u0026lt;0.05 vs. Sham-24h; \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. Sham-72h; \u003csup\u003e@\u003c/sup\u003eP\u0026lt;0.05 vs. Sham-1w.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/30df03f304e3cc2f1cdc972f.png"},{"id":94597890,"identity":"4cbbc00a-eec7-4dbf-9532-64a822593027","added_by":"auto","created_at":"2025-10-28 18:50:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":818668,"visible":true,"origin":"","legend":"\u003cp\u003eIn vitro establishment of a ferroptosis model in rat spinal cord neurons. \u003cstrong\u003e(A\u003c/strong\u003e) NeuN was detected via immunofluorescence staining to identify rat spinal cord neurons. \u003cstrong\u003e(B\u003c/strong\u003e) The CCK-8 assay was employed to assess neuronal viability across different treatment groups. (\u003cstrong\u003eC-E\u003c/strong\u003e) The mRNA expression levels of ACSL4, GPX4 and SLC7A11 in neurons of different treatments were detected by RT-qPCR. (\u003cstrong\u003eF-I\u003c/strong\u003e) The protein expression levels of ACSL4, GPX4 and SLC7A11 in neurons of different treatments were detected by western blotting. The data are presented as mean ± SD. *P\u0026lt;0.05 vs. 0 μM.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/91bff38382379e5302e9e500.png"},{"id":94598016,"identity":"2914eb18-cf56-45f2-81a6-87096b8a6ed0","added_by":"auto","created_at":"2025-10-28 18:50:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2116436,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of HMGB1 suppresses neuronal ferroptosis via regulation of ACSL4. Transfection efficiency of sh-HMGB1s in neurons was verified by (\u003cstrong\u003eA\u003c/strong\u003e) RT-qPCR, and \u003cstrong\u003e(B-C\u003c/strong\u003e) western blotting. Transfection efficiency of ACSL4 overexpression plasmid in neurons was verified by (\u003cstrong\u003eD\u003c/strong\u003e) RT-qPCR, and \u003cstrong\u003e(E-F\u003c/strong\u003e) western blotting. (\u003cstrong\u003eG-H\u003c/strong\u003e) The concentrations of MDA and GSH in neurons of different treatments were measured using biochemical assay kits. (\u003cstrong\u003eI\u003c/strong\u003e) The FerroOrange probes were used to detect the ferrous ion levels in neurons across different treatment groups. (\u003cstrong\u003eJ\u003c/strong\u003e) TEM assay was used to detect the microstructure of neurons in different treatment groups. The data are presented as mean ± SD. *P\u0026lt;0.05 vs. sh-NC, OE-NC or Control; \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. Erastin; \u003csup\u003e@\u003c/sup\u003eP\u0026lt;0.05 vs. Erastin+sh-HMGB1.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/c8d43d4d2814767d61df3f32.png"},{"id":94597429,"identity":"3a8f540c-1cf5-4486-8c09-cb21b8c83f51","added_by":"auto","created_at":"2025-10-28 18:47:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":797464,"visible":true,"origin":"","legend":"\u003cp\u003eHMGB1 regulates neuronal ferroptosis through targeted modulation of ACSL4. (\u003cstrong\u003eA-C\u003c/strong\u003e) The mRNA expression levels of ACSL4, GPX4 and SLC7A11 in neurons of different groups were detected by RT-qPCR. (\u003cstrong\u003eD-G\u003c/strong\u003e) The protein expression levels of ACSL4, GPX4 and SLC7A11 in neurons of different groups were detected by western blotting. (\u003cstrong\u003eH-I\u003c/strong\u003e) The CO-IP experiment was performed to investigate the specific interaction between HMGB1 and ACSL4. The data are presented as mean ± SD. *P\u0026lt;0.05 vs. Control; \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. Erastin; \u003csup\u003e@\u003c/sup\u003eP\u0026lt;0.05 vs. Erastin+sh-HMGB1.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/b34893f8f9ed37be2106e622.png"},{"id":94598052,"identity":"198d4f58-81f8-4a90-9c80-42732da270db","added_by":"auto","created_at":"2025-10-28 18:51:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1651069,"visible":true,"origin":"","legend":"\u003cp\u003eGlycyrrhizic acid treatment effectively reverses neuronal ferroptosis following spinal cord injury in rats. (\u003cstrong\u003eA-B\u003c/strong\u003e) The concentrations of MDA and GSH in rat spinal cord tissue of different groups were measured using biochemical assay kits. (\u003cstrong\u003eC\u003c/strong\u003e) The total iron assay kit was employed to measure the iron content in rat spinal cord tissue of different groups. (\u003cstrong\u003eD\u003c/strong\u003e) Prussian blue staining was employed to assess iron deposition in spinal cord tissues of rats. (\u003cstrong\u003eE-H\u003c/strong\u003e) The mRNA expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 in rat spinal cord tissue were detected by RT-qPCR. (\u003cstrong\u003eI-M\u003c/strong\u003e) The protein expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 in rat spinal cord tissue were detected by western blotting. The data are presented as mean ± SD. *P\u0026lt;0.05 vs. Sham; \u003csup\u003e#\u003c/sup\u003eP\u0026lt;0.05 vs. SCI+PBS.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/e46140897399f1342bd7c586.png"},{"id":94599242,"identity":"c6e304ae-bf8e-420b-9711-d1a4d1f4efa0","added_by":"auto","created_at":"2025-10-28 19:04:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7919112,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7833607/v1/ef03c4fd-119c-4ab9-85ce-7dc7ff6e7b9a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Interference with HMGB1 inhibits neuronal ferroptosis following spinal cord injury through targeting ACSL4","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSpinal cord injury (SCI) is a severe neurological disorder characterized by damage to the central nervous system, typically resulting from traumatic or non-traumatic events that cause structural or functional impairment of the spinal cord [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It often leads to significant dysfunction in motor, sensory, and autonomic nervous systems, and is associated with high rates of disability and mortality [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. SCI is classified into primary and secondary injures. The primary injury refers to the immediate mechanical disruption of neural tissues and cells, which compromises local microcirculation and results in hemorrhage and necrosis. Current evidence indicates that primary injury is irreversible. The secondary injury follows the initial insult and involves a cascade of pathological processes, including inflammatory responses, oxidative stress mediated by oxygen free radicals, lipid peroxidation, and programmed cell death [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This secondary damage evolves over an extended period, leading to progressive expansion of the lesion area and causing neural damage that surpasses the extent of the primary injury [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Therefore, understanding the molecular mechanisms underlying the onset and progression of secondary injury after SCI holds critical importance for developing effective therapeutic strategies.\u003c/p\u003e\u003cp\u003eFerroptosis is a form of regulated cell death characterized by iron dependency and lipid peroxidation, with hallmark features including intracellular iron accumulation, depletion of GSH, and excessive production of lipid ROS, ultimately leading to oxidative damage and disruption of the cellular membrane system [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Accumulating evidence indicates that ferroptosis contributes to the progression of secondary injury following SCI [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Notably, Ryan et al. demonstrated that administration of the ferroptosis inhibitor UAMC-3203-HCl in murine models of SCI significantly restored motor function and mitigated secondary tissue damage [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. High mobility group protein B1 (HMGB1), a highly conserved non-histone chromosomal binding protein, plays a critical role not only in cellular processes such as growth, development and differentiation, but also in pathological and physiological responses including inflammation, immune regulation and neural injury repair [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Accumulating evidence indicates that HMGB1 is upregulated following SCI and has been implicated in the regulation of ferroptosis across various cell types [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Nevertheless, to date, no study has reported the regulatory role of HMGB1 in neuronal ferroptosis after SCI in rats or elucidated its underlying molecular mechanisms. Therefore, the present study aimed to investigate the regulatory role of HMGB1 in neuronal ferroptosis of SCI rats and to explore its underlying molecular mechanisms.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cb\u003eMaterials.\u003c/b\u003e The CCK-8 cell proliferation and cytotoxicity assay kit and the prussian blue iron stain kit were purchased from Solaibao Technology Co., Ltd. The antibodies against β-Actin, HMGB1, ACSL4, GPX4, SLC7A11 and NeuN were from Abcam. The FerroOrange probe, Glycyrrhizic acid (GA), Fer-1 and Erastin were purchased from MedChemExpress LLC. MDA assay kit and GSH assay kit were purchased from Nanjing Jiancheng Bioengineering Institute. Total iron assay kit was obtained from Servicebio. Sh-HMGB1-1, sh-HMGB1-2, sh-HMGB1-3, sh-NC, ACSL4 overexpression (OE-ACSL4) lentiviral vector and OE-NC were obtained from GeneUniversal\u0026zwnj;.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAnimals.\u003c/b\u003e Ninety SPF female SD rats aged 6\u0026ndash;8 weeks were purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd. (license No. SCXK (Zhe) 2024-0001). All experiments followed ethical guidelines approved by the Ganzhou People's Hospital (No. D2025-009).\u003c/p\u003e\u003cp\u003e\u003cb\u003eSpinal cord injury model.\u003c/b\u003e After 7 days of adaptive feeding, the rats were anesthetized via inhalation of sevoflurane. The dorsal and lumbar fur was completely shaved, and the animals were positioned in the prone position and secured on the surgical board. The surgical site was disinfected with iodophor. A 2\u0026ndash;3 cm longitudinal incision was made with the tenth thoracic vertebra as the central landmark. The paraspinal muscles were dissected bilaterally using scissors until the lamina was exposed. The interspinous ligaments between the ninth, tenth, and eleventh spinous processes were carefully transected to isolate the tenth spinous process. Once isolated, the vertebral junctions became clearly visible. A small incision was made at the intervertebral space, and fine scissors were inserted through the opening. The scissors were first advanced along the lamina to the right side and used to perform a laminectomy; the same procedure was repeated on the left side. Following complete bilateral laminectomy, the vertebral segment corresponding to the tenth spinous process was gently removed with forceps, thereby exposing the underlying spinal cord. The dura was then trimmed to create an opening sufficient to allow unimpeded passage of a 15 g Kirschner wire. A custom-made guiding tube was placed to ensure accurate positioning, and the 15 g Kirschner wire was dropped freely from a height of 6 cm through the tube to deliver a standardized contusion injury to the spinal cord. The rats exhibited a distinct tail-flick reflex, followed by twitching of the hind limbs and subsequent paralysis. The spinal cord displayed congestion without complete transection, indicating successful model establishment. Following the surgical procedure, an electric blanket was utilized to maintain normothermia. Cefuroxime sodium was administered via intramuscular injection for three consecutive days postoperatively to prevent surgical site infection. Urination was facilitated three times daily during the postoperative period. In the sham group, the rats underwent surgical exposure of the spinal cord without receiving any impact intervention.\u003c/p\u003e\u003cp\u003e\u003cb\u003eExperimental design.\u003c/b\u003e First, the rats were divided into six groups: sham-24h, SCI-24h, sham-72h, SCI-72h, sham-1w, SCI-1w. Rats in both the SCI model group and the sham group were euthanized at predetermined time (24h, 72h and 1week) points post-modeling to collect spinal cord tissue samples for subsequent analysis. Then, the rats were divided into four groups: sham, SCI, SCI\u0026thinsp;+\u0026thinsp;phosphate-buffered saline (PBS), SCI\u0026thinsp;+\u0026thinsp;GA. The SCI model in rats was established according to the aforementioned method. Prior to model induction, rats in the SCI\u0026thinsp;+\u0026thinsp;GA group received an intravenous injection of 6 mg/kg glycyrrhizic acid (an antagonist of HMGB1) via the tail vein for therapeutic intervention, while those in the SCI\u0026thinsp;+\u0026thinsp;PBS group were administered an equivalent volume of PBS.\u003c/p\u003e\u003cp\u003e\u003cb\u003eReverse transcription quantitative PCR (RT-qPCR).\u003c/b\u003e The samples were collected and total RNA was isolated using a Total RNA Miniprep Kit. Subsequently, cDNA synthesis was carried out following the instructions provided by the manufacturer. A RT-qPCR analysis was conducted under the following conditions: Initial denaturation at 95˚C for 5 min, followed by denaturation at 95˚C for 10 sec, annealing at 60˚C for 30 sec, extension from 65 to 95˚C with a temperature increment of 0.5˚C every 5 sec. Following completion of the reaction, the average cycle threshold (Ct) values were determined for each gene as well as for the reference gene. The relative expression levels of genes were evaluated using the widely accepted method known of 2\u003csup\u003e\u0026minus; ΔΔCT\u003c/sup\u003e. The sequences of the primers are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene symbol\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHMGB1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAAAGGAGATCCTAAGAAGCCGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCATAACGAGCCTTGTCAGCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eACSL4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCAAGCATTCCTCCAAGTAGACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCAGCCGTAGGTAAAGCAGGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGPX4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGGCAGGAGCCAGGAAGTAATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eACCACGCAGCCGTTCTTATC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSLC7A11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTGGCTGGTTTTACCTCAACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCTCGGCGCTAATGGTTGTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTGGAGAAACCTGCCAAGTATG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGTGGAAGAATGGGAGTTGCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern blotting.\u003c/b\u003e Total protein was extracted and the content was assessed using a bicinchoninc assay protein assay kit. Subsequently, the protein (30 mg) was separated by 10% SDS-PAGE and transferred onto a polyvinylidene difluoride membrane. The membranes used for the target protein (and β-actin) were blocked with 5% skimmed milk at 25˚C for 1 h. The corresponding membranes were incubated with the following primary antibodies: HMGB1 (1:1,000), ACSL4 (1:1,000), GPX4 (1:1,000) and SLC7A11 (1:1,000), followed by incubation with a secondary antibody for 1 h. Finally, the protein bands were assessed by an ECL-detecting kit and β-actin was used as a loading control.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDetection MDA and GSH levels.\u003c/b\u003e Spinal cord or cell samples were collected, and the levels of MDA and GSH were determined in accordance with the protocols outlined in the respective kit instructions.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIron content assay.\u003c/b\u003e Rat spinal cord tissues were collected, and the iron ion content in the tissues from each experimental group was measured according to the protocol provided in the total iron ion detection kit instructions.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePrussian blue staining.\u003c/b\u003e The spinal cord tissues of rats were first fixed and embedded in paraffin, followed by sectioning. The tissue sections were then deparaffinized and rehydrated through a graded ethanol series to distilled water. Subsequently, the sections were incubated in a freshly prepared staining solution containing equal volumes of 2% potassium ferrocyanide and 2% hydrochloric acid for 30 minutes, followed by two washes with distilled water. Thereafter, DAB chromogenic solution was applied to the sections for approximately 10 minutes. The reaction was terminated by removing the DAB solution, after which the sections were rinsed once with 0.01 mol/L PBS and three times with distilled water. Nuclei were counterstained with hematoxylin. Finally, the sections were dehydrated through an ascending alcohol series, cleared in xylene, mounted with neutral balsam, and examined under a light microscope for imaging. Following staining, iron-rich regions in the tissue appeared brown, while nuclei were stained light blue.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIsolation of primary spinal cord neuron.\u003c/b\u003e Primary rat spinal cord neurons were isolated according to the method described by Guo et al [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Pregnant SD rats at 14 days of gestation were anesthetized, and fetal rat spinal cords were aseptically dissected, minced, and digested with 0.125% trypsin at 37\u0026deg;C for 15 min. The enzymatic digestion was terminated by the addition of an equal volume of neuron-specific complete culture medium. The cell suspension was centrifuged, and the supernatant was discarded. Fresh complete culture medium was added, and the pellet was gently resuspended by pipetting, followed by a 10 min settling period to allow large tissue fragments to settle. The upper fraction containing single cells was collected and seeded into poly-L-lysine-coated sterile 6-well plates at a density of 1 \u0026times; 10⁵ cells/mL. The plates were incubated at 37\u0026deg;C in a humidified atmosphere of 5% CO₂ and 95% air for 4 hours, after which the medium was replaced with serum-free neuronal culture medium. After 24 hours in culture, cytarabine was added to a final concentration of 10 \u0026micro;mol/L to inhibit glial cell proliferation. Neuronal identity was confirmed on day 7 via immunofluorescent staining for NeuN.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell culture, treatment and transfection.\u003c/b\u003e Primary rat spinal cord neurons were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37\u0026deg;C in an atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e. To establish an in vitro neuronal ferroptosis model, neurons were exposed to varying concentrations of the ferroptosis inducer Erastin (0, 2, 5 and 10 \u0026micro;M) for 24 and 48 h. The optimal concentration and treatment duration were determined based on assessments of neuron viability and the expression levels of ferroptosis-related markers (ACSL4, GPX4 and SLC7A11).\u003c/p\u003e\u003cp\u003eAs for cell transfection, neurons were prepared when the density of the cells reached 70%. Rat spinal cord neurons were transfected with different lentiviral vector for 48 h by using lipofectamine 3000. RNA and proteins were isolated from neurons across different treatment groups to assess transfection efficiency following transfection.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell Counting Kit-8 (CCK-8).\u003c/b\u003e Cell proliferation was determined by Cell Counting Kit-8 assay (CCK-8). The cells were cultured in 96-well plates. Following the replacement of the culture medium, 10 \u0026micro;L of CCK-8 reagent was added to each well and incubated in a controlled environment for 2 hours. The absorbance value at a wavelength of 450nm was determined through enzymatic labeling for each well.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFerroOrange staining.\u003c/b\u003e Neurons were seeded into fluorescent culture dishes and incubated overnight under controlled conditions at 37\u0026deg;C in a humidified atmosphere with 5% CO\u003csub\u003e2\u003c/sub\u003e. Following incubation, the supernatant was carefully removed, and cells were rinsed three times with serum-free medium to ensure removal of residual components. Subsequently, 1 \u0026micro;M FerroOrange working solution was added to the cells, which were then incubated in the dark at 37\u0026deg;C for 30 minutes. Fluorescence imaging was performed using a fluorescence microscope equipped with excitation at 543 nm and emission detection at 580 nm.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTransmission electron microscopy (TEM).\u003c/b\u003e The cells were fixed in electron microscope fixation solution for about 30 min. The cells were double stained with 3% uranium acetate and lead citrate. The ultrastructure of the cells was observed by transmission electron microscope and photographed for preservation.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCo-immunoprecipitation (Co-IP) assay.\u003c/b\u003e Neuronal cell samples were collected and lysed, followed by centrifugation to obtain the supernatant. One microgram of the corresponding antibody (HMGB1 or ACSL4 antibody) was added to the cell lysate and incubated at 4\u0026deg;C overnight with gentle agitation. 10 \u0026micro;L protein A/G agarose beads were prepared by washing three times with an appropriate volume of lysis buffer via centrifugation at 3,000 rpm for 3 minutes per wash. The pre-washed protein A/G agarose beads (10 \u0026micro;L) were then added to the lysate that had been incubated with the antibody, and the mixture was incubated at 4\u0026deg;C for 4 hours under gentle shaking to facilitate antibody-bead conjugation. Following incubation, the sample was centrifuged at 3,000 rpm for 3 minutes at 4\u0026deg;C to pellet the agarose beads. The supernatant was carefully removed, and the beads were washed 3\u0026ndash;4 times with 1 mL of lysis buffer. Finally, 15 \u0026micro;L of 2\u0026times; SDS loading buffer was added to the beads, and the samples were boiled for 5 minutes to elute bound proteins. Subsequent analysis was performed using SDS-PAGE and Western blotting to detect the immunoprecipitated proteins.\u003c/p\u003e\u003cp\u003e\u003cb\u003eStatistical analyses.\u003c/b\u003e SPSS 22.0 (IBM Corp.) was applied for statistical analysis and the experimental data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (x\u0026thinsp;\u0026plusmn;\u0026thinsp;s). One-Way ANOVA was used for comparison between the groups and the t-test was selected for a two-way comparison. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate a statistically significant difference.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eHMGB1 and ferroptosis are up-regelated in the spinal cord tissues of rats following spinal cord injury.\u003c/b\u003e As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-I, the mRNA and protein expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 were detected by RT-qPCR and western blotting, respectively. Compared with the sham group, the mRNA and protein expression levels of HMGB1 and ACSL4 were significantly elevated at 24 h, 48 h, and 1 week after SCI in rats, whereas the mRNA and protein expression levels of GPX4 and SLC7A11 were markedly reduced at the same time points. Moreover, the variation in expression levels shows a certain time-dependent characteristic. Then, we detected the levels of MDA and GSH in the spinal cord tissues of different groups of rats (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ-K). Compared with the sham group, the MDA level was significantly elevated at 24 h, 48 h, and 1 week following SCI in rats, while the GSH level was markedly reduced at the same time points. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL, we used Prussian blue staining to observe the iron deposition in the spinal cord tissues of rats in different groups. No iron deposition was observed in the sham group at different time points, while in the SCI group, obvious iron deposition could only be observed in rats 1 week after injury. Furthermore, a total iron ion detection kit was employed to assess the variations in iron ion levels within spinal cord tissues across different rat groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM). Compared with the sham group, a significant elevation in iron ion levels was observed in the spinal cord 1 week after injury. However, no significant differences were detected at 24 h or 48 h post-injury.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEstablish a ferroptosis model of rat spinal cord neurons.\u003c/b\u003e Immunofluorescence was used to identify the marker proteins (NeuN) of rat spinal cord neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The results indicated that NeuN was highly expressed in rat spinal cord neurons. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, the cell viability of neurons exposed to various concentrations of Erastin for 24 and 48 hours was assessed using the CCK-8 assay. Compared with the 0 \u0026micro;M group, only the 10 \u0026micro;M Erastin treatment for 48 hours significantly decreased the cell viability of neurons. Subsequently, the mRNA and protein expression levels of ACSL4, GPX4 and SLC7A11 were detected by RT-qPCR and western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-I). Compared with the 0 \u0026micro;M group, the mRNA and protein expression levels of ACSL4 were significantly increased in the 2 \u0026micro;M, 5 \u0026micro;M and 10 \u0026micro;M group, whereas the mRNA and protein expression levels of GPX4 and SLC7A11 were markedly reduced in the 2 \u0026micro;M, 5 \u0026micro;M and 10 \u0026micro;M group. Based on the above results, we chose to treat rat spinal cord neurons with 10 \u0026micro;M Erastin for 48 hours to simulate an in vitro neuronal ferroptosis model.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eInhibition of HMGB1 suppresses neuronal ferroptosis via regulation of ACSL4.\u003c/b\u003e As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-C, RT-qPCR and Western blotting were employed to assess the transfection efficiency of three distinct sh-HMGB1 lentiviral vectors in rat spinal cord neurons. Compared with the sh-NC group, the mRNA and protein expression levels of HMGB1 in the sh-HMGB1-1, sh-HMGB1-2 and sh-HMGB1-3 groups were significantly decreased in rat spinal cord neurons. Among these lentiviral vectors, sh-HMGB1-3 demonstrated the most pronounced knockdown efficacy and was therefore selected for subsequent cellular experiments. In addition, RT-qPCR and Western blotting were also employed to assess the transfection efficiency of ACSL4 overexpression lentiviral vectors in rat spinal cord neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-F). Compared with the OE-NC group, the mRNA and protein expression levels of ACSL4 in the OE-ACSL4 group were significantly increased in rat spinal cord neurons. Then, we detected the levels of MDA and GSH in different treatment neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-H). Compared with the control group, the MDA level was significantly increased in the Erastin group, and the GSH level was significantly decreased in the Erastin group. Compared with the Erastin group, the MDA level was significantly decreased in the Erastin\u0026thinsp;+\u0026thinsp;Fer-1 group and Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group, while the GSH level was significantly increased in the Erastin\u0026thinsp;+\u0026thinsp;Fer-1 group and Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group. Compared with the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group, the MDA level was significantly increased in the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1\u0026thinsp;+\u0026thinsp;OE-ACSL4 group, and the GSH level was significantly decreased in the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1\u0026thinsp;+\u0026thinsp;OE-ACSL4 group. Subsequently, FerroOrange staining was used to observe the differences in ferrous ion levels among neurons in different treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI). Compared with the control group, the Erastin group exhibited elevated levels of ferrous ions. In contrast, treatment with Fer-1 or sh-HMGB1 significantly reduced ferrous ion levels in neurons relative to the Erastin group. Furthermore, when compared with the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group, neuronal ferrous ion levels were further increased in the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1\u0026thinsp;+\u0026thinsp;OE-ACSL4 group. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ, TEM was subsequently employed to examine the microstructural alterations in neurons across the various treatment groups. Compared with the control group, neurons in the Erastin group exhibited smaller mitochondria and loss of mitochondrial cristae. In contrast, mitochondrial morphology in the Erastin\u0026thinsp;+\u0026thinsp;Fer-1 and Erastin\u0026thinsp;+\u0026thinsp;sh-HMGB1 groups was largely restored to normal relative to the Erastin group. Furthermore, compared with the Erastin\u0026thinsp;+\u0026thinsp;sh-HMGB1 group, neurons in the Erastin\u0026thinsp;+\u0026thinsp;sh-HMGB1\u0026thinsp;+\u0026thinsp;OE-ACSL4 group displayed further mitochondrial shrinkage, complete absence of mitochondrial cristae, and rupture of the plasma membrane.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eHMGB1 regulates neuronal ferroptosis through targeted modulation of ACSL4.\u003c/b\u003e To further validate the regulatory role of HMGB1 in neuronal ferroptosis, we used RT-qPCR and Western blotting to assess the mRNA and protein expression levels of ACSL4, GPX4, and SLC7A11 in neurons across different treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-G). Compared with the Erastin group, the mRNA and protein expression levels of ACSL4 was significantly decreased in the Erastin\u0026thinsp;+\u0026thinsp;Fer-1 group and Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group, while the mRNA and protein expression levels of GPX4 and SLC7A11 were significantly increased in the Erastin\u0026thinsp;+\u0026thinsp;Fer-1 group and Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group. Moreover, Compared with the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group, the mRNA and protein expression levels of ACSL4 was significantly increased in the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1\u0026thinsp;+\u0026thinsp;OE-ACSL4 group, and the mRNA and protein expression levels of GPX4 and SLC7A11 were significantly decreased in the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1\u0026thinsp;+\u0026thinsp;OE-ACSL4 group. To further verify the targeted interaction between HMGB1 and ACSL4 in rat spinal cord neurons, we conducted a Co-IP experiment and the results were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I. These results confirm a direct targeted interaction between HMGB1 and ACSL4 in rat spinal cord neurons.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eGlycyrrhizic acid treatment effectively reverses neuronal ferroptosis following SCI in rats.\u003c/b\u003e To further validate the impact of HMGB1 inhibition on ferroptosis in a rat model of SCI at the in vivo level, we administered the HMGB1 inhibitor glycyrrhizin (GA) to SCI rats. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B, Compared with the SCI\u0026thinsp;+\u0026thinsp;PBS group, the MDA level was significantly decreased in the SCI\u0026thinsp;+\u0026thinsp;GA group, while the GSH level was significantly increased in the SCI\u0026thinsp;+\u0026thinsp;GA group. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, a total iron ion detection kit was employed to assess the variations in iron ion levels within spinal cord tissues across different rat groups. Compared with the SCI\u0026thinsp;+\u0026thinsp;PBS group, the iron ion level was significantly decreased in the SCI\u0026thinsp;+\u0026thinsp;GA group. In addition, prussian blue staining was employed to assess iron deposition in spinal cord tissues across different rat groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Compared with the SCI\u0026thinsp;+\u0026thinsp;PBS group, the iron deposition in the spinal cord tissue of the SCI\u0026thinsp;+\u0026thinsp;GA group rats was significantly reduced. Finally, the mRNA and protein expression levels of HMGB1, ACSL4, GPX4 and SLC7A11 in the spinal cord tissues of different groups of rats were detected by RT-qPCR and western blotting, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-M). Compared with the SCI\u0026thinsp;+\u0026thinsp;PBS group, the mRNA and protein expression levels of HMGB1 and ACSL4 were significantly decreased in the SCI\u0026thinsp;+\u0026thinsp;GA group, while the mRNA and protein expression levels of GPX4 and SLC7A11 were significantly increased in the SCI\u0026thinsp;+\u0026thinsp;GA group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSpinal cord injury (SCI) is a severe form of central nervous system trauma that results in significant motor, sensory, and autonomic dysfunction [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Currently, this complex condition lacks effective therapeutic interventions and has emerged as a growing global health concern. Secondary injury following SCI is potentially reversible [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Accumulating evidence indicates that ferroptosis plays a critical role in modulating the physiological and pathological processes associated with secondary injury after SCI [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Following SCI, substantial alterations occur in the local microenvironment, including extensive intramedullary hemorrhage, red blood cell accumulation, cellular rupture, and hemolysis, leading to iron overload in the injured tissue. Additionally, oxidative stress triggers a cascade of lipid peroxidation reactions. These pathological changes collectively contribute to the induction of ferroptosis post-SCI [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Our experimental results demonstrate that, compared with the sham-operated group, SCI rats exhibit significantly elevated levels of MDA, iron ions and ACSL4 in spinal cord tissues, accompanied by marked reductions in GSH, GPX4, and SLC7A11.\u003c/p\u003e\u003cp\u003eHMGB1 is an intracellular protein predominantly localized in the cell nucleus and peripheral blood, with widespread distribution throughout the body, including various neural cell types such as neurons, microglia, and astrocytes [\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Upon cellular stress, innate immune cells actively secrete HMGB1, while necrotic cells release it passively, establishing HMGB1 as a key pathophysiological mediator in autoimmune disorders and neuroinflammatory conditions [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Accumulating evidence indicates that HMGB1 expression is upregulated in SCI patient tissues [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Consistently, our experimental results demonstrate a significantly elevated expression level of HMGB1 in the spinal cord tissues of SCI-induced rats compared to the sham group. Furthermore, HMGB1 has been implicated in the progression of diverse pathological conditions through its regulation of ferroptosis. Liu et al. reported that suppression of HMGB1 mitigates blood-brain barrier dysfunction following intravenous thrombolysis by inhibiting endothelial cell ferroptosis [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Davaanyam et al. demonstrated that HMGB1 induces ferroptosis in astrocytes via upregulation of hepcidin, thereby exacerbating ischemic acute brain injury [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Notably, our results indicate that sh-HMGB1 intervention at the cellular level reduces the expression of ferroptosis-related markers in rat spinal cord neurons, while pharmacological inhibition of HMGB1 using GA in animal models likewise attenuates ferroptosis-related marker expression in SCI rats.\u003c/p\u003e\u003cp\u003eACSL4 is a critical enzyme involved in lipid metabolism, and phospholipid peroxidation represents a hallmark feature of ferroptosis [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Upregulation of ACSL4 promotes the accumulation of lipid peroxides, thereby inducing ferroptotic cell death. Conversely, inhibition of ACSL4 activity or reduction of lipid peroxidation can effectively mitigate ferroptosis-associated cellular damage and related pathological manifestations [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Previous studies have demonstrated that HMGB1 regulates ACSL4 expression in various cell types, including trophoblast cells [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], leukemia cells [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], and renal tubular epithelial cells [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In the present study, we found that, compared with the Erastin group, sh-HMGB1 significantly reduced both mRNA and protein levels of ACSL4 in rat spinal cord neurons. In rescue experiments, overexpression of ACSL4 in the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1\u0026thinsp;+\u0026thinsp;OE-ACSL4 group markedly restored ACSL4 expression at both the mRNA and protein levels, relative to the Erastin\u0026thinsp;+\u0026thinsp;shHMGB1 group. Furthermore, Co-IP assays confirmed a direct physical interaction between HMGB1 and ACSL4 in rat spinal cord neurons.\u003c/p\u003e\u003cp\u003eBased on the results of the present study, it can be concluded that targeted suppression of ACSL4 through interference with HMGB1 inhibits neuronal ferroptosis in SCI rats. However, the present study exhibits certain limitations. At the animal level, only a single HMGB1 inhibitor, GA, was employed for intervention, and no comparative analysis of the effects of multiple inhibitors was conducted. Furthermore, no reverse validation experiment involving ACSL4 overexpression was performed in vivo. In future studies, we aim to address these limitations through additional experimental investigations.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, SCI rats exhibit significantly elevated levels of MDA, iron ions, HMGB1 and ACSL4 in spinal cord tissues, accompanied by marked reductions in GSH, GPX4, and SLC7A11. Interference with HMGB1 inhibits neuronal ferroptosis through targeted suppression of ACSL4. Besides, pharmacological inhibition of HMGB1 using GA in animal models likewise attenuates ferroptosis-related marker expression in SCI rats.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch3\u003eData share statement:\u003c/h3\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEthical Approval:\u003c/strong\u003e\u003cp\u003eThis article does not contain any studies with human participants (Clinical trial number: not applicable). Besides, animals were housed and operated in strict compliance with the ethical principles of animal experimentation, and the operations were ratified by the Ganzhou People's Hospital (No. D2025-009). All animal experiments complied with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. Besides, all animal experiments as in accordance with the ARRIVE guidelines.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eConsent to participate:\u003c/h2\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eDisclosure:\u003c/h2\u003e\u003cp\u003eThe authors declare no competing financial interest.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e\u003cp\u003eThis work was supported by the Science and Technology Plan project of Ganzhou City (NO. 2023NS127385) and the Natural Science Foundation of Jiangxi Province (NO. 20242BAB20380).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZhiwu Wu drafted the manuscript and conducted the experiments. Qinglin Zhong, Tao Li, Helan Yuan,Tianxiang Zeng, Jinshi Zhang, Kaiming Feng, Xinyun Ye and Qiuhua Jiang conducted the experiments and performed data analysis. Qianliang Huang designed the experiments and revised the manuscript. All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eTrueblood CT, Singh A, Cusimano MA, Hou S (2024) Autonomic Dysreflexia in Spinal Cord Injury: Mechanisms and Prospective Therapeutic Targets. Neuroscientist 30(5):597\u0026ndash;611. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/10738584231217455\u003c/span\u003e\u003cspan address=\"10.1177/10738584231217455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaroudi M, Rezk A, Daher M, Balmaceno-Criss M, Gregoryczyk JG, Sharma Y, McDonald CL, Diebo BG, Daniels AH (2024) Management of traumatic spinal cord injury: A current concepts review of contemporary and future treatment. Injury 55(6):111472. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.injury.2024.111472\u003c/span\u003e\u003cspan address=\"10.1016/j.injury.2024.111472\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh G, Sharma P, Forrest G, Harkema S, Behrman A, Gerasimenko Y (2024) Spinal Cord Transcutaneous Stimulation in Cervical Spinal Cord Injury: A Review Examining Upper Extremity Neuromotor Control, Recovery Mechanisms, and Future Directions. J Neurotrauma 41(17\u0026ndash;18):2056\u0026ndash;2074. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/neu.2023.0438\u003c/span\u003e\u003cspan address=\"10.1089/neu.2023.0438\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMigliorini F, Cocconi F, Sch\u0026auml;fer L, Simeone F, Jeyaraman M, Maffulli N (2024) Pharmacological management of secondary chronic spinal cord injury: a systematic review. Br Med Bull 151(1):49\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bmb/ldae009\u003c/span\u003e\u003cspan address=\"10.1093/bmb/ldae009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFerber GA, Anderson KD (2025) Recovery Insights Following Spinal Cord Injury: A Consumer's Perspective. Phys Med Rehabil Clin N Am 36(1):139\u0026ndash;154. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pmr.2024.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.pmr.2024.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAnjum A, Yazid MD, Fauzi Daud M, Idris J, Ng AMH, Selvi Naicker A, Ismail OHR, Athi Kumar RK, Lokanathan Y (2020) Spinal Cord Injury: Pathophysiology, Multimolecular Interactions, and Underlying Recovery Mechanisms. Int J Mol Sci 21(20):7533. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21207533\u003c/span\u003e\u003cspan address=\"10.3390/ijms21207533\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Al Mamun A, Yuan Y, Lu Q, Xiong J, Yang S, Wu C, Wu Y, Wang J (2021) Acute spinal cord injury: Pathophysiology and pharmacological intervention (Review). Mol Med Rep 23(6):417. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/mmr.2021.12056\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2021.12056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng J, Conrad M (2025) Ferroptosis: when metabolism meets cell death. Physiol Rev 105(2):651\u0026ndash;706. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/physrev.00031.2024\u003c/span\u003e\u003cspan address=\"10.1152/physrev.00031.2024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe N, Yuan D, Luo M, Xu Q, Wen Z, Wang Z, Zhao J, Liu Y (2025) Ferroptosis contributes to immunosuppression. Front Med 19(1):1\u0026ndash;22. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11684-024-1080-8\u003c/span\u003e\u003cspan address=\"10.1007/s11684-024-1080-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZeng W, Wang F, Cui Z, Zhang Y, Li Y, Li N, Mao Z, Zhang H, Liu Y, Miao Y, Sun S, Cai Y, Xiong B (2025) Inhibition of ferroptosis counteracts the advanced maternal age-induced oocyte deterioration. Cell Death Differ 32(6):1071\u0026ndash;1085. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41418-025-01519-2\u003c/span\u003e\u003cspan address=\"10.1038/s41418-025-01519-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang Y, Bai J (2024) Ferroptosis in the neurovascular unit after spinal cord injury. Exp Neurol 381:114943. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.expneurol.2024.114943\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2024.114943\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYao S, Pang M, Wang Y, Wang X, Lin Y, Lv Y, Xie Z, Hou J, Du C, Qiu Y, Guan Y, Liu B, Wang J, Xiang AP, Rong L (2023) Mesenchymal stem cell attenuates spinal cord injury by inhibiting mitochondrial quality control-associated neuronal ferroptosis. Redox Biol 67:102871. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.redox.2023.102871\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2023.102871\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRyan F, Blex C, Ngo TD, Kopp MA, Michalke B, Venkataramani V, Curran L, Schwab JM, Ruprecht K, Otto C, Jhelum P, Kroner A, David S (2024) Ferroptosis inhibitor improves outcome after early and delayed treatment in mild spinal cord injury. Acta Neuropathol 147(1):106. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00401-024-02758-2\u003c/span\u003e\u003cspan address=\"10.1007/s00401-024-02758-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFan J, He K, Zhang Y, Li R, Yi X, Li S (2025) HMGB1: new biomarker and therapeutic target of autoimmune and autoinflammatory skin diseases. Front Immunol 16:1569632. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2025.1569632\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2025.1569632\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePassali D, Bellussi LM, Santantonio M, Passali GC (2025) HMGB1 as a Key Modulator in Nasal Inflammatory Disorders: A Narrative Review. J Clin Med 14(15):5392. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/jcm14155392\u003c/span\u003e\u003cspan address=\"10.3390/jcm14155392\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVladimirova D, Staneva S, Ugrinova I (2025) Multifaceted role of HMGB1: From nuclear functions to cytoplasmic and extracellular signaling in inflammation and cancer-Review. Adv Protein Chem Struct Biol 143:271\u0026ndash;300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/bs.apcsb.2024.09.014\u003c/span\u003e\u003cspan address=\"10.1016/bs.apcsb.2024.09.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu Z, Li M (2023) High-Mobility Group Box 1 in Spinal Cord Injury and Its Potential Role in Brain Functional Remodeling After Spinal Cord Injury. Cell Mol Neurobiol 43(3):1005\u0026ndash;1017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10571-022-01240-5\u003c/span\u003e\u003cspan address=\"10.1007/s10571-022-01240-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFang P, Pan HC, Lin SL, Zhang WQ, Rauvala H, Schachner M, Shen YQ (2014) HMGB1 contributes to regeneration after spinal cord injury in adult zebrafish. Mol Neurobiol 49(1):472\u0026ndash;483. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12035-013-8533-4\u003c/span\u003e\u003cspan address=\"10.1007/s12035-013-8533-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo L, Zhang D, Ren X, Liu D (2023) SYVN1 attenuates ferroptosis and alleviates spinal cord ischemia-reperfusion injury in rats by regulating the HMGB1/NRF2/HO-1 axis. Int Immunopharmacol 123:110802. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2023.110802\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2023.110802\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHersh AM, Weber-Levine C, Jiang K, Theodore N (2024) Spinal Cord Injury: Emerging Technologies. Neurosurg Clin N Am 35(2):243\u0026ndash;251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.nec.2023.10.001\u003c/span\u003e\u003cspan address=\"10.1016/j.nec.2023.10.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang W, Zhang L, Liu X, Guo Q, Jiang X, Wu J, Zhu Y, Gu Y, Chen L, Xi K (2025) Punicalagin inhibits neuron ferroptosis and secondary neuroinflammation to promote spinal cord injury recovery. Int Immunopharmacol 148:114048. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2025.114048\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2025.114048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi D, Lu X, Xu G, Liu S, Gong Z, Lu F, Xia X, Jiang J, Wang H, Zou F, Ma X (2023) Dihydroorotate dehydrogenase regulates ferroptosis in neurons after spinal cord injury via the P53-ALOX15 signaling pathway. CNS Neurosci Ther 29(7):1923\u0026ndash;1939. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cns.14150\u003c/span\u003e\u003cspan address=\"10.1111/cns.14150\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi QS, Jia YJ (2023) Ferroptosis: a critical player and potential therapeutic target in traumatic brain injury and spinal cord injury. Neural Regen Res 18(3):506\u0026ndash;512. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4103/1673-5374.350187\u003c/span\u003e\u003cspan address=\"10.4103/1673-5374.350187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Sun C, Zhao C, Hao J, Zhang Y, Fan B, Li B, Duan H, Liu C, Kong X, Wu P, Yao X, Feng S (2019) Ferroptosis inhibitor SRS 16\u0026ndash;86 attenuates ferroptosis and promotes functional recovery in contusion spinal cord injury. Brain Res 1706:48\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.brainres.2018.10.023\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2018.10.023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVahabi A, \u0026Ouml;zt\u0026uuml;rk AM, Kılı\u0026ccedil;lı B, Birim D, Kaftan \u0026Ouml;cal G, Dağcı T, Armağan G (2024) Silibinin promotes healing in spinal cord injury through anti-ferroptotic mechanisms. JOR Spine 7(3):e1344. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jsp2.1344\u003c/span\u003e\u003cspan address=\"10.1002/jsp2.1344\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu Z, Wang Z, Xie Z, Zhu H, Li C, Xie S, Zhou W, Zhang Z, Li M (2022) Glycyrrhizic Acid Attenuates the Inflammatory Response After Spinal Cord Injury by Inhibiting High Mobility Group Box-1 Protein Through the p38/Jun N-Terminal Kinase Signaling Pathway. World Neurosurg 158:e856\u0026ndash;e864. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.wneu.2021.11.085\u003c/span\u003e\u003cspan address=\"10.1016/j.wneu.2021.11.085\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan J, Guo L, Ma J, Zhang H, Xiao M, Li N, Gong H, Yan M (2024) HMGB1 as an extracellular pro-inflammatory cytokine: Implications for drug-induced organic damage. Cell Biol Toxicol 15(1):55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10565-024-09893-2\u003c/span\u003e\u003cspan address=\"10.1007/s10565-024-09893-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShen P, Zhang L, Jiang X, Yu B, Zhang J (2024) Targeting HMGB1 and Its Interaction with Receptors: Challenges and Future Directions. J Med Chem 67(24):21671\u0026ndash;21694. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jmedchem.4c01912\u003c/span\u003e\u003cspan address=\"10.1021/acs.jmedchem.4c01912\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi J, Wang Z, Li J, Zhao H, Ma Q (2025) HMGB1: A New Target for Ischemic Stroke and Hemorrhagic Transformation. Transl Stroke Res 16(3):990\u0026ndash;1015. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12975-024-01258-5\u003c/span\u003e\u003cspan address=\"10.1007/s12975-024-01258-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKikuchi K, Uchikado H, Miura N, Morimoto Y, Ito T, Tancharoen S, Miyata K, Sakamoto R, Kikuchi C, Iida N, Shiomi N, Kuramoto T, Miyagi N, Kawahara KI (2011) HMGB1 as a therapeutic target in spinal cord injury: A hypothesis for novel therapy development. Exp Ther Med 2(5):767\u0026ndash;770. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/etm.2011.310\u003c/span\u003e\u003cspan address=\"10.3892/etm.2011.310\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun L, Zhao L, Li P, Liu X, Liang F, Jiang Y, Kang N, Gao C, Yang J (2019) Effect of hyperbaric oxygen therapy on HMGB1/NF-κB expression and prognosis of acute spinal cord injury: A randomized clinical trial. Neurosci Lett 692:47\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.neulet.2018.10.059\u003c/span\u003e\u003cspan address=\"10.1016/j.neulet.2018.10.059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu J, Pang SY, Zhou SY, He QY, Zhao RY, Qu Y, Yang Y, Guo ZN (2024) Lipocalin-2 aggravates blood-brain barrier dysfunction after intravenous thrombolysis by promoting endothelial cell ferroptosis via regulating the HMGB1/Nrf2/HO-1 pathway. Redox Biol 76:103342. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.redox.2024.103342\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2024.103342\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDavaanyam D, Lee H, Seol SI, Oh SA, Kim SW, Lee JK (2023) HMGB1 induces hepcidin upregulation in astrocytes and causes an acute iron surge and subsequent ferroptosis in the postischemic brain. Exp Mol Med 55(11):2402\u0026ndash;2416. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s12276-023-01111-z\u003c/span\u003e\u003cspan address=\"10.1038/s12276-023-01111-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhuo B, Qin C, Deng S, Jiang H, Si S, Tao F, Cai F, Meng Z (2025) The role of ACSL4 in stroke: mechanisms and potential therapeutic target. Mol Cell Biochem 480(4):2223\u0026ndash;2246. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11010-024-05150-6\u003c/span\u003e\u003cspan address=\"10.1007/s11010-024-05150-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJiang Y, Zhang M, Sun M (2025) ACSL4 at the helm of the lipid peroxidation ship: a deep-sea exploration towards ferroptosis. Front Pharmacol 16:1594419. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphar.2025.1594419\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2025.1594419\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTuo QZ, Liu Y, Xiang Z, Yan HF, Zou T, Shu Y, Ding XL, Zou JJ, Xu S, Tang F, Gong YQ, Li XL, Guo YJ, Zheng ZY, Deng AP, Yang ZZ, Li WJ, Zhang ST, Ayton S, Bush AI, Xu H, Dai L, Dong B, Lei P (2022) Thrombin induces ACSL4-dependent ferroptosis during cerebral ischemia/reperfusion. Signal Transduct Target Ther 7(1):59. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-022-00917-z\u003c/span\u003e\u003cspan address=\"10.1038/s41392-022-00917-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui J, Chen Y, Yang Q, Zhao P, Yang M, Wang X, Mang G, Yan X, Wang D, Tong Z, Wang P, Kong Y, Wang N, Wang D, Dong N, Liu M, E M, Zhang M, Yu B (2024) Protosappanin A Protects DOX-Induced Myocardial Injury and Cardiac Dysfunction by Targeting ACSL4/FTH1 Axis-Dependent Ferroptosis. Adv Sci (Weinh) 11(34):e2310227. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/advs.202310227\u003c/span\u003e\u003cspan address=\"10.1002/advs.202310227\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong Y, Li Y, Tang W, Chen Q, Kong C (2025) Increased Trophoblast Cell Ferroptosis via HMGB1/ACSL4 Pathway Is Associated with Spontaneous Abortion. Reprod Sci 32(5):1713\u0026ndash;1722. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s43032-025-01817-7\u003c/span\u003e\u003cspan address=\"10.1007/s43032-025-01817-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKong Q, Liang Q, Tan Y, Luo X, Ling Y, Li X, Cai Y, Chen H (2025) Induction of ferroptosis by SIRT1 knockdown alleviates cytarabine resistance in acute myeloid leukemia by activating the HMGB1/ACSL4 pathway. Int J Oncol 66(1):2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ijo.2024.5708\u003c/span\u003e\u003cspan address=\"10.3892/ijo.2024.5708\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao Z, Li G, Wang Y, Li Y, Xu H, Liu W, Hao W, Yao Y, Zeng R (2023) Cytoplasmic HMGB1 induces renal tubular ferroptosis after ischemia/reperfusion. Int Immunopharmacol 116:109757. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2023.109757\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2023.109757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"HMGB1, spinal cord injury, ACSL4, ferroptosis, neuron","lastPublishedDoi":"10.21203/rs.3.rs-7833607/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7833607/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSpinal cord injury (SCI) refers to structural and functional impairments of the spinal cord resulting from various etiologies. Ferroptosis has been increasingly recognized as a critical contributor to neuronal damage following SCI. Therefore, this study aims to investigate the regulatory role of HMGB1 in neuronal ferroptosis of SCI rats and to explore its underlying mechanisms. Iron ion deposition, MDA and GSH levels, as well as the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 in spinal cord tissue of SCI rats were measured at 24 h, 72 h and 1 week post-injury. Then, an in vitro neuronal ferroptosis model was established by treating primary rat spinal cord neurons with Erastin. Neuronal cells were transfected with lentiviral vectors for HMGB1 interference or ACSL4 overexpression. Iron ion levels, MDA content, GSH activity, and the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 were measured. The interaction between HMGB1 and ACSL4 was assessed by co-immunoprecipitation assays. Finally, SCI rats were administered the HMGB1 inhibitor glycyrrhizic acid (GA) and the effects GA on the iron ion deposition, MDA and SOD levels, as well as the expressions of HMGB1, ACSL4, SLC7A11 and GPX4 in spinal cord tissues were evaluated. Iron ion deposition was observed in the spinal cord tissue of SCI rats, accompanied by increased levels of MDA, HMGB1 and ACSL4, as well as decreased levels of GSH, GPX4, and SLC7A11. These alterations exhibited a time-dependent pattern. The administration of GA in SCI rats significantly reduces iron ion deposition, decreases the levels of MDA, HMGB1 and ACSL4, and increases the levels of GSH, GPX4, and SLC7A11. Furthermore, cellular-level results demonstrated that interfering with HMGB1 could attenuate ferroptosis in rat spinal cord neurons through targeted suppression of ACSL4. Targeted suppression of ACSL4 expression through interference with HMGB1 inhibits neuronal ferroptosis in SCI rats.\u003c/p\u003e","manuscriptTitle":"Interference with HMGB1 inhibits neuronal ferroptosis following spinal cord injury through targeting ACSL4","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-28 18:10:50","doi":"10.21203/rs.3.rs-7833607/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-13T02:33:21+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-04T11:06:51+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-31T11:31:26+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-21T08:57:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"183312028298729054916326603515479539956","date":"2025-10-21T06:35:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"217029711382849743918972225389154118853","date":"2025-10-20T10:15:25+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"127322110749966490202559472766297956097","date":"2025-10-17T00:52:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"192051052663086788464146591710043100384","date":"2025-10-14T06:44:33+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-14T02:37:20+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-13T21:02:07+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-11T10:24:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Neurochemical Research","date":"2025-10-11T08:44:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"f4a27c40-00ac-4f6f-af00-6e7afd3e0a46","owner":[],"postedDate":"October 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-18T12:54:34+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-28 18:10:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7833607","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7833607","identity":"rs-7833607","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00