The E3 ligase HECTD1 controls skeletal muscle sarcomere and mitochondrial integrity

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Sarcomeres are the fundamental functional units of skeletal muscle, essential for both force generation and metabolic homeostasis. While sarcomere degradation has been extensively studied, the mechanisms that preserve its integrity remain poorly defined. Here, we identify HECTD1 as an E3 ubiquitin ligase required for sarcomere maintenance and mitochondrial integrity. We show that HECTD1 ubiquitylates and stabilizes the chaperones KLHL40/41, which protect thin-filament components from misfolding and degradation. Consequently, reducing Hectd1 expression in myotubes coordinately decreases the levels of multiple sarcomere proteins. Skeletal muscle–specific Hectd1 knockout mice ( Hectd1 mKO) show severe sarcomere and mitochondrial disorganization and dysfunction, progressive muscle weakness, exercise and glucose intolerance, and unresolved tissue remodeling. Importantly, human iPSC-derived myotubes carrying a patient-associated HECTD1 mutation, recapitulate key molecular features of the Hectd1 mKO. These findings establish HECTD1 as a central regulator linking sarcomere proteostasis to mitochondrial function and identify its dysfunction as a cause of myopathy with mitochondriopathy.
Full text 249,334 characters · extracted from preprint-html · click to expand
The E3 ligase HECTD1 controls skeletal muscle sarcomere and mitochondrial integrity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The E3 ligase HECTD1 controls skeletal muscle sarcomere and mitochondrial integrity Jorge Ruas, Igor Cervenka, Aurel Leuchtmann, Paulo Jannig, Serge Ducommun, and 19 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8663318/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Sarcomeres are the fundamental functional units of skeletal muscle, essential for both force generation and metabolic homeostasis. While sarcomere degradation has been extensively studied, the mechanisms that preserve its integrity remain poorly defined. Here, we identify HECTD1 as an E3 ubiquitin ligase required for sarcomere maintenance and mitochondrial integrity. We show that HECTD1 ubiquitylates and stabilizes the chaperones KLHL40/41, which protect thin-filament components from misfolding and degradation. Consequently, reducing Hectd1 expression in myotubes coordinately decreases the levels of multiple sarcomere proteins. Skeletal muscle–specific Hectd1 knockout mice ( Hectd1 mKO) show severe sarcomere and mitochondrial disorganization and dysfunction, progressive muscle weakness, exercise and glucose intolerance, and unresolved tissue remodeling. Importantly, human iPSC-derived myotubes carrying a patient-associated HECTD1 mutation, recapitulate key molecular features of the Hectd1 mKO. These findings establish HECTD1 as a central regulator linking sarcomere proteostasis to mitochondrial function and identify its dysfunction as a cause of myopathy with mitochondriopathy. Biological sciences/Physiology Biological sciences/Biochemistry Health sciences/Molecular medicine Figures Figure 1 Figure 1 Figure 2 Figure 3 Figure 4 Figure 4 Figure 5 Figure 5 Figure 6 Figure 6 Figure 7 Introduction Skeletal muscle is the largest organ of the human body and a central determinant of mobility, metabolic health, and systemic physiology. Its contractile capacity and high bioenergetic demands originate from the sarcomere, the minimal contractile unit and a highly ordered supramolecular machine that enables force production 1 . Research in muscle biology has uncovered several mechanisms by which sarcomeres break down during catabolic states, particularly in conditions of disuse, fasting, cachexia, or aging. These efforts have revealed a core atrophy program centered on increased proteolysis, driven in part by E3 ubiquitin ligases such as MuRF1 2 , Atrogin-1/MAFbx 3 , and Fbxo30/Musa-1 4 . Conversely, other E3 ubiquitin ligases such as UBR4 and UBR5 have been shown to regulate muscle hypertrophy through mechanisms that promote ribosome biogenesis and protein synthesis or quality control 5 . However, the pathways that preserve and maintain sarcomere structure under homeostatic conditions are less understood. Adding to this complexity, sarcomeres and mitochondria are intimately intertwined both structurally and metabolically. The lattice-like arrangement of myofibrils is organized by desmin, whose intermediate filament network physically links sarcomeres to surrounding mitochondria and thereby dictates their spatial distribution 6 . This architecture coordinates calcium flux and ATP demand with mitochondrial metabolism. Conversely, mitochondrial dysfunction can destabilize sarcomeres and accelerate proteolytic programs. Thus, mechanisms that sustain sarcomere integrity are inherently tied to bioenergetics and mitochondrial health. Dissecting the pathways that couple structural maintenance to metabolic function is therefore necessary not only for understanding muscle physiology, but also for clarifying how muscle dysfunction contributes to systemic metabolic disease. Here we describe an unexpected function for the HECT Domain E3 Ubiquitin Protein Ligase 1 (HECTD1). Contrary to the canonical degradative role associated with many E3 ligases, we find that HECTD1 is essential for maintaining thin-filament stability and sarcomere integrity. Rather than promoting protein loss, HECTD1 supports the stability of key molecular chaperones involved in thin-filament assembly, including KLHL40 and KLHL41—proteins whose loss-of-function is known to cause severe congenital myopathies. Strikingly, loss of Hectd1 not only disrupts sarcomere structure but also leads to profound mitochondrial dysfunction in skeletal muscle. The absence of HECTD1 destabilizes thin-filament components, triggers structural collapse, and compromises mitochondrial organization and bioenergetics. These observations position HECTD1 at a previously unrecognized intersection between contractile unit stability and mitochondrial function. Given the severity of the phenotype observed in Hectd1 -deficient muscle, including progressive weakness, exercise and glucose intolerance, and abnormal tissue remodeling, our findings establish HECTD1 as a novel myopathy gene with mitochondriopathy. More broadly, this work identifies a previously unappreciated mechanism of sarcomere maintenance and opens new avenues for therapeutic exploration aimed at preserving muscle structure and metabolic function in both aging and disease. HECTD1 / Hectd1 expression is altered in muscle disorders. To identify differentially expressed genes in situations where skeletal muscle structure/function is disrupted, we curated and analyzed publicly available RNA-sequencing data from human and mouse skeletal muscle in instances of myopathy or muscle atrophy ( Fig. 1a,b ). This analysis identified 498 and 16 genes in common for myopathy and muscle atrophy conditions, respectively. Among these, we observed the expected changes in expression of several atrogenes 7-9 known to be associated with the different disorders ( Supplementary Fig. 1a ). For example, muscle atrophy samples showed increased levels of Fbxo30/Musa-1 4 , Fbxo32/Atrogin 3 , and Trim63/Murf-1 2 , E3 ubiquitin ligases with well-established roles in muscle mass loss. Conversely, myopathy samples showed increased levels of transcripts involved in extracellular matrix remodeling 10,11 . All samples showed reduced levels of transcripts related to mitochondrial function and energy production 12 . Surprisingly, HECTD1 / Hectd1 was the only gene found to be differentially expressed in all analyzed samples ( Fig. 1a,b,c ). HECTD1 belongs to the HECT family of E3 Ubiquitin ligases 13 and was initially identified as necessary for neural tube closure during embryonic development 14,15 . Interestingly, the changes in HECTD1 / Hectd1 mRNA partitioned perfectly into atrophy and myopathy groups, its levels increasing in the former but decreasing in the latter ( Fig. 1d ). Analysis of Hectd1 expression in a comprehensive panel of mouse tissues revealed that it is ubiquitously expressed, although with highest expression in skeletal muscle ( Fig. 1e ). Querying the single nucleus RNA-seq Myoatlas database 16 revealed that the largest proportion of Hectd1 transcripts comes from muscle fibers, but its expression appears in most other cell types within skeletal muscle ( Supplementary Fig. 1b,c) . Immunoblot analysis of protein extracts from mouse tissues confirmed the ubiquitous expression of HECTD1, which could be seen in all analyzed tissues (except kidney) as a band with the predicted molecular weight of 290 kDa ( Fig. 1f ). In the same immunoblot several other bands could be seen, which could represent products of alternative splicing or proteins non-specifically recognized by the antibody. In agreement with the RNA-seq analyses, Hectd1 expression in mouse muscle increased during atrophy and an acute eccentric exercise bout and decreased with muscle injury and regeneration ( Fig. 2a,b,c ). In an in vitro model of dexamethasone-induced muscle atrophy, we could see a similar and transient increase in Hectd1 in primary myotubes ( Fig. 2d,e ). Reducing Hectd1 expression in vitro decreases sarcomere structure-related proteins To explore the role of Hectd1 in vitro , we silenced its expression in C2C12 myoblasts differentiated into myotubes. Using qRT-PCR we determined that although Hectd1 expression increased during myotube differentiation, it was efficiently silenced upon knockdown ( Fig. 2f ). Under the same conditions, we also followed the expression of a select number of genes relevant to muscle function. Hectd1 knockdown led to gene expression changes in pathways involved in calcium handling, muscle differentiation, protein turnover, and muscle size and structure ( Supplementary Fig. 2a,b,c,d ). Interestingly, we also observed a reduction in the expression of genes related to energy metabolism and mitochondrial function, such as Glut4 ( Slc2a4 ) and PGC-1a ( Ppargc1a ) ( Supplementary Fig. 2e ). Several major myopathy-causative genes were affected by the reduction in Hectd1 levels ( Fig. 2f) . Among these were collagen alpha-1(VI) chain ( Col6a1 ) 17 , calpain 3 ( Capn3 ) 18 , dystrophin ( Dmd ) 19 , dm1 protein kinase ( Dmpk ) 20 , emerin ( Emd ), four and a half lim domains 1 ( Fhl1 ) 21 , nebulin ( Neb ), and tropomyosin 3 ( Tpm3 ) 22 . As E3 ubiquitin ligases are well-known for controlling protein degradation, we complemented the gene expression analysis with mass spectrometry-based proteomics analysis of cell extracts prepared on the first day of differentiation ( i.e., 48 h after Hectd1 silencing). Pathway analysis of proteins differentially detected in the Hectd1 knockdown cell extracts vs scrambled siRNA controls highlighted, in line with HECTD1’s previously described function, an increase in processes related to the regulation of cell shape 23 , motility 24 , and organelle organization ( Fig. 3a and Supplementary Fig. 3a ) and a robust decrease in processes related to muscle structure and contraction ( Fig. 3b and Supplementary Fig. 3b ). The latter observation was somewhat surprising as most muscle E3 ligases are linked to target protein degradation. However, further network analysis of the proteomics data using STRING 25 confirmed a significantly decreased abundance of a large cluster of proteins related to sarcomere structure ( Fig. 3c , in light blue). This cluster of 30 proteins included, among others, several forms of Tropomyosin (TPM1 and TPM2), several forms of Troponin (TNNC1, TNNC2, TNNT2, TNNT3, with TNNT1 being the only increased protein in the cluster), Titin (TTN), alpha-actin-1 (ACTA1), several forms of Myosin heavy and light chains (MYH3, MYH6, MYH13, MYL6B, MYL1), and Nebulin (NEB) 1 . HECTD1 is the E3 ubiquitin ligase for KLHL40/41 and Nebulin Interestingly, the cluster containing HECTD1 in the STRING analysis was connected to the decreased sarcomere structure components through Kelch-like family member 41 (KLHL41), which was also reduced upon Hectd1 knockdown. KLHL41 and KLHL40 are molecular chaperones that share 51% identity and 72% similarity and are stabilized and activated by ubiquitylation. KLHL40/41 activation helps stabilize NEB 26 and Leiomodin 3 (LMOD3) 27 , which are fundamental for sarcomeric integrity 28,29 . Loss-of-function mutations in either of these 4 proteins have been implicated in nemaline myopathy 22 . One of the disease mechanisms that result in nemaline myopathy is caused by mutations that prevent the activation of KLHL40/41 through ubiquitylation by an E3 ubiquitin ligase that has remained unknown. This leads to the destabilization and aggregation of NEB, an 800 kDa protein that anchors the sarcomere thin filament into the Z-disc 30 . Because of its fundamental role in thin filament assembly and integrity, mechanisms that destabilize NEB cause sarcomere disorganization and muscle weakness ( Fig. 3d ). To investigate if HECTD1 is the E3 ligase for KLHL40/41, we ectopically expressed wild-type (wt) Hectd1 or a catalytically inactive mutant (mut) 31 , together with Klhl41 in BOSC23 cells. Immunoblotting analysis of the different proteins showed that indeed wt HECTD1 was able to stabilize KLHL41, whereas the catalytically inactive mut was not ( Fig. 3e ). Using similar experimental conditions and co-expressing a Myc-tagged version of ubiquitin (Ub-Myc), we determined that the ubiquitylation levels of KLHL41 are increased in the presence of wt but not mut HECTD1 ( Fig. 3f ). To evaluate if HECTD1-mediated KLHL41 ubiquitylation resulted in NEB stabilization, we repeated the experiments, co-expressing a NEB fragment previously shown to be stabilized by KLHL41, thus bypassing the challenge in over-expressing such a large protein 26 . Surprisingly, HECTD1 wt was sufficient to stabilize the NEB fragment, although this effect was even more pronounced in the presence of KLHL41 ( Fig. 3g ). In this case, we could also observe an effect of mut HECTD1 on NEB fragment stabilization, albeit to a much lesser extent than in the presence of the wt protein ( Fig. 3g ). Similar results were obtained for KLHL40 ( Supplementary Fig. 3c,d,e,f,g ) with the notable difference that KLHL40 was still stabilized by mut HECTD1 (suggesting E3 ligase redundancy in this case). Skeletal muscle-specific Hectd1 knockout mice show muscle weakness and signs of ongoing tissue remodeling To further evaluate the consequences of losing Hectd1 expression in skeletal muscle, we generated a skeletal muscle-specific Hectd1 knockout mouse ( Hectd1 mKO) ( Fig. 4a ). With this strategy, deletion of Hectd1 exon 3 results in a premature stop codon after amino acid 50 of 2618, and the complete absence of the full-length protein in skeletal muscle ( Fig. 4b and Supplementary Fig. 4a ) with a slight reduction in brown adipose tissue, liver and heart ( Fig. 4c ) most likely due to known “leakage” of the human skeletal a-actin (HSA) promoter cassette. According to gnomAD, HECTD1 heterozygous loss-of-function variants are not tolerated (pLI score: 1, LOEUF score: 0.265), and missense mutations have intolerance to variation (Z-Score: 6.43). In line with these predictions, the whole-body knockout of Hectd1 is embryonic lethal 32 , but some phenotypic data are available at the International Mouse Phenotyping Consortium (IMPC) for heterozygous mice carrying only one Hectd1 null allele ( Supplementary Fig. 4b ), which show significant changes in circulating calcium and alkaline phosphatase levels as well as immune cells 33 . Searching for potential Hectd1 -associated phenotypes from eQTL studies shows a higher association to traits connected to the nervous system in line with its described role in neural tube morphogenesis and nervous system development ( Supplementary Fig. 4c ). Morphometric analysis of 4-month-old Hectd1 mKO mice revealed no differences in body mass or composition determined by MRI in both males and females when compared with littermate controls ( Fig. 4d,e ). Despite this observation, both male and female Hectd1 mKOs performed worse than controls in a grip strength test, which was indicative of developing muscle weakness ( Fig. 4f ). When determining the mass of different muscles, we detected differences in the M. gastrocnemius (GA) and the M. soleus (SOL), which were heavier in the Hectd1 mKOs, compared to controls ( Fig. 4g ). No differences were seen for the M. extensor digitorum longus (EDL) and M. tibialis anterior (TA). To evaluate if the differences in grip strength and muscle size were reflective of differences in fiber type composition, we determined the expression of myosin heavy chain (MyHC) genes type I (MyHCI), type IIa (MyHCIIa), type IIb (MyHCIIb), and type IIx (MyHCIIx). In EDL and SOL, examples of fast glycolytic and slow oxidative muscles, respectively, the observed pattern of MyHC gene expression was indicative of a shift towards weaker, more oxidative fibers ( i.e. , increased MyHCI in both EDL and SOL) as well as higher expression of embryonic MyHC (eMyHC) and Myogenin ( Myog ) indicative of ongoing tissue regeneration ( Fig. 4h ) 34,35 . Similar but statistically less significant trends were observed in TA and GA muscles ( Supplementary Fig. 4d ). The development of muscle weakness in the Hectd1 mKOs was progressive as we could not see statistically significant differences in ex vivo muscle contractility in 8-week-old animals ( Fig. 4i and Supplementary Fig. 4e ), except for a faster recovery from fatigue for the Hectd1 mKO SOL ( Fig. 4i ). Additionally, even though these different molecular signatures were already altered in 4-month-old Hectd1 mKOs, those animals did not display differences in exercise performance measured by running to exhaustion either due to compensation from the slower oxidative MyHCs, the fact that not all the muscles are affected equally, or the relatively young age ( Supplementary Fig. 4f ). Taken together these data indicate that Hectd1 mKO mice suffer from progressive muscle weakness with hallmarks of ongoing tissue regeneration. Transcriptomics and proteomics analysis of Hectd1 mKO muscle reveal multiple molecular marks of myopathy with mitochondrial dysfunction Different muscle beds seem to respond differently to the absence of Hectd1 expression. We have evaluated gene expression of a few selected genes connected to major skeletal muscle processes such as structure, calcium handling, mitochondrial metabolism, and protein turnover ( Supplementary Fig. 4g ). Among the analyzed muscle beds, SOL from Hectd1 mKOs showed the largest shift in gene expression (including MyHCs), when compared to controls. To further explore the molecular changes behind the observed Hectd1 mKO phenotype, we performed global analysis of gene expression by RNA-seq using the SOL muscle ( Fig. 5a ). Comparing differentially expressed genes (DEGs) between Hectd1 mKO and wt littermate controls we obtained 1,236 genes with higher and 1,182 genes with lower expression ( Fig. 5b ). Prediction of upstream transcription factors (TFs) that potentially regulate the genes with lower expression were mostly related to energy metabolism, highlighting several well-known regulators of cellular bioenergetics 12 such as Yin-Yang 1 (YY1), Estrogen-related Receptor (ERR), Estrogen Receptor (ER), and Thyroid Hormone Receptor (TR) ( Fig. 5c ). Conversely, genes with higher expression in Hectd1 mKO muscle were predicted to be under the control of TFs related to muscle differentiation 36 and remodeling, including Myogenin (MYOG), Myogenic Differentiation 1 (MYOD), Paired Box (PAX) and Mothers Against Decapentaplegic Homolog (SMAD) ( Fig. 5d ). Pathway analysis across several knowledgebases highlighted multifaceted effects of Hectd1 knockout. Disease-Gene associations (DisGeNET) 37 showed that DEGs regulated by Hectd1 are related to several myopathies and mitochondriopathies ( Fig. 5e ). Wikipathways 38 and Reactome 39 pathway databases highlighted an upregulation of pathways connected to extracellular matrix, cytoskeletal remodeling and adhesion, whereas DEGs with reduced expression in Hectd1 mKO muscle were again indicative of mitochondrial dysfunction and energy metabolism ( Supplementary Fig. 5a,b ). Comparing DEG signatures from Hectd1 mKO muscles to previously analyzed public datasets showed the greatest concordance with denervation in line with our previous observation, since it manifests with both atrophy and hallmarks of regeneration like centrally nucleated fibers ( Supplementary Fig. 5c ). As for the in vitro studies, we performed proteomics analysis of Hectd1 mKO SOL and EDL vs controls ( Fig. 5f,g,h ). From the comparisons, we detected 462 and 166 more abundant proteins compared to 345 and 33 less abundant proteins in Hectd1 mKO SOL and EDL extracts vs the corresponding controls, respectively ( Fig. 5g,h ). Performing pathway analysis with the list of proteins differentially detected only in the Hectd1 mKO SOL vs wt showed changes primarily related to bioenergetics, whereas the proteins in common between SOL and EDL grouped under protein refolding ( Fig. 5i) . No differentially regulated pathways were identified from proteins unique to the EDL, probably due to their low number. As HECTD1 is an E3 ubiquitin ligase, we were interested in determining which changes in protein levels could be explained by changes in the corresponding transcripts, and which changes in protein stability could be directly dependent on its enzymatic activity. To this end, we compared the SOL transcriptomics and proteomics data and found 332 IDs in common between both sets, with high concordance where 303 were co-regulated ( i.e. , either increased or decreased in both omics analysis) and only 29 contra-regulated ( Fig. 5j,k ). These genes/proteins grouped in pathways of energy metabolism connected mostly to mitochondria, with a small contribution from protein folding ( Supplementary Fig. 5d ). Interestingly, 455 proteins in the proteomics analysis did not have a corresponding DEG in the transcriptomics data ( Fig. 5j ). Here we could find a small contribution from pathways of energy metabolism as well, but a higher proportion of proteasomal degradation, protein stability, and translation ( Fig. 5j and Supplementary Fig. 5d ). Hectd1 mKOs are glucose-intolerant and show progressive loss of muscle strength and exercise performance Due to the repeated and strong indication of mitochondrial dysfunction, we decided to further investigate this feature of the Hectd1 mKO phenotype. In addition to the transcriptomics and proteomics data showing a reduction in mitochondrially-encoded genes and proteins, we performed immunoblotting using antibodies for the different electron transport chain (ETC) complexes, which also showed a robust decrease in all analyzed components ( Fig. 6a,b ). The changes in mitochondrial RNA processing and transport in RNA-seq data ( Supplementary Fig. 5e,f ) prompted us to determine the protein levels for some of the key components, and we could see a decrease in expression for Leucine Rich Pentatricopeptide Repeat Containing (LRPPRC), mitochondrial Lon Peptidase 1 (LONP1), Translocase Of Outer Mitochondrial Membrane 20 (TOMM20), and Voltage Dependent Anion Channel 1 (VDAC1) without changes in Heat Shock Protein 60 (HSP60) or Transcription Factor A, Mitochondrial (TFAM) ( Fig. 6c,d ). We did not observe differences in mitochondrial DNA content ( Supplementary Fig. 5g,h ), probably due to the compensatory elevation in the expression of RNA Polymerase Mitochondrial (POLRMT) ( Supplementary Fig. 5f ). This decrease in mitochondrial ETC components could also be seen using skeletal muscle sections of Hectd1 mKOs, measured by the activity of mitochondrial complexes I and II ( Fig. 6e,f ). In accordance with these data, an intraperitoneal glucose tolerance test showed that indeed Hectd1 mKOs are significantly less glucose tolerant than littermate controls at the age of 4 months, even when on a chow diet ( Fig. 6g,h ). Because of the seemingly progressive nature of the Hectd1 mKO, we evaluated a cohort of 1-year-old mice for their muscle strength and endurance performance. At this age, grip strength was even more drastically reduced ( Fig. 6i ) and exercise performance was now significantly impaired in the mKOs ( Fig. 6j ), but still no differences in body mass or composition were observed ( Supplementary Fig. 6a ). Histopathology analysis of Hectd1 mKO muscle shows myofibrillar disorganization and subsarcolemmal accumulation of desmin Electron microscopy analysis of Hectd1 mKO SOL sections at 6 months of age revealed a heterogeneous phenotype among the muscle fibers, with profound sarcomere disruption in some fibers but conserved structure in others ( Fig. 6k ). However, alterations in mitochondrial structure were apparent and seen throughout the sections. In addition, we could see many vacuoles adjacent to mitochondria and sarcomeres ( Fig. 6k ). At one year, the muscle histopathological features were more evident and showed a unique histological phenotype of a “desmin storage myopathy” in Hectd1 mKO mice ( Fig. 6l ). This is witnessed by the accumulation of subsarcolemmal material in several muscle fibers, with a pale blue or hyaline appearance on trichrome sections. The identified storage material strongly reacted to desmin and to a lesser extent to desmin-related protein alpha-crystallin B chain, while failing to react to dystrophin-C, myotilin, and alpha-actinin. Most of the fibers had a lobulated appearance of their sarcoplasm, highlighted by the NADH-NTB stain, indicating disorganization of the myofibrillar network. Furthermore, there was increased subsarcolemmal mitochondrial content on light microscopy and EM, and accumulation of structurally abnormal mitochondria on EM indicating mitochondrial dysfunction ( Fig. 6l ). Identification of a family with a HECTD1 variant associated with muscle weakness. To learn if HECTD1 might be responsible for muscle disease in humans we interrogated the exome data of 1,150 undiagnosed patients with unexplained muscle disease 40 for variants in the HECTD1 gene. Standard filtering criteria for rare diseases were applied, both for a recessive and a dominant mode of inheritance, namely moderate to high Variant Effect Predictor (VEP) and minor allele frequency (MAF) 0% or up to 1% in the control population, respectively. No patients with rare recessive (either homozygous or compound heterozygous) variants were identified in the unsolved cohort. However, a novel heterozygous HECTD1 variant was found in a family with two affected individuals (over two generations). The variant (hg38:chr14:31136628G>A) results in a non-synonymous amino acid change at position 1006 (A1006V) and is predicted to be deleterious with a Combined Annotation Dependent Depletion 41 score of 28 ( i.e., amongst the top 0.16% most deleterious variants in the genome), a SIFT 42 score of 0 (deleterious) and a PolyPhen 43 score of 0.722 (possibly damaging). It is absent from +152,000 control alleles of gnomAD (https://gnomad.broadinstitute.org) and 37,430 internal controls, both in the homozygous and heterozygous state. The HECTD1-A1006V carriers were a father and son, with no further family history of muscle disease. Both patients showed significantly elevated creatine kinase levels, but only the father showed additional clinical symptoms. These included distal and proximal muscle weakness and signs of neuropathic changes determined by electromyogram. Human iPSC-derived myotubes engineered with the HECTD1 31136628G>A substitution show deficits in sarcomere structure and bioenergetic pathways The HECTD1-A1006V substitution is not predicted to lead to a complete loss of function. This would also not be expected due to the predicted embryonic lethality of a complete lack of HECTD1. To investigate the consequences of the HECTD1-A1006V variant for muscle cell function, we engineered human iPSCs from a healthy donor to carry the heterozygous 31136628G>A substitution. Mutant and isogenic control cell lines were differentiated to myoblasts, and then to myotubes 44 . We observed no differences in the differentiation potential of either line, or any other apparent morphological differences ( Fig. 7a ). In addition, HECTD1 transcript and protein levels were similar between both lines ( Fig. 7b,c) . However, RNA-sequencing analysis of gene expression comparing the DEGs between HECTD1-A1006V mutant and control myotubes revealed 548 genes with higher and 430 genes with lower expression ( Fig. 7d,e ). Performing pathway analysis using genes with lower expression in the mutant cell line highlighted clear signatures of myopathy, muscle weakness and neuropathy ( Fig. 7f ), and molecular pathways related to muscle contraction and translation ( Fig. 7g) . Mirroring what we saw in the Hectd1 mKO muscle transcriptomics and myotube Hectd1 knockdown proteomics data sets, we identified a cluster of muscle contraction-related genes showing significantly lower expression in the HECTD1-A1006V line (vs the isogenic control), which included several thin filament components, and desmin ( Fig. 7h,i ). In contrast, signatures of metabolic dysfunction were comparatively modest relative to Hectd1 mKO muscle, but nonetheless evident, including reduced expression of several ETC components and other metabolic enzymes, as well as lowered mitochondrial DNA transcription ( Supplementary Fig. 6b ). Among the upregulated genes, the dominant molecular signature reflected extracellular matrix remodeling and altered calcium signaling ( Supplementary Fig. 6c,d,e ). These data show that the heterozygous HECTD1-A1006V mutation is sufficient to elicit some of the changes observed in our other loss-of-function in vitro and in vivo models. Together, this work positions HECTD1 at the intersection between sarcomere maintenance and stability and mitochondrial function and opens avenues for therapeutic exploration aimed at preserving muscle structure and metabolic function in both aging and disease. Discussion Pathological states in which sarcomere structure or function is disrupted can provide valuable windows into the machinery required for its maintenance. We therefore reasoned that examining changes in gene expression across different species and muscle diseases could reveal factors that are essential under normal conditions but difficult to identify in an unperturbed system. This strategy led us to HECTD1, whose loss unmasks a previously unrecognized requirement for this E3 ligase in sustaining thin-filament stability, sarcomere organization, and mitochondrial function. We show that HECTD1 is needed for thin-filament assembly as it is required to stabilize several regulatory and structural sarcomere components including KLHL40/41, nebulin, and desmin. Although we identified the HECTD1 gene as downregulated in different myopathy muscle samples, its expression is increased in conditions of muscle atrophy. Several E3 ligases such as MAFbx/ATROGIN1/FBXO32 3 , MURF1/TRIM63 2 , MUSA1/FBXO30 4 , SMART/FBXO21 45 are known to be increased during muscle atrophy, where they target different sarcomeric components for degradation. Conversely, E3 ligases such as UBR4 and UBR5 promote muscle hypertrophy through involvement of the HAT1/RBBP4/RBBP7 histone-binding complex 5 , and Hedgehog signaling 46 , respectively. Although we cannot rule out that HECTD1-mediated ubiquitylation targets some muscle proteins directly for degradation, our findings show that it is critical for sarcomere assembly and maintenance, where it takes on the role of a molecular chaperone. The paradoxical increase in Hectd1 expression during muscle atrophy could therefore be a compensatory mechanism or part of a dynamic interplay between sarcomere assembly and disassembly, which during atrophy tips towards the latter. Interestingly, it has been reported that desmin levels increase during some cases of muscle atrophy, which is hypothesized to be a compensatory mechanism to support the electromechanical properties of wasting fibers 47 . There is limited information about what happens to KLHL40/41 and NEB during muscle atrophy. Interestingly, whereas mutations that prevent activation of KLHL40/41 - NEB are not often studied for their effects on muscle bioenergetic defects, we observe ample evidence of mitochondrial dysfunction in our in vitro and in vivo models of Hectd1 silencing/knockout. Since mutations in desmin cause both structural abnormalities and mitochondrial dysfunction 6 , this could be a consequence of the breakdown of the desmin filament network, which links the contractile myofibrils to the sarcolemma and cellular organelles. Evidence of mitochondrial dysfunction appears in both our transcriptomics and proteomics data sets obtained with loss of Hectd1 function, suggesting that HECTD1 does not directly control the stability of metabolic components. However, its absence may affect the activity of an upstream transcription factor necessary to maintain mitochondrial homeostasis. Our analysis of putative upstream regulators that could be responsible for a reduction in gene expression upon Hectd1 deletion indeed highlighted YY1, ER, ERRα, and TR (among others), all known positive regulators of mitochondrial function 48–51 . Conversely, predicted upstream regulators for genes with increased expression upon Hectd1 knockout include MYOG, MYOD, and PAX transcription factors, clearly indicative of an ongoing muscle regeneration process 52 . This molecular signature of unresolved muscle remodeling is further supported by the increase in embryonic myosin heavy chain expression we see in Hectd1 mKO muscles. Considering the conservation of many of the sarcomere components regulated by HECTD1 between skeletal muscle and the heart, where Hectd1 is also expressed, it is tempting to speculate that this E3 ligase may also play a role in heart disease. Indeed, polymorphisms predicted to affect Hectd1 splicing have been correlated with the incidence of congenital heart disease, although this has not been experimentally tested 53 . In addition to its reported links to neurological disease, our work uncovers Hectd1 as a potential common target in skeletal muscle, heart, and brain disease. As complete loss of Hectd1 function is not compatible with life, we endeavored to identify families affected by myopathy without a genetic diagnostic carrying HECTD1 mutations. Remarkably, modeling the identified patient mutation in human iPCS-derived myotubes revealed a significant overlap with the pathways we found to be dysregulated in the C2C12 knockdown and in the Hectd1 mKO experiments. Based on available domain annotations, HECTD1 A1006 resides in the inter-module linker between the ankyrin repeat region (~ aa 366–457) and the C-terminal SUN/MIB2 domain (~ aa 1107–1240). Although not within the catalytic HECT domain (~ aa 2131–2608), this region likely contributes to substrate/adaptor binding or domain orientation. Therefore, the A1006V mutation plausibly disrupts the structural scaffold required for HECTD1 to recruit or stabilize client proteins. Further work focusing on HECTD1 coding mutations, SNPs in gene regulatory regions, or mechanisms of stimulus- and age-dependent loss of gene expression will further highlight HECTD1 as a novel controller of sarcomere integrity and mitochondrial function in skeletal muscle. Given the conservation of several of the affected molecular components in several cell types (e.g. desmin, and mitochondrial ETC components), HECTD1 may play similar roles in other organs. Methods Publicly available datasets Data for Hectd1 expression in different animal models and human cohorts were collected from the following studies deposited on GEO database: GSE103608 (Collagen VI-related muscular dystrophy, Control vs Pooled Col6RD), GSE120642 (Critical limb ischemia, Healthy adult vs Critical limb ischemia), GSE169571 (Intraperitoneal dexamethasone injection, Pooled wt saline vs pooled wt dexamethasone), GSE115650 (Facioscapulohumeral muscular dystrophy, Control vs FSHD), GSE202745 (Limb-girdle muscular dystrophy, M. vastus lateralis , Control vs Disease), GSE145480 (Aging in rodents as models of human sarcopenia, 8 month vs 28 month), GSE201255 (Myotonic dystrophy type 1 (DM1), Adult Controls vs adult onset DM1), GSE139213 (Skeletal muscle Tsc1 knockout mice, Tsc1 fl/fl vehicle vs Tsc1 mKO vehicle), GSE237099 (Analysis of skeletal muscle gene expression upon mouse hindlimb unloading and reloading, Control vs Hindlimb unloading), GSE114820 (Cancer-Cachexia in Tumor-Bearing Mice, PBS Control vs LLC 4 weeks), GSE151757 (Inclusion body myositis, AMP vs IBM), SRP196460 (Denervation, 0 days vs 14 days), GSE147127 (Myofiber single-nucleus RNA-seq, 5 month M. soleus and 5 month M. tibialis anterior ). Publicly available datasets were downloaded and converted to fastq files using SRA Toolkit (NCBI). Analysis of gene expression using quantitative real-time PCR (qRT-PCR) Tissues samples for skeletal muscle and heart were first pulverized using a dry ice-cold mortar and pestle. Total RNA was extracted from cell cultures and frozen tissue using TRI reagent (Sigma-Aldrich) per manufacturer's instructions. Subsequently 1 μg of RNA was treated with Amplification Grade DNAse I (Thermo Scientific) and 500 ng of DNase-treated RNA was used to prepare cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qRT-PCR using SYBR Green and primer pairs specific to each target transcript was performed on a ViiA7 and QuantStudio6 real-time PCR system (Applied Biosystems). Gene expression was calculated following the delta-delta Ct method and normalized to the expression of hypoxanthine phosphoribosyltransferase ( Hprt ) as a housekeeping gene for cell culture samples and geometric mean of Hprt and TATA-binding protein ( Tbp ) as a housekeeping gene for tissue samples. Western Blot Cell cultures and frozen tissues were homogenized directly in SDS protein lysis buffer (125 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol) and sonicated on Soniprep 150 (MSE). Protein lysates were quantified using the Pierce BCA Protein Assay Kit (Thermo Scientific) according to the manufacturer’s instructions. After adding 5% b-mercaptoethanol and 0.004% bromophenol blue samples were boiled at 70 °C for 15 min. Protein extracts were resolved by SDS polyacrylamide gel electrophoresis and transferred into polyvinylidene difluoride membranes. Membranes were blocked with 5% skim milk and incubated with antibodies against: HECTD1 (Abcam ab101992), FLAG M2 (Sigma-Aldrich F1804), FLAG M2 Affinity Gel (Sigma-Aldrich A2220), C-MYC (Sigma-Aldrich C3956), HA (Biolegend 901501), ERK1/2 (CST 9101), p-ERK1/2 T202/Y204 (CST 9102), AKT (CST 9272), p-AKT S473 (CST 4058), alpha-tubulin (Sigma-Aldrich T6199), OXPHOS mitoprofile (Abcam ab110413), COXIV (Invitrogen A21348), HSC70 (Santa Cruz sc-7298), LRPPC (Sigma HPA036409), LONP1 (Invitrogen PA5-51692), TOMM20 (Santa Cruz sc-17764), VDAC1 (Abcam ab14734), mtHSP60 (Enzo Lifesciences AB1-SPA-807-E), TFAM (Abcam ab-131607). Western blot band densitometry was performed using ImageLab software (BioRad) with volumetric analysis and normalized to membrane stained with amido black 10B as loading control. Hindlimb unloading and reloading This protocol was modified from previous studies 54 . 10 to 12-week-old male C57BL/6J mice or 8-week-old female mice were assigned to three main groups: control, hindlimb unloading or hindlimb reloading. For the hindlimb unloading phase, mice were slightly suspended by tail for the specified number of days, maximum 10. Briefly, mice were placed inside a restrainer and, using hypoallergenic medical tape, a nylon line was attached in a helical pattern around the base of the tail. The line was connected to a small swivel keychain with metal rings that were attached to a rod running the length of the cage (GR900, Tecniplast). The hindlimbs were kept off the ground with the mouse’s body at an approximately 30° angle. Mice were able to move freely on the y-axis, rotate 360° using their forelegs, and had access to one side of the cage with food and water ad libitum . Mice were housed in pairs during the unloading phase. The reloading phase commenced after 10 days of hindlimb unloading, where the animals were returned to normal ambulation in conventional cages for the specified number of days. Control mice were kept in conventional cages throughout the entire protocol. Downhill running To induce microtrauma to limb muscle sarcomeres, adult mice were subjected to an acute bout of downhill running as previously described 55 . Briefly, following a four-day familiarization period, animals ran for 5 min at 6 m/min, followed by 55 min at 17 m/min on a 15º downhill slope. Hindlimb muscles were harvested and snap frozen in liquid nitrogen immediately (0 h), or 8 h, 24 h, 72 h, and 144 h after the acute bout. Muscles were subsequently processed for RNA extraction and qRT-qPCR as described above. BaCl 2 injections To induce muscle injury (myonecrosis), mice were intramuscularly injected with barium chloride (BaCl 2 ; 1.2% in saline). Prior to the procedure, mice were given a subcutaneous injection of 0.05 - 0.1 mg/kg buprenorphine and placed under isoflurane anesthesia. Right gastrocnemius muscle of 8-week-old male C57BL/6J mice were injected with 50 μl of BaCl 2 and the contralateral gastrocnemius muscle was injected with an equivalent volume of control solution (saline). Mice were monitored and given postoperative pain relief for 1-2 days. The injected muscles were collected at the specified time points. Primary myoblast and myotube cultures, and dexamethasone treatments Mouse primary myoblasts were isolated, cultured and differentiated according to previously described methods 55 . Muscles of 2-week-old C57BL/6J mice were harvested from the fore- and hindlimbs, minced, and incubated with 2.4 U/ml dispase (Grade II, Roche), 1% collagenase B (Roche), and 2.5 mM CaCl 2 for 25 min at 37 °C. The cell suspension was homogenized by pipetting, filtered through a 70 μm cell strainer, centrifuged, resuspended in Ham’s F-10 Nutrient Mix (Gibco) supplemented with 20% fetal bovine serum (Sigma-Aldrich), 2.5 ng/ml basic fibroblast growth factor (Thermo-Fisher Scientific), 2.5 mg/ml fungizone (Thermo-Fisher Scientific), 5 mg/ml plasmocin (Invivogen) and 100 U/ml penicillin-streptomycin (Gibco), and plated in regular tissue culture dishes to remove contaminant fibroblasts. After 20 min, cells were transferred to collagen-coated tissue culture dishes. Pre-plating in regular culture dishes was performed at every passage until there was no fibroblast contamination. Cells were then maintained and expanded at low confluence in a 1:1 mixture of DMEM (Gibco) and Ham's F10 Nutrient Mix supplemented with 20% fetal bovine serum, 2.5 ng/ml basic fibroblast growth factor and 100 U/ml penicillin-streptomycin. To differentiate the myoblasts into myotubes, cells were seeded in growth medium at high confluence and switched to differentiation medium (DMEM with 5% horse serum and 100 U/ml penicillin-streptomycin) 16-24 hours later. Full differentiation of the myotubes was typically achieved 2-3 days after induction and was confirmed using light microscopy. Myoblasts were maintained, expanded, and differentiated in collagen-coated tissue culture dishes at 37 °C and 5% CO 2 . Fully differentiated myotubes were treated with Dexamethasone for the indicated periods of time at the different concentrations. C2C12 myotubes C2C12 cells were purchased from ATCC and grown at 37 °C and 5% CO 2 in DMEM, 10% FBS, and 100 U/ml penicillin streptomycin. To differentiate them into myotubes, cells were seeded in growth medium at high confluence and switched to differentiation medium (DMEM with 2% horse serum (Sigma-Aldrich) and 100 U/ml penicillin-streptomycin) 16-24 h later for 2-3 days. siRNA transfection C2C12 cells were transfected according to the following protocol. Combination of two control and Hectd1 siRNAs (Dharmacon) and Lipofectamine RNAiMAX (Invitrogen) were separately incubated in serum-free Optimem (Thermo-Fisher Scientific) for 8 min. Solutions were then mixed, resulting in a ratio of 50 nM total siRNA to 1 μl of Lipofectamine and incubated for 15 min at room temperature. The transfection mixture was added to the 6-well plate and mixed with a suspension of freshly trypsinized cells. C2C12 proteomics Proteolytic digestion Cell pellets were solubilized in 20 µl of 8 M urea in 50 mM Tris-HCl, pH 8.5 sonicated in water bath for 5 min before 10 µl of 1% ProteaseMAX surfactant (Promega) in 10% acetonitrile (ACN) and Tris-HCl as well as 1 µl of 100x protease inhibitor cocktail (Roche) was added. The samples were then sonicated using VibraCell probe (Sonics & Materials, Inc.) for 40 s with pulse 2-2 s (on/off) at 20% amplitude. Protein concentration was determined by BCA assay (Pierce) and a volume corresponding to 25 µg of protein of each sample was taken and supplemented with Tris-HCl buffer up to 90 µl. Proteins were reduced with 3.5 µl of 250 mM dithiothreitol in Tris-HCl buffer, incubated at 37 °C during 45 min and then alkylated with 5 µl of 500 mM iodoroacetamide at room temperature (RT) in dark for 30 min. Then 0.5 µg of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37 °C. The digestion was stopped with 5 µl cc. formic acid (FA), incubating the solutions at RT for 5 min. The sample was cleaned on a C18 Hypersep plate with 40 µl bed volume (Thermo Fisher Scientific), dried using a vacuum concentrator (Eppendorf). PRLC-MS/MS analysis The peptides in solvent A (0.1% FA in 2% ACN) were separated on a 50 cm long EASY-Spray C18 column (Thermo Fisher Scientific) connected to an Ultimate 3000 nano-HPLC (Thermo Fisher Scientific) using a gradient from 2-26% of solvent B (98% AcN, 0.1% FA) in 90 min and up to 95% of solvent B in 5 min at a flow rate of 300 nl/min. Mass spectra were acquired on a Orbitrap Fusion Lumos tribrid mass spectrometer (Thermo Fisher Scientific) ranging from m/z 375 to 1600 at a resolution of R=120,000 (at m/z 200) targeting 4x10 5 ions for maximum injection time of 50 ms, followed by data-dependent higher-energy collisional dissociation (HCD) fragmentations of precursor ions with a charge state 2+ to 6+, using 30 s dynamic exclusion. The tandem mass spectra of the top precursor ions were acquired in 2 s cycle time with a resolution of R=30,000, targeting 5x10 4 ions for maximum injection time of 54 ms, setting quadrupole isolation width to 0.7 Th and normalized collision energy to 28%. Data analysis The raw data files were loaded in Proteome Discoverer v2.4 and searched against mouse UniProt protein databases using the Mascot Server 2.5.1 search engine (Matrix Science Ltd.). Parameters were chosen as follows: up to two missed cleavage sites for trypsin, precursor mass tolerance 10 ppm, and 0.02 Da for the HCD fragment ions. Dynamic modifications of oxidation on methionine, deamidation of asparagine and glutamine and acetylation of N-termini were set. Protein annotation was also performed in Proteome Discoverer using the Gene Ontology database on the server of Thermo Scientific linked with biological processes, cellular localization and molecular function. Initial search results were filtered with 5% FDR using Percolator node in Proteome Discoverer. Quantification was based on the precursor ion intensities. For quantification both unique and razor peptides were requested. Additional bioinformatics analyses Upset plots were created with differentially expressed genes from publicly available data sets separated into mouse models of atrophy and human myopathy samples. Atrogene heatmap was created from curated list of atrogenes 7-9 in the following way. Atrogenes were sorted based on the number of datasets they are differentially expressed in and sum of fold-changes across these datasets. Top 80 genes are shown, clustered by Euclidean distance. Differentially regulated pathways from C2C12 Hectd1 knockdown myotubes were created using AmiGO with Gene Ontology databases and String network was created from proteins that had at least two neighboring nodes and minimum interaction score of 0.7 (high confidence). BOSC-23 cells BOSC-23 cells were grown at 37 °C and 5% CO 2 in DMEM (Thermo-Fisher Scientific), 10% fetal bovine serum (FBS) (Sigma-Aldrich), and 100 U/ml penicillin streptomycin (Thermo-Fisher Scientific). Plasmid constructs Tagged Klhl40 and Klhl41 plasmids were cloned from mouse soleus cDNA using Phusion High-Fidelity DNA Polymerase (Thermo-Scientific) into pcDNA3.1-Flag from following studies (REF PGC1) using NotI and XhoI sites with following primers: Klhl40 forward: 5’-AAAGCGGCCGCTACGCTGGGCTTGGAG-3’; Klhl40 reverse: 5’-GGGCGGGGCTCGAGTCACATCTTGGTCAG-3’; Klhl41 forward: 5’-AAAGCGGCCGCTGATTCCCAGCGGGAG-3’; Klhl41 reverse: 5’-GGGGGCTCGAGTCATAGTTTAGACAGTTTAAACAGATTTAAGC-3’. C-Myc tag primers with stop codon and overhangs (forward: 5’- TCGACGAACAAAAACTCATCTCAGAAGAGGATCTGGGTTCTTGAG-3’; reverse: 5’-GATCCTCAAGAACCCAGATCCTCTTCTGAGATGAGTTTTTGTTCG-3’) were annealed in annealing buffer (10 mM Tris, pH 7.5 - 8.0, 50 mM NaCl, 1 mM EDTA) by warming up the solution to 95 °C for 2 min and in the heat block, let to cool overnight and inserted into pCMV5 (Sigma-Aldrich) using SalI and BamHI sites. Tagged Neb-frag(5876-6073) was cloned from mouse soleus cDNA using Phusion High-Fidelity DNA Polymerase (Thermo-Scientific) into resulting pCMV5-Myc (Sigma-Aldrich) using EcoRI and SalI sites using following primers: forward: 5’-AAAAGAATTCATGAGAGCTTACTGGAACGCC-3’; reverse: 5’-AAAGTCGACGGTGAATTTGTCCTTTGACTTCTC-3’. HA-Hectd1 plasmids were kind gifts from Irene Zohn and ubiquitin plasmid was a kind gift from Nico Dantuma. Plasmid transfection BOSC-23 for direct western blot were seeded on 24-well plates and transfected 24 h after seeding using 1 mg/ml polyethyleneimine (Polysciences) in a stoichiometry of 2:1 (polyethyleneimine:DNA) according to the following protocol. Plasmid DNA and polyethyleneimine were equilibrated separately in serum-free DMEM for 20 min. Afterwards, the plasmid and polyethyleneimine solutions were combined and incubated for 30 min. Combined solution was added dropwise to the cells and incubated for 24 h before harvesting. Cells were transfected, as indicated, with the following amounts of each corresponding plasmid per well: 300 ng HA-Hectd1; 200 ng Flag-Klhl40/41; 100 ng Neb-(5876-6073)-Myc. For co-immunoprecipitation, cells were seeded on 10-cm dishes and transfected using CaCl 2 method according to the following protocol. Plasmid DNA was incubated with 310 mM CaCl 2 (Sigma-Aldrich) for 8 min and added dropwise into equal volume of 2xHBS pH 7.0 (50 mM HEPES, 280 mM NaCl, 1,5 mM Na 2 HPO 4 ) while vortexing. Solution was incubated for 15 minutes, added dropwise to cells, and incubated for 24 h before harvesting. Cells were transfected, as indicated, with following amounts of each corresponding plasmid per plate: 4 mg HA-Hectd1; 1 mg Flag-Klhl40/41; 2 mg Myc-Ubiquitin. Co-Immunoprecipitation for ubiquitylation Cells were lysed in cold lysis buffer (1% Triton X-100, 50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA), supplemented with protease inhibitors (Sigma-Aldrich), 10 mM deubiquitinase inhibitor N-Ethylmaleimide (Sigma-Aldrich), and 0.1 mM DTT. Lysate was collected after 20 min of lysis at 4 °C and cleared by centrifugation at 16.1 RCF for 10 min. Samples had either 15 µl of FLAG agarose beads (Sigma-Aldrich) added or incubated with respective antibodies for 30 min with 30 µl of G protein sepharose beads (GE healthcare) added afterwards. Both beads were equilibrated in the lysis buffer before being added to each sample. Samples were incubated on a carousel overnight, washed 3 times with lysis buffer, 50 µl of 2x Laemmli buffer (250 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 10% b-mercaptoethanol, 0.004% bromophenol blue) was added, samples were boiled at 70 °C for 15 min, and subjected to analysis by Western blotting. Animal models Mice were housed in groups of 3-5 per cage on a 12-h light/dark cycle, at approximately 22° C (GM500 cages, Tecniplast). Animals had access to water and standard rodent chow diet (Special Diets Services CRM-P) ad libitum . The Hectd1 mKO mice and their floxed littermates were generated in-house by breeding Hectd1 tm1c and HSA-Cre animals, while C57BL/6N mice were purchased from Janvier Labs and acclimated to the animal facility before use. All collected tissues were immediately frozen in liquid nitrogen and stored at –80 °C until analysis. All experiments were approved by the regional animal ethics committee of Northern Stockholm, Sweden. Sperm with Hectd1 tm1a(EUCOMM)Hmgu allele were purchased from IMPC, reanimated, and bred with Flp recombinase transgenic mice to generate Hectd1 tm1c animals at IMG (Institute of Molecular Genetics of the ASCR, Prague, Czech Republic). Primers for genotyping Hectd1 floxed allele were the following: forward, 5´-ATCCCCACATGGTGGAAGTA-3´; reverse, 5´- TCATCACTGGGCAAATACCA-3´. HSA-Cre transgenic mice (B6.Cg-Tg(ACTA1-cre)79Jme/J) were purchased from The Jackson Laboratory and were genotyped using following primers: forward 5´- CACGACCAAGTGACAGCAAT -3´; reverse, 5´- AGAGACGGAAATCCATCGCT -3´. MRI Body composition analysis was examined using Magnetic resonance imaging (MRI) on an EchoMRI platform. Grip Strength Limb grip strength was measured in 4-month-old male and female Hectd1 mKO mice for basal grip strength and 16-month-old male for Hectd1 mKO mice aged cohort with age-matched wild-type littermates, using a grip strength meter (Bioseb). Mice were held by their tails and allowed to grasp the bar of the device with their front paws or a grid with all four paws. They were pulled away from the device and force generated after release was recorded. This process was repeated 4 times for 2 consecutive days and average grip strength was calculated and normalized to their previously determined lean mass. Ex vivo analysis of muscle force and fatigability Skeletal muscle force-producing capacity, fatigue resistance and recovery capacity were measured for EDL and soleus muscles from 8-9-week-old male Hectd1 mKO and age-matched floxed littermates. Mice were placed under isoflurane anesthesia, cervically dislocated, soleus and EDL muscles were immediately removed, immersed in Tyrode solution (121 mM NaCl, 5 mM KCl, 1.8 mM CaCl 2 , 0.4 mM NaH 2 PO 4 , 0.5 mM MgCl 2 , 24 mM NaHCO 3 , 0.1 mM EDTA, and 5.5 mM glucose) and placed in a stimulation chamber with proximal and distal tendons attached to hooks. The chamber was maintained at 31 °C using a circulatory water bath, and the Tyrode solution’s pH was kept at 7.4 by continuous superfusion with carbogen (95% O2, 5% CO 2 ). The muscles were set to optimal length, and force-frequency relationships were determined by stimulating the muscles at different frequencies (1 Hz to 120 Hz for soleus and 1Hz to 150 Hz for EDL). Muscle-specific force (kN/m 2 ) was calculated using the muscle’s CSA, which was obtained by dividing muscle mass by the product of muscle length and density (1.06 g/cm 3 ). Fatigue resistance was evaluated by measuring tetanic force at 70 Hz stimulation with 600 ms duration and 2-s intervals for 100 contractions in the soleus or at 100 Hz with 300 ms duration and 2-s intervals for 50 contractions in the EDL. After the fatigue protocol, the muscles were allowed to recover for 10 min, and tetanic force was measured at 1, 2, 5, and 10 min to determine the recovery capacity. Running to exhaustion Mice were acclimated to a treadmill (Columbus Instruments) for four consecutive days, 10 min/day with speeds varying between 5 and 10 m/min. After the acclimation period, all animals were submitted to a graded treadmill exercise test on a 10° upward incline, starting at 6 m/min with increments of 3 m/min every 3 min, until the animal was unable keep up with the treadmill session due to exhaustion, defined as the moment when the mice refused to continue running even with encouragement. All exercise bouts were performed at the same time of the day. Global gene expression analysis by RNA-sequencing Total RNA was extracted from Hectd1 mKO mice M. soleus using TRI reagent (Sigma-Aldrich) as per the manufacturer's instructions. RNA was purified and treated with DNase using NucleoSpin RNA II columns (Machery Nagel) to remove any remaining DNA contaminants. RNA integrity was verified using an Agilent Bioanalyzer, with all samples showing RNA integrity number (RIN) greater than 8. Stranded mRNA Library Preparation Kit was used with a polyA-enrichment strategy to prepare the sequencing libraries. RNA-sequencing was performed at GATC Biotech (Konstanz, Germany) using Illumina NovaSeq 6000, generating 150-bp paired-end reads. Quality control of raw reads was performed using the FastQC tool kit (Babraham Bioinformatics). The reads were then aligned using STAR aligner 56 tool to the genomes of Mus musculus (GRCm38.p6) and Homo sapiens (GRCh38.p13) respectively (downloaded from NCBI). Reads aligning to gene exons were counted using featureCounts program from Subread package 57 . Out of these, lists of differentially expressed genes (DEGs) between groups as well as normalized read counts were obtained using the DESeq2 package 58 . Considering the study design, all genes showing p -value (adjusted by Benjamini-Hochberg method) < 0.1 for Hectd1 mKO M. soleus RNA-Seq and < 0.05 for other RNA-Seq datasets were further examined for the enrichment of functional processes. To identify differentially expressed pathways, gene list of DEGs were queried by clusterProfiler package 59 against Gene Ontology, Wikipathways, and DisGeNET databases using overrepresentation and GSEA analysis. Skeletal muscle proteomics Peptide preparation Frozen muscle segments were pulverized in liquid nitrogen and resuspended in LYSE buffer (PreOmics), heated at 95 °C for 5 min and sonicated in a water-bath sonicator (Diagenode) for 15 min. Protein concentration in the lysate was estimated based on tryptophan fluorescence (excitation 295 nm, emission 340 nm) compared to a standard curve. For each sample, 30 µg of protein lysate were digested with 1.5 µg of lysyl - endopeptidase C and 1.5 µg of trypsin at 37 °C overnight under continuous shaking. Peptides were desalted on StageTip plugs with 3 layers of styrenedivinylbenzene (SDB)-RPS, lyophilized and resuspended in 2% Acetonitrile and 0,1% TFA, pH 2. Mass spectrometry data acquisition Peptides were separated on a 50 cm column of ReproSil-Pur C18-AQ 1.9 μm resin (Dr. Maisch GmbH) packed in-house. The column was heated at 60 °C by a column oven. Liquid chromatography was carried out on an anEASY-nLC-1200 system coupled through a nanoelectrospray source to an Orbitrap Exploris mass spectrometer (Thermo Fisher Scientific). Peptides were loaded in buffer A applying a nonlinear 120-min gradient of 0–65% buffer B at a flow rate of 300 nl/min. The mass spectrometer was operated in data-independent acquisition (DIA) mode, consisting of one MS1 full scan (300–1,650 m/z range) acquired at a resolution of 120,000 with normalized automatic gain control (AGC) target set to 300 and 78 MS2 scans collected at a resolution of 15,000, an isolation window of 17.3 m/z and window overlap of 1. Cycle time was 3 s. HCD collision energy was set at 30%. Mass spectrometry data analysis DIA raw files were processed using Spectronaut (Biognosys), version 16.0.220606.53, using FASTA digest for library-free search. Mouse FASTA files were UP000000589_10090 from 2022 (21984 entries) and the corresponding additional file (41647 entries). Carbamidomethyl (C) was set as a fixed modification, and acetyl (protein N-term) and oxidations (M) were set as variable modifications. False discovery rate cutoff was set at 1% at precursor and protein levels. DNA isolation DNA was isolated from interphase of TRI reagent (Sigma-Aldrich) after RNA extraction per manufacturer’s instructions. Glucose tolerance test Glucose tolerance was evaluated in 16 to 20-week-old male and female Hectd1 mKO mice and age-matched wild-type littermates. Mice were fasted for 5 h, weighted, and injected intraperitoneally with a bolus of glucose (2 mg/kg) in PBS. Blood samples were obtained by tail bleeding before and 15, 30, 60 and 120 min after glucose administration using a OneTouch Accu-Check glucometer. Muscle histopathology Muscles were mounted on a cork support with tragacanth gum, frozen in liquid nitrogen-cooled isopentane, and 12 μm thick cross-sections were cut using a cryostat. The sections were transferred to Superfrost Plus Adhesion slides, with four non-consecutive sections used per sample. To evaluate mitochondrial complex activity, we incubated sections from the soleus muscle with freshly-prepared NADH-NTB solution (1.5 mM NADH, 1.5 mM NTB, 0.2 M Tris-HCl pH 7.4) for 15 min at 55 °C for Complex I activity or with freshly prepared SDH-NBT solution (0.2 M phosphate buffer pH 7.6, 170 mM succinic acid, 1.22 mM NTB for 30 min at 37 °C. for Complex II activity). Sections were washed with deionized water, dehydrated in graded ethanol, cleared in xylene, and mounted with Pertex mounting media (Histolab). Imaging was performed in a Zeiss Axio Imager and quantified in ImageJ by counting average intensity of at least 4 sections with subtracted background per animal. Fresh frozen muscle tissue from one-year old mice was processed at Mayo Clinic. Frozen mouse muscle samples were cut at 10 μm for histochemical and immunohistochemical staining following Mayo Clinic laboratory developed protocols. H&E sections were stained in Gill’s hematoxylin followed by bluing solution and run through successive Eosin Y and alcohol to differentiate and dehydrate. Trichrome sections were stained in Harris hematoxylin, rinsed in running distilled water, and incubated in modified Gomori’s trichrome solution consisting of chromotrope 2R, fast green, and phosphotungstic acid, then differentiated in sequential 0.2% acetic acid and dehydrated. NADH sections were incubated at 37 °C in working NADH solution consisting of β-Nicotinamide adenine dinucleotide, 0.9% sodium chloride, 2% nitrotetrazolium blue chloride, and triple distilled water, and mounted with glycerol gelatin. ATPase sections were preincubated in working solution consisting of sodium acetate, sodium barbital, and 0.1 N hydrochloric acid, and pH adjusted to 4.3. Sections were incubated at 37 °C in working solution of adenosine 5’ triphosphate, calcium chloride, and sodium barbital, followed by successive rinses with 1% calcium chloride, 2% cobaltous chloride, 0.1 M sodium barbital, rinsed in running distilled water, and precipitated with ammonium sulfide solution. Sections were dehydrated and mounted with canada balsam. Desmin (1:80, MilliporeSigma, Darmstadt, Germany, cat. #D1033), alpha-crystallin B chain (1:1000, Enzo Life Sciences, cat. #ADI-SPA-222-D), dystrophin C (1:100, Novocastra, Deer Park, IL, cat. #NCL-DYS2), myotilin (1:400, Novocastra, Deer Park, IL, cat. #NCL-MYOTILIN), NCAM (1:10, Cell Sciences, Newburyport, MA, cat. #MON9012-1), and alpha-actinin (1:400, MilliporeSigma, Darmstadt, Germany, cat. # A-7811). Immunohistochemistry was performed sequentially with the histochemistry stains. Desmin sections were fixed in 10% neutral buffered formalin and rinsed in 1X PBS buffer prior to staining. Alpha-crystallin B chain, dystrophin, myotilin, NCAM, and alpha-actinin were fixed in cold acetone. All sections were blocked in Normal Goat Serum (1:10, Jackson ImmunoResearch, West Grove, PA, USA, cat. #005-000-121) and incubated in each respective primary antibody overnight at 4 °C. Biotinylated Goat anti-Mouse (KLP-SeraCare, Milford, MA, cat. #5570-0006) was used as the secondary antibody, followed by Vectastain ABC (Vector Laboratories, Newark, CA, cat. #PK-6100), and stained with Dako DAB chromogen (Agilent, Santa Clara, CA, cat. #K346811-2). Slides were reviewed by E.N. (Muscle pathologist) and photos taken via an Olympus DP73 camera. Electron microscopy The dissected Hectd1 mKO soleus muscles were immersion fixed in 2.5% glutaraldehyde and 1% paraformaldehyde buffered in 0.1 M phosphate buffer pH 7.4 at RT for 1 h followed by storage at 4 °C. The fixed samples were rinsed in 0.1 M phosphate buffer followed by postfixation in 2% osmium tetroxide in 0.1 M phosphate buffer, pH 7.4 at 4 °C for 2 h. After stepwise dehydration in ethanol and acetone the samples were resin infiltrated and finally embedded in LX-112 (Ladd Research). Ultrathin sections (~80-100 nm) were prepared using an EM UC7 (Leica) and transferred onto formvar slot grids and contrasted with uranyl acetate followed by lead citrate. The grids were examined in a HT7700 transmission electron microscope (Hitachi High-Technologies,) at 80 kV and digital images were acquired using a 2kx2k Veleta CCD camera (Olympus Soft Imaging Solutions). Human induced pluripotent stem cells (hiPSCs) Initial experiments involving the generation and validation of the hiPSCs carrying the HECTD1-A1006V mutation were performed at the University of Pennsylvania iPSC Core (RRID:SCR_022426) and were approved by the University’s Embryonic Stem Cell Research Oversight Committee. Subsequent experiments for molecular analyses were performed at the University of Michigan and approved by the Human Pluripotent Stem Cell Research Oversight Committee (HPSCRO). The human iPSC line PENN123i-SV20 (also referred to as SV20 60 ) was used for CRISPR/Cas9-based gene editing. Parental and gene edited cell lines were cultured in StemMACS™ iPS-Brew XF medium (Miltenyi Biotec, 130–104-368) in Matrigel (Corning, 356231)-coated dishes as previously described 60 . All cell lines were routinely tested to be free of mycoplasma. CRISPR/Cas9 gene editing of hiPSCs To generate iPSC lines that carry the heterozygous 31136628G>A substitution, we transduced SV20 cells with the Cas9D10A nickase protein complexed with a set of two single guide RNAs (sgRNAs) targeting sequences close to the mutation site, and a single-stranded oligonucleotide (ssODN) homology-directed repair (HDR) template containing the base substitution 61 . The guide RNA sequences (gRNA#1: 5’-TTTCGGTTGGAACGTGCACC-3’ and gRNA#2: 5’-AGAGATTCAACTGTAGCCAA-3) were designed using the CRISPR Targets tool at https://genome.ucsc.edu/ and sgRNAs containing both crRNA and tracrRNA were synthesized by Synthego. ssODN 5’-CCAGAAACTCACCATTTTCAAAAGGTACTGTTCCAGAGATTCAACTGTAGCCAAAGGTTCCATCTTCAACATTCTGCCAGTCCTGTCAATCAATGCAGTTTCACCAGGTACACGTTCCAACCGAAATCGTAATCTCCTTGTAAGTATCTACACAAAAACG3’ was synthesized by IDTDNA (Alt-R TM HDR Donor Oligos). Ribonucleoprotein complexes (10.5 pmol Cas9D10A and 40 pmol sgRNA#1, 10.5 pmol Cas9D10A and 40 pmol sgRNA#2) were prepared and mixed with 100 pmol ssODN template and 200,000 single cell suspension in P3 Primary Cell Nucleofector solution (Lonza). Samples were subsequently electroporated in a 4D-nucleofector with X-unit (Lonza) using program CA-137. Transduced iPSCs were seeded onto Matrigel-coated 24-well plates in growth medium supplemented with CEPT cocktail (Fujifilm, 033-26071) to reduce cell death. After 24 h, cells were cultured in fresh growth medium without CEPT for another 2 days before replating as single cells at low density. Cells were fed every other day, and mature colonies were isolated and screened by PCR with the primer set 5’-AGGTGAAGCTTGCAGTGAAC-3’ and 5’-ATGCTTATTTCACCGTGCCC-3’. PCR products were digested with ssODN-origin restriction enzyme Afl III. Correctly edited heterozygous colonies were further confirmed by sanger sequencing alignment on SNAPGENE. iPSC clones resistant to Afl III digestion (unedited) were expanded as isogenic control cell lines. Heterozygous and isogenic lines were analyzed by G-banded karyotyping (Cell Line Genetics). All cell lines used in this study were confirmed to be of normal karyotype. Cultrex plate coating Cultrex RGF Basement Membrane Extract (R&D systems, 3433-010-01) was thawed on ice overnight upon receipt, aliquoted, and stored at –80 °C. Individual aliquots were thawed at 4 °C and diluted in ice-cold DMEM/F12 (Gibco, 11320033) to 0.1 mg/ml. Diluted Cultrex was added to plates (~1 ml per 7 cm 2 ) and incubated at 37 °C for at least 2 h before use, after which excess coating solution was removed by vacuum. Alternatively, coated plates containing the Cultrex coating solution were sealed with Parafilm and stored at 4 °C for up to 3 days; stored plates were equilibrated at 37 ⁰C for at least 1 h before use. Generation of skeletal muscle progenitor cells (SMPCs) from HECTD1-A1006V hiPSCs Myogenic differentiation of HECTD1-A1006V and isogenic control hiPSCs was performed in a two-step process as previously described 44 . First, Pax7 + skeletal muscle progenitor cells (SMPCs) were generated 62 followed by enrichment of ERBB3/NGFR positive cells 63 . HNK1 − /ERBB3 + /NGFR + cells were collected after 28 to 32 days of differentiation and cultured in Lonza skeletal muscle growth medium (Lonza SkGM2, CC-3245) supplemented with 20 ng/ml Fibroblast growth factor 2 (FGF2, R&D systems, BT-FGFB) on Cultrex RGF Basement Membrane Extract-coated plates with medium change every other day. When reaching 70–80% confluence (designated as passage 0), SMPCs were passaged, expanded and cryopreserved. Myotube differentiation from hiPSC-SMPCs hiPCS-SMPCs were expanded in skeletal muscle growth medium and passaged into 6-well plates (passage 2). When reaching confluence (~90%), cells were differentiated in N2-ITS differentiation medium: DMEM/F12 (Gibco, 11320033), 1% Insulin-Transferrin-Selenium (ITS-G, Gibco, 41400045), 1% N2 supplement (Gibco, 41400045), Penicilin-Streptomycin (Gibco, 15140122), 1% GlutaMAX™ (Gibco, 35050061), 10 µM TGF-b inhibitor SB-431542 (Selleck Chemicals, S1067), and 10 ng/ml IGF-1 (R&D Systems, BT-FGFB) for 3-4 days until complete multinucleated myotube formation. Immunofluorescence staining of hiPSC-derived myotubes For immunofluorescence staining, differentiated myotubes were fixed in 4% paraformaldehyde, washed with PBS and permeabilized in 0.3% Triton-X-100 containing 4% normal horse serum (Sigma). Samples were then blocked with 4% normal horse serum and the expression of pan myosin heavy chain (MyHC) in myotubes was detected using the MF-20 antibody (1:100, Developmental Studies Hybridoma Bank) followed by secondary antibody (Alexa Fluor 561 goat anti–mouse IgG1 1:1000; Invitrogen). RNA extraction and bulk RNA-sequencing of hiPSC-derived myotubes For RNA extraction, differentiated myotubes were washed in ice cold PBS and then harvested in 1 ml TRIzol ® . RNA was extracted and on column DNase I treated using a Direct-zol™ RNA Miniprep Kit (Zymo, R2052). RNA integrity number (RIN) > 8 was verified with an Agilent Bioanalyzer before bulk RNA-sequencing (see: Global gene expression analysis by RNA-sequencing). Protein extraction and immunoblotting of hiPSC-derived myotubes Cells were washed once in ice cold PBS and each well scraped into 1 ml of PBS containing protease inhibitors (cOmplete™ Protease Inhibitor Cocktail EDTA-Free; Roche, 11873580001) on ice. Cells were pelleted (500 rcf, 5 min, 4 °C), the supernatant was removed, and pellets were resuspended in protein lysis buffer (50 mM Tris-HCl, pH 7.4; 180 mM NaCl; 1 mM EDTA; 1% Triton X-100; 20% Glycerol) supplemented with freshly added protease inhibitor cocktail and 1 mM dithiothreitol. Lysates were incubated on ice for 10 min and then sonicated using a Diagenode Bioruptor® (5 cycles of 30 s on high power, 30 s off, 4 °C). Cellular debris were removed by centrifugation (18,000 rcf, 20 min, 4 °C), and cleared cell lysates were transferred to fresh tubes. Protein concentrations were determined using a Bradford assay. Equal amounts of protein (25 µg) were resolved on hand-cast SDS-polyacrylamide gels (4% stacking, 10% resolving) and electrotransferred onto polyvinylidene difluoride membranes (80 mA, 20 h, 4 °C) Total protein loading was assessed with Ponceau S staining. Membranes were blocked in 5% milk in TBS for 1 h at room temperature and incubated overnight at 4 °C with anti-HECTD1 antibody (1 µg/ml in 5% milk, TBST, Abcam, ab101992). After washing with TBST, membranes were incubated with HRP-conjugated rabbit anti-mouse IgG (1:10,000 in 5% milk/TBST, Abcam, ab6728) for 1 h at room temperature. Protein bands were detected using enhanced chemiluminescence (Amersham ECL Prime; Cytiva, 89168-782) and imaged with an iBright™ CL1500 system. Statistical analysis The analysis of the data was carried out using R, Excel, and GraphPad Prism as described above. Specifics regarding statistical analyses and sample sizes are found in figure legends. Declarations Informed consent was obtained from all patients." Study Approval All animal experiments were approved by the regional animal ethics committee of Northern Stockholm, Sweden. Data availability Next-generation sequencing (NGS) data generated is deposited at GEO. In addition, all used datasets are made available as Supplemental Data. Code used to analyze NGS data will be available at the RuasLab GitHub (https://github.com/ruaslab). Any additional information required to reanalyze the data reported in this paper is available from the corresponding author upon request. Author Contributions I.C., and J.L.R. conceived, coordinated, and designed the study. J.L.R. secured funding. I.C., A.B.L., P.R.J., S.D., E.N., E.K., J.C.C., B.J., M.Mu., T.S., and A.R. planned and performed experiments. M.Mu., and B.L. contributed to data analysis and interpretation. A.H., A.T., and V.S. secured clinical data from myopathy patients. F.Y., and W.Y. generated the hiPSC line. I.C., J.L.R., and A.B.L. wrote and edited the manuscript with input from all authors. All authors read and approved the manuscript. Acknowledgements Protein identification and quantification were carried out by the Proteomics Biomedicum core facility, Karolinska Institutet (https://ki.se/en/research/proteomics-biomedicum-core-facility). We thank Dr. Irene Zohn (George Washington University School of Medicine and Health Sciences, USA) and Dr. Nico Dantuma (Karolinska Institutet, Sweden) for the kind gift of Hectd1 and Ubiquitin expression plasmids, respectively. This project was supported by grants from the Swedish Research Council (2016-00785, 2022-02743), The Novo Nordisk Foundation (NNF16OC0020804, NNF18OC0054132, NN0082202), and The Knut and Alice Wallenberg Foundation (KAW2019.0109). References Wang, Z. et al. The molecular basis for sarcomere organization in vertebrate skeletal muscle. Cell 184 , 2135-2150 e2113 (2021). https://doi.org:10.1016/j.cell.2021.02.047 Bodine, S. C. et al. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 294 , 1704-1708 (2001). https://doi.org:10.1126/science.1065874 Gomes, M. D., Lecker, S. H., Jagoe, R. T., Navon, A. & Goldberg, A. L. Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl Acad Sci U S A 98 , 14440-14445 (2001). https://doi.org:10.1073/pnas.251541198 Sartori, R. et al. BMP signaling controls muscle mass. Nat Genet 45 , 1309-1318 (2013). https://doi.org:10.1038/ng.2772 Hunt, L. C. et al. A Key Role for the Ubiquitin Ligase UBR4 in Myofiber Hypertrophy in Drosophila and Mice. Cell Rep 28 , 1268-1281 e1266 (2019). https://doi.org:10.1016/j.celrep.2019.06.094 Agnetti, G., Herrmann, H. & Cohen, S. New roles for desmin in the maintenance of muscle homeostasis. FEBS J 289 , 2755-2770 (2022). https://doi.org:10.1111/febs.15864 Sacheck, J. M. et al. Rapid disuse and denervation atrophy involve transcriptional changes similar to those of muscle wasting during systemic diseases. FASEB J 21 , 140-155 (2007). https://doi.org:10.1096/fj.06-6604com Lecker, S. H. et al. Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. FASEB J 18 , 39-51 (2004). https://doi.org:10.1096/fj.03-0610com Verbrugge, S. A. J. et al. Genes Whose Gain or Loss-Of-Function Increases Skeletal Muscle Mass in Mice: A Systematic Literature Review. Front Physiol 9 , 553 (2018). https://doi.org:10.3389/fphys.2018.00553 Kumar, L., Bisen, M., Khan, A., Kumar, P. & Patel, S. K. S. Role of Matrix Metalloproteinases in Musculoskeletal Diseases. Biomedicines 10 (2022). https://doi.org:10.3390/biomedicines10102477 Ahmad, K., Shaikh, S., Ahmad, S. S., Lee, E. J. & Choi, I. Cross-Talk Between Extracellular Matrix and Skeletal Muscle: Implications for Myopathies. Front Pharmacol 11 , 142 (2020). https://doi.org:10.3389/fphar.2020.00142 Spinelli, J. B. & Haigis, M. C. The multifaceted contributions of mitochondria to cellular metabolism. Nat Cell Biol 20 , 745-754 (2018). https://doi.org:10.1038/s41556-018-0124-1 Wang, Y., Argiles-Castillo, D., Kane, E. I., Zhou, A. & Spratt, D. E. HECT E3 ubiquitin ligases - emerging insights into their biological roles and disease relevance. J Cell Sci 133 (2020). https://doi.org:10.1242/jcs.228072 Zohn, I. E., Anderson, K. V. & Niswander, L. The Hectd1 ubiquitin ligase is required for development of the head mesenchyme and neural tube closure. Dev Biol 306 , 208-221 (2007). https://doi.org:10.1016/j.ydbio.2007.03.018 Kasarskis, A., Manova, K. & Anderson, K. V. A phenotype-based screen for embryonic lethal mutations in the mouse. Proc Natl Acad Sci U S A 95 , 7485-7490 (1998). https://doi.org:10.1073/pnas.95.13.7485 Petrany, M. J. et al. Single-nucleus RNA-seq identifies transcriptional heterogeneity in multinucleated skeletal myofibers. Nat Commun 11 , 6374 (2020). https://doi.org:10.1038/s41467-020-20063-w Bushby, K. M., Collins, J. & Hicks, D. Collagen type VI myopathies. Adv Exp Med Biol 802 , 185-199 (2014). https://doi.org:10.1007/978-94-007-7893-1_12 Liewluck, T. & Milone, M. Untangling the complexity of limb-girdle muscular dystrophies. Muscle Nerve 58 , 167-177 (2018). https://doi.org:10.1002/mus.26077 Wein, N., Alfano, L. & Flanigan, K. M. Genetics and emerging treatments for Duchenne and Becker muscular dystrophy. Pediatr Clin North Am 62 , 723-742 (2015). https://doi.org:10.1016/j.pcl.2015.03.008 Meola, G. & Cardani, R. Myotonic dystrophies: An update on clinical aspects, genetic, pathology, and molecular pathomechanisms. Biochim Biophys Acta 1852 , 594-606 (2015). https://doi.org:10.1016/j.bbadis.2014.05.019 Bonne, G. & Quijano-Roy, S. Emery-Dreifuss muscular dystrophy, laminopathies, and other nuclear envelopathies. Handb Clin Neurol 113 , 1367-1376 (2013). https://doi.org:10.1016/B978-0-444-59565-2.00007-1 Laitila, J. & Wallgren-Pettersson, C. Recent advances in nemaline myopathy. Neuromuscul Disord 31 , 955-967 (2021). https://doi.org:10.1016/j.nmd.2021.07.012 Li, X. et al. Ubiquitylation of phosphatidylinositol 4-phosphate 5-kinase type I gamma by HECTD1 regulates focal adhesion dynamics and cell migration. J Cell Sci 126 , 2617-2628 (2013). https://doi.org:10.1242/jcs.117044 Shen, X. et al. HECTD1 controls the protein level of IQGAP1 to regulate the dynamics of adhesive structures. Cell Commun Signal 15 , 2 (2017). https://doi.org:10.1186/s12964-016-0156-8 von Mering, C. et al. STRING: known and predicted protein-protein associations, integrated and transferred across organisms. Nucleic Acids Res 33 , D433-437 (2005). https://doi.org:10.1093/nar/gki005 Ramirez-Martinez, A. et al. KLHL41 stabilizes skeletal muscle sarcomeres by nonproteolytic ubiquitination. Elife 6 (2017). https://doi.org:10.7554/eLife.26439 Garg, A. et al. KLHL40 deficiency destabilizes thin filament proteins and promotes nemaline myopathy. J Clin Invest 124 , 3529-3539 (2014). https://doi.org:10.1172/JCI74994 Pappas, C. T., Bliss, K. T., Zieseniss, A. & Gregorio, C. C. The Nebulin family: an actin support group. Trends Cell Biol 21 , 29-37 (2011). https://doi.org:10.1016/j.tcb.2010.09.005 Chereau, D. et al. Leiomodin is an actin filament nucleator in muscle cells. Science 320 , 239-243 (2008). https://doi.org:10.1126/science.1155313 Chu, M., Gregorio, C. C. & Pappas, C. T. Nebulin, a multi-functional giant. J Exp Biol 219 , 146-152 (2016). https://doi.org:10.1242/jeb.126383 Sarkar, A. A. & Zohn, I. E. Hectd1 regulates intracellular localization and secretion of Hsp90 to control cellular behavior of the cranial mesenchyme. J Cell Biol 196 , 789-800 (2012). https://doi.org:10.1083/jcb.201105101 D'Alonzo, D. et al. Hectd1 is essential for embryogenesis in mice. Gene Expr Patterns 34 , 119064 (2019). https://doi.org:10.1016/j.gep.2019.119064 Lv, K. et al. HectD1 controls hematopoietic stem cell regeneration by coordinating ribosome assembly and protein synthesis. Cell Stem Cell 28 , 1275-1290 e1279 (2021). https://doi.org:10.1016/j.stem.2021.02.008 Hindi, S. M. & Millay, D. P. All for One and One for All: Regenerating Skeletal Muscle. Csh Perspect Biol 14 (2022). https://doi.org:ARTN a040824 10.1101/cshperspect.a040824 Schiaffino, S., Rossi, A. C., Smerdu, V., Leinwand, L. A. & Reggiani, C. Developmental myosins: expression patterns and functional significance. Skelet Muscle 5 , 22 (2015). https://doi.org:10.1186/s13395-015-0046-6 Morgan, J. & Partridge, T. Skeletal muscle in health and disease. Dis Model Mech 13 (2020). https://doi.org:10.1242/dmm.042192 Piñero, J. et al. DisGeNET: a discovery platform for the dynamical exploration of human diseases and their genes. Database (Oxford) 2015 , bav028 (2015). https://doi.org:10.1093/database/bav028 Martens, M. et al. WikiPathways: connecting communities. Nucleic Acids Res 49 , D613-D621 (2021). https://doi.org:10.1093/nar/gkaa1024 Jassal, B. et al. The reactome pathway knowledgebase. Nucleic Acids Res 48 , D498-D503 (2020). https://doi.org:10.1093/nar/gkz1031 Töpf, A. et al. Sequential targeted exome sequencing of 1001 patients affected by unexplained limb-girdle weakness. Genet Med 22 , 1478-1488 (2020). https://doi.org:10.1038/s41436-020-0840-3 Kircher, M. et al. A general framework for estimating the relative pathogenicity of human genetic variants. Nat Genet 46 , 310-315 (2014). https://doi.org:10.1038/ng.2892 Vaser, R., Adusumalli, S., Leng, S. N., Sikic, M. & Ng, P. C. SIFT missense predictions for genomes. Nat Protoc 11 , 1-9 (2016). https://doi.org:10.1038/nprot.2015.123 Adzhubei, I., Jordan, D. M. & Sunyaev, S. R. Predicting functional effect of human missense mutations using PolyPhen-2. Curr Protoc Hum Genet Chapter 7 , Unit7 20 (2013). https://doi.org:10.1002/0471142905.hg0720s76 Das, S. et al. Motor neurons and endothelial cells additively promote development and fusion of human iPSC-derived skeletal myocytes. Skelet Muscle 14 , 5 (2024). https://doi.org:10.1186/s13395-024-00336-4 Milan, G. et al. Regulation of autophagy and the ubiquitin-proteasome system by the FoxO transcriptional network during muscle atrophy. Nat Commun 6 , 6670 (2015). https://doi.org:10.1038/ncomms7670 Mellis, D. et al. Ubiquitin-protein ligase Ubr5 cooperates with hedgehog signalling to promote skeletal tissue homeostasis. PLoS Genet 17 , e1009275 (2021). https://doi.org:10.1371/journal.pgen.1009275 Marzuca-Nassr, G. N., Vitzel, K. F., Mancilla-Solorza, E. & Márquez, J. L. Sarcomere Structure: The Importance of Desmin Protein in Muscle Atrophy. Int J Morphol 36 , 576-583 (2018). https://doi.org:Doi 10.4067/S0717-95022018000200576 Hevener, A. L., Ribas, V., Moore, T. M. & Zhou, Z. ERα in the Control of Mitochondrial Function and Metabolic Health. Trends Mol Med 27 , 31-46 (2021). https://doi.org:10.1016/j.molmed.2020.09.006 Gaillard, S., Dwyer, M. A. & McDonnell, D. P. Definition of the molecular basis for estrogen receptor-related receptor-alpha-cofactor interactions. Mol Endocrinol 21 , 62-76 (2007). https://doi.org:10.1210/me.2006-0179 Cunningham, J. T. et al. mTOR controls mitochondrial oxidative function through a YY1-PGC-1alpha transcriptional complex. Nature 450 , 736-740 (2007). https://doi.org:10.1038/nature06322 Fernández-Vizarra, E., Enriquez, J. A., Pérez-Martos, A., Montoya, J. & Fernández-Silva, P. Mitochondrial gene expression is regulated at multiple levels and differentially in the heart and liver by thyroid hormones. Curr Genet 54 , 13-22 (2008). https://doi.org:10.1007/s00294-008-0194-x Hernández-Hernández, M., García-González, E. G., Brun, C. E. & Rudnicki, M. A. The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. Semin Cell Dev Biol 72 , 10-18 (2017). https://doi.org:10.1016/j.semcdb.2017.11.010 Zerafati-Jahromi, G. et al. Sequence variants in HECTD1 result in a variable neurodevelopmental disorder. Am J Hum Genet 112 , 537-553 (2025). https://doi.org:10.1016/j.ajhg.2025.01.001 Morey-Holton, E. R. & Globus, R. K. Hindlimb unloading rodent model: technical aspects. J Appl Physiol (1985) 92 , 1367-1377 (2002). https://doi.org:10.1152/japplphysiol.00969.2001 Correia, J. C. et al. Zfp697 is an RNA-binding protein that regulates skeletal muscle inflammation and remodeling. Proc Natl Acad Sci U S A 121 , e2319724121 (2024). https://doi.org:10.1073/pnas.2319724121 Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29 , 15-21 (2013). https://doi.org:10.1093/bioinformatics/bts635 Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30 , 923-930 (2014). https://doi.org:10.1093/bioinformatics/btt656 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15 , 550 (2014). https://doi.org:10.1186/s13059-014-0550-8 Wu, T. et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb) 2 , 100141 (2021). https://doi.org:10.1016/j.xinn.2021.100141 Pashos, E. E. et al. Large, Diverse Population Cohorts of hiPSCs and Derived Hepatocyte-like Cells Reveal Functional Genetic Variation at Blood Lipid-Associated Loci. Cell Stem Cell 20 , 558-570 e510 (2017). https://doi.org:10.1016/j.stem.2017.03.017 Ran, F. A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154 , 1380-1389 (2013). https://doi.org:10.1016/j.cell.2013.08.021 Chal, J. et al. Generation of human muscle fibers and satellite-like cells from human pluripotent stem cells in vitro. Nat Protoc 11 , 1833-1850 (2016). https://doi.org:10.1038/nprot.2016.110 Hicks, M. R. et al. ERBB3 and NGFR mark a distinct skeletal muscle progenitor cell in human development and hPSCs. Nat Cell Biol 20 , 46-57 (2018). https://doi.org:10.1038/s41556-017-0010-2 Additional Declarations There is NO Competing Interest. Supplementary Files FigureS02.pdf Supplementary Figure 2 FigureS01.pdf Supplementary Figure 1 FigureS02.pdf Supplementary Figure 2 FigureS03.pdf Supplementary Figure 3 FigureS04.pdf Supplementary Figure 4 FigureS04.pdf Supplementary Figure 4 FigureS05.pdf Supplementary Figure 5 FigureS06.pdf Supplementary Figure 6 FigureS06.pdf Supplementary Figure 6 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8663318","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":599176693,"identity":"8ba5972c-01a7-46b7-80d5-ffe5477bfe8f","order_by":0,"name":"Jorge Ruas","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYBACxnYwZQPECUBsACXxamkGU2kkaGFgBpOHoVoYiNDC3Mz7TOLHn/PR/OwJbFI3CuzyGNibt0ngdxi7mWRv2+3cmT0P2KRzDJKLGXiOlRHQwsYmwdtwO3fDjQSQlgOJDRI5ZgS1SP75cy53P1yL/BvCWqR52A7kbpCA28JDUAuztWxbcu6MMw+brYF+SWzjSSu2wKfFsL2N8eabP3a5/e3JB2/n/LFL7Gc/vPEGXi0NCAshTDZ8ykFAnpCCUTAKRsEoGAUMANkcQ6V0/X+WAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-1110-2606","institution":"University of Michigan","correspondingAuthor":true,"prefix":"","firstName":"Jorge","middleName":"","lastName":"Ruas","suffix":""},{"id":599176694,"identity":"f0f8e928-c22f-409a-87aa-7bbaaac9dcad","order_by":1,"name":"Igor Cervenka","email":"","orcid":"","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Igor","middleName":"","lastName":"Cervenka","suffix":""},{"id":599176695,"identity":"92ff19e1-0adc-40c1-9962-49de384db119","order_by":2,"name":"Aurel Leuchtmann","email":"","orcid":"https://orcid.org/0000-0002-5800-005X","institution":"University of Michigan Medical School","correspondingAuthor":false,"prefix":"","firstName":"Aurel","middleName":"","lastName":"Leuchtmann","suffix":""},{"id":599176696,"identity":"f103aaad-5c4b-445f-bc85-5b5e5534a8d8","order_by":3,"name":"Paulo Jannig","email":"","orcid":"https://orcid.org/0000-0002-2569-4091","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Paulo","middleName":"","lastName":"Jannig","suffix":""},{"id":599176697,"identity":"15fd3043-1b65-4f44-9762-3bc07556499b","order_by":4,"name":"Serge Ducommun","email":"","orcid":"","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Serge","middleName":"","lastName":"Ducommun","suffix":""},{"id":599176698,"identity":"c17e8908-0aa9-449f-820b-dc2716ff2df2","order_by":5,"name":"Elie Naddaf","email":"","orcid":"https://orcid.org/0000-0001-6212-1236","institution":"Mayo Clinic","correspondingAuthor":false,"prefix":"","firstName":"Elie","middleName":"","lastName":"Naddaf","suffix":""},{"id":599176699,"identity":"4f3b607f-79b9-440a-ac7f-6f6688887099","order_by":6,"name":"Elieen Kokesh","email":"","orcid":"","institution":"Mayo Clinic","correspondingAuthor":false,"prefix":"","firstName":"Elieen","middleName":"","lastName":"Kokesh","suffix":""},{"id":599176700,"identity":"3422196c-2cb9-4745-a329-e2f38afa4d52","order_by":7,"name":"Jorge Correia","email":"","orcid":"","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Jorge","middleName":"","lastName":"Correia","suffix":""},{"id":599176701,"identity":"1e9276d2-5e2e-47a1-9b82-c60e0cc42fd5","order_by":8,"name":"Marta Murgia","email":"","orcid":"https://orcid.org/0000-0001-6244-3358","institution":"University of Padova and Max-Planck-Institute of Biochemistry","correspondingAuthor":false,"prefix":"","firstName":"Marta","middleName":"","lastName":"Murgia","suffix":""},{"id":599176702,"identity":"2a6adeec-d985-4c20-8d96-7b48df0b7aaa","order_by":9,"name":"Tadas Sereiva","email":"","orcid":"https://orcid.org/0009-0008-0340-1420","institution":"University of Michigan Medical School","correspondingAuthor":false,"prefix":"","firstName":"Tadas","middleName":"","lastName":"Sereiva","suffix":""},{"id":599176703,"identity":"1120416a-42fe-467d-b179-7f99e4864fa9","order_by":10,"name":"Bo Li","email":"","orcid":"https://orcid.org/0000-0001-5843-0925","institution":"University of Michigan Medical School","correspondingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Li","suffix":""},{"id":599176704,"identity":"34bc1134-d2b8-48a8-b4af-dcc2daf47d79","order_by":11,"name":"Feikun Yang","email":"","orcid":"https://orcid.org/0000-0002-7295-0553","institution":"University of Pennsylvania.","correspondingAuthor":false,"prefix":"","firstName":"Feikun","middleName":"","lastName":"Yang","suffix":""},{"id":599176705,"identity":"ec4841de-c13c-444b-afaf-b317d4e2be98","order_by":12,"name":"Baptiste Jude","email":"","orcid":"","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Baptiste","middleName":"","lastName":"Jude","suffix":""},{"id":599176706,"identity":"5d5cda35-311d-4099-a08f-c18f95435b6c","order_by":13,"name":"Anastasia Rumyantseva","email":"","orcid":"https://orcid.org/0000-0002-7847-6178","institution":"Karolinska institutet","correspondingAuthor":false,"prefix":"","firstName":"Anastasia","middleName":"","lastName":"Rumyantseva","suffix":""},{"id":599176707,"identity":"5ad8b57e-4f5a-4aa3-92bc-782edf3c8864","order_by":14,"name":"Michelle Azzolini","email":"","orcid":"","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Michelle","middleName":"","lastName":"Azzolini","suffix":""},{"id":599176708,"identity":"4f2eb4a6-d456-445a-ad59-796b8820c782","order_by":15,"name":"Margareta Porsmyr-Palmertz","email":"","orcid":"","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Margareta","middleName":"","lastName":"Porsmyr-Palmertz","suffix":""},{"id":599176709,"identity":"00dbbfec-8fb4-4f89-ab68-a5bb174909e3","order_by":16,"name":"Wenli Yang","email":"","orcid":"https://orcid.org/0000-0002-1873-2336","institution":"University of Pennsylvania","correspondingAuthor":false,"prefix":"","firstName":"Wenli","middleName":"","lastName":"Yang","suffix":""},{"id":599176710,"identity":"306ce028-65e4-4cff-b1b6-3df1e6e9819b","order_by":17,"name":"Matthias Mann","email":"","orcid":"https://orcid.org/0000-0003-1292-4799","institution":"Max Planck Institute of Biochemistry","correspondingAuthor":false,"prefix":"","firstName":"Matthias","middleName":"","lastName":"Mann","suffix":""},{"id":599176711,"identity":"f717595b-dcdb-416b-9dfe-5fcff7d18933","order_by":18,"name":"Christoph Freyer","email":"","orcid":"https://orcid.org/0000-0003-0418-1673","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Christoph","middleName":"","lastName":"Freyer","suffix":""},{"id":599176712,"identity":"c3830a9a-eec5-4597-b689-8f07ad473a7d","order_by":19,"name":"Anna Wredenberg","email":"","orcid":"https://orcid.org/0000-0002-2500-6121","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Anna","middleName":"","lastName":"Wredenberg","suffix":""},{"id":599176713,"identity":"ece40c52-58c4-4b53-9ac7-34b82370ce30","order_by":20,"name":"Johanna Lanner","email":"","orcid":"https://orcid.org/0000-0002-1222-9473","institution":"Karolinska Institutet","correspondingAuthor":false,"prefix":"","firstName":"Johanna","middleName":"","lastName":"Lanner","suffix":""},{"id":599176714,"identity":"086a9ac5-6696-4878-9c7b-24f30b913339","order_by":21,"name":"Andreas Hahn","email":"","orcid":"","institution":"Justus-Liebig-University","correspondingAuthor":false,"prefix":"","firstName":"Andreas","middleName":"","lastName":"Hahn","suffix":""},{"id":599176715,"identity":"b3c9c2d2-b40e-4381-afa1-81dcda77ae4a","order_by":22,"name":"Ana Töpf","email":"","orcid":"https://orcid.org/0000-0002-9227-2526","institution":"Newcastle University","correspondingAuthor":false,"prefix":"","firstName":"Ana","middleName":"","lastName":"Töpf","suffix":""},{"id":599176716,"identity":"2d70819d-c8a4-4182-a8ed-8d53857a975b","order_by":23,"name":"Volker Straub","email":"","orcid":"https://orcid.org/0000-0001-9046-3540","institution":"Newcastle University","correspondingAuthor":false,"prefix":"","firstName":"Volker","middleName":"","lastName":"Straub","suffix":""}],"badges":[],"createdAt":"2026-01-21 20:30:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8663318/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8663318/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104404771,"identity":"af85065a-1e75-4ed8-979c-bdc7747f83db","added_by":"auto","created_at":"2026-03-11 12:21:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":188100,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptomics analysis of myopathy and muscle atrophy samples identifies \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHECTD1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e as a commonly dysregulated gene.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,\u003c/strong\u003e Upset plots showing overlaps of sets of differentially expressed genes in myopathy and atrophy RNA-seq datasets ordered by combination degree. \u003cstrong\u003ec,\u003c/strong\u003e Schematic representation of mouse \u003cem\u003eHectd1 \u003c/em\u003egene and protein structure. \u003cstrong\u003ed,\u003c/strong\u003e Differential gene expression of \u003cem\u003eHectd1\u003c/em\u003e in atrophy and myopathy datasets expressed as log\u003csub\u003e2\u003c/sub\u003e of fold-change. \u003cstrong\u003ee,\u003c/strong\u003e Quantification of \u003cem\u003eHectd1\u003c/em\u003e expression in selected mouse tissues assessed by RT-qPCR. Skeletal muscle samples are indicated in gray (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ef,\u003c/strong\u003e Immunoblot of HECTD1 protein in selected mouse tissues, arrow indicates size of full-length HECTD1 protein. All data are represented as mean ± sd. FDR – false discovery rate.\u003c/p\u003e","description":"","filename":"Binder11.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/4745acde54eeecf40cf38aea.png"},{"id":104329606,"identity":"75ae6d55-54df-4fe4-9b88-8ab60b014a3d","added_by":"auto","created_at":"2026-03-10 14:46:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":188100,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptomics analysis of myopathy and muscle atrophy samples identifies \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHECTD1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e as a commonly dysregulated gene.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,\u003c/strong\u003e Upset plots showing overlaps of sets of differentially expressed genes in myopathy and atrophy RNA-seq datasets ordered by combination degree. \u003cstrong\u003ec,\u003c/strong\u003e Schematic representation of mouse \u003cem\u003eHectd1 \u003c/em\u003egene and protein structure. \u003cstrong\u003ed,\u003c/strong\u003e Differential gene expression of \u003cem\u003eHectd1\u003c/em\u003e in atrophy and myopathy datasets expressed as log2 of fold-change. \u003cstrong\u003ee,\u003c/strong\u003e Quantification of \u003cem\u003eHectd1\u003c/em\u003e expression in selected mouse tissues assessed by RT-qPCR. Skeletal muscle samples are indicated in gray (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ef,\u003c/strong\u003e Immunoblot of HECTD1 protein in selected mouse tissues, arrow indicates size of full-length HECTD1 protein. All data are represented as mean ± sd. FDR – false discovery rate.\u003c/p\u003e","description":"","filename":"Binder11.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/d3d468d9db8fcecfe6e037a0.png"},{"id":104178029,"identity":"c007795a-bf83-436d-9bb1-bcf4086fe106","added_by":"auto","created_at":"2026-03-08 16:51:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":85203,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e expression is differentially regulated in situations of muscle regeneration and atrophy.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Quantification of \u003cem\u003eHectd1\u003c/em\u003e expression in \u003cem\u003egastrocnemius\u003c/em\u003e muscle during a hindlimb unloading-reloading protocol (\u003cem\u003en\u003c/em\u003e = 6-8). \u003cstrong\u003eb,\u003c/strong\u003e Quantification of time resolved \u003cem\u003eHectd1\u003c/em\u003e expression in \u003cem\u003egastrocnemius\u003c/em\u003e muscle after a downhill running protocol (\u003cem\u003en\u003c/em\u003e = 6). \u003cstrong\u003ec,\u003c/strong\u003e Quantification of time resolved \u003cem\u003eHectd1\u003c/em\u003e expression after BaCl\u003csub\u003e2\u003c/sub\u003e injection into the \u003cem\u003egastrocnemius\u003c/em\u003e muscle with contralateral side as a control (\u003cem\u003en\u003c/em\u003e = 5-6). \u003cstrong\u003ed,\u003c/strong\u003e Expression of \u003cem\u003eHectd1\u003c/em\u003e gene in differentiated primary mouse myotubes after 6-h treatment with either 10 μM or 20 μM dexamethasone assessed by RT-qPCR (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ee,\u003c/strong\u003e Expression of \u003cem\u003eHectd1\u003c/em\u003e in differentiated primary mouse myotubes after 48-hour treatment with either 1 μM or 10 μM dexamethasone assessed by RT-qPCR (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ef,\u003c/strong\u003e Quantification of gene expression during differentiation of C2C12 myotubes after control or \u003cem\u003eHectd1\u003c/em\u003e siRNA transfection (\u003cem\u003en\u003c/em\u003e = 3). All data are represented as mean ± sd. Data in \u003cstrong\u003ea\u003c/strong\u003e were analyzed by pairwise \u003cem\u003et\u003c/em\u003e-test with \u003cem\u003eP\u003c/em\u003e-value correction using Holm-Bonferroni method, indicated p-values represent comparison with previous time point. Data in \u003cstrong\u003eb\u003c/strong\u003e were analyzed by one-way ANOVA, indicated \u003cem\u003eP\u003c/em\u003e-values represent comparison to 0 h (pre-exercise). Data in \u003cstrong\u003ec\u003c/strong\u003e were analyzed by paired t-test for individual time points. Data in \u003cstrong\u003ed\u003c/strong\u003e were analyzed by Student’s \u003cem\u003et\u003c/em\u003e-test. Data in \u003cstrong\u003ee\u003c/strong\u003e were analyzed by one-way ANOVA. Data in \u003cstrong\u003ef\u003c/strong\u003e were analyzed with two-way ANOVA, \u003cem\u003eP\u003c/em\u003e-value for interaction between differentiation timepoint and genotype is indicated in the graph. Comparison of individual time points was analyzed by pairwise t-test with Holm-Bonferroni correction. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, *** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder12.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/90fdbd8f227aceb3a911f394.png"},{"id":104178031,"identity":"89f5328e-e0de-4cc5-bc5e-b782ab0d3664","added_by":"auto","created_at":"2026-03-08 16:51:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":275403,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHECTD1 is the E3 ligase for KLHL40/41 and necessary to maintain sarcomere integrity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,\u003c/strong\u003e Differentially regulated GO-BP identified from proteins with \u003cstrong\u003ea\u003c/strong\u003e increased and \u003cstrong\u003eb\u003c/strong\u003e decreased expression in C2C12 myotubes after knockdown of \u003cem\u003eHectd1\u003c/em\u003e, numbering to the right indicates rank of the pathway when sorted by p-value. \u003cstrong\u003ec,\u003c/strong\u003e STRING functional protein association network of differentially expressed proteins in C2C12 myotubes after knockdown of \u003cem\u003eHectd1\u003c/em\u003e with directionality of expression indicated as border color and identified clusters indicated as background color. HECTD1 and KLHL41 are highlighted. Connected subgraphs with less than three proteins are not shown. \u003cstrong\u003ed\u003c/strong\u003e, Schema with current molecular understanding of KLHL40/41 contribution to pathogenesis of nemaline myopathy. Question marks indicate suspected but unknown regulator of KLHL40/41 ubiquitylation. \u003cstrong\u003ee\u003c/strong\u003e, Immunoblot detection and quantification of KLHL41 stabilization after co-expression of wild-type (wt) or catalytically inactive (mut) \u003cem\u003eHectd1\u003c/em\u003e (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ef\u003c/strong\u003e, Immunoprecipitation of KLHL41 followed by immunoblot detection and quantification of KLHL41 ubiquitination after co-expression of wt or mut \u003cem\u003eHectd1\u003c/em\u003e (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003eg\u003c/strong\u003e, Immunoblot detection of nebulin fragment stabilization after co-expression of wt or mut \u003cem\u003eHectd1\u003c/em\u003e and \u003cem\u003eKlhl41\u003c/em\u003e. All data are represented as mean ± sd. Immunoblot data in \u003cstrong\u003ee\u003c/strong\u003e were normalized to loading control and analyzed by one-way ANOVA. Immunoblot data for KLHL41 in \u003cstrong\u003ef\u003c/strong\u003e were normalized to corresponding KLHL41 input and analyzed by one-way ANOVA. GO – Gene Ontology, BP – biological process, ORA – overrepresentation analysis.\u003c/p\u003e","description":"","filename":"Binder13.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/3c0473fef0b34fac10a90818.png"},{"id":104403866,"identity":"e0d6bc1e-5129-4786-8115-1ca2fe1e9099","added_by":"auto","created_at":"2026-03-11 12:19:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":141972,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSkeletal muscle-specific \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eknockout mice (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mKO) show muscle weakness.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea, \u003c/strong\u003eSchematic representation of the knockout strategy to generate \u003cem\u003eHectd1\u003c/em\u003e mKO mice. Deletion of exon 3 introduces an early stop codon at amino acid 51.\u003cstrong\u003eb\u003c/strong\u003e, Immunoblot of HECTD1 protein in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice, arrow indicates the size of the full-length HECTD1 protein. \u003cstrong\u003ec\u003c/strong\u003e, Gene expression of \u003cem\u003eHectd1\u003c/em\u003e (exon 22/23) and deleted exon 3 of \u003cem\u003eHectd1\u003c/em\u003e in selected metabolic tissues assessed by RT-qPCR (\u003cem\u003en\u003c/em\u003e = 6). \u003cstrong\u003ed\u003c/strong\u003e, Body mass of 4-month-old male and female control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 6-10). \u003cstrong\u003ee\u003c/strong\u003e, Body composition of 4-month-old male and female control and \u003cem\u003eHectd1\u003c/em\u003emKO mice measured by MRI and expressed as percentage of total body mass (\u003cem\u003en\u003c/em\u003e= 6-10). \u003cstrong\u003ef\u003c/strong\u003e, Front and all paw lean mass-normalized grip strength of 4-month-old \u003cem\u003eHectd1\u003c/em\u003e mKO males and females compared to control mice (\u003cem\u003en\u003c/em\u003e= 6-8).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(g)\u003c/strong\u003e Muscle mass of individual muscle beds of 4-month-old \u003cem\u003eHectd1\u003c/em\u003e mKO mice compared to control (\u003cem\u003en\u003c/em\u003e= 9-10).\u003cstrong\u003e (h)\u003c/strong\u003e Gene expression analysis of skeletal muscle myosin heavy chain (MyHC) isoforms and Myogenin in the EDL and SOL muscles of control and \u003cem\u003eHectd1\u003c/em\u003emKO mice expressed as fold-change (\u003cem\u003en\u003c/em\u003e = 5-19).\u003cstrong\u003e (i)\u003c/strong\u003e \u003cem\u003eEx vivo\u003c/em\u003eanalysis of the absolute and specific SOL contractile force as well as fatigability and recovery in control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 4-5).\u003cstrong\u003e \u003c/strong\u003eAll data are represented as mean ± sd. Data in \u003cstrong\u003ec-h \u003c/strong\u003ewere analyzed by Student’s \u003cem\u003et\u003c/em\u003e-test. Data in \u003cstrong\u003ei \u003c/strong\u003ewere analyzed by repeated measures ANOVA, interaction between time and genotype is plotted on the graph. SOL – \u003cem\u003esoleus\u003c/em\u003e, EDL - \u003cem\u003eextensor digitorum longus\u003c/em\u003e, GAST – \u003cem\u003egastrocnemius\u003c/em\u003e, TA – \u003cem\u003etibialis anterior\u003c/em\u003e, BAT – brown adipose tissue, eWAT – epididymal white adipose tissue, sWAT – subcutaneous white adipose tissue.\u003c/p\u003e","description":"","filename":"Binder14.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/5c38c786a78d5e279648f2a6.png"},{"id":104329673,"identity":"b8958816-f13a-4353-9826-a46dc78fbc48","added_by":"auto","created_at":"2026-03-10 14:48:02","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":141972,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSkeletal muscle-specific \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eknockout mice (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mKO) show muscle weakness.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea, \u003c/strong\u003eSchematic representation of the knockout strategy to generate \u003cem\u003eHectd1\u003c/em\u003e mKO mice. Deletion of exon 3 introduces an early stop codon at amino acid 51.\u003cstrong\u003eb\u003c/strong\u003e, Immunoblot of HECTD1 protein in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice, arrow indicates the size of the full-length HECTD1 protein. \u003cstrong\u003ec\u003c/strong\u003e, Gene expression of \u003cem\u003eHectd1\u003c/em\u003e (exon 22/23) and deleted exon 3 of \u003cem\u003eHectd1\u003c/em\u003e in selected metabolic tissues assessed by RT-qPCR (\u003cem\u003en\u003c/em\u003e = 6). \u003cstrong\u003ed\u003c/strong\u003e, Body mass of 4-month-old male and female control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 6-10). \u003cstrong\u003ee\u003c/strong\u003e, Body composition of 4-month-old male and female control and \u003cem\u003eHectd1\u003c/em\u003emKO mice measured by MRI and expressed as percentage of total body mass (\u003cem\u003en\u003c/em\u003e= 6-10). \u003cstrong\u003ef\u003c/strong\u003e, Front and all paw lean mass-normalized grip strength of 4-month-old \u003cem\u003eHectd1\u003c/em\u003e mKO males and females compared to control mice (\u003cem\u003en\u003c/em\u003e= 6-8).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(g)\u003c/strong\u003e Muscle mass of individual muscle beds of 4-month-old \u003cem\u003eHectd1\u003c/em\u003e mKO mice compared to control (\u003cem\u003en\u003c/em\u003e= 9-10).\u003cstrong\u003e (h)\u003c/strong\u003e Gene expression analysis of skeletal muscle myosin heavy chain (MyHC) isoforms and Myogenin in the EDL and SOL muscles of control and \u003cem\u003eHectd1\u003c/em\u003emKO mice expressed as fold-change (\u003cem\u003en\u003c/em\u003e = 5-19).\u003cstrong\u003e (i)\u003c/strong\u003e \u003cem\u003eEx vivo\u003c/em\u003eanalysis of the absolute and specific SOL contractile force as well as fatigability and recovery in control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 4-5).\u003cstrong\u003e \u003c/strong\u003eAll data are represented as mean ± sd. Data in \u003cstrong\u003ec-h \u003c/strong\u003ewere analyzed by Student’s \u003cem\u003et\u003c/em\u003e-test. Data in \u003cstrong\u003ei \u003c/strong\u003ewere analyzed by repeated measures ANOVA, interaction between time and genotype is plotted on the graph. SOL – \u003cem\u003esoleus\u003c/em\u003e, EDL - \u003cem\u003eextensor digitorum longus\u003c/em\u003e, GAST – \u003cem\u003egastrocnemius\u003c/em\u003e, TA – \u003cem\u003etibialis anterior\u003c/em\u003e, BAT – brown adipose tissue, eWAT – epididymal white adipose tissue, sWAT – subcutaneous white adipose tissue.\u003c/p\u003e","description":"","filename":"Binder14.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/e45bbaee09816dc6b9df6d63.png"},{"id":104403995,"identity":"c952e05f-1eb3-4147-9f47-3e0e22d6ec74","added_by":"auto","created_at":"2026-03-11 12:19:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":170580,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptomics and proteomics analysis of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mKO muscle, reveals structural and bioenergetic dysfunction.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea, \u003c/strong\u003ePrincipal component analysis for the RNA-Seq performed in the \u003cem\u003esoleus\u003c/em\u003e muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO and control mice. \u003cstrong\u003eb\u003c/strong\u003e, RNA-Seq MA plot showing mean gene expression against log\u003csub\u003e2\u003c/sub\u003e fold-change in the \u003cem\u003esoleus\u003c/em\u003e mucles of \u003cem\u003eHectd1\u003c/em\u003e mKO mice. Differentially expressed genes (\u003cem\u003eP\u003c/em\u003eadj \u0026lt; 0.1) are shown in blue for increased and red for decreased expression when compared to control (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ec,d,\u003c/strong\u003e Predicted upstream transcription factors from differentially expressed genes with \u003cstrong\u003ec\u003c/strong\u003e decreased and \u003cstrong\u003ed\u003c/strong\u003e increased expression in the \u003cem\u003esoleus\u003c/em\u003e muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO mice. \u003cstrong\u003ee,\u003c/strong\u003e Gene set enrichment analysis of Disease-Gene associations in the \u003cem\u003esoleus\u003c/em\u003e muscle of Hectd1 mKO mice, numbering to the right indicates rank of the pathway when sorted by \u003cem\u003eP\u003c/em\u003e-value. \u003cstrong\u003ef,\u003c/strong\u003e Principal component analysis for the MS performed in the \u003cem\u003esoleus\u003c/em\u003e and \u003cem\u003eextensor digitorum longus\u003c/em\u003e (EDL) muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO and control mice. \u003cstrong\u003eg,h, \u003c/strong\u003eMass spectrometry volcano plots showing log\u003csub\u003e2\u003c/sub\u003e fold-change against -log\u003csub\u003e10\u003c/sub\u003e\u003cem\u003e P\u003c/em\u003e-value in the \u003cstrong\u003eg\u003c/strong\u003e \u003cem\u003esoleus\u003c/em\u003e and \u003cstrong\u003eh\u003c/strong\u003e EDL of \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 4). \u003cstrong\u003ei,\u003c/strong\u003e Comparison of differentially expressed proteins between the \u003cem\u003esoleus\u003c/em\u003e and EDL of \u003cem\u003eHectd1\u003c/em\u003e mKO mice with corresponding GO-BP overrepresentation pathways analysis for respective sets. No differentially regulated pathways were identified for differentially expressed proteins uniquely found in the EDL. \u003cstrong\u003ej,\u003c/strong\u003e Venn diagram of overlap between differentially expressed genes and proteins in the \u003cem\u003esoleus\u003c/em\u003e muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO mice identified by RNA-Seq and MS respectively. GO-BP overrepresentation pathway analysis for gene/protein IDs unique to the MS dataset or for differentially expressed genes and proteins common between RNA-Seq and MS of \u003cem\u003eHectd1\u003c/em\u003e mKO \u003cem\u003esoleus\u003c/em\u003e muscle. \u003cstrong\u003ek,\u003c/strong\u003e Correlation plot of common genes and proteins identified by RNA-Seq (expressed as log\u003csub\u003e2\u003c/sub\u003e fold-change) and MS (expressed as expression difference) with \u003cem\u003eP\u003c/em\u003e-values indicated as point color and point size. The number of co-regulated and contra-regulated instances is indicated in the graph. GSEA – gene set enrichment analysis, NES – normalized enrichment score, FDR – false discovery rate, MS – mass spectrometry, GO – Gene Ontology, BP – biological process, ORA – overrepresentation analysis.\u003c/p\u003e","description":"","filename":"Binder15.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/34011ff5f678593924083755.png"},{"id":104329720,"identity":"651cc3d7-8f6a-40c3-94e8-f7b9cec8e5e4","added_by":"auto","created_at":"2026-03-10 14:48:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":170580,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscriptomics and proteomics analysis of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mKO muscle, reveals structural and bioenergetic dysfunction.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea, \u003c/strong\u003ePrincipal component analysis for the RNA-Seq performed in the \u003cem\u003esoleus\u003c/em\u003e muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO and control mice. \u003cstrong\u003eb\u003c/strong\u003e, RNA-Seq MA plot showing mean gene expression against log2 fold-change in the \u003cem\u003esoleus\u003c/em\u003e mucles of \u003cem\u003eHectd1\u003c/em\u003e mKO mice. Differentially expressed genes (\u003cem\u003eP\u003c/em\u003eadj \u0026lt; 0.1) are shown in blue for increased and red for decreased expression when compared to control (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ec,d,\u003c/strong\u003e Predicted upstream transcription factors from differentially expressed genes with \u003cstrong\u003ec\u003c/strong\u003e decreased and \u003cstrong\u003ed\u003c/strong\u003e increased expression in the \u003cem\u003esoleus\u003c/em\u003e muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO mice. \u003cstrong\u003ee,\u003c/strong\u003e Gene set enrichment analysis of Disease-Gene associations in the \u003cem\u003esoleus\u003c/em\u003e muscle of Hectd1 mKO mice, numbering to the right indicates rank of the pathway when sorted by \u003cem\u003eP\u003c/em\u003e-value. \u003cstrong\u003ef,\u003c/strong\u003e Principal component analysis for the MS performed in the \u003cem\u003esoleus\u003c/em\u003e and \u003cem\u003eextensor digitorum longus\u003c/em\u003e (EDL) muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO and control mice. \u003cstrong\u003eg,h, \u003c/strong\u003eMass spectrometry volcano plots showing log2 fold-change against -log10\u003cem\u003e P\u003c/em\u003e-value in the \u003cstrong\u003eg\u003c/strong\u003e \u003cem\u003esoleus\u003c/em\u003e and \u003cstrong\u003eh\u003c/strong\u003e EDL of \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 4). \u003cstrong\u003ei,\u003c/strong\u003e Comparison of differentially expressed proteins between the \u003cem\u003esoleus\u003c/em\u003e and EDL of \u003cem\u003eHectd1\u003c/em\u003e mKO mice with corresponding GO-BP overrepresentation pathways analysis for respective sets. No differentially regulated pathways were identified for differentially expressed proteins uniquely found in the EDL. \u003cstrong\u003ej,\u003c/strong\u003e Venn diagram of overlap between differentially expressed genes and proteins in the \u003cem\u003esoleus\u003c/em\u003e muscle of \u003cem\u003eHectd1\u003c/em\u003e mKO mice identified by RNA-Seq and MS respectively. GO-BP overrepresentation pathway analysis for gene/protein IDs unique to the MS dataset or for differentially expressed genes and proteins common between RNA-Seq and MS of \u003cem\u003eHectd1\u003c/em\u003e mKO \u003cem\u003esoleus\u003c/em\u003e muscle. \u003cstrong\u003ek,\u003c/strong\u003e Correlation plot of common genes and proteins identified by RNA-Seq (expressed as log2 fold-change) and MS (expressed as expression difference) with \u003cem\u003eP\u003c/em\u003e-values indicated as point color and point size. The number of co-regulated and contra-regulated instances is indicated in the graph. GSEA – gene set enrichment analysis, NES – normalized enrichment score, FDR – false discovery rate, MS – mass spectrometry, GO – Gene Ontology, BP – biological process, ORA – overrepresentation analysis.\u003c/p\u003e","description":"","filename":"Binder15.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/71877d9f33141961be025520.png"},{"id":104403666,"identity":"9ccdd633-3978-4c97-8fba-11680499b35c","added_by":"auto","created_at":"2026-03-11 12:18:48","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2703228,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mKOs show progressive disruption of sarcomere and mitochondrial integrity and function.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,\u003c/strong\u003e Immunoblot detection and quantification of mitochondrial OXPHOS proteins from different complexes in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ec,d,\u003c/strong\u003eImmunoblot detection and quantification of mitochondrial transcription and RNA processing regulators in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003emKO mice (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ee,f, \u003c/strong\u003eRepresentative staining and quantification for mitochondrial OXPHOS \u003cstrong\u003ee\u003c/strong\u003e complex I activity (NADH-NTB) and \u003cstrong\u003ef\u003c/strong\u003ecomplex II activity (SDH-NTB) in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003emKO mice (\u003cem\u003en\u003c/em\u003e = 3). Scale bar - 50 μm. \u003cstrong\u003eg,h,\u003c/strong\u003e Intraperitoneal glucose tolerance test time-course of 5 h fasted control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice and corresponding calculation of area under the curve (\u003cem\u003en\u003c/em\u003e = 21). \u003cstrong\u003ei,\u003c/strong\u003e Front and all paw lean mass-normalized grip strength of 1-year-old \u003cem\u003eHectd1\u003c/em\u003e mKO males (\u003cem\u003en\u003c/em\u003e = 5-6). \u003cstrong\u003ej,\u003c/strong\u003eTotal distance and work achieved by 1-year-old control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice during treadmill running to exhaustion protocol (\u003cem\u003en\u003c/em\u003e = 4-6). \u003cstrong\u003ek,\u003c/strong\u003eRepresentative electron micrographs of ultrastructural abnormalities in the \u003cem\u003esoleus\u003c/em\u003emuscle of \u003cem\u003eHectd1\u003c/em\u003e mKO mice in transversal sections. Scale bars lengths are indicated inside images. \u003cstrong\u003el, \u003c/strong\u003eRepresentative immunohistochemical images of the 1-year-old \u003cem\u003esoleus\u003c/em\u003e muscle sections of control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice. Following subpanels are included: 1) Hematoxylin-Eosin, 2) NADH-NTB, 3) Modified Gomori trichrome, 4) ATPase at pH 4.3, 5) desmin, 6) alpha-crystallin B chain, 7) dystrophin-C-terminus, 8) myotilin, 9) alpha-actinin10) Transmission electron microscopy. In muscle samples from \u003cem\u003eHectd1\u003c/em\u003e mKO mice, there was variability in muscle fiber size with accumulation of subsarcolemmal material in several fibers (1). NADH-NTB stain (2) demonstrated lobulated appearance of the muscle fibers in \u003cem\u003eHectd1\u003c/em\u003e KO indicating myofibrillar disorganization, with no reactivity in the subsarcolemmal storage material. On trichrome stain (3), the storage material has a pale blue appearance and there is an increase in subsarcolemmal fuchsinophilia, indicating increased mitochondrial content. In ATPase-reacted section, the storage material occurred mostly in type 1 fibers (dark brown) which appeared smaller in size than type 2 (pink). An example muscle fiber is marked by an arrow pointing to the subsarcolemmal storage material on all serial sections. Myofibrillar myopathy antibody panel demonstrated strong reactivity of the storage material to desmin (5) and to a lesser extent to alpha-crystallin B chain (6), with no reactivity to dystrophin-C (7), myotilin (8) or alpha-actinin. Electron microscopy section (10) demonstrating subsarcolemmal accumulation of filamentous material, 14-18 nm in diameter, surrounded by mitochondria, some of which are structurally abnormal (arrow). Scale bars: 50 μm (1-8), 1 μm 9. All data are represented as mean ± sd. Data in \u003cstrong\u003eb\u003c/strong\u003e, \u003cstrong\u003ed, e, f, h, i\u003c/strong\u003e and \u003cstrong\u003ej\u003c/strong\u003e were analyzed by Student’s \u003cem\u003et\u003c/em\u003e-test. Data in \u003cstrong\u003eg\u003c/strong\u003ewere analyzed by repeated measures ANOVA, interaction between time and genotype is indicated on the graph. OXPHOS – mitochondrial oxidative phosphorylation system, SOL – \u003cem\u003esoleus \u003c/em\u003emuscle, NADH – Nicotinamide adenine dinucleotide, SDH – succinate dehydrogenase, NTB – nitro blue tetrazolium chloride, GTT - intraperitoneal glucose tolerance test, AUC – area under the curve.\u003c/p\u003e","description":"","filename":"Binder16.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/ce632c8b33db5854a1652dc1.png"},{"id":104329742,"identity":"b3690262-2fdf-40ca-9e56-d933ca5cd308","added_by":"auto","created_at":"2026-03-10 14:49:58","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2703228,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mKOs show progressive disruption of sarcomere and mitochondrial integrity and function.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,b,\u003c/strong\u003e Immunoblot detection and quantification of mitochondrial OXPHOS proteins from different complexes in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ec,d,\u003c/strong\u003eImmunoblot detection and quantification of mitochondrial transcription and RNA processing regulators in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003emKO mice (\u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003ee,f, \u003c/strong\u003eRepresentative staining and quantification for mitochondrial OXPHOS \u003cstrong\u003ee\u003c/strong\u003e complex I activity (NADH-NTB) and \u003cstrong\u003ef\u003c/strong\u003ecomplex II activity (SDH-NTB) in the \u003cem\u003esoleus\u003c/em\u003e muscle of control and \u003cem\u003eHectd1\u003c/em\u003emKO mice (\u003cem\u003en\u003c/em\u003e = 3). Scale bar - 50 μm. \u003cstrong\u003eg,h,\u003c/strong\u003e Intraperitoneal glucose tolerance test time-course of 5 h fasted control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice and corresponding calculation of area under the curve (\u003cem\u003en\u003c/em\u003e = 21). \u003cstrong\u003ei,\u003c/strong\u003e Front and all paw lean mass-normalized grip strength of 1-year-old \u003cem\u003eHectd1\u003c/em\u003e mKO males (\u003cem\u003en\u003c/em\u003e = 5-6). \u003cstrong\u003ej,\u003c/strong\u003eTotal distance and work achieved by 1-year-old control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice during treadmill running to exhaustion protocol (\u003cem\u003en\u003c/em\u003e = 4-6). \u003cstrong\u003ek,\u003c/strong\u003eRepresentative electron micrographs of ultrastructural abnormalities in the \u003cem\u003esoleus\u003c/em\u003emuscle of \u003cem\u003eHectd1\u003c/em\u003e mKO mice in transversal sections. Scale bars lengths are indicated inside images. \u003cstrong\u003el, \u003c/strong\u003eRepresentative immunohistochemical images of the 1-year-old \u003cem\u003esoleus\u003c/em\u003e muscle sections of control and \u003cem\u003eHectd1\u003c/em\u003e mKO mice. Following subpanels are included: 1) Hematoxylin-Eosin, 2) NADH-NTB, 3) Modified Gomori trichrome, 4) ATPase at pH 4.3, 5) desmin, 6) alpha-crystallin B chain, 7) dystrophin-C-terminus, 8) myotilin, 9) alpha-actinin10) Transmission electron microscopy. In muscle samples from \u003cem\u003eHectd1\u003c/em\u003e mKO mice, there was variability in muscle fiber size with accumulation of subsarcolemmal material in several fibers (1). NADH-NTB stain (2) demonstrated lobulated appearance of the muscle fibers in \u003cem\u003eHectd1\u003c/em\u003e KO indicating myofibrillar disorganization, with no reactivity in the subsarcolemmal storage material. On trichrome stain (3), the storage material has a pale blue appearance and there is an increase in subsarcolemmal fuchsinophilia, indicating increased mitochondrial content. In ATPase-reacted section, the storage material occurred mostly in type 1 fibers (dark brown) which appeared smaller in size than type 2 (pink). An example muscle fiber is marked by an arrow pointing to the subsarcolemmal storage material on all serial sections. Myofibrillar myopathy antibody panel demonstrated strong reactivity of the storage material to desmin (5) and to a lesser extent to alpha-crystallin B chain (6), with no reactivity to dystrophin-C (7), myotilin (8) or alpha-actinin. Electron microscopy section (10) demonstrating subsarcolemmal accumulation of filamentous material, 14-18 nm in diameter, surrounded by mitochondria, some of which are structurally abnormal (arrow). Scale bars: 50 μm (1-8), 1 μm 9. All data are represented as mean ± sd. Data in \u003cstrong\u003eb\u003c/strong\u003e, \u003cstrong\u003ed, e, f, h, i\u003c/strong\u003e and \u003cstrong\u003ej\u003c/strong\u003e were analyzed by Student’s \u003cem\u003et\u003c/em\u003e-test. Data in \u003cstrong\u003eg\u003c/strong\u003ewere analyzed by repeated measures ANOVA, interaction between time and genotype is indicated on the graph. OXPHOS – mitochondrial oxidative phosphorylation system, SOL – \u003cem\u003esoleus \u003c/em\u003emuscle, NADH – Nicotinamide adenine dinucleotide, SDH – succinate dehydrogenase, NTB – nitro blue tetrazolium chloride, GTT - intraperitoneal glucose tolerance test, AUC – area under the curve.\u003c/p\u003e","description":"","filename":"Binder16.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/3f799a77163ec0b12304558e.png"},{"id":104178039,"identity":"ed2e6020-f32a-4734-8ad4-82f9703d815b","added_by":"auto","created_at":"2026-03-08 16:51:43","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":841077,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHuman iPSC-derived myotubes with a heterozygous HECTD1\u003c/strong\u003e-\u003cstrong\u003eA1006V mutation show overlap with the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mKO molecular phenotype.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Representative microscopy images of human iPSC-derived myotubes engineered to carry the heterozygous HECTD1-A1006V mutation and isogenic controls; Phase contrast (upper panels), and anti-MyHC immunofluorescence (lower panels). \u003cstrong\u003eb,\u003c/strong\u003e \u003cem\u003eHECTD1\u003c/em\u003e gene expression levels determined by qRT-PCR. \u003cstrong\u003ec,\u003c/strong\u003e HECTD1 protein levels determined by immunoblotting using an anti-HECTD1 antibody. \u003cstrong\u003ed,\u003c/strong\u003e Principal Component Analysis (PCA) of the RNA-sequencing performed using HECTD1-A1006V vs control myotubes. \u003cstrong\u003ee,\u003c/strong\u003e RNA-Seq MA plot showing mean gene expression against log\u003csub\u003e2\u003c/sub\u003e fold-change in HECTD1-A1006V cells vs controls. \u003cstrong\u003ef,g,\u003c/strong\u003e Pathway analysis of differentially expressed genes with lower expression in HECTD1 Ala1006Val cells vs controls. \u003cstrong\u003eh,i,\u003c/strong\u003e Heatmap and String analysis of interactions between genes identified in “Muscle contraction” Reactome pathway in \u003cstrong\u003eg\u003c/strong\u003e in HECTD1-A1006V cells vs controls. ORA – overrepresentation analysis, FC – fold change, FDR – false discovery rate.\u003c/p\u003e","description":"","filename":"Binder17.png","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/5cc91871432d7e304e5d6b47.png"},{"id":108181480,"identity":"a2eafb50-5ccc-4e6c-b1df-db80fa2e5f1d","added_by":"auto","created_at":"2026-04-30 08:58:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8080138,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/5a06ea81-cd30-4484-9946-babb5cef8135.pdf"},{"id":104403990,"identity":"cb05bb6f-8e33-4a6d-bdae-d71efcb860e3","added_by":"auto","created_at":"2026-03-11 12:19:33","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":118469,"visible":true,"origin":"","legend":"Supplementary Figure 2","description":"","filename":"FigureS02.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/85d3efd13db53ab8c223b098.pdf"},{"id":104178040,"identity":"695efe5c-1b80-4c91-b8f2-245737ab4e76","added_by":"auto","created_at":"2026-03-08 16:51:43","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":737379,"visible":true,"origin":"","legend":"Supplementary Figure 1","description":"","filename":"FigureS01.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/794734d25b7cdad05b4b0a9b.pdf"},{"id":104329852,"identity":"01baf008-8a86-4ef8-87f9-d33a045fab52","added_by":"auto","created_at":"2026-03-10 14:51:52","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":118469,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 2\u003c/p\u003e","description":"","filename":"FigureS02.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/07f2646541996ddfb8593466.pdf"},{"id":104178030,"identity":"97adce80-cefa-448c-a235-590f2ac14009","added_by":"auto","created_at":"2026-03-08 16:51:43","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":154443,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 3\u003c/p\u003e","description":"","filename":"FigureS03.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/2d4bb709e7599ee5e3729004.pdf"},{"id":104404004,"identity":"a7d24a99-8f1f-45eb-907a-7dff7b171adc","added_by":"auto","created_at":"2026-03-11 12:19:34","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":345890,"visible":true,"origin":"","legend":"Supplementary Figure 4","description":"","filename":"FigureS04.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/cbe4acfc953481304abe9d70.pdf"},{"id":104329900,"identity":"391d3b33-92da-4ba0-bbb3-1fbbfaa4e05d","added_by":"auto","created_at":"2026-03-10 14:52:35","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":345890,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 4\u003c/p\u003e","description":"","filename":"FigureS04.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/e560a33751233e9516d56d59.pdf"},{"id":104178034,"identity":"4a01b2f5-9cde-4a80-bdb5-cae98ac29118","added_by":"auto","created_at":"2026-03-08 16:51:43","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":88323,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 5\u003c/p\u003e","description":"","filename":"FigureS05.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/f3254d6d584551169f0d5fa4.pdf"},{"id":104404012,"identity":"a0bb0f69-1a95-4c58-8364-04c1a5884f3c","added_by":"auto","created_at":"2026-03-11 12:19:35","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":93673,"visible":true,"origin":"","legend":"Supplementary Figure 6","description":"","filename":"FigureS06.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/47e9cc8b7899f8d5abf7bee3.pdf"},{"id":104331071,"identity":"c01e3dc0-21f7-4a57-8589-0b6334cf151b","added_by":"auto","created_at":"2026-03-10 14:57:36","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":93673,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Figure 6\u003c/p\u003e","description":"","filename":"FigureS06.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8663318/v1/26afd202593e23a549fe1f04.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"The E3 ligase HECTD1 controls skeletal muscle sarcomere and mitochondrial integrity","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSkeletal muscle is the largest organ of the human body and a central determinant of mobility, metabolic health, and systemic physiology. Its contractile capacity and high bioenergetic demands originate from the sarcomere, the minimal contractile unit and a highly ordered supramolecular machine that enables force production\u003csup\u003e1\u003c/sup\u003e. Research in muscle biology has uncovered several mechanisms by which sarcomeres break down during catabolic states, particularly in conditions of disuse, fasting, cachexia, or aging. These efforts have revealed a core atrophy program centered on increased proteolysis, driven in part by E3 ubiquitin ligases such as MuRF1\u003csup\u003e2\u003c/sup\u003e, Atrogin-1/MAFbx\u003csup\u003e3\u003c/sup\u003e, and Fbxo30/Musa-1\u003csup\u003e4\u003c/sup\u003e. Conversely, other E3 ubiquitin ligases such as UBR4 and UBR5 have been shown to regulate muscle hypertrophy through mechanisms that promote ribosome biogenesis and protein synthesis or quality control\u003csup\u003e5\u003c/sup\u003e. However, the pathways that preserve and maintain sarcomere structure under homeostatic conditions are less understood. Adding to this complexity, sarcomeres and mitochondria are intimately intertwined both structurally and metabolically. The lattice-like arrangement of myofibrils is organized by desmin, whose intermediate filament network physically links sarcomeres to surrounding mitochondria and thereby dictates their spatial distribution\u003csup\u003e6\u003c/sup\u003e. This architecture coordinates calcium flux and ATP demand with mitochondrial metabolism. Conversely, mitochondrial dysfunction can destabilize sarcomeres and accelerate proteolytic programs. Thus, mechanisms that sustain sarcomere integrity are inherently tied to bioenergetics and mitochondrial health. Dissecting the pathways that couple structural maintenance to metabolic function is therefore necessary not only for understanding muscle physiology, but also for clarifying how muscle dysfunction contributes to systemic metabolic disease.\u003c/p\u003e\n\u003cp\u003eHere we describe an unexpected function for the HECT Domain E3 Ubiquitin Protein Ligase 1 (HECTD1). Contrary to the canonical degradative role associated with many E3 ligases, we find that HECTD1 is essential for maintaining thin-filament stability and sarcomere integrity. Rather than promoting protein loss, HECTD1 supports the stability of key molecular chaperones involved in thin-filament assembly, including KLHL40 and KLHL41\u0026mdash;proteins whose loss-of-function is known to cause severe congenital myopathies. Strikingly, loss of \u003cem\u003eHectd1\u003c/em\u003e not only disrupts sarcomere structure but also leads to profound mitochondrial dysfunction in skeletal muscle. The absence of HECTD1 destabilizes thin-filament components, triggers structural collapse, and compromises mitochondrial organization and bioenergetics. These observations position HECTD1 at a previously unrecognized intersection between contractile unit stability and mitochondrial function. Given the severity of the phenotype observed in \u003cem\u003eHectd1\u003c/em\u003e-deficient muscle, including progressive weakness, exercise and glucose intolerance, and abnormal tissue remodeling, our findings establish HECTD1 as a novel myopathy gene with mitochondriopathy. More broadly, this work identifies a previously unappreciated mechanism of sarcomere maintenance and opens new avenues for therapeutic exploration aimed at preserving muscle structure and metabolic function in both aging and disease.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHECTD1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e/\u003cem\u003eHectd1\u003c/em\u003e expression is altered in muscle disorders.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify differentially expressed genes in situations where skeletal muscle structure/function is disrupted, we curated and analyzed publicly available RNA-sequencing data from human and mouse skeletal muscle in instances of myopathy or muscle atrophy (\u003cstrong\u003eFig. 1a,b\u003c/strong\u003e). This analysis identified 498 and 16 genes in common for myopathy and muscle atrophy conditions, respectively. Among these, we observed the expected changes in expression of several atrogenes\u003csup\u003e7-9\u003c/sup\u003e known to be associated with the different disorders (\u003cstrong\u003eSupplementary Fig. 1a\u003c/strong\u003e). For example, muscle atrophy samples showed increased levels of \u003cem\u003eFbxo30/Musa-1\u003c/em\u003e\u003csup\u003e4\u003c/sup\u003e,\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003eFbxo32/Atrogin\u003c/em\u003e\u003csup\u003e3\u003c/sup\u003e, and \u003cem\u003eTrim63/Murf-1\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e, E3 ubiquitin ligases with well-established roles in muscle mass loss. Conversely, myopathy samples showed increased levels of transcripts involved in extracellular matrix remodeling\u003csup\u003e10,11\u003c/sup\u003e. All samples showed reduced levels of transcripts related to mitochondrial function and energy production\u003csup\u003e12\u003c/sup\u003e. Surprisingly, \u003cem\u003eHECTD1\u003c/em\u003e/\u003cem\u003eHectd1\u003c/em\u003e was the only gene found to be differentially expressed in all analyzed samples (\u003cstrong\u003eFig. 1a,b,c\u003c/strong\u003e). HECTD1 belongs to the HECT family of E3 Ubiquitin ligases\u003csup\u003e13\u003c/sup\u003e and was initially identified as necessary for neural tube closure during embryonic development\u003csup\u003e14,15\u003c/sup\u003e. Interestingly, the changes in \u003cem\u003eHECTD1\u003c/em\u003e/\u003cem\u003eHectd1\u003c/em\u003e mRNA partitioned perfectly into atrophy and myopathy groups, its levels increasing in the former but decreasing in the latter (\u003cstrong\u003eFig. 1d\u003c/strong\u003e). Analysis of \u003cem\u003eHectd1\u003c/em\u003e expression in a comprehensive panel of mouse tissues revealed that it is ubiquitously expressed, although with highest expression in skeletal muscle (\u003cstrong\u003eFig. 1e\u003c/strong\u003e). Querying the single nucleus RNA-seq Myoatlas database\u003csup\u003e16\u003c/sup\u003e revealed that the largest proportion of \u003cem\u003eHectd1\u003c/em\u003e transcripts comes from muscle fibers, but its expression appears in most other cell types within skeletal muscle (\u003cstrong\u003eSupplementary Fig. 1b,c)\u003c/strong\u003e. Immunoblot analysis of protein extracts from mouse tissues confirmed the ubiquitous expression of HECTD1, which could be seen in all analyzed tissues (except kidney) as a band with the predicted molecular weight of 290 kDa (\u003cstrong\u003eFig. 1f\u003c/strong\u003e). In the same immunoblot several other bands could be seen, which could represent products of alternative splicing or proteins non-specifically recognized by the antibody. In agreement with the RNA-seq analyses, \u003cem\u003eHectd1\u003c/em\u003e expression in mouse muscle increased during atrophy and an acute eccentric exercise bout and decreased with muscle injury and regeneration (\u003cstrong\u003eFig. 2a,b,c\u003c/strong\u003e). In an \u003cem\u003ein vitro\u003c/em\u003e model of dexamethasone-induced muscle atrophy, we could see a similar and transient increase in \u003cem\u003eHectd1\u003c/em\u003e in primary myotubes (\u003cstrong\u003eFig. 2d,e\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReducing \u003cem\u003eHectd1\u003c/em\u003e expression \u003cem\u003ein vitro\u003c/em\u003e decreases sarcomere structure-related proteins\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the role of \u003cem\u003eHectd1\u003c/em\u003e \u003cem\u003ein vitro\u003c/em\u003e, we silenced its expression in C2C12 myoblasts differentiated into myotubes. Using qRT-PCR we determined that although \u003cem\u003eHectd1\u003c/em\u003e expression increased during myotube differentiation, it was efficiently silenced upon knockdown (\u003cstrong\u003eFig. 2f\u003c/strong\u003e). Under the same conditions, we also followed the expression of a select number of genes relevant to muscle function. \u003cem\u003eHectd1\u003c/em\u003e knockdown led to gene expression changes in pathways involved in calcium handling, muscle differentiation, protein turnover, and muscle size and structure (\u003cstrong\u003eSupplementary Fig. 2a,b,c,d\u003c/strong\u003e). Interestingly, we also observed a reduction in the expression of genes related to energy metabolism and mitochondrial function, such as Glut4 (\u003cem\u003eSlc2a4\u003c/em\u003e) and PGC-1a (\u003cem\u003ePpargc1a\u003c/em\u003e) (\u003cstrong\u003eSupplementary Fig. 2e\u003c/strong\u003e). Several major myopathy-causative genes were affected by the reduction in \u003cem\u003eHectd1\u003c/em\u003e levels (\u003cstrong\u003eFig. 2f)\u003c/strong\u003e. Among these were collagen alpha-1(VI) chain (\u003cem\u003eCol6a1\u003c/em\u003e)\u003csup\u003e17\u003c/sup\u003e, calpain 3 (\u003cem\u003eCapn3\u003c/em\u003e)\u003csup\u003e18\u003c/sup\u003e, dystrophin (\u003cem\u003eDmd\u003c/em\u003e)\u003csup\u003e19\u003c/sup\u003e, dm1 protein kinase (\u003cem\u003eDmpk\u003c/em\u003e)\u003csup\u003e20\u003c/sup\u003e, emerin (\u003cem\u003eEmd\u003c/em\u003e), four and a half lim domains 1 (\u003cem\u003eFhl1\u003c/em\u003e)\u003csup\u003e21\u003c/sup\u003e, nebulin (\u003cem\u003eNeb\u003c/em\u003e), and tropomyosin 3 (\u003cem\u003eTpm3\u003c/em\u003e)\u003csup\u003e22\u003c/sup\u003e. As E3 ubiquitin ligases are well-known for controlling protein degradation, we complemented the gene expression analysis with mass spectrometry-based proteomics analysis of cell extracts prepared on the first day of differentiation (\u003cem\u003ei.e.,\u003c/em\u003e 48 h after \u003cem\u003eHectd1\u003c/em\u003e silencing). Pathway analysis of proteins differentially detected in the \u003cem\u003eHectd1\u003c/em\u003e knockdown cell extracts vs scrambled siRNA controls highlighted, in line with HECTD1\u0026rsquo;s previously described function, an increase in processes related to the regulation of cell shape\u003csup\u003e23\u003c/sup\u003e, motility\u003csup\u003e24\u003c/sup\u003e, and organelle organization (\u003cstrong\u003eFig. 3a and Supplementary Fig. 3a\u003c/strong\u003e) and a robust decrease in processes related to muscle structure and contraction (\u003cstrong\u003eFig. 3b and Supplementary Fig. 3b\u003c/strong\u003e). The latter observation was somewhat surprising as most muscle E3 ligases are linked to target protein degradation. However, further network analysis of the proteomics data using STRING\u003csup\u003e25\u003c/sup\u003e confirmed a significantly decreased abundance of a large cluster of proteins related to sarcomere structure (\u003cstrong\u003eFig. 3c\u003c/strong\u003e, in light blue). This cluster of 30 proteins included, among others, several forms of Tropomyosin (TPM1 and TPM2), several forms of Troponin (TNNC1, TNNC2, TNNT2, TNNT3, with TNNT1 being the only increased protein in the cluster), Titin (TTN), alpha-actin-1 (ACTA1), several forms of Myosin heavy and light chains (MYH3, MYH6, MYH13, MYL6B, MYL1), and Nebulin (NEB)\u003csup\u003e1\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHECTD1 is the E3 ubiquitin ligase for KLHL40/41 and Nebulin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInterestingly, the cluster containing HECTD1 in the STRING analysis was connected to the decreased sarcomere structure components through Kelch-like family member 41 (KLHL41), which was also reduced upon \u003cem\u003eHectd1\u003c/em\u003e knockdown. KLHL41 and KLHL40 are molecular chaperones that share 51% identity and 72% similarity and are stabilized and activated by ubiquitylation. KLHL40/41 activation helps stabilize NEB\u003csup\u003e26\u003c/sup\u003e and Leiomodin 3 (LMOD3)\u003csup\u003e27\u003c/sup\u003e, which are fundamental for sarcomeric integrity\u003csup\u003e28,29\u003c/sup\u003e. Loss-of-function mutations in either of these 4 proteins have been implicated in nemaline myopathy\u003csup\u003e22\u003c/sup\u003e. One of the disease mechanisms that result in nemaline myopathy is caused by mutations that prevent the activation of KLHL40/41 through ubiquitylation by an E3 ubiquitin ligase that has remained unknown. This leads to the destabilization and aggregation of NEB, an 800 kDa protein that anchors the sarcomere thin filament into the Z-disc\u003csup\u003e30\u003c/sup\u003e. Because of its fundamental role in thin filament assembly and integrity, mechanisms that destabilize NEB cause sarcomere disorganization and muscle weakness (\u003cstrong\u003eFig. 3d\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo investigate if HECTD1 is the E3 ligase for KLHL40/41, we ectopically expressed wild-type (wt) \u003cem\u003eHectd1\u003c/em\u003e or a catalytically inactive mutant (mut)\u003csup\u003e31\u003c/sup\u003e, together with \u003cem\u003eKlhl41\u003c/em\u003e in BOSC23 cells. Immunoblotting analysis of the different proteins showed that indeed wt HECTD1 was able to stabilize KLHL41, whereas the catalytically inactive mut was not (\u003cstrong\u003eFig. 3e\u003c/strong\u003e). Using similar experimental conditions and co-expressing a Myc-tagged version of ubiquitin (Ub-Myc), we determined that the ubiquitylation levels of KLHL41 are increased in the presence of wt but not mut HECTD1 (\u003cstrong\u003eFig. 3f\u003c/strong\u003e). To evaluate if HECTD1-mediated KLHL41 ubiquitylation resulted in NEB stabilization, we repeated the experiments, co-expressing a NEB fragment previously shown to be stabilized by KLHL41, thus bypassing the challenge in over-expressing such a large protein\u003csup\u003e26\u003c/sup\u003e. Surprisingly, HECTD1 wt was sufficient to stabilize the NEB fragment, although this effect was even more pronounced in the presence of KLHL41 (\u003cstrong\u003eFig. 3g\u003c/strong\u003e). In this case, we could also observe an effect of mut HECTD1 on NEB fragment stabilization, albeit to a much lesser extent than in the presence of the wt protein (\u003cstrong\u003eFig. 3g\u003c/strong\u003e). Similar results were obtained for KLHL40 (\u003cstrong\u003eSupplementary Fig. 3c,d,e,f,g\u003c/strong\u003e) with the notable difference that KLHL40 was still stabilized by mut HECTD1 (suggesting E3 ligase redundancy in this case).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSkeletal muscle-specific \u003cem\u003eHectd1\u003c/em\u003e knockout mice show muscle weakness and signs of ongoing tissue remodeling\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further evaluate the consequences of losing \u003cem\u003eHectd1\u003c/em\u003e expression in skeletal muscle, we generated a skeletal muscle-specific \u003cem\u003eHectd1\u003c/em\u003e knockout mouse (\u003cem\u003eHectd1\u003c/em\u003e mKO) (\u003cstrong\u003eFig. 4a\u003c/strong\u003e). With this strategy, deletion of \u003cem\u003eHectd1\u003c/em\u003e exon 3 results in a premature stop codon after amino acid 50 of 2618, and the complete absence of the full-length protein in skeletal muscle (\u003cstrong\u003eFig. 4b and Supplementary Fig. 4a\u003c/strong\u003e) with a slight reduction in brown adipose tissue, liver and heart (\u003cstrong\u003eFig. 4c\u003c/strong\u003e) most likely due to known \u0026ldquo;leakage\u0026rdquo; of the human skeletal a-actin (HSA) promoter cassette. According to gnomAD, \u003cem\u003eHECTD1\u003c/em\u003e heterozygous loss-of-function variants are not tolerated (pLI score: 1, LOEUF score: 0.265), and missense mutations have intolerance to variation (Z-Score: 6.43). In line with these predictions, the whole-body knockout of \u003cem\u003eHectd1\u003c/em\u003e is embryonic lethal\u003csup\u003e32\u003c/sup\u003e, but some phenotypic data are available at the International Mouse Phenotyping Consortium (IMPC) \u0026nbsp;for heterozygous mice carrying only one \u003cem\u003eHectd1\u003c/em\u003e null allele (\u003cstrong\u003eSupplementary Fig. 4b\u003c/strong\u003e), which show significant changes in circulating calcium and alkaline phosphatase levels as well as immune cells\u003csup\u003e33\u003c/sup\u003e. Searching for potential \u003cem\u003eHectd1\u003c/em\u003e-associated phenotypes from eQTL studies shows a higher association to traits connected to the nervous system in line with its described role in neural tube morphogenesis and nervous system development (\u003cstrong\u003eSupplementary Fig. 4c\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMorphometric analysis of 4-month-old \u003cem\u003eHectd1\u003c/em\u003e mKO mice revealed no differences in body mass or composition determined by MRI in both males and females when compared with littermate controls (\u003cstrong\u003eFig. 4d,e\u003c/strong\u003e). Despite this observation, both male and female \u003cem\u003eHectd1\u003c/em\u003e mKOs performed worse than controls in a grip strength test, which was indicative of developing muscle weakness (\u003cstrong\u003eFig. 4f\u003c/strong\u003e). When determining the mass of different muscles, we detected differences in the \u003cem\u003eM. gastrocnemius\u003c/em\u003e (GA) and the \u003cem\u003eM. soleus\u003c/em\u003e (SOL), which were heavier in the \u003cem\u003eHectd1\u003c/em\u003e mKOs, compared to controls (\u003cstrong\u003eFig. 4g\u003c/strong\u003e). No differences were seen for the \u003cem\u003eM. extensor digitorum longus\u003c/em\u003e (EDL) and \u003cem\u003eM. tibialis anterior\u003c/em\u003e (TA). To evaluate if the differences in grip strength and muscle size were reflective of differences in fiber type composition, we determined the expression of myosin heavy chain (MyHC) genes type I (MyHCI), type IIa (MyHCIIa), type IIb (MyHCIIb), and type IIx (MyHCIIx). In EDL and SOL, examples of fast glycolytic and slow oxidative muscles, respectively, the observed pattern of MyHC gene expression was indicative of a shift towards weaker, more oxidative fibers (\u003cem\u003ei.e.\u003c/em\u003e, increased MyHCI in both EDL and SOL) as well as higher expression of embryonic MyHC (eMyHC) and Myogenin (\u003cem\u003eMyog\u003c/em\u003e) indicative of ongoing tissue regeneration (\u003cstrong\u003eFig. 4h\u003c/strong\u003e)\u003csup\u003e34,35\u003c/sup\u003e. Similar but statistically less significant trends were observed in TA and GA muscles (\u003cstrong\u003eSupplementary Fig. 4d\u003c/strong\u003e). The development of muscle weakness in the \u003cem\u003eHectd1\u003c/em\u003e mKOs was progressive as we could not see statistically significant differences in \u003cem\u003eex vivo\u003c/em\u003e muscle contractility in 8-week-old animals (\u003cstrong\u003eFig. 4i and Supplementary Fig. 4e\u003c/strong\u003e), except for a faster recovery from fatigue for the \u003cem\u003eHectd1\u003c/em\u003e mKO SOL (\u003cstrong\u003eFig. 4i\u003c/strong\u003e). Additionally, even though these different molecular signatures were already altered in 4-month-old \u003cem\u003eHectd1\u003c/em\u003e mKOs, those animals did not display differences in exercise performance measured by running to exhaustion either due to compensation from the slower oxidative MyHCs, the fact that not all the muscles are affected equally, or the relatively young age (\u003cstrong\u003eSupplementary Fig. 4f\u003c/strong\u003e). Taken together these data indicate that \u003cem\u003eHectd1\u003c/em\u003e mKO mice suffer from progressive muscle weakness with hallmarks of ongoing tissue regeneration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTranscriptomics and proteomics analysis of \u003cem\u003eHectd1\u003c/em\u003e mKO muscle reveal multiple molecular marks of myopathy with mitochondrial dysfunction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferent muscle beds seem to respond differently to the absence of \u003cem\u003eHectd1\u003c/em\u003e expression. We have evaluated gene expression of a few selected genes connected to major skeletal muscle processes such as structure, calcium handling, mitochondrial metabolism, and protein turnover (\u003cstrong\u003eSupplementary Fig. 4g\u003c/strong\u003e). Among the analyzed muscle beds, SOL from \u003cem\u003eHectd1\u003c/em\u003e mKOs showed the largest shift in gene expression (including MyHCs), when compared to controls. To further explore the molecular changes behind the observed \u003cem\u003eHectd1\u003c/em\u003e mKO phenotype, we performed global analysis of gene expression by RNA-seq using the SOL muscle (\u003cstrong\u003eFig. 5a\u003c/strong\u003e). Comparing differentially expressed genes (DEGs) between \u003cem\u003eHectd1\u003c/em\u003e mKO and wt littermate controls we obtained 1,236 genes with higher and 1,182 genes with lower expression (\u003cstrong\u003eFig. 5b\u003c/strong\u003e). Prediction of upstream transcription factors (TFs) that potentially regulate the genes with lower expression were mostly related to energy metabolism, highlighting several well-known regulators of cellular bioenergetics\u003csup\u003e12\u003c/sup\u003e such as Yin-Yang 1 (YY1), Estrogen-related Receptor (ERR), Estrogen Receptor (ER), and Thyroid Hormone Receptor (TR) (\u003cstrong\u003eFig. 5c\u003c/strong\u003e). Conversely, genes with higher expression in \u003cem\u003eHectd1\u003c/em\u003e mKO muscle were predicted to be under the control of TFs related to muscle differentiation\u003csup\u003e36\u003c/sup\u003e and remodeling, including Myogenin (MYOG), Myogenic Differentiation 1 (MYOD), Paired Box (PAX) and Mothers Against Decapentaplegic Homolog (SMAD) (\u003cstrong\u003eFig. 5d\u003c/strong\u003e). Pathway analysis across several knowledgebases highlighted multifaceted effects of \u003cem\u003eHectd1\u003c/em\u003e knockout. Disease-Gene associations (DisGeNET)\u003csup\u003e37\u003c/sup\u003e showed that DEGs regulated by \u003cem\u003eHectd1\u003c/em\u003e are related to several myopathies and mitochondriopathies (\u003cstrong\u003eFig. 5e\u003c/strong\u003e). Wikipathways\u003csup\u003e38\u003c/sup\u003e and Reactome\u003csup\u003e39\u003c/sup\u003e pathway databases highlighted an upregulation of pathways connected to extracellular matrix, cytoskeletal remodeling and adhesion, whereas DEGs with reduced expression in \u003cem\u003eHectd1\u003c/em\u003e mKO muscle were again indicative of mitochondrial dysfunction and energy metabolism (\u003cstrong\u003eSupplementary Fig. 5a,b\u003c/strong\u003e). Comparing DEG signatures from \u003cem\u003eHectd1\u003c/em\u003e mKO muscles to previously analyzed public datasets showed the greatest concordance with denervation in line with our previous observation, since it manifests with both atrophy and hallmarks of regeneration like centrally nucleated fibers (\u003cstrong\u003eSupplementary Fig. 5c\u003c/strong\u003e). As for the \u003cem\u003ein vitro\u003c/em\u003e studies, we performed proteomics analysis of \u003cem\u003eHectd1\u003c/em\u003e mKO SOL and EDL vs controls (\u003cstrong\u003eFig. 5f,g,h\u003c/strong\u003e). From the comparisons, we detected 462 and 166 more abundant proteins compared to 345 and 33 less abundant proteins in \u003cem\u003eHectd1\u003c/em\u003e mKO SOL and EDL extracts vs the corresponding controls, respectively (\u003cstrong\u003eFig. 5g,h\u003c/strong\u003e). Performing pathway analysis with the list of proteins differentially detected only in the \u003cem\u003eHectd1\u003c/em\u003e mKO SOL vs wt showed changes primarily related to bioenergetics, whereas the proteins in common between SOL and EDL grouped under protein refolding (\u003cstrong\u003eFig. 5i)\u003c/strong\u003e. No differentially regulated pathways were identified from proteins unique to the EDL, probably due to their low number. As HECTD1 is an E3 ubiquitin ligase, we were interested in determining which changes in protein levels could be explained by changes in the corresponding transcripts, and which changes in protein stability could be directly dependent on its enzymatic activity. To this end, we compared the SOL transcriptomics and proteomics data and found 332 IDs in common between both sets, with high concordance where 303 were co-regulated (\u003cem\u003ei.e.\u003c/em\u003e, either increased or decreased in both omics analysis) and only 29 contra-regulated (\u003cstrong\u003eFig. 5j,k\u003c/strong\u003e). These genes/proteins grouped in pathways of energy metabolism connected mostly to mitochondria, with a small contribution from protein folding (\u003cstrong\u003eSupplementary Fig. 5d\u003c/strong\u003e). Interestingly, 455 proteins in the proteomics analysis did not have a corresponding DEG in the transcriptomics data (\u003cstrong\u003eFig. 5j\u003c/strong\u003e). Here we could find a small contribution from pathways of energy metabolism as well, but a higher proportion of proteasomal degradation, protein stability, and translation (\u003cstrong\u003eFig. 5j\u0026nbsp;\u003c/strong\u003eand\u003cstrong\u003e\u0026nbsp;Supplementary Fig. 5d\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHectd1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e\u0026nbsp;mKOs are glucose-intolerant and show progressive loss of muscle strength and exercise performance\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDue to the repeated and strong indication of mitochondrial dysfunction, we decided to further investigate this feature of the \u003cem\u003eHectd1\u003c/em\u003e mKO phenotype. In addition to the transcriptomics and proteomics data showing a reduction in mitochondrially-encoded genes and proteins, we performed immunoblotting using antibodies for the different electron transport chain (ETC) complexes, which also showed a robust decrease in all analyzed components (\u003cstrong\u003eFig. 6a,b\u003c/strong\u003e). The changes in mitochondrial RNA processing and transport in RNA-seq data (\u003cstrong\u003eSupplementary Fig. 5e,f\u003c/strong\u003e) prompted us to determine the protein levels for some of the key components, and we could see a decrease in expression for Leucine Rich Pentatricopeptide Repeat Containing (LRPPRC), mitochondrial Lon Peptidase 1 (LONP1), Translocase Of Outer Mitochondrial Membrane 20 (TOMM20), and Voltage Dependent Anion Channel 1 (VDAC1) without changes in Heat Shock Protein 60 (HSP60) or Transcription Factor A, Mitochondrial (TFAM) (\u003cstrong\u003eFig. 6c,d\u003c/strong\u003e). We did not observe differences in mitochondrial DNA content (\u003cstrong\u003eSupplementary Fig. 5g,h\u003c/strong\u003e), probably due to the compensatory elevation in the expression of RNA Polymerase Mitochondrial (POLRMT) (\u003cstrong\u003eSupplementary Fig. 5f\u003c/strong\u003e). This decrease in mitochondrial ETC components could also be seen using skeletal muscle sections of \u003cem\u003eHectd1\u003c/em\u003e mKOs, measured by the activity of mitochondrial complexes I and II (\u003cstrong\u003eFig. 6e,f\u003c/strong\u003e). In accordance with these data, an intraperitoneal glucose tolerance test showed that indeed \u003cem\u003eHectd1\u003c/em\u003e mKOs are significantly less glucose tolerant than littermate controls at the age of 4 months, even when on a chow diet (\u003cstrong\u003eFig. 6g,h\u003c/strong\u003e). Because of the seemingly progressive nature of the \u003cem\u003eHectd1\u003c/em\u003e mKO, we evaluated a cohort of 1-year-old mice for their muscle strength and endurance performance. At this age, grip strength was even more drastically reduced (\u003cstrong\u003eFig. 6i\u003c/strong\u003e) and exercise performance was now significantly impaired in the mKOs (\u003cstrong\u003eFig. 6j\u003c/strong\u003e), but still no differences in body mass or composition were observed (\u003cstrong\u003eSupplementary Fig. 6a\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistopathology analysis of \u003cem\u003eHectd1\u003c/em\u003e mKO muscle shows myofibrillar disorganization and subsarcolemmal accumulation of desmin \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eElectron microscopy analysis of \u003cem\u003eHectd1\u003c/em\u003e mKO SOL sections at 6 months of age revealed a heterogeneous phenotype among the muscle fibers, with profound sarcomere disruption in some fibers but conserved structure in others (\u003cstrong\u003eFig. 6k\u003c/strong\u003e). However, alterations in mitochondrial structure were apparent and seen throughout the sections. In addition, we could see many vacuoles adjacent to mitochondria and sarcomeres (\u003cstrong\u003eFig. 6k\u003c/strong\u003e). At one year, the muscle histopathological features were more evident and showed a unique histological phenotype of a \u0026ldquo;desmin storage myopathy\u0026rdquo; in \u003cem\u003eHectd1\u003c/em\u003e mKO mice (\u003cstrong\u003eFig. 6l\u003c/strong\u003e). This is witnessed by the accumulation of subsarcolemmal material in several muscle fibers, with a pale blue or hyaline appearance on trichrome sections. The identified storage material strongly reacted to desmin and to a lesser extent to desmin-related protein alpha-crystallin B chain, while failing to react to dystrophin-C, myotilin, and alpha-actinin. Most of the fibers had a lobulated appearance of their sarcoplasm, highlighted by the NADH-NTB stain, indicating disorganization of the myofibrillar network. Furthermore, there was increased subsarcolemmal mitochondrial content on light microscopy and EM, and accumulation of structurally abnormal mitochondria on EM indicating mitochondrial dysfunction (\u003cstrong\u003eFig. 6l\u003c/strong\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of a family with a \u003cem\u003eHECTD1\u003c/em\u003e variant associated with muscle weakness.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo learn if \u003cem\u003eHECTD1\u003c/em\u003e might be responsible for muscle disease in humans we interrogated the exome data of 1,150 undiagnosed patients with unexplained muscle disease\u003csup\u003e40\u003c/sup\u003e for variants in the \u003cem\u003eHECTD1\u003c/em\u003e gene. Standard filtering criteria for rare diseases were applied, both for a recessive and a dominant mode of inheritance, namely moderate to high Variant Effect Predictor (VEP) and minor allele frequency (MAF) 0% or up to 1% in the control population, respectively. No patients with rare recessive (either homozygous or compound heterozygous) variants were identified in the unsolved cohort. However, a novel heterozygous \u003cem\u003eHECTD1\u003c/em\u003e variant was found in a family with two affected individuals (over two generations). The variant (hg38:chr14:31136628G\u0026gt;A) results in a non-synonymous amino acid change at position 1006 (A1006V) and is predicted to be deleterious with a Combined Annotation Dependent Depletion\u003csup\u003e41\u003c/sup\u003e score of 28 (\u003cem\u003ei.e.,\u003c/em\u003e amongst the top 0.16% most deleterious variants in the genome), a SIFT\u003csup\u003e42\u003c/sup\u003e score of \u0026nbsp;0 (deleterious) and \u0026nbsp;a PolyPhen\u003csup\u003e43\u003c/sup\u003e score of 0.722 (possibly damaging). It is absent from +152,000 control alleles of gnomAD (https://gnomad.broadinstitute.org) and 37,430 internal controls, both in the homozygous and heterozygous state. The HECTD1-A1006V carriers were a father and son, with no further family history of muscle disease. Both patients showed significantly elevated creatine kinase levels, but only the father showed additional clinical symptoms. These included distal and proximal muscle weakness and signs of neuropathic changes determined by electromyogram.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman iPSC-derived myotubes engineered with the \u003cem\u003eHECTD1\u003c/em\u003e \u003cem\u003e31136628G\u0026gt;A\u003c/em\u003e substitution show deficits in sarcomere structure and bioenergetic pathways\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe HECTD1-A1006V substitution\u0026nbsp;is not predicted to lead to a complete loss of function. This would also not be expected due to the predicted embryonic lethality of a complete lack of HECTD1. To investigate the consequences of the HECTD1-A1006V variant for muscle cell function, we engineered human iPSCs from a healthy donor to carry the heterozygous 31136628G\u0026gt;A substitution. Mutant and isogenic control cell lines were differentiated to myoblasts, and then to myotubes\u003csup\u003e44\u003c/sup\u003e. We observed no differences in the differentiation potential of either line, or any other apparent morphological differences (\u003cstrong\u003eFig. 7a\u003c/strong\u003e). In addition, \u003cem\u003eHECTD1\u003c/em\u003e transcript and protein levels were similar between both lines (\u003cstrong\u003eFig. 7b,c)\u003c/strong\u003e. However, RNA-sequencing analysis of gene expression comparing the DEGs between HECTD1-A1006V mutant and control myotubes revealed 548 genes with higher and 430 genes with lower expression (\u003cstrong\u003eFig. 7d,e\u003c/strong\u003e). Performing pathway analysis using genes with lower expression in the mutant cell line highlighted clear signatures of myopathy, muscle weakness and neuropathy (\u003cstrong\u003eFig. 7f\u003c/strong\u003e), and molecular pathways related to muscle contraction and translation (\u003cstrong\u003eFig. 7g)\u003c/strong\u003e. Mirroring what we saw in the \u003cem\u003eHectd1\u003c/em\u003e mKO muscle transcriptomics and myotube \u003cem\u003eHectd1\u003c/em\u003e knockdown proteomics data sets, we identified a cluster of muscle contraction-related genes showing significantly lower expression in the HECTD1-A1006V line (vs the isogenic control), which included several thin filament components, and desmin (\u003cstrong\u003eFig. 7h,i\u003c/strong\u003e). In contrast, signatures of metabolic dysfunction were comparatively modest relative to \u003cem\u003eHectd1\u003c/em\u003e mKO muscle, but nonetheless evident, including reduced expression of several ETC components and other metabolic enzymes, as well as lowered mitochondrial DNA transcription (\u003cstrong\u003eSupplementary Fig. 6b\u003c/strong\u003e). Among the upregulated genes, the dominant molecular signature reflected extracellular matrix remodeling and altered calcium signaling (\u003cstrong\u003eSupplementary Fig. 6c,d,e\u003c/strong\u003e). These data show that the heterozygous HECTD1-A1006V mutation is sufficient to elicit some of the changes observed in our other loss-of-function \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e models. Together, this work positions HECTD1 at the intersection between sarcomere maintenance and stability and mitochondrial function and opens avenues for therapeutic exploration aimed at preserving muscle structure and metabolic function in both aging and disease.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePathological states in which sarcomere structure or function is disrupted can provide valuable windows into the machinery required for its maintenance. We therefore reasoned that examining changes in gene expression across different species and muscle diseases could reveal factors that are essential under normal conditions but difficult to identify in an unperturbed system. This strategy led us to HECTD1, whose loss unmasks a previously unrecognized requirement for this E3 ligase in sustaining thin-filament stability, sarcomere organization, and mitochondrial function. We show that HECTD1 is needed for thin-filament assembly as it is required to stabilize several regulatory and structural sarcomere components including KLHL40/41, nebulin, and desmin. Although we identified the \u003cem\u003eHECTD1\u003c/em\u003e gene as downregulated in different myopathy muscle samples, its expression is increased in conditions of muscle atrophy. Several E3 ligases such as MAFbx/ATROGIN1/FBXO32\u003csup\u003e3\u003c/sup\u003e, MURF1/TRIM63\u003csup\u003e2\u003c/sup\u003e, MUSA1/FBXO30\u003csup\u003e4\u003c/sup\u003e, SMART/FBXO21\u003csup\u003e45\u003c/sup\u003e are known to be increased during muscle atrophy, where they target different sarcomeric components for degradation. Conversely, E3 ligases such as UBR4 and UBR5 promote muscle hypertrophy through involvement of the HAT1/RBBP4/RBBP7 histone-binding complex\u003csup\u003e5\u003c/sup\u003e, and Hedgehog signaling\u003csup\u003e46\u003c/sup\u003e, respectively. Although we cannot rule out that HECTD1-mediated ubiquitylation targets some muscle proteins directly for degradation, our findings show that it is critical for sarcomere assembly and maintenance, where it takes on the role of a molecular chaperone. The paradoxical increase in \u003cem\u003eHectd1\u003c/em\u003e expression during muscle atrophy could therefore be a compensatory mechanism or part of a dynamic interplay between sarcomere assembly and disassembly, which during atrophy tips towards the latter. Interestingly, it has been reported that desmin levels increase during some cases of muscle atrophy, which is hypothesized to be a compensatory mechanism to support the electromechanical properties of wasting fibers\u003csup\u003e47\u003c/sup\u003e. There is limited information about what happens to KLHL40/41 and NEB during muscle atrophy.\u003c/p\u003e \u003cp\u003eInterestingly, whereas mutations that prevent activation of KLHL40/41 - NEB are not often studied for their effects on muscle bioenergetic defects, we observe ample evidence of mitochondrial dysfunction in our \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e models of \u003cem\u003eHectd1\u003c/em\u003e silencing/knockout. Since mutations in desmin cause both structural abnormalities and mitochondrial dysfunction\u003csup\u003e6\u003c/sup\u003e, this could be a consequence of the breakdown of the desmin filament network, which links the contractile myofibrils to the sarcolemma and cellular organelles. Evidence of mitochondrial dysfunction appears in both our transcriptomics and proteomics data sets obtained with loss of \u003cem\u003eHectd1\u003c/em\u003e function, suggesting that HECTD1 does not directly control the stability of metabolic components. However, its absence may affect the activity of an upstream transcription factor necessary to maintain mitochondrial homeostasis. Our analysis of putative upstream regulators that could be responsible for a reduction in gene expression upon \u003cem\u003eHectd1\u003c/em\u003e deletion indeed highlighted YY1, ER, ERRα, and TR (among others), all known positive regulators of mitochondrial function\u003csup\u003e48\u0026ndash;51\u003c/sup\u003e. Conversely, predicted upstream regulators for genes with increased expression upon \u003cem\u003eHectd1\u003c/em\u003e knockout include MYOG, MYOD, and PAX transcription factors, clearly indicative of an ongoing muscle regeneration process\u003csup\u003e52\u003c/sup\u003e. This molecular signature of unresolved muscle remodeling is further supported by the increase in embryonic myosin heavy chain expression we see in \u003cem\u003eHectd1\u003c/em\u003e mKO muscles. Considering the conservation of many of the sarcomere components regulated by HECTD1 between skeletal muscle and the heart, where \u003cem\u003eHectd1\u003c/em\u003e is also expressed, it is tempting to speculate that this E3 ligase may also play a role in heart disease. Indeed, polymorphisms predicted to affect \u003cem\u003eHectd1\u003c/em\u003e splicing have been correlated with the incidence of congenital heart disease, although this has not been experimentally tested\u003csup\u003e53\u003c/sup\u003e. In addition to its reported links to neurological disease, our work uncovers \u003cem\u003eHectd1\u003c/em\u003e as a potential common target in skeletal muscle, heart, and brain disease. As complete loss of \u003cem\u003eHectd1\u003c/em\u003e function is not compatible with life, we endeavored to identify families affected by myopathy without a genetic diagnostic carrying \u003cem\u003eHECTD1\u003c/em\u003e mutations. Remarkably, modeling the identified patient mutation in human iPCS-derived myotubes revealed a significant overlap with the pathways we found to be dysregulated in the C2C12 knockdown and in the \u003cem\u003eHectd1\u003c/em\u003e mKO experiments. Based on available domain annotations, HECTD1 A1006 resides in the inter-module linker between the ankyrin repeat region (~\u0026thinsp;aa 366\u0026ndash;457) and the C-terminal SUN/MIB2 domain (~\u0026thinsp;aa 1107\u0026ndash;1240). Although not within the catalytic HECT domain (~\u0026thinsp;aa 2131\u0026ndash;2608), this region likely contributes to substrate/adaptor binding or domain orientation. Therefore, the A1006V mutation plausibly disrupts the structural scaffold required for HECTD1 to recruit or stabilize client proteins. Further work focusing on \u003cem\u003eHECTD1\u003c/em\u003e coding mutations, SNPs in gene regulatory regions, or mechanisms of stimulus- and age-dependent loss of gene expression will further highlight HECTD1 as a novel controller of sarcomere integrity and mitochondrial function in skeletal muscle. Given the conservation of several of the affected molecular components in several cell types (e.g. desmin, and mitochondrial ETC components), HECTD1 may play similar roles in other organs.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cem\u003e\u003cu\u003ePublicly available datasets\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eData for \u003cem\u003eHectd1\u003c/em\u003e expression in different animal models and human cohorts were collected from the following studies deposited on GEO database: GSE103608 (Collagen VI-related muscular dystrophy, Control vs Pooled Col6RD), GSE120642 (Critical limb ischemia, Healthy adult vs Critical limb ischemia), GSE169571 (Intraperitoneal dexamethasone injection, Pooled wt saline vs pooled wt dexamethasone), GSE115650 (Facioscapulohumeral muscular dystrophy, Control vs FSHD), GSE202745 (Limb-girdle muscular dystrophy, \u003cem\u003eM.\u003c/em\u003e \u003cem\u003evastus lateralis\u003c/em\u003e, Control vs Disease), GSE145480 (Aging in rodents as models of human sarcopenia, 8 month vs 28 month), GSE201255 (Myotonic dystrophy type 1 (DM1), Adult Controls vs adult onset DM1), GSE139213 (Skeletal muscle \u003cem\u003eTsc1\u003c/em\u003e knockout mice, \u003cem\u003eTsc1\u003c/em\u003e fl/fl vehicle vs \u003cem\u003eTsc1\u003c/em\u003e mKO vehicle), GSE237099 (Analysis of skeletal muscle gene expression upon mouse hindlimb unloading and reloading, Control vs Hindlimb unloading), GSE114820 (Cancer-Cachexia in Tumor-Bearing Mice, PBS Control vs LLC 4 weeks), GSE151757 (Inclusion body myositis, AMP vs IBM), SRP196460 (Denervation, 0 days vs 14 days), GSE147127 (Myofiber single-nucleus RNA-seq, 5 month \u003cem\u003eM. soleus\u003c/em\u003e and 5 month \u003cem\u003eM.\u003c/em\u003e \u003cem\u003etibialis anterior\u003c/em\u003e). Publicly available datasets were downloaded and converted to fastq files using SRA Toolkit (NCBI).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAnalysis of gene expression using quantitative real-time PCR (qRT-PCR)\u003c/p\u003e\n\u003cp\u003eTissues samples for skeletal muscle and heart were first pulverized using a dry ice-cold mortar and pestle. Total RNA was extracted from cell cultures and frozen tissue using TRI reagent (Sigma-Aldrich) per manufacturer\u0026apos;s instructions. Subsequently 1 \u0026mu;g of RNA was treated with Amplification Grade DNAse I (Thermo Scientific) and 500 ng of DNase-treated RNA was used to prepare cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qRT-PCR using SYBR Green and primer pairs specific to each target transcript was performed on a ViiA7 and QuantStudio6 real-time PCR system (Applied Biosystems). Gene expression was calculated following the delta-delta Ct method and normalized to the expression of hypoxanthine phosphoribosyltransferase (\u003cem\u003eHprt\u003c/em\u003e) as a housekeeping gene for cell culture samples and geometric mean of \u003cem\u003eHprt\u003c/em\u003e and TATA-binding protein (\u003cem\u003eTbp\u003c/em\u003e) as a housekeeping gene for tissue samples.\u003c/p\u003e\n\u003cp\u003eWestern Blot\u003c/p\u003e\n\u003cp\u003eCell cultures and frozen tissues were homogenized directly in SDS protein lysis buffer (125 mM Tris-HCl, pH 6.8; 2% SDS; 10% glycerol) and sonicated on Soniprep 150 (MSE). Protein lysates were quantified using the Pierce BCA Protein Assay Kit (Thermo Scientific) according to the manufacturer\u0026rsquo;s instructions. After adding 5%\u0026nbsp;b-mercaptoethanol and 0.004% bromophenol blue samples were boiled at 70 \u0026deg;C for 15 min. Protein extracts were resolved by SDS polyacrylamide gel electrophoresis and transferred into polyvinylidene difluoride membranes. Membranes were blocked with 5% skim milk and incubated with antibodies against: HECTD1 (Abcam ab101992), FLAG M2 (Sigma-Aldrich F1804), FLAG M2 Affinity Gel (Sigma-Aldrich A2220), C-MYC (Sigma-Aldrich C3956), HA (Biolegend 901501), ERK1/2 (CST 9101), p-ERK1/2 T202/Y204 (CST 9102), AKT (CST 9272), p-AKT S473 (CST 4058), alpha-tubulin (Sigma-Aldrich T6199), OXPHOS mitoprofile (Abcam ab110413), COXIV (Invitrogen A21348), HSC70 (Santa Cruz sc-7298), LRPPC (Sigma HPA036409), LONP1 (Invitrogen PA5-51692), TOMM20 (Santa Cruz sc-17764), VDAC1 (Abcam ab14734), mtHSP60 (Enzo Lifesciences AB1-SPA-807-E), TFAM (Abcam ab-131607). Western blot band densitometry was performed using ImageLab software (BioRad) with volumetric analysis and normalized to membrane stained with amido black 10B as loading control.\u003c/p\u003e\n\u003cp\u003eHindlimb unloading and reloading\u003c/p\u003e\n\u003cp\u003eThis protocol was modified from previous studies\u003csup\u003e54\u003c/sup\u003e. 10 to 12-week-old male C57BL/6J mice or 8-week-old female mice were assigned to three main groups: control, hindlimb unloading or hindlimb reloading. For the hindlimb unloading phase, mice were slightly suspended by tail for the specified number of days, maximum 10. Briefly, mice were placed inside a restrainer and, using hypoallergenic medical tape, a nylon line was attached in a helical pattern around the base of the tail. The line was connected to a small swivel keychain with metal rings that were attached to a rod running the length of the cage (GR900, Tecniplast). The hindlimbs were kept off the ground with the mouse\u0026rsquo;s body at an approximately 30\u0026deg; angle. Mice were able to move freely on the y-axis, rotate 360\u0026deg; using their forelegs, and had access to one side of the cage with food and water \u003cem\u003ead libitum\u003c/em\u003e. Mice were housed in pairs during the unloading phase. The reloading phase commenced after 10 days of hindlimb unloading, where the animals were returned to normal ambulation in conventional cages for the specified number of days. Control mice were kept in conventional cages throughout the entire protocol.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eDownhill running\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo induce microtrauma to limb muscle sarcomeres, adult mice were subjected to an acute bout of downhill running as previously described\u003csup\u003e55\u003c/sup\u003e. Briefly, following a four-day familiarization period, animals ran for 5 min at 6 m/min, followed by 55 min at 17 m/min on a 15\u0026ordm; downhill slope. Hindlimb muscles were harvested and snap frozen in liquid nitrogen immediately (0 h), or 8 h, 24 h, 72 h, and 144 h after the acute bout. Muscles were subsequently processed for RNA extraction and qRT-qPCR as described above.\u003c/p\u003e\n\u003cp\u003eBaCl\u003csub\u003e2\u003c/sub\u003e injections\u003c/p\u003e\n\u003cp\u003eTo induce muscle injury (myonecrosis), mice were intramuscularly injected with barium chloride (BaCl\u003csub\u003e2\u003c/sub\u003e; 1.2% in saline). Prior to the procedure, mice were given a subcutaneous injection of 0.05 - 0.1 mg/kg buprenorphine and placed under isoflurane anesthesia. Right \u003cem\u003egastrocnemius\u003c/em\u003e muscle of 8-week-old male C57BL/6J mice were injected with 50 \u0026mu;l of BaCl\u003csub\u003e2\u003c/sub\u003e and the contralateral \u003cem\u003egastrocnemius\u003c/em\u003e muscle was injected with an equivalent volume of control solution (saline). Mice were monitored and given postoperative pain relief for 1-2 days. The injected muscles were collected at the specified time points.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003ePrimary myoblast and myotube cultures, and dexamethasone treatments\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eMouse primary myoblasts were isolated, cultured and differentiated according to previously described methods\u003csup\u003e55\u003c/sup\u003e. Muscles of 2-week-old C57BL/6J mice were harvested from the fore- and hindlimbs, minced, and incubated with 2.4 U/ml dispase (Grade II, Roche), 1% collagenase B (Roche), and 2.5 mM CaCl\u003csub\u003e2\u003c/sub\u003e for 25 min at 37 \u0026deg;C. The cell suspension was homogenized by pipetting, filtered through a 70 \u0026mu;m cell strainer, centrifuged, resuspended in Ham\u0026rsquo;s F-10 Nutrient Mix (Gibco) supplemented with 20% fetal bovine serum (Sigma-Aldrich), 2.5 ng/ml basic fibroblast growth factor (Thermo-Fisher Scientific), 2.5 mg/ml fungizone (Thermo-Fisher Scientific), 5 mg/ml plasmocin (Invivogen) and 100 U/ml penicillin-streptomycin (Gibco), and plated in regular tissue culture dishes to remove contaminant fibroblasts. After 20 min, cells were transferred to collagen-coated tissue culture dishes. Pre-plating in regular culture dishes was performed at every passage until there was no fibroblast contamination. Cells were then maintained and expanded at low confluence in a 1:1 mixture of DMEM (Gibco) and Ham\u0026apos;s F10 Nutrient Mix supplemented with 20% fetal bovine serum, 2.5 ng/ml basic fibroblast growth factor and 100 U/ml penicillin-streptomycin. To differentiate the myoblasts into myotubes, cells were seeded in growth medium at high confluence and switched to differentiation medium (DMEM with 5% horse serum and 100 U/ml penicillin-streptomycin) 16-24 hours later. Full differentiation of the myotubes was typically achieved 2-3 days after induction and was confirmed using light microscopy. Myoblasts were maintained, expanded, and differentiated in collagen-coated tissue culture dishes at 37 \u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. Fully differentiated myotubes were treated with Dexamethasone for the indicated periods of time at the different concentrations.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eC2C12 myotubes\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eC2C12 cells were purchased from ATCC and grown at 37 \u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e in DMEM, 10% FBS, and 100 U/ml penicillin streptomycin. To differentiate them into myotubes, cells were seeded in growth medium at high confluence and switched to differentiation medium (DMEM with 2% horse serum (Sigma-Aldrich) and 100 U/ml penicillin-streptomycin) 16-24 h later for 2-3 days.\u003c/p\u003e\n\u003cp\u003esiRNA transfection\u003c/p\u003e\n\u003cp\u003eC2C12 cells were transfected according to the following protocol. Combination of two control and \u003cem\u003eHectd1\u003c/em\u003e siRNAs (Dharmacon) and Lipofectamine RNAiMAX (Invitrogen) were separately incubated in serum-free Optimem (Thermo-Fisher Scientific) for 8 min. Solutions were then mixed, resulting in a ratio of 50 nM total siRNA to 1 \u0026mu;l of Lipofectamine and incubated for 15 min at room temperature. The transfection mixture was added to the 6-well plate and mixed with a suspension of freshly trypsinized cells.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eC2C12 proteomics\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eProteolytic digestion\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCell pellets were solubilized in 20 \u0026micro;l of 8 M urea in 50 mM Tris-HCl, pH 8.5 sonicated in water bath for 5 min before 10 \u0026micro;l of 1% ProteaseMAX surfactant (Promega) in 10% acetonitrile (ACN) and Tris-HCl as well as 1 \u0026micro;l of 100x protease inhibitor cocktail (Roche) was added. The samples were then sonicated using VibraCell probe (Sonics \u0026amp; Materials, Inc.) for 40 s with pulse 2-2 s (on/off) at 20% amplitude. Protein concentration was determined by BCA assay (Pierce) and a volume corresponding to 25 \u0026micro;g of protein of each sample was taken and supplemented with Tris-HCl buffer up to 90 \u0026micro;l. Proteins were reduced with 3.5 \u0026micro;l of 250 mM dithiothreitol in Tris-HCl buffer, incubated at 37 \u0026deg;C during 45 min and then alkylated with 5 \u0026micro;l of 500 mM iodoroacetamide at room temperature (RT) in dark for 30 min. Then 0.5 \u0026micro;g of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37 \u0026deg;C. \u0026nbsp;The digestion was stopped with 5 \u0026micro;l cc. formic acid (FA), incubating the solutions at RT for 5 min. The sample was cleaned on a C18 Hypersep plate with 40 \u0026micro;l bed volume (Thermo Fisher Scientific), dried using a vacuum concentrator (Eppendorf).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePRLC-MS/MS analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe peptides in solvent A (0.1% FA in 2% ACN) were separated on a 50 cm long EASY-Spray C18 column (Thermo Fisher Scientific) connected to an Ultimate 3000 nano-HPLC (Thermo Fisher Scientific) using a gradient from 2-26% of solvent B (98% AcN, 0.1% FA) in 90 min and up to 95% of solvent B in 5 min at a flow rate of 300 nl/min. Mass spectra were acquired on a Orbitrap Fusion Lumos tribrid mass spectrometer (Thermo Fisher Scientific) ranging from \u003cem\u003em/z\u003c/em\u003e 375 to 1600 at a resolution of R=120,000 (at \u003cem\u003em/z\u003c/em\u003e 200) targeting 4x10\u003csup\u003e5\u003c/sup\u003e ions for maximum injection time of 50 ms, followed by data-dependent higher-energy collisional dissociation (HCD) fragmentations of precursor ions with a charge state 2+ to 6+, using 30 s dynamic exclusion. The tandem mass spectra of the top precursor ions were acquired in 2 s cycle time with a resolution of R=30,000, targeting 5x10\u003csup\u003e4\u003c/sup\u003e ions for maximum injection time of 54 ms, setting quadrupole isolation width to 0.7 Th and normalized collision energy to 28%.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eData analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data files were loaded in Proteome Discoverer v2.4 and searched against mouse UniProt protein databases using the Mascot Server 2.5.1 search engine (Matrix Science Ltd.). Parameters were chosen as follows: up to two missed cleavage sites for trypsin, precursor mass tolerance 10 ppm, and 0.02 Da for the HCD fragment ions. Dynamic modifications of oxidation on methionine, deamidation of asparagine and glutamine and acetylation of N-termini were set. Protein annotation was also performed in Proteome Discoverer using the Gene Ontology database on the server of Thermo Scientific linked with biological processes, cellular localization and molecular function. Initial search results were filtered with 5% FDR using Percolator node in Proteome Discoverer. Quantification was based on the precursor ion intensities. For quantification both unique and razor peptides were requested.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAdditional bioinformatics analyses\u003c/p\u003e\n\u003cp\u003eUpset plots were created with differentially expressed genes from publicly available data sets separated into mouse models of atrophy and human myopathy samples. Atrogene heatmap was created from curated list of atrogenes\u003csup\u003e7-9\u003c/sup\u003e in the following way. Atrogenes were sorted based on the number of datasets they are differentially expressed in and sum of fold-changes across these datasets. Top 80 genes are shown, clustered by Euclidean distance. Differentially regulated pathways from C2C12 \u003cem\u003eHectd1\u003c/em\u003e knockdown myotubes were created using AmiGO with Gene Ontology databases and String network was created from proteins that had at least two neighboring nodes and minimum interaction score of 0.7 (high confidence).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eBOSC-23 cells\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eBOSC-23 cells were grown at 37 \u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e in DMEM (Thermo-Fisher Scientific), 10% fetal bovine serum (FBS) (Sigma-Aldrich), and 100 U/ml penicillin streptomycin (Thermo-Fisher Scientific).\u003c/p\u003e\n\u003cp\u003ePlasmid constructs\u003c/p\u003e\n\u003cp\u003eTagged Klhl40 and Klhl41 plasmids were cloned from mouse soleus cDNA using Phusion High-Fidelity DNA Polymerase (Thermo-Scientific) into pcDNA3.1-Flag from following studies (REF PGC1) using NotI and XhoI sites with following primers: Klhl40 forward: 5\u0026rsquo;-AAAGCGGCCGCTACGCTGGGCTTGGAG-3\u0026rsquo;; Klhl40 reverse: 5\u0026rsquo;-GGGCGGGGCTCGAGTCACATCTTGGTCAG-3\u0026rsquo;; Klhl41 forward: 5\u0026rsquo;-AAAGCGGCCGCTGATTCCCAGCGGGAG-3\u0026rsquo;; Klhl41 reverse: 5\u0026rsquo;-GGGGGCTCGAGTCATAGTTTAGACAGTTTAAACAGATTTAAGC-3\u0026rsquo;. C-Myc tag primers with stop codon and overhangs (forward: 5\u0026rsquo;- TCGACGAACAAAAACTCATCTCAGAAGAGGATCTGGGTTCTTGAG-3\u0026rsquo;; reverse: 5\u0026rsquo;-GATCCTCAAGAACCCAGATCCTCTTCTGAGATGAGTTTTTGTTCG-3\u0026rsquo;) were annealed in annealing buffer (10 mM Tris, pH 7.5 - 8.0, 50 mM NaCl, 1 mM EDTA) by warming up the solution to 95 \u0026deg;C for 2 min and in the heat block, let to cool overnight and inserted into pCMV5 (Sigma-Aldrich) using SalI and BamHI sites. Tagged Neb-frag(5876-6073) was cloned from mouse soleus cDNA using Phusion High-Fidelity DNA Polymerase (Thermo-Scientific) into resulting pCMV5-Myc (Sigma-Aldrich) using EcoRI and SalI sites using following primers: forward: 5\u0026rsquo;-AAAAGAATTCATGAGAGCTTACTGGAACGCC-3\u0026rsquo;; reverse:\u0026nbsp;5\u0026rsquo;-AAAGTCGACGGTGAATTTGTCCTTTGACTTCTC-3\u0026rsquo;. HA-Hectd1 plasmids were kind gifts from Irene Zohn and ubiquitin plasmid was a kind gift from Nico Dantuma.\u003c/p\u003e\n\u003cp\u003ePlasmid transfection\u003c/p\u003e\n\u003cp\u003eBOSC-23 for direct western blot were seeded on 24-well plates and transfected 24 h after seeding using 1\u0026nbsp;mg/ml polyethyleneimine (Polysciences) in a stoichiometry of 2:1 (polyethyleneimine:DNA) according to the following protocol. Plasmid DNA and polyethyleneimine were equilibrated separately in serum-free DMEM for 20 min. Afterwards, the plasmid and polyethyleneimine solutions were combined and incubated for 30 min. Combined solution was added dropwise to the cells and incubated for 24 h before harvesting. Cells were transfected, as indicated, with the following amounts of each corresponding plasmid per well: 300 ng HA-Hectd1; 200 ng Flag-Klhl40/41; 100 ng Neb-(5876-6073)-Myc. For co-immunoprecipitation, cells were seeded on 10-cm dishes and transfected using CaCl\u003csub\u003e2\u003c/sub\u003e method according to the following protocol. Plasmid DNA was incubated with 310 mM CaCl\u003csub\u003e2\u003c/sub\u003e (Sigma-Aldrich) for 8 min and added dropwise into equal volume of 2xHBS pH 7.0 (50 mM HEPES, 280 mM NaCl, 1,5 mM Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e) while vortexing. Solution was incubated for 15 minutes, added dropwise to cells, and incubated for 24 h before harvesting. Cells were transfected, as indicated, with following amounts of each corresponding plasmid per plate: 4\u0026nbsp;mg HA-Hectd1; 1\u0026nbsp;mg Flag-Klhl40/41; 2\u0026nbsp;mg Myc-Ubiquitin.\u003c/p\u003e\n\u003cp\u003eCo-Immunoprecipitation for ubiquitylation\u003c/p\u003e\n\u003cp\u003eCells were lysed in cold lysis buffer (1% Triton X-100, 50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA), supplemented with protease inhibitors (Sigma-Aldrich), 10 mM deubiquitinase inhibitor N-Ethylmaleimide (Sigma-Aldrich), and 0.1 mM DTT. Lysate was collected after 20 min of lysis at 4 \u0026deg;C and cleared by centrifugation at 16.1 RCF for 10 min. Samples had either 15 \u0026micro;l of FLAG agarose beads (Sigma-Aldrich) added or incubated with respective antibodies for 30 min with 30 \u0026micro;l of G protein sepharose beads (GE healthcare) added afterwards. Both beads were equilibrated in the lysis buffer before being added to each sample. Samples were incubated on a carousel overnight, washed 3 times with lysis buffer, 50 \u0026micro;l of 2x Laemmli buffer (250 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 10%\u0026nbsp;b-mercaptoethanol, 0.004% bromophenol blue) was added, samples were boiled at 70 \u0026deg;C for 15 min, and subjected to analysis by Western blotting.\u003c/p\u003e\n\u003cp\u003eAnimal models\u003c/p\u003e\n\u003cp\u003eMice were housed in groups of 3-5 per cage on a 12-h light/dark cycle, at approximately 22\u0026deg; C (GM500 cages, Tecniplast). Animals had access to water and standard rodent chow diet (Special Diets Services CRM-P) \u003cem\u003ead libitum\u003c/em\u003e. The \u003cem\u003eHectd1\u003c/em\u003e mKO mice and their floxed littermates were generated in-house by breeding \u003cem\u003eHectd1\u003c/em\u003e\u003csup\u003etm1c\u003c/sup\u003e and \u003cem\u003eHSA-Cre\u003c/em\u003e animals, while C57BL/6N mice were purchased from Janvier Labs and acclimated to the animal facility before use. All collected tissues were immediately frozen in liquid nitrogen and stored at \u0026ndash;80 \u0026deg;C until analysis. All experiments were approved by the regional animal ethics committee of Northern Stockholm, Sweden. Sperm with \u003cem\u003eHectd1\u003c/em\u003e\u003csup\u003etm1a(EUCOMM)Hmgu\u003c/sup\u003e allele were purchased from IMPC, reanimated, and bred with Flp recombinase transgenic mice to generate \u003cem\u003eHectd1\u003c/em\u003e\u003csup\u003etm1c\u003c/sup\u003e animals at IMG (Institute of Molecular Genetics of the ASCR, Prague, Czech Republic). Primers for genotyping \u003cem\u003eHectd1\u003c/em\u003e floxed allele were the following: forward, 5\u0026acute;-ATCCCCACATGGTGGAAGTA-3\u0026acute;; reverse, 5\u0026acute;- TCATCACTGGGCAAATACCA-3\u0026acute;. HSA-Cre transgenic mice (B6.Cg-Tg(ACTA1-cre)79Jme/J) were purchased from The Jackson Laboratory and were genotyped using following primers: forward 5\u0026acute;- CACGACCAAGTGACAGCAAT -3\u0026acute;; reverse, 5\u0026acute;- AGAGACGGAAATCCATCGCT -3\u0026acute;.\u003c/p\u003e\n\u003cp\u003eMRI\u003c/p\u003e\n\u003cp\u003eBody composition analysis was examined using Magnetic resonance imaging (MRI) on an EchoMRI platform.\u003c/p\u003e\n\u003cp\u003eGrip Strength\u003c/p\u003e\n\u003cp\u003eLimb grip strength was measured in 4-month-old male and female \u003cem\u003eHectd1\u003c/em\u003e mKO mice for basal grip strength and 16-month-old male for \u003cem\u003eHectd1\u003c/em\u003e mKO mice aged cohort with age-matched wild-type littermates, using a grip strength meter (Bioseb). Mice were held by their tails and allowed to grasp the bar of the device with their front paws or a grid with all four paws. They were pulled away from the device and force generated after release was recorded. This process was repeated 4 times for 2 consecutive days and average grip strength was calculated and normalized to their previously determined lean mass.\u003c/p\u003e\n\u003cp\u003eEx\u0026nbsp;vivo analysis of muscle force and fatigability\u003c/p\u003e\n\u003cp\u003eSkeletal muscle force-producing capacity, fatigue resistance and recovery capacity were measured for EDL and \u003cem\u003esoleus\u003c/em\u003e muscles from 8-9-week-old male \u003cem\u003eHectd1\u003c/em\u003e mKO and age-matched floxed littermates. Mice were placed under isoflurane anesthesia, cervically dislocated, \u003cem\u003esoleus\u003c/em\u003e and EDL muscles were immediately removed, immersed in Tyrode solution (121 mM NaCl, 5 mM KCl, 1.8 mM CaCl\u003csub\u003e2\u003c/sub\u003e, 0.4 mM NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 0.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 24 mM NaHCO\u003csub\u003e3\u003c/sub\u003e, 0.1 mM EDTA, and 5.5 mM glucose) and placed in a stimulation chamber with proximal and distal tendons attached to hooks. The chamber was maintained at 31 \u0026deg;C using a circulatory water bath, and the Tyrode solution\u0026rsquo;s pH was kept at 7.4 by continuous superfusion with carbogen (95% O2, 5% CO\u003csub\u003e2\u003c/sub\u003e). The muscles were set to optimal length, and force-frequency relationships were determined by stimulating the muscles at different frequencies (1 Hz to 120 Hz for \u003cem\u003esoleus\u003c/em\u003e and 1Hz to 150 Hz for EDL). Muscle-specific force (kN/m\u003csup\u003e2\u003c/sup\u003e) was calculated using the muscle\u0026rsquo;s CSA, which was obtained by dividing muscle mass by the product of muscle length and density (1.06 g/cm\u003csup\u003e3\u003c/sup\u003e). Fatigue resistance was evaluated by measuring tetanic force at 70 Hz stimulation with 600 ms duration and 2-s intervals for 100 contractions in the \u003cem\u003esoleus\u003c/em\u003e or at 100 Hz with 300 ms duration and 2-s intervals for 50 contractions in the EDL. After the fatigue protocol, the muscles were allowed to recover for 10 min, and tetanic force was measured at 1, 2, 5, and 10 min to determine the recovery capacity.\u003c/p\u003e\n\u003cp\u003eRunning to exhaustion\u003c/p\u003e\n\u003cp\u003eMice were acclimated to a treadmill (Columbus Instruments) for four consecutive days, 10 min/day with speeds varying between 5 and 10 m/min. After the acclimation period, all animals were submitted to a graded treadmill exercise test on a 10\u0026deg; upward incline, starting at 6 m/min with increments of 3 m/min\u0026nbsp;every 3 min, until the animal was unable keep up with the treadmill session due to exhaustion, defined as the moment when the mice refused to continue running even with encouragement. All exercise bouts were performed at the same time of the day.\u003c/p\u003e\n\u003cp\u003eGlobal gene expression analysis by RNA-sequencing\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from \u003cem\u003eHectd1\u003c/em\u003e mKO mice \u003cem\u003eM. soleus\u003c/em\u003e using TRI reagent (Sigma-Aldrich) as per the manufacturer\u0026apos;s instructions. RNA was purified and treated with DNase using NucleoSpin RNA II columns (Machery Nagel) to remove any remaining DNA contaminants. RNA integrity was verified using an Agilent Bioanalyzer, with all samples showing RNA integrity number (RIN) greater than 8. Stranded mRNA Library Preparation Kit was used with a polyA-enrichment strategy to prepare the sequencing libraries. RNA-sequencing was performed at GATC Biotech (Konstanz, Germany) using Illumina NovaSeq 6000, generating 150-bp paired-end reads. Quality control of raw reads was performed using the FastQC tool kit (Babraham Bioinformatics). The reads were then aligned using STAR aligner\u003csup\u003e56\u003c/sup\u003e tool to the genomes of \u003cem\u003eMus musculus\u003c/em\u003e (GRCm38.p6) and \u003cem\u003eHomo sapiens\u003c/em\u003e (GRCh38.p13) respectively (downloaded from NCBI). Reads aligning to gene exons were counted using featureCounts program from Subread package\u003csup\u003e57\u003c/sup\u003e. Out of these, lists of differentially expressed genes (DEGs) between groups as well as normalized read counts were obtained using the DESeq2 package\u003csup\u003e58\u003c/sup\u003e. Considering the study design, all genes showing\u003cem\u003e\u0026nbsp;p\u003c/em\u003e-value (adjusted by Benjamini-Hochberg method) \u0026lt; 0.1 for \u003cem\u003eHectd1\u003c/em\u003e mKO \u003cem\u003eM. soleus\u003c/em\u003e RNA-Seq and \u0026lt; 0.05 for other RNA-Seq datasets were further examined for the enrichment of functional processes. To identify differentially expressed pathways, gene list of DEGs were queried by clusterProfiler package\u003csup\u003e59\u003c/sup\u003e against Gene Ontology, Wikipathways, and DisGeNET databases using overrepresentation and GSEA analysis.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eSkeletal muscle proteomics\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePeptide preparation\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFrozen muscle segments were pulverized in liquid nitrogen and resuspended in LYSE buffer (PreOmics), heated at 95 \u0026deg;C for 5 min and sonicated in a water-bath sonicator (Diagenode) for 15 min. Protein concentration in the lysate was estimated based on tryptophan fluorescence (excitation 295 nm, emission 340 nm) compared to a standard curve. For each sample, 30 \u0026micro;g of protein lysate were digested with 1.5 \u0026micro;g of\u003cem\u003e\u0026nbsp;\u003c/em\u003elysyl\u003cem\u003e-\u003c/em\u003eendopeptidase C and 1.5 \u0026micro;g of trypsin at 37 \u0026deg;C overnight under continuous shaking. Peptides were desalted on StageTip plugs with 3 layers of styrenedivinylbenzene (SDB)-RPS, lyophilized and resuspended in 2% Acetonitrile and 0,1% TFA, pH 2.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMass spectrometry data acquisition\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePeptides were separated on a 50 cm column of ReproSil-Pur C18-AQ 1.9 \u0026mu;m resin (Dr. Maisch GmbH) packed in-house. The column was heated at 60 \u0026deg;C by a column oven. Liquid chromatography was carried out on an anEASY-nLC-1200 system coupled through a nanoelectrospray source to an Orbitrap Exploris mass spectrometer (Thermo Fisher Scientific). Peptides were loaded in buffer A applying a nonlinear 120-min gradient of 0\u0026ndash;65% buffer B at a flow rate of 300 nl/min. The mass spectrometer was operated in data-independent acquisition (DIA) mode, consisting of one MS1 full scan (300\u0026ndash;1,650 m/z range) acquired at a resolution of 120,000 with normalized automatic gain control (AGC) target set to 300 and 78 MS2 scans collected at a resolution of 15,000, an isolation window of 17.3 m/z and window overlap of 1. Cycle time was 3 s. HCD collision energy was set at 30%.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMass spectrometry data analysis\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eDIA raw files were processed using Spectronaut (Biognosys), version 16.0.220606.53, using FASTA digest for library-free search. Mouse FASTA files were UP000000589_10090 from 2022 (21984 entries) and the corresponding additional file (41647 entries). Carbamidomethyl (C) was set as a fixed modification, and acetyl (protein N-term) and oxidations (M) were set as variable modifications. False discovery rate cutoff was set at 1% at precursor and protein levels.\u003c/p\u003e\n\u003cp\u003eDNA isolation\u003c/p\u003e\n\u003cp\u003eDNA was isolated from interphase of TRI reagent (Sigma-Aldrich) after RNA extraction per manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003eGlucose tolerance test\u003c/p\u003e\n\u003cp\u003eGlucose tolerance was evaluated in 16 to 20-week-old male and female \u003cem\u003eHectd1\u003c/em\u003e mKO mice and age-matched wild-type littermates. Mice were fasted for 5 h, weighted, and injected intraperitoneally with a bolus of glucose (2 mg/kg) in PBS. Blood samples were obtained by tail bleeding before and 15, 30, 60 and 120 min after glucose administration using a OneTouch Accu-Check glucometer.\u003c/p\u003e\n\u003cp\u003eMuscle histopathology\u003c/p\u003e\n\u003cp\u003eMuscles were mounted on a cork support with tragacanth gum, frozen in liquid nitrogen-cooled isopentane, and 12 \u0026mu;m thick cross-sections were cut using a cryostat. The sections were transferred to Superfrost Plus Adhesion slides, with four non-consecutive sections used per sample. To evaluate mitochondrial complex activity, we incubated sections from the\u003cem\u003e\u0026nbsp;soleus\u003c/em\u003e muscle with freshly-prepared NADH-NTB solution (1.5 mM NADH, 1.5 mM NTB, 0.2 M Tris-HCl pH 7.4) for 15 min at 55 \u0026deg;C for Complex I activity or with freshly prepared SDH-NBT solution (0.2 M phosphate buffer pH 7.6, 170 mM succinic acid, 1.22 mM NTB for 30 min at 37 \u0026deg;C. for Complex II activity). Sections were washed with deionized water, dehydrated in graded ethanol, cleared in xylene, and mounted with Pertex mounting media (Histolab). Imaging was performed in a Zeiss Axio Imager and quantified in ImageJ by counting average intensity of at least 4 sections with subtracted background per animal.\u003c/p\u003e\n\u003cp\u003eFresh frozen muscle tissue from one-year old mice was processed at Mayo Clinic. Frozen mouse muscle samples were cut at 10 \u0026mu;m for histochemical and immunohistochemical staining following Mayo Clinic laboratory developed protocols. H\u0026amp;E sections were stained in Gill\u0026rsquo;s hematoxylin followed by bluing solution and run through successive Eosin Y and alcohol to differentiate and dehydrate. Trichrome sections were stained in Harris hematoxylin, rinsed in running distilled water, and incubated in modified Gomori\u0026rsquo;s trichrome solution consisting of chromotrope 2R, fast green, and phosphotungstic acid, then differentiated in sequential 0.2% acetic acid and dehydrated. NADH sections were incubated at 37 \u0026deg;C in working NADH solution consisting of \u0026beta;-Nicotinamide adenine dinucleotide, 0.9% sodium chloride, 2% nitrotetrazolium blue chloride, and triple distilled water, and mounted with glycerol gelatin. ATPase sections were preincubated in working solution consisting of sodium acetate, sodium barbital, and 0.1 N hydrochloric acid, and pH adjusted to 4.3. Sections were incubated at 37 \u0026deg;C in working solution of adenosine 5\u0026rsquo; triphosphate, calcium chloride, and sodium barbital, followed by successive rinses with 1% calcium chloride, 2% cobaltous chloride, 0.1 M sodium barbital, rinsed in running distilled water, and precipitated with ammonium sulfide solution. Sections were dehydrated and mounted with canada balsam. Desmin (1:80, MilliporeSigma, Darmstadt, Germany, cat. #D1033), alpha-crystallin B chain (1:1000, Enzo Life Sciences, cat. #ADI-SPA-222-D), dystrophin C (1:100, Novocastra, Deer Park, IL, cat. #NCL-DYS2), myotilin (1:400, Novocastra, Deer Park, IL, cat. #NCL-MYOTILIN), NCAM (1:10, Cell Sciences, Newburyport, MA, cat. #MON9012-1), and alpha-actinin (1:400, MilliporeSigma, Darmstadt, Germany, cat. # A-7811). Immunohistochemistry was performed sequentially with the histochemistry stains. Desmin sections were fixed in 10% neutral buffered formalin and rinsed in 1X PBS buffer prior to staining. Alpha-crystallin B chain, dystrophin, myotilin, NCAM, and alpha-actinin were fixed in cold acetone. All sections were blocked in Normal Goat Serum (1:10, Jackson ImmunoResearch, West Grove, PA, USA, cat. #005-000-121) and incubated in each respective primary antibody overnight at 4 \u0026deg;C. Biotinylated Goat anti-Mouse (KLP-SeraCare, Milford, MA, cat. #5570-0006) was used as the secondary antibody, followed by Vectastain ABC (Vector Laboratories, Newark, CA, cat. #PK-6100), and stained with Dako DAB chromogen (Agilent, Santa Clara, CA, cat. #K346811-2). Slides were reviewed by E.N. (Muscle pathologist) and photos taken via an Olympus DP73 camera.\u003c/p\u003e\n\u003cp\u003eElectron microscopy\u003c/p\u003e\n\u003cp\u003eThe dissected \u003cem\u003eHectd1\u003c/em\u003e mKO soleus muscles were immersion fixed in 2.5% glutaraldehyde and 1% paraformaldehyde buffered in 0.1 M phosphate buffer pH 7.4 at RT for 1 h followed by storage at 4 \u0026deg;C. The fixed samples were rinsed in 0.1 M phosphate buffer followed by postfixation in 2% osmium tetroxide in 0.1 M phosphate buffer, pH 7.4 at 4 \u0026deg;C for 2 h. After stepwise dehydration in ethanol and acetone the samples were resin infiltrated and finally embedded in LX-112 (Ladd Research). Ultrathin sections (~80-100 nm) were prepared using an EM UC7 (Leica) and transferred onto formvar slot grids and contrasted with uranyl acetate followed by lead citrate. The grids were examined in a HT7700 transmission electron microscope (Hitachi High-Technologies,) at 80 kV and digital images were acquired using a 2kx2k Veleta CCD camera (Olympus Soft Imaging Solutions).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eHuman induced pluripotent stem cells (hiPSCs)\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eInitial experiments involving the generation and validation of the hiPSCs carrying the HECTD1-A1006V mutation were performed at the University of Pennsylvania iPSC Core (RRID:SCR_022426) and were approved by the University\u0026rsquo;s \u0026nbsp;Embryonic Stem Cell Research Oversight Committee. Subsequent experiments for molecular analyses were performed at the University of Michigan and approved by the Human Pluripotent Stem Cell Research Oversight Committee (HPSCRO). The human iPSC line PENN123i-SV20 (also referred to as SV20\u003csup\u003e60\u003c/sup\u003e) was used for CRISPR/Cas9-based gene editing. Parental and gene edited cell lines were cultured in StemMACS\u0026trade; iPS-Brew XF medium (Miltenyi Biotec, 130\u0026ndash;104-368) in Matrigel (Corning, 356231)-coated dishes as previously described\u003csup\u003e60\u003c/sup\u003e. All cell lines were routinely tested to be free of mycoplasma.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCRISPR/Cas9 gene editing of hiPSCs\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo generate iPSC lines that carry the heterozygous 31136628G\u0026gt;A substitution, we transduced SV20 cells with the Cas9D10A nickase protein complexed with a set of two single guide RNAs (sgRNAs) targeting sequences close to the mutation site, and a single-stranded oligonucleotide (ssODN) homology-directed repair (HDR) template containing the base substitution\u003csup\u003e61\u003c/sup\u003e. \u0026nbsp;The guide RNA sequences (gRNA#1: \u0026nbsp;5\u0026rsquo;-TTTCGGTTGGAACGTGCACC-3\u0026rsquo; and gRNA#2: 5\u0026rsquo;-AGAGATTCAACTGTAGCCAA-3) were designed using the CRISPR Targets tool at \u0026nbsp;https://genome.ucsc.edu/ and sgRNAs containing both crRNA and tracrRNA were synthesized by Synthego. \u0026nbsp;ssODN 5\u0026rsquo;-CCAGAAACTCACCATTTTCAAAAGGTACTGTTCCAGAGATTCAACTGTAGCCAAAGGTTCCATCTTCAACATTCTGCCAGTCCTGTCAATCAATGCAGTTTCACCAGGTACACGTTCCAACCGAAATCGTAATCTCCTTGTAAGTATCTACACAAAAACG3\u0026rsquo;\u003c/p\u003e\n\u003cp\u003ewas synthesized by IDTDNA (Alt-R\u003csup\u003eTM\u003c/sup\u003e HDR Donor Oligos). Ribonucleoprotein complexes (10.5 pmol Cas9D10A and 40 pmol sgRNA#1, 10.5 pmol Cas9D10A and 40 pmol sgRNA#2) were prepared and mixed with 100 pmol ssODN template and 200,000 single cell suspension in P3 Primary Cell Nucleofector solution (Lonza). Samples were subsequently electroporated in a 4D-nucleofector with X-unit (Lonza) using program CA-137. Transduced iPSCs were seeded onto Matrigel-coated 24-well plates in growth medium supplemented with CEPT cocktail (Fujifilm, 033-26071) to reduce cell death. After 24 h, cells were cultured in fresh growth medium without CEPT for another 2 days before replating as single cells at low density. \u0026nbsp;Cells were fed every other day, and mature colonies were isolated and screened by PCR with the primer set 5\u0026rsquo;-AGGTGAAGCTTGCAGTGAAC-3\u0026rsquo; and 5\u0026rsquo;-ATGCTTATTTCACCGTGCCC-3\u0026rsquo;. \u0026nbsp;PCR products were digested with ssODN-origin restriction enzyme \u003cem\u003eAfl\u003c/em\u003eIII. \u0026nbsp;Correctly edited heterozygous colonies were further confirmed by sanger sequencing alignment on SNAPGENE. \u0026nbsp;iPSC clones resistant to \u003cem\u003eAfl\u003c/em\u003eIII digestion (unedited) were expanded as isogenic control cell lines. Heterozygous and isogenic lines were analyzed by G-banded karyotyping (Cell Line Genetics). All cell lines used in this study were confirmed to be of normal karyotype. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCultrex plate coating \u0026nbsp;\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCultrex RGF Basement Membrane Extract (R\u0026amp;D systems, 3433-010-01) was thawed on ice overnight upon receipt, aliquoted, and stored at \u0026ndash;80 \u0026deg;C. Individual aliquots were thawed at 4 \u0026deg;C and diluted in ice-cold DMEM/F12 (Gibco, 11320033) to 0.1 mg/ml. Diluted Cultrex was added to plates (~1 ml per 7 cm\u003csup\u003e2\u003c/sup\u003e) and incubated at 37 \u0026deg;C for at least 2 h before use, after which excess coating solution was removed by vacuum. Alternatively, coated plates containing the Cultrex coating solution were sealed with Parafilm and stored at 4 \u0026deg;C for up to 3 days; stored plates were equilibrated at 37 ⁰C for at least 1 h before use. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eGeneration of skeletal muscle progenitor cells (SMPCs) from HECTD1-A1006V hiPSCs\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eMyogenic differentiation of HECTD1-A1006V and isogenic control hiPSCs was performed in a two-step process as previously described\u003csup\u003e44\u003c/sup\u003e. First, Pax7\u003csup\u003e+\u003c/sup\u003e skeletal muscle progenitor cells (SMPCs) were generated\u003csup\u003e62\u003c/sup\u003e followed by enrichment of ERBB3/NGFR positive cells\u003csup\u003e63\u003c/sup\u003e. HNK1\u003csup\u003e\u0026minus;\u003c/sup\u003e/ERBB3\u003csup\u003e+\u003c/sup\u003e/NGFR\u003csup\u003e+\u003c/sup\u003e cells were collected after 28 to 32 days of differentiation and cultured in Lonza skeletal muscle growth medium (Lonza SkGM2, CC-3245) supplemented with 20 ng/ml Fibroblast growth factor 2 (FGF2, R\u0026amp;D systems, BT-FGFB) on Cultrex RGF Basement Membrane Extract-coated plates with medium change every other day. When reaching 70\u0026ndash;80% confluence (designated as passage 0), SMPCs were passaged, expanded and cryopreserved.\u003c/p\u003e\n\u003cp\u003eMyotube differentiation from hiPSC-SMPCs\u003c/p\u003e\n\u003cp\u003ehiPCS-SMPCs were expanded in skeletal muscle growth medium and passaged into 6-well plates (passage 2). When reaching confluence (~90%), cells were differentiated in N2-ITS differentiation medium: DMEM/F12 (Gibco, 11320033), 1% Insulin-Transferrin-Selenium (ITS-G, Gibco, 41400045), 1% N2 supplement (Gibco, 41400045), Penicilin-Streptomycin (Gibco, 15140122), 1% GlutaMAX\u0026trade; (Gibco, 35050061), 10 \u0026micro;M TGF-b inhibitor SB-431542 (Selleck Chemicals, S1067), and 10 ng/ml IGF-1 (R\u0026amp;D Systems, BT-FGFB) for 3-4 days until complete multinucleated myotube formation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eImmunofluorescence staining of hiPSC-derived myotubes\u003c/p\u003e\n\u003cp\u003eFor immunofluorescence staining, differentiated myotubes were fixed in 4% paraformaldehyde, washed with PBS and permeabilized in 0.3% Triton-X-100 containing 4% normal horse serum (Sigma). Samples were then blocked with 4% normal horse serum and the expression of pan myosin heavy chain (MyHC) in myotubes was detected using\u0026nbsp;the MF-20 antibody (1:100, Developmental Studies Hybridoma Bank) followed by secondary antibody (Alexa Fluor 561 goat anti\u0026ndash;mouse IgG1 1:1000; Invitrogen).\u003c/p\u003e\n\u003cp\u003eRNA extraction and bulk RNA-sequencing of hiPSC-derived myotubes\u003c/p\u003e\n\u003cp\u003eFor RNA extraction, differentiated myotubes were washed in ice cold PBS and then harvested in 1 ml TRIzol\u003csup\u003e\u0026reg;\u003c/sup\u003e. RNA was extracted and on column DNase I treated using a Direct-zol\u0026trade; RNA Miniprep Kit (Zymo, R2052). RNA integrity number (RIN) \u0026gt; 8 was verified with an Agilent Bioanalyzer before bulk RNA-sequencing (see: Global gene expression analysis by RNA-sequencing).\u003c/p\u003e\n\u003cp\u003eProtein extraction and immunoblotting of hiPSC-derived myotubes\u003c/p\u003e\n\u003cp\u003eCells were washed once in ice cold PBS and each well scraped into 1 ml of PBS containing protease inhibitors (cOmplete\u0026trade; Protease Inhibitor Cocktail EDTA-Free; Roche, 11873580001) on ice. Cells were pelleted (500 rcf, 5 min, 4 \u0026deg;C), the supernatant was removed, and pellets were resuspended in protein lysis buffer (50 mM Tris-HCl, pH 7.4; 180 mM NaCl; 1 mM EDTA; 1% Triton X-100; 20% Glycerol) supplemented with freshly added protease inhibitor cocktail and 1 mM dithiothreitol. Lysates were incubated on ice for 10 min and then sonicated using a Diagenode Bioruptor\u0026reg; (5 cycles of 30 s on high power, 30 s off, 4 \u0026deg;C). Cellular debris were removed by centrifugation (18,000 rcf, 20 min, 4 \u0026deg;C), and cleared cell lysates were transferred to fresh tubes. Protein concentrations were determined using a Bradford assay. Equal amounts of protein (25 \u0026micro;g) were resolved on hand-cast SDS-polyacrylamide gels (4% stacking, 10% resolving) and electrotransferred onto polyvinylidene difluoride membranes (80 mA, 20 h, 4 \u0026deg;C) Total protein loading was assessed with Ponceau S staining. Membranes were blocked in 5% milk in TBS for 1 h at room temperature and incubated overnight at 4 \u0026deg;C with anti-HECTD1 antibody (1 \u0026micro;g/ml in 5% milk, TBST, Abcam, ab101992). After washing with TBST, membranes were incubated with HRP-conjugated rabbit anti-mouse IgG (1:10,000 in 5% milk/TBST, Abcam, ab6728) for 1 h at room temperature. Protein bands were detected using enhanced chemiluminescence (Amersham ECL Prime; Cytiva, 89168-782) and imaged with an iBright\u0026trade; CL1500 system. \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStatistical analysis\u003c/p\u003e\n\u003cp\u003eThe analysis of the data was carried out using R, Excel, and GraphPad Prism as described above. Specifics regarding statistical analyses and sample sizes are found in figure legends.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cspan\u003eInformed consent was obtained from all patients.\u0026quot;\u003c/span\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eStudy Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the regional animal ethics committee of Northern Stockholm, Sweden.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNext-generation sequencing (NGS) data generated is deposited at GEO. In addition, all used datasets are made available as Supplemental Data. Code used to analyze NGS data will be available at the RuasLab GitHub (https://github.com/ruaslab). Any additional information required to reanalyze the data reported in this paper is available from the corresponding author upon request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI.C., and J.L.R. conceived, coordinated, and designed the study. J.L.R. secured funding. I.C., A.B.L., P.R.J., S.D., E.N., E.K., J.C.C., B.J., M.Mu., T.S., and A.R. planned and performed experiments. M.Mu., and B.L. contributed to data analysis and interpretation. A.H., A.T., and V.S. secured clinical data from myopathy patients. F.Y., and W.Y. generated the hiPSC line. I.C., J.L.R., and A.B.L. wrote and edited the manuscript with input from all authors. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eProtein identification and quantification were carried out by the Proteomics Biomedicum core facility, Karolinska Institutet (https://ki.se/en/research/proteomics-biomedicum-core-facility). We thank Dr. Irene Zohn (George Washington University School of Medicine and Health Sciences, USA) and Dr. Nico Dantuma (Karolinska Institutet, Sweden) for the kind gift of Hectd1 and Ubiquitin expression plasmids, respectively. This project was supported by grants from the Swedish Research Council (2016-00785, 2022-02743), The Novo Nordisk Foundation (NNF16OC0020804, NNF18OC0054132, NN0082202), and The Knut and Alice Wallenberg Foundation (KAW2019.0109).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWang, Z.\u003cem\u003e et al.\u003c/em\u003e The molecular basis for sarcomere organization in vertebrate skeletal muscle. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e184\u003c/strong\u003e, 2135-2150 e2113 (2021). https://doi.org:10.1016/j.cell.2021.02.047\u003c/li\u003e\n\u003cli\u003eBodine, S. C.\u003cem\u003e et al.\u003c/em\u003e Identification of ubiquitin ligases required for skeletal muscle atrophy. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e294\u003c/strong\u003e, 1704-1708 (2001). https://doi.org:10.1126/science.1065874\u003c/li\u003e\n\u003cli\u003eGomes, M. D., Lecker, S. H., Jagoe, R. T., Navon, A. \u0026amp; Goldberg, A. L. Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 14440-14445 (2001). https://doi.org:10.1073/pnas.251541198\u003c/li\u003e\n\u003cli\u003eSartori, R.\u003cem\u003e et al.\u003c/em\u003e BMP signaling controls muscle mass. \u003cem\u003eNat Genet\u003c/em\u003e \u003cstrong\u003e45\u003c/strong\u003e, 1309-1318 (2013). https://doi.org:10.1038/ng.2772\u003c/li\u003e\n\u003cli\u003eHunt, L. C.\u003cem\u003e et al.\u003c/em\u003e A Key Role for the Ubiquitin Ligase UBR4 in Myofiber Hypertrophy in Drosophila and Mice. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 1268-1281 e1266 (2019). https://doi.org:10.1016/j.celrep.2019.06.094\u003c/li\u003e\n\u003cli\u003eAgnetti, G., Herrmann, H. \u0026amp; Cohen, S. New roles for desmin in the maintenance of muscle homeostasis. \u003cem\u003eFEBS J\u003c/em\u003e \u003cstrong\u003e289\u003c/strong\u003e, 2755-2770 (2022). https://doi.org:10.1111/febs.15864\u003c/li\u003e\n\u003cli\u003eSacheck, J. M.\u003cem\u003e et al.\u003c/em\u003e Rapid disuse and denervation atrophy involve transcriptional changes similar to those of muscle wasting during systemic diseases. \u003cem\u003eFASEB J\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 140-155 (2007). https://doi.org:10.1096/fj.06-6604com\u003c/li\u003e\n\u003cli\u003eLecker, S. H.\u003cem\u003e et al.\u003c/em\u003e Multiple types of skeletal muscle atrophy involve a common program of changes in gene expression. \u003cem\u003eFASEB J\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 39-51 (2004). https://doi.org:10.1096/fj.03-0610com\u003c/li\u003e\n\u003cli\u003eVerbrugge, S. A. J.\u003cem\u003e et al.\u003c/em\u003e Genes Whose Gain or Loss-Of-Function Increases Skeletal Muscle Mass in Mice: A Systematic Literature Review. \u003cem\u003eFront Physiol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 553 (2018). https://doi.org:10.3389/fphys.2018.00553\u003c/li\u003e\n\u003cli\u003eKumar, L., Bisen, M., Khan, A., Kumar, P. \u0026amp; Patel, S. K. S. Role of Matrix Metalloproteinases in Musculoskeletal Diseases. \u003cem\u003eBiomedicines\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e (2022). https://doi.org:10.3390/biomedicines10102477\u003c/li\u003e\n\u003cli\u003eAhmad, K., Shaikh, S., Ahmad, S. S., Lee, E. J. \u0026amp; Choi, I. Cross-Talk Between Extracellular Matrix and Skeletal Muscle: Implications for Myopathies. \u003cem\u003eFront Pharmacol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 142 (2020). https://doi.org:10.3389/fphar.2020.00142\u003c/li\u003e\n\u003cli\u003eSpinelli, J. B. \u0026amp; Haigis, M. C. The multifaceted contributions of mitochondria to cellular metabolism. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 745-754 (2018). https://doi.org:10.1038/s41556-018-0124-1\u003c/li\u003e\n\u003cli\u003eWang, Y., Argiles-Castillo, D., Kane, E. I., Zhou, A. \u0026amp; Spratt, D. E. HECT E3 ubiquitin ligases - emerging insights into their biological roles and disease relevance. \u003cem\u003eJ Cell Sci\u003c/em\u003e \u003cstrong\u003e133\u003c/strong\u003e (2020). https://doi.org:10.1242/jcs.228072\u003c/li\u003e\n\u003cli\u003eZohn, I. E., Anderson, K. V. \u0026amp; Niswander, L. The Hectd1 ubiquitin ligase is required for development of the head mesenchyme and neural tube closure. \u003cem\u003eDev Biol\u003c/em\u003e \u003cstrong\u003e306\u003c/strong\u003e, 208-221 (2007). https://doi.org:10.1016/j.ydbio.2007.03.018\u003c/li\u003e\n\u003cli\u003eKasarskis, A., Manova, K. \u0026amp; Anderson, K. V. A phenotype-based screen for embryonic lethal mutations in the mouse. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, 7485-7490 (1998). https://doi.org:10.1073/pnas.95.13.7485\u003c/li\u003e\n\u003cli\u003ePetrany, M. J.\u003cem\u003e et al.\u003c/em\u003e Single-nucleus RNA-seq identifies transcriptional heterogeneity in multinucleated skeletal myofibers. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 6374 (2020). https://doi.org:10.1038/s41467-020-20063-w\u003c/li\u003e\n\u003cli\u003eBushby, K. M., Collins, J. \u0026amp; Hicks, D. Collagen type VI myopathies. \u003cem\u003eAdv Exp Med Biol\u003c/em\u003e \u003cstrong\u003e802\u003c/strong\u003e, 185-199 (2014). https://doi.org:10.1007/978-94-007-7893-1_12\u003c/li\u003e\n\u003cli\u003eLiewluck, T. \u0026amp; Milone, M. Untangling the complexity of limb-girdle muscular dystrophies. \u003cem\u003eMuscle Nerve\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 167-177 (2018). https://doi.org:10.1002/mus.26077\u003c/li\u003e\n\u003cli\u003eWein, N., Alfano, L. \u0026amp; Flanigan, K. M. Genetics and emerging treatments for Duchenne and Becker muscular dystrophy. \u003cem\u003ePediatr Clin North Am\u003c/em\u003e \u003cstrong\u003e62\u003c/strong\u003e, 723-742 (2015). https://doi.org:10.1016/j.pcl.2015.03.008\u003c/li\u003e\n\u003cli\u003eMeola, G. \u0026amp; Cardani, R. Myotonic dystrophies: An update on clinical aspects, genetic, pathology, and molecular pathomechanisms. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e \u003cstrong\u003e1852\u003c/strong\u003e, 594-606 (2015). https://doi.org:10.1016/j.bbadis.2014.05.019\u003c/li\u003e\n\u003cli\u003eBonne, G. \u0026amp; Quijano-Roy, S. Emery-Dreifuss muscular dystrophy, laminopathies, and other nuclear envelopathies. \u003cem\u003eHandb Clin Neurol\u003c/em\u003e \u003cstrong\u003e113\u003c/strong\u003e, 1367-1376 (2013). https://doi.org:10.1016/B978-0-444-59565-2.00007-1\u003c/li\u003e\n\u003cli\u003eLaitila, J. \u0026amp; Wallgren-Pettersson, C. Recent advances in nemaline myopathy. \u003cem\u003eNeuromuscul Disord\u003c/em\u003e \u003cstrong\u003e31\u003c/strong\u003e, 955-967 (2021). https://doi.org:10.1016/j.nmd.2021.07.012\u003c/li\u003e\n\u003cli\u003eLi, X.\u003cem\u003e et al.\u003c/em\u003e Ubiquitylation of phosphatidylinositol 4-phosphate 5-kinase type I gamma by HECTD1 regulates focal adhesion dynamics and cell migration. \u003cem\u003eJ Cell Sci\u003c/em\u003e \u003cstrong\u003e126\u003c/strong\u003e, 2617-2628 (2013). https://doi.org:10.1242/jcs.117044\u003c/li\u003e\n\u003cli\u003eShen, X.\u003cem\u003e et al.\u003c/em\u003e HECTD1 controls the protein level of IQGAP1 to regulate the dynamics of adhesive structures. \u003cem\u003eCell Commun Signal\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 2 (2017). https://doi.org:10.1186/s12964-016-0156-8\u003c/li\u003e\n\u003cli\u003evon Mering, C.\u003cem\u003e et al.\u003c/em\u003e STRING: known and predicted protein-protein associations, integrated and transferred across organisms. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e33\u003c/strong\u003e, D433-437 (2005). https://doi.org:10.1093/nar/gki005\u003c/li\u003e\n\u003cli\u003eRamirez-Martinez, A.\u003cem\u003e et al.\u003c/em\u003e KLHL41 stabilizes skeletal muscle sarcomeres by nonproteolytic ubiquitination. \u003cem\u003eElife\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e (2017). https://doi.org:10.7554/eLife.26439\u003c/li\u003e\n\u003cli\u003eGarg, A.\u003cem\u003e et al.\u003c/em\u003e KLHL40 deficiency destabilizes thin filament proteins and promotes nemaline myopathy. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e124\u003c/strong\u003e, 3529-3539 (2014). https://doi.org:10.1172/JCI74994\u003c/li\u003e\n\u003cli\u003ePappas, C. T., Bliss, K. T., Zieseniss, A. \u0026amp; Gregorio, C. C. The Nebulin family: an actin support group. \u003cem\u003eTrends Cell Biol\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 29-37 (2011). https://doi.org:10.1016/j.tcb.2010.09.005\u003c/li\u003e\n\u003cli\u003eChereau, D.\u003cem\u003e et al.\u003c/em\u003e Leiomodin is an actin filament nucleator in muscle cells. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e320\u003c/strong\u003e, 239-243 (2008). https://doi.org:10.1126/science.1155313\u003c/li\u003e\n\u003cli\u003eChu, M., Gregorio, C. C. \u0026amp; Pappas, C. T. Nebulin, a multi-functional giant. \u003cem\u003eJ Exp Biol\u003c/em\u003e \u003cstrong\u003e219\u003c/strong\u003e, 146-152 (2016). https://doi.org:10.1242/jeb.126383\u003c/li\u003e\n\u003cli\u003eSarkar, A. A. \u0026amp; Zohn, I. E. Hectd1 regulates intracellular localization and secretion of Hsp90 to control cellular behavior of the cranial mesenchyme. \u003cem\u003eJ Cell Biol\u003c/em\u003e \u003cstrong\u003e196\u003c/strong\u003e, 789-800 (2012). https://doi.org:10.1083/jcb.201105101\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Alonzo, D.\u003cem\u003e et al.\u003c/em\u003e Hectd1 is essential for embryogenesis in mice. \u003cem\u003eGene Expr Patterns\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 119064 (2019). https://doi.org:10.1016/j.gep.2019.119064\u003c/li\u003e\n\u003cli\u003eLv, K.\u003cem\u003e et al.\u003c/em\u003e HectD1 controls hematopoietic stem cell regeneration by coordinating ribosome assembly and protein synthesis. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 1275-1290 e1279 (2021). https://doi.org:10.1016/j.stem.2021.02.008\u003c/li\u003e\n\u003cli\u003eHindi, S. M. \u0026amp; Millay, D. P. All for One and One for All: Regenerating Skeletal Muscle. \u003cem\u003eCsh Perspect Biol\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e (2022). https://doi.org:ARTN a040824 10.1101/cshperspect.a040824\u003c/li\u003e\n\u003cli\u003eSchiaffino, S., Rossi, A. C., Smerdu, V., Leinwand, L. A. \u0026amp; Reggiani, C. Developmental myosins: expression patterns and functional significance. \u003cem\u003eSkelet Muscle\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 22 (2015). https://doi.org:10.1186/s13395-015-0046-6\u003c/li\u003e\n\u003cli\u003eMorgan, J. \u0026amp; Partridge, T. Skeletal muscle in health and disease. \u003cem\u003eDis Model Mech\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e (2020). https://doi.org:10.1242/dmm.042192\u003c/li\u003e\n\u003cli\u003ePi\u0026ntilde;ero, J.\u003cem\u003e et al.\u003c/em\u003e DisGeNET: a discovery platform for the dynamical exploration of human diseases and their genes. \u003cem\u003eDatabase (Oxford)\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, bav028 (2015). https://doi.org:10.1093/database/bav028\u003c/li\u003e\n\u003cli\u003eMartens, M.\u003cem\u003e et al.\u003c/em\u003e WikiPathways: connecting communities. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, D613-D621 (2021). https://doi.org:10.1093/nar/gkaa1024\u003c/li\u003e\n\u003cli\u003eJassal, B.\u003cem\u003e et al.\u003c/em\u003e The reactome pathway knowledgebase. \u003cem\u003eNucleic Acids Res\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, D498-D503 (2020). https://doi.org:10.1093/nar/gkz1031\u003c/li\u003e\n\u003cli\u003eT\u0026ouml;pf, A.\u003cem\u003e et al.\u003c/em\u003e Sequential targeted exome sequencing of 1001 patients affected by unexplained limb-girdle weakness. \u003cem\u003eGenet Med\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 1478-1488 (2020). https://doi.org:10.1038/s41436-020-0840-3\u003c/li\u003e\n\u003cli\u003eKircher, M.\u003cem\u003e et al.\u003c/em\u003e A general framework for estimating the relative pathogenicity of human genetic variants. \u003cem\u003eNat Genet\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 310-315 (2014). https://doi.org:10.1038/ng.2892\u003c/li\u003e\n\u003cli\u003eVaser, R., Adusumalli, S., Leng, S. N., Sikic, M. \u0026amp; Ng, P. C. SIFT missense predictions for genomes. \u003cem\u003eNat Protoc\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1-9 (2016). https://doi.org:10.1038/nprot.2015.123\u003c/li\u003e\n\u003cli\u003eAdzhubei, I., Jordan, D. M. \u0026amp; Sunyaev, S. R. Predicting functional effect of human missense mutations using PolyPhen-2. \u003cem\u003eCurr Protoc Hum Genet\u003c/em\u003e \u003cstrong\u003eChapter 7\u003c/strong\u003e, Unit7 20 (2013). https://doi.org:10.1002/0471142905.hg0720s76\u003c/li\u003e\n\u003cli\u003eDas, S.\u003cem\u003e et al.\u003c/em\u003e Motor neurons and endothelial cells additively promote development and fusion of human iPSC-derived skeletal myocytes. \u003cem\u003eSkelet Muscle\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 5 (2024). https://doi.org:10.1186/s13395-024-00336-4\u003c/li\u003e\n\u003cli\u003eMilan, G.\u003cem\u003e et al.\u003c/em\u003e Regulation of autophagy and the ubiquitin-proteasome system by the FoxO transcriptional network during muscle atrophy. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 6670 (2015). https://doi.org:10.1038/ncomms7670\u003c/li\u003e\n\u003cli\u003eMellis, D.\u003cem\u003e et al.\u003c/em\u003e Ubiquitin-protein ligase Ubr5 cooperates with hedgehog signalling to promote skeletal tissue homeostasis. \u003cem\u003ePLoS Genet\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, e1009275 (2021). https://doi.org:10.1371/journal.pgen.1009275\u003c/li\u003e\n\u003cli\u003eMarzuca-Nassr, G. N., Vitzel, K. F., Mancilla-Solorza, E. \u0026amp; M\u0026aacute;rquez, J. L. Sarcomere Structure: The Importance of Desmin Protein in Muscle Atrophy. \u003cem\u003eInt J Morphol\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 576-583 (2018). https://doi.org:Doi 10.4067/S0717-95022018000200576\u003c/li\u003e\n\u003cli\u003eHevener, A. L., Ribas, V., Moore, T. M. \u0026amp; Zhou, Z. ER\u0026alpha; in the Control of Mitochondrial Function and Metabolic Health. \u003cem\u003eTrends Mol Med\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 31-46 (2021). https://doi.org:10.1016/j.molmed.2020.09.006\u003c/li\u003e\n\u003cli\u003eGaillard, S., Dwyer, M. A. \u0026amp; McDonnell, D. P. Definition of the molecular basis for estrogen receptor-related receptor-alpha-cofactor interactions. \u003cem\u003eMol Endocrinol\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 62-76 (2007). https://doi.org:10.1210/me.2006-0179\u003c/li\u003e\n\u003cli\u003eCunningham, J. T.\u003cem\u003e et al.\u003c/em\u003e mTOR controls mitochondrial oxidative function through a YY1-PGC-1alpha transcriptional complex. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e450\u003c/strong\u003e, 736-740 (2007). https://doi.org:10.1038/nature06322\u003c/li\u003e\n\u003cli\u003eFern\u0026aacute;ndez-Vizarra, E., Enriquez, J. A., P\u0026eacute;rez-Martos, A., Montoya, J. \u0026amp; Fern\u0026aacute;ndez-Silva, P. Mitochondrial gene expression is regulated at multiple levels and differentially in the heart and liver by thyroid hormones. \u003cem\u003eCurr Genet\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 13-22 (2008). https://doi.org:10.1007/s00294-008-0194-x\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ndez-Hern\u0026aacute;ndez, M., Garc\u0026iacute;a-Gonz\u0026aacute;lez, E. G., Brun, C. E. \u0026amp; Rudnicki, M. A. The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. \u003cem\u003eSemin Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e72\u003c/strong\u003e, 10-18 (2017). https://doi.org:10.1016/j.semcdb.2017.11.010\u003c/li\u003e\n\u003cli\u003eZerafati-Jahromi, G.\u003cem\u003e et al.\u003c/em\u003e Sequence variants in HECTD1 result in a variable neurodevelopmental disorder. \u003cem\u003eAm J Hum Genet\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e, 537-553 (2025). https://doi.org:10.1016/j.ajhg.2025.01.001\u003c/li\u003e\n\u003cli\u003eMorey-Holton, E. R. \u0026amp; Globus, R. K. Hindlimb unloading rodent model: technical aspects. \u003cem\u003eJ Appl Physiol (1985)\u003c/em\u003e \u003cstrong\u003e92\u003c/strong\u003e, 1367-1377 (2002). https://doi.org:10.1152/japplphysiol.00969.2001\u003c/li\u003e\n\u003cli\u003eCorreia, J. C.\u003cem\u003e et al.\u003c/em\u003e Zfp697 is an RNA-binding protein that regulates skeletal muscle inflammation and remodeling. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e121\u003c/strong\u003e, e2319724121 (2024). https://doi.org:10.1073/pnas.2319724121\u003c/li\u003e\n\u003cli\u003eDobin, A.\u003cem\u003e et al.\u003c/em\u003e STAR: ultrafast universal RNA-seq aligner. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 15-21 (2013). https://doi.org:10.1093/bioinformatics/bts635\u003c/li\u003e\n\u003cli\u003eLiao, Y., Smyth, G. K. \u0026amp; Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 923-930 (2014). https://doi.org:10.1093/bioinformatics/btt656\u003c/li\u003e\n\u003cli\u003eLove, M. I., Huber, W. \u0026amp; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. \u003cem\u003eGenome Biol\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 550 (2014). https://doi.org:10.1186/s13059-014-0550-8\u003c/li\u003e\n\u003cli\u003eWu, T.\u003cem\u003e et al.\u003c/em\u003e clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. \u003cem\u003eInnovation (Camb)\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 100141 (2021). https://doi.org:10.1016/j.xinn.2021.100141\u003c/li\u003e\n\u003cli\u003ePashos, E. E.\u003cem\u003e et al.\u003c/em\u003e Large, Diverse Population Cohorts of hiPSCs and Derived Hepatocyte-like Cells Reveal Functional Genetic Variation at Blood Lipid-Associated Loci. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 558-570 e510 (2017). https://doi.org:10.1016/j.stem.2017.03.017\u003c/li\u003e\n\u003cli\u003eRan, F. A.\u003cem\u003e et al.\u003c/em\u003e Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e154\u003c/strong\u003e, 1380-1389 (2013). https://doi.org:10.1016/j.cell.2013.08.021\u003c/li\u003e\n\u003cli\u003eChal, J.\u003cem\u003e et al.\u003c/em\u003e Generation of human muscle fibers and satellite-like cells from human pluripotent stem cells in vitro. \u003cem\u003eNat Protoc\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1833-1850 (2016). https://doi.org:10.1038/nprot.2016.110\u003c/li\u003e\n\u003cli\u003eHicks, M. R.\u003cem\u003e et al.\u003c/em\u003e ERBB3 and NGFR mark a distinct skeletal muscle progenitor cell in human development and hPSCs. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 46-57 (2018). https://doi.org:10.1038/s41556-017-0010-2\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8663318/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8663318/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSarcomeres are the fundamental functional units of skeletal muscle, essential for both force generation and metabolic homeostasis. While sarcomere degradation has been extensively studied, the mechanisms that preserve its integrity remain poorly defined. Here, we identify HECTD1 as an E3 ubiquitin ligase required for sarcomere maintenance and mitochondrial integrity. We show that HECTD1 ubiquitylates and stabilizes the chaperones KLHL40/41, which protect thin-filament components from misfolding and degradation. Consequently, reducing \u003cem\u003eHectd1\u003c/em\u003e expression in myotubes coordinately decreases the levels of multiple sarcomere proteins. Skeletal muscle\u0026ndash;specific \u003cem\u003eHectd1\u003c/em\u003e knockout mice (\u003cem\u003eHectd1\u003c/em\u003e mKO) show severe sarcomere and mitochondrial disorganization and dysfunction, progressive muscle weakness, exercise and glucose intolerance, and unresolved tissue remodeling. Importantly, human iPSC-derived myotubes carrying a patient-associated HECTD1 mutation, recapitulate key molecular features of the \u003cem\u003eHectd1\u003c/em\u003e mKO. These findings establish HECTD1 as a central regulator linking sarcomere proteostasis to mitochondrial function and identify its dysfunction as a cause of myopathy with mitochondriopathy.\u003c/p\u003e","manuscriptTitle":"The E3 ligase HECTD1 controls skeletal muscle sarcomere and mitochondrial integrity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-08 16:51:38","doi":"10.21203/rs.3.rs-8663318/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"debbe2f0-9048-44ed-882c-f0ef92c4c732","owner":[],"postedDate":"March 8th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":63756353,"name":"Biological sciences/Physiology"},{"id":63756354,"name":"Biological sciences/Biochemistry"},{"id":63756355,"name":"Health sciences/Molecular medicine"}],"tags":[],"updatedAt":"2026-04-13T16:13:28+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-08 16:51:38","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8663318","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8663318","identity":"rs-8663318","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Outcome instruments

MUSA

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00