Early life stress induces age-dependent epigenetic changes in p11 gene expression

Early life stress induces age-dependent epigenetic changes in p11 gene expression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Early life stress induces age-dependent epigenetic changes in p11 gene expression Mi Kyoung Seo, Jung Goo Lee, Sung Woo Park This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-118558/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Early life stress (ELS) causes long-lasting changes in depression-like behaviors through epigenetic mechanisms. However, little is known about the effects of ELS in adulthood, specifically across different age groups. In this study, the epigenetic modifications of p11 expression in adult mice subjected to ELS were investigated in different stages of adulthood. Pups experienced maternal separation (MS) for 3 h daily from postnatal day 1 to 21. At young and middle adulthood, behavior phenotypes, hippocampal p11 expression levels, and levels of histone acetylation and methylation and DNA methylation at the hippocampal p11 promoter were measured. Middle-aged, but not young adult, MS mice exhibited depression-like behavior in the forced swimming test. Concurrent with reduced hippocampal p11 levels, mice in both age groups showed decreases in histone acetylation and activating histone methylation as well as increases in repressive histone methylation at the p11 promoter. The extent of the reduction in gene expression and histone acetylation was much higher in middle than in young adulthood. Moreover, DNA methylation analysis of the p11 promoter revealed increased CpG methylation in middle-aged MS mice only. The results highlight the age-dependent deleterious effects of ELS on depression-like behavior and on the epigenetic modifications of p11 transcription. Biological sciences/Genetics Biological sciences/Neuroscience Depression DNA methylation early life stress histone modification maternal separation p11 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Children exposed to early life stress (ELS) such as neglect and abuse have a significantly increased risk of developing depression 1 , 2 . In human and animal studies, ELS has been reported to induce a depression-like phenotype in adulthood 3 , 4 . These studies are focused on the epigenetic mechanisms, for example, DNA methylation and histone modification, by which ELS may alter the expression of genes involved in the stress response, including brain-derived neurotrophic factor (BDNF), glucocorticoid receptor (GR; NR3C1 ), and corticotrophin-releasing factor 3 , 4 . The emphasis of these papers is mainly on the detrimental effects of ELS. However, little is known regarding the effects of ELS on behaviors and epigenetic mechanisms over the lifespan, especially among different adult age groups. DNA methylation and histone modification, two representative epigenetic mechanisms, control gene transcription by affecting chromatin remodeling 5 . DNA methylation at the 5'-C-phosphate-G-3' (CpG) dinucleotide is classically associated with transcriptional repression 6 . Regions with a high density of CpGs are known as CpG islands; they are often found in the gene regulatory regions of promoters. Methylated CpGs in a promoter can induce gene silencing by blocking transcription factor binding or by attracting proteins that cause chromatin remodeling 6 . Histone modifications affect chromatin structure via post-translational modification, for example, acetylation and methylation, of the lysine (K) residues in the histone tails 7 . Acetylation of histone H3 or H4 relaxes the interaction between DNA and histone, allowing the transcriptional machinery access to the promoter, thereby activating transcription 7 . K4 and K19 on histone H3 are commonly modified in gene transcription activation 8 . Histone methylation, in contrast, is associated with both gene activation (H3K4 and H3K36) and repression (H3K9, H3K27, and H4K20), depending on the K residue methylated and its valence state (i.e., mono-, di-, or tri-methylation) 9 . In animals that had experienced ELS, those in young adulthood exhibit decreased H3K9 dimethylation (me2) at the BNDF IV promoter and, accordingly, increased BDNF IV expression, whereas those in middle adulthood show increased repressive H3K9me2 at the BDNF IV promoter and concurrent decreased BDNF IV expression 10 . Additionally, ELS was found to be associated with an age-dependent decline in cognition. In another study, ELS was demonstrated to be associated with long-term deleterious effects on the regulation of GR expression via histone acetylation and methylation as well as on depression-like behavior 11 . The effects of ELS on the epigenetic regulation of other stress-related genes besides BDNF and GR are less well-known and warrant further investigation. P11 ( S100A10 ) plays an important role in depression and antidepressant action 12 . Patients with depression show reduced p11 levels in the brain, and p11 knockout mice display a depression-like phenotype 13 – 16 . Antidepressant therapy, including selective serotonin reuptake inhibitors, enhances p11 expression 15 , 17 , 18 . Furthermore, p11 gene transfer therapy effectively reverses depression-like behavior in mice 14 . In addition, p11 is critical in the antidepressant actions of BDNF 18 . However, whether epigenetic regulation of the p11 gene following ELS is altered across the life span is unknown. Maternal separation (MS) is widely used as a model to examine the effects of ELS 19 . In this study, the effects of MS on histone modification and DNA methylation at the p11 promoter in the hippocampus was investigated as the animals aged. Results Effects of MS on depression-like behavior and hippocampal p11 expression in young adult and middle-aged mice FST was used to evaluate depression-like phenotypes. Control and MS animals in young adulthood did not significantly differ in immobility time. Conversely, middle aged-MS animals were significantly more immobile than controls, indicating a depression-like phenotype (control = 31.03 ± 7.86 sec, MS = 78.18 ± 10.82 sec; t = 3.411, p = 0.003; Fig. 3 A). Hippocampal p11 mRNA expression levels between control and MS animals in young and middle adulthood were assessed. MS animals showed a significant reduction in p11 mRNA in young (control = 1.00 ± 0.13, MS = 0.76 ± 0.12; t = 2.277, p = 0.034) and middle (control = 1.00 ± 0.11, MS = 0.33 ± 0.14; t = 8.644, p < 0.001) adulthood (Fig. 3 B). Moreover, the reduction was about 43% higher in middle-aged than in young adult MS animals. Effects of MS on histone acetylation and methylation at the hippocampal p11 promoter of young adult and middle-aged mice Epigenetic histone modifications at the p11 promoter were examined in control and MS mice in young and middle adulthood. Histone acetylation at the hippocampal p11 promoter was reduced in both young adult (control = 1.00 ± 0.11, MS = 0.73 ± 0.09; t = 3.172, p = 0.005) and middle-aged (control = 1.00 ± 0.09, MS = 0.38 ± 0.13; t = 8.378, p < 0.001) MS mice (Fig. 4 A). The reduction was about 45% greater in middle-aged MS animals compared to those in young adulthood. Similarly, H3K4 trimethylation, a marker of histone modification activation, of the p11 promoter was reduced in MS mice in young (control = 1.00 ± 0.08, MS = 0.32 ± 0.17; t = 8.063, p < 0.001) and middle adulthood (control = 1.00 ± 0.13, MS = 0.57 ± 0.15; t = 3.997, p = 0.001; Fig. 4 B). In contrast, H3K27 trimethylation, a marker of histone modification repression, was increased greatly in the MS group of both young (control = 1.00 ± 0.12, MS = 1.54 ± 0.13; t = 3.422, p = 0.003) and middle adulthood (control = 1.00 ± 0.14, MS = 1.68 ± 0.13; t = 3.882, p = 0.001; Fig. 4 C). Effects of MS on DNA methylation at the hippocampal p11 promoter of young adult and middle-aged mice CpG methylation at the p11 promoter was examined in the hippocampus of young adult and middle-aged MS and control animals. While DNA methylation at the p11 promoter did not differ between MS and control mice in young adulthood, it was significantly increased in the middle-aged MS group (control = 100 ± 11.36%, MS = 141.20 ± 7.89%; t = 3.051, p = 0.006; Fig. 5 ). Discussion This paper reports that MS in early life exerts persistent effects on depression-like behavior and on epigenetic mechanisms associated with decreased p11 expression in adulthood, and these effects become more pronounced with age. MS had no effect on behavior in young adult mice, but depression-like behavior appeared in middle age. The distinct behavioral changes observed between young adult and middle-aged MS mice are likely to be due to long-term deleterious effects associated with changes in hippocampal p11 expression via histone modification and DNA methylation at its promoter. In a past study, young adult (2 months) MS mice did not exhibit depression-like behavior in the FST; however, MS mice in middle adulthood (8 months) showed increased immobility time 11 , a finding replicated here. Most MS studies report depression-like behaviors in the FST in young adult animals 20 , although some papers are inconsistent. The findings seem to depend on the strain of mice used in the study. Similar to the MS model used here, Ruiz et al . (2018) found that MS (3 h daily from PND 1 to PND 14) in rats increased immobility time at two ages; furthermore, middle-aged (10 months) rats had longer immobility times than young adult (4 months) rats 21 . Taken together, early MS seems to induce more severe depressive-like behaviors in middle than in young adulthood. In this study, MS is associated with a reduction of hippocampal p11 expression at two time points in adulthood. Previous studies have demonstrated that chronic stress in adults induces p11 loss, as well as depression-like behaviors 22 , 23 . This study is the first to show an association between ELS and p11 levels. In a study using yeast two-hybrid screening, p11 was initially identified as a binding protein to the serotonin 1B (5-HT 1B ) receptor; the 5-HT 1B receptor regulates serotonin neurotransmission 15 . p11 interacts with the 5-HT 1B receptor by increasing its trafficking to the cell surface, where it binds to serotonin released from presynaptic neurons. Consequently, 5-HT 1B receptor signaling efficacy is enhanced. In mice, p11 overexpression increases 5-HT 1B receptor function and is associated with reduced immobility in the tail suspension test. In contrast, in p11 knockout mice, the number of 5-HT 1B receptors is reduced at the cell membrane. Notably, MS (3 h daily from PDN 2 to PND 13) in a rat ELS model reduced hippocampal 5-HT 1B receptor binding when assayed through [ 125 I] cyanopindolol autoradiography 24 . The reduced binding may result from ELS-induced reductions of p11 levels. Reduced hippocampal p11 expression in young adult and middle-aged MS animals was associated with altered histone modifications (i.e., significant decreases in H3 acetylation and H3K4me3 and a significant increase in H3K27me3) at the p11 promoter region. Moreover, p11 expression levels and H3 acetylation after MS were more severely perturbed in middle adulthood. Suri et al . (2014) demonstrated that MS induces opposing age-dependent effects on the expression of histone modifying enzymes such as histone deacetylase ( Hdac1 to Hdac11 ) and histone methyltransferase ( G9a and Suv391 ) in young adulthood (2 months) versus middle adulthood 25 . Nonetheless, the altered expression of these enzymes did not affect overall H3 acetylation, H3K9me2, and H3K9me3 at either of the ages. Although histone modifying enzymes may not globally change histone modification across the lifespan, these enzymes may differentially regulate histone modifications at the promoters of stress-related genes during aging. A loss of balance between epigenetic modifications during aging is referred to as “epigenetic drift” 26 . The global distribution of many histone acetylation and methylation modifications (i.e., H3K27me3, H3K56ac, and H4K16ac) has been found to be altered during aging in various organisms 27 , 28 . Accordingly, MS animals in middle age, but not young adulthood, show histone modifications associated with decreased BDNF IV expression concurrent with impairments in hippocampal-dependent cognition 10 . A similar age-dependent effect on histone acetylation and methylation at the GR exon I 7 promoter has been observed 11 . Taken together, middle-aged MS animals may exhibit more severe changes in histone modification than young adult MS animals due to age-related epigenetic drift. Increased DNA methylation in p11 promoter regions following MS were only present in middle-aged mice, not those in young adulthood. The increased DNA methylation, along with the altered histone modifications, could account for the reduced p11 expression in middle-aged MS animals. In accordance, a negative correlation between p11 gene transcription and CpG DNA methylation at the p11 promoter has been reported 29 . Moreover, reduced p11 levels in a genetic rodent model of depression were associated with higher DNA methylation, while escitalopram treatment elevated p11 levels and reduced DNA methylation of the p11 promoter. In rodents, the absence of maternal care such as licking, grooming, and arched-back nursing, is associated with hypothalamic-pituitary-adrenal (HPA) axis dysregulation as identified by increased glucocorticoid levels 30 . The lack of maternal care modifies DNA methylation, resulting in decreased hippocampal GR expression 31 . Accordingly, adults with histories of childhood maltreatment show increased DNA methylation of the GR exon I F promoter and, consequently, increased HPA activity 32 , 33 . GR acts as a ligand-activated transcription factor. When activated by glucocorticoids, GR translocates to the nucleus and binds to GR binding sites within the promoters of target genes, thereby activating or repressing their expression 34 . p11 is a target gene for GRs. Putative GR binding sites were identified using the web-based tools described in the Materials and Methods section; this site includes one CpG site (Fig. 2 ). Zhang et al . (2008) reported that GR increases p11 promoter activity via the interaction of glucocorticoid-bound GR with GR binding sites 35 . Thus, elevated GR levels may activate p11 transcription. Hippocampal GR expression levels have been found to be reduced in young adult and middle-aged MS animals and, furthermore, the reduction in middle adulthood was remarkably higher than in young adulthood 11 . Thus, the differential reduction in p11 levels in middle-aged MS animals could be due to CpG methylation of the GR binding site, which prevents GR from easily accessing the p11 promoter, resulting in reduced p11 transcriptional activity. Nevertheless, further experiments are needed to address whether MS causes an age-dependent decrease in nuclear GR levels. In conclusion, this study demonstrates that ELS induces long-term deleterious effects on depression-like behavior and hippocampal p11 expression through altered epigenetic modifications of the p11 promoter during adulthood. Furthermore, the deleterious effects are more severe with age. Methods Animals The animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at the College of Medicine Inje University (approval no. 2016-053) and performed in accordance with the IACUC and the ARRIVE 36 guidelines. All animals were anesthetized with carbon dioxide (CO 2 ) according to the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020 Edition). Pregnant C57BL/6J mice (Daehan Biolink, Chungbuk, Korea) arrived at the Inje Medical College animal facility on gestation day 15. Each dam and its litter were housed in standard cages under standard laboratory conditions (21 °C, 12 h/12 h light/dark cycle, food and water available ad libitum). Maternal separation (MS) Litters were divided randomly into control and MS groups. Pups in the MS group were separated from their mothers for 3 h daily starting on postnatal day (PND) 1 to PND 21 as described previously 37 . Pups in the control group were left undisturbed except during routine animal facility handling. Male control and MS mice were assayed at either 2 months old (young adulthood) or at 8 months old (middle adulthood; Fig. 1 ). Forced swimming test (FST) To assess depression-like behavior, the FST was performed in control and MS mice at either young ( n = 10–12/group) or middle ( n = 11–13/group) adulthood as described previously 37 . Mice were individually placed in transparent plastic cylinders (25 cm height × 10 cm diameter) containing 12 cm of water (23–25 °C) for 7 min and recorded on video. After an initial 2-min habituation period, the time spent immobile during the remaining 5 min was analyzed. Measurement of mRNA levels using quantitative real-time polymerase chain reaction (qRT-PCR) Following the FST, whole brains were extracted ( n = 10–12/group, young adulthood; n = 11–13/group, middle adulthood). The hippocampus was dissected from the brain; RNA isolation, cDNA synthesis, and qRT-PCR were performed on the hippocampal tissue as described previously 37 . Gene-specific primers (Table 1 ) for p11 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used under the following conditions: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 sec, 55 °C for 35 sec, and 72 °C for 35 sec. The cycle threshold (Ct) values were calculated automatically. Relative quantification was performed using the 2 −△△Ct comparative Ct method, where ΔCt = Ct target gene − Ct GAPDH . Final values are expressed relative to the control group. Table 1 Primers used in the study. Primer Sequence (5’–3’) quantitative real-time polymerase chain reaction (qRT-PCR) for mRNA P11 mRNA 44 * Forward TGCTCATGGAAAGGGAGTTC Reverse CCCCGCCACTATTGATAGAA GAPDH mRNA 45 # Forward AACAGCAACTCCCATTCTTC Reverse TGGTCCAGGGTTTCTTACTC qRT-PCR for histone modification (chromatin immunoprecipitation [ChIP] assay) P11 promoter † (189 base-pair [bp]; base 93554641–93554829) Forward CGTTCCTCCTGCTTATCTAG Reverse GCTCTTAGTATTTCAGGGCA qRT-PCR for DNA methylation (methylation-specific polymerase chain reaction [MSP] analysis) P11 promoter † Methylation-Specific: (150 bp; base 93554710–93554859) Forward TTTGGTTATTGTGTTTTTCGAGAC Reverse ACCCTATTATAAACGTCCCTACGA Unmethylation-Specific: (155 bp; 93554609–93554863) Forward TTTTGGTTATTGTGTTTTTTGAGAT Reverse AACAACCCTATTATAAACATCCCTACA * Mus musculus S100 calcium binding protein A10 (calpactin; S100a10), mRNA; NCBI Reference Sequence: NM_009112.2 # Mus musculus glyceraldehyde-3-phosphate dehydrogenase (GAPDH), pesudogene 14 (Gapdh-ps14) on chromosome 8; NCBI Reference Sequence: NG_007829.2 † Mus musculus strain C57BL/6J chromosome 3, GRCm38.p4 C57BL/6J; NCBI Reference Sequence: NC_000069.6 (GenBank Assembly ID: GCF_000001635.24) Chromatin immunoprecipitation (ChIP) assays Chromatin was extracted from the isolated hippocampus using a standard protocol (SimpleChIP® Plus Enzymatic Chromatic IP Kit; Cell Signaling, Beverly, MA, USA) as described previously ( n = 10–12/group, young adulthood; n = 11–13/group, middle adulthood) 37 . Primers were designed around a putative p11 promoter region (Table 1 and Fig. 2 ). Because the p11 promoter is not well characterized in mice, the region of interest was created based on previous data on epigenetic alterations in the rat p11 promoter 29 , 38 . The putative proximal promoter of the p11 gene (~ 700 base-pair upstream region) includes transcription factor binding sites generated by PROMO 39 , 40 and MotifMap 41 , 42 , two freely available web-based tools that identify presumptive transcription factor binding sites (Fig. 2 ). Chromatin was immunoprecipitated with antibodies against histone H3 acetylated at K9 and K14 (AcH3, 06-599; Millipore Sigma, Billerica, MA, USA) 37 , histone H3 trimethylated at K4 (H3K4me3, ab8580; Abcam, Cambridge, MA, USA) 11 , and histone H3 trimethylated at K27 (H3K27me3, ab6002; Abcam) 11 using a SimpleChIP® Plus Enzymatic Chromatic IP Kit. To confirm antibody specificity, chromatin samples were immunoprecipitated with ChIP antibodies and normal rabbit IgG (#2729; Cell Signaling). qRT-PCR was performed on purified DNA using a control primer set (SimpleChIP® Mouse RPL30 Intron 2 Primers #7015; Cell Signaling) and p11 promoter primers (Figure S1). Ct values were normalized to input DNA. The 2 −△△Ct comparative Ct method was used for relative quantification, where ΔCt = Ct immunoprecipitation – Ct input . Final values are expressed relative to control group. Methylation-specific polymerase chain reaction (MSP) analysis Genomic DNA was extracted from the hippocampus using a QIAGEN DNA prep kit (51036; Valencia, CA, USA) and treated with bisulfite using an EpiTect® Bisulfite kit (59104; QIAGEN). To determine the DNA methylation status of CpG in the p11 promoter region, a qRT-PCR was performed on the same amount of bisulfite-treated DNA using an EpiScope® MSP kit (#R100A; TaKaRa, Otsu, Japan) containing SYBR green (TaKaRa). Specific primers for methylated or unmethylated p11 promoters were designed using MethPrimer 43 . Primers include either a 150 base-pair (methylation-specific) or 155 base-pair (unmethylation-specific) region with 5 CpGs sites in the p11 promoter region (Fig. 2 ). Primer sequences are listed in Table 1 . The p11 promoter region was confirmed to be amplified with methylation- and unmethylation-specific primers (Figure S2). The qPCR reaction conditions were as follows: initial denaturation at 95 °C for 30 sec, followed by 40 cycles of denaturation at 98 °C for 5 sec, annealing at 53 °C for 30 sec, and extension at 72 °C for 1 min. Ct values were normalized to GAPDH, and differences in methylation and unmethylation between control and MS groups ( n = 10–12/group, young adulthood; n = 11–13/group, middle adulthood) were calculated using the 2 −△△Ct comparative Ct method. Relative levels of methylated DNA (%) were calculated according to the following formula: methylated rate (%) = methylated DNA / (methylated DNA + unmethylated DNA) × 100. Statistical analysis GraphPad Prim 8.0 (La Jolla, USA) was used for statistical analysis. All data are presented as the mean ± standard error of the mean (SEM). Because control and MS groups were compared in young or middle adulthood, the data were analyzed using unpaired Student’s t-tests. Data Availability The data ate availability from the corresponding author upon request. Declarations Acknowledgments This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2018R1D1A1B07049481 to J.G. Lee and NRF-2020R1I1A3060731 to M.K. Seo) & the Korea government (MIST) (NRF-2020R1A2C1010148 to S.W. Park). Author Contributions Conceptualization, S.W.P. and J.G.L.; Experiments and Analysis, M.K.S., S.W.P, and J.G.L.; Writing – Original Draft, S.W.P.; Writing-Assistance, M.K.S.; Supervision, S.W.P. and J.G.L. Competing Interests The authors declare no conflict of interest. References Bernet, C.Z. & Stein, M.B. Relationship of childhood maltreatment to the onset and course of major depression in adulthood. Depress. Anxiety 9 , 169–174 (1999). Burgess, R.L. & Conger, R.D. Family interaction in abusive, neglectful, and normal families. Child Dev. 49 , 1163–1173 (1978). Lutz, P.E. & Turecki, G. DNA methylation and childhood maltreatment: from animal models to human studies. Neuroscience 264 , 142–156 (2014). Zannas, A.S. & West, A.E. Epigenetics and the regulation of stress vulnerability and resilience. Neuroscience 264 , 157–170 (2014). Jaenisch, R. & Bird, A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. 33 , 245–254 (2003). Jones, P.A. Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat. Rev. Genet. 13 , 484–492 (2012). Kouzarides, T. Chromatin modifications and their function. Cell 128 , 693–705 (2007). Turner, B.M. Cellular memory and the histone code. Cell 111 , 285–291 (2002). Izzo, A. & Schneider, R. Chatting histone modifications in mammals. Brief Funct. Genomics 9 , 429–443 (2010). Suri, D., et al . Early stress evokes age-dependent biphasic changes in hippocampal neurogenesis, BDNF expression, and cognition. Biol. Psychiatry 73 , 658–666 (2013). Seo, M.K., et al . Effects of early life stress on epigenetic changes of the glucocorticoid receptor 1 7 promoter during adulthood. Int. J. Mol. Sci. 21 , 6331; 10.3390/ijms21176331 (2020). Svenningsson, P., Kim, Y., Warner-Schmidt, J., Oh, Y.S. & Greengard, P. p11 and its role in depression and therapeutic responses to antidepressants. Nat. Rev. Neurosci. 14 , 673–680 (2013). Anisman, H., et al . Seroto-nin receptor subtype and p11 mRNA expression in stress-relevant brain regions of suicide and control sub-jects. J. Psychiatry Neurosci . 33 , 131–141 (2008). Alexander, B., et al . Reversal of depressed behaviors in mice by p11 gene therapy in the nucleus accumbens. Sci. Transl. Med. 2 , 54ra76; 10.1126/scitranslmed.3001079 (2010). Svenningsson, P., et al . Alterations in 5-HT1B receptor function by p11 in depression-like states. Science 311 , 77–80 (2006). Zhang, L., et al . P11 (S100A10) as a potential biomarker of psychiatric patients at risk of suicide. J. Psychiatr. Res. 45 , 435–441 (2011). Egeland, M., Warner-Schmidt, J., Greengard, P. & Svenningsson, P. Neurogenic effects of fluoxetine are attenuated in p11 (S100A10) knockout mice. Biol. Psychiatry 67 , 1048–1056 (2010). Warner-Schmidt, J.L., et al . A role for p11 in the antidepressant action of brain-derived neurotrophic factor. Biol. Psychiatry 68 , 528–535 (2010). Levine, S. Developmental determinants of sensitivity and resistance to stress. Psychoneuroendocrinology 30 , 939–946 (2005). Tractenberg, S.G., et al . An overview of maternal separation effects on behavioural outcomes in mice: Evidence from a four-stage methodological systematic review. Neurosci. Biobehav. Rev. 68 , 489–503 (2016). Ruiz, R., et al . Early life stress accelerates age-induced effects on neurogenesis, depression, and metabolic risk. Psychoneuroendocrinology 96 , 203–211 (2018). Seo, J.S., et al . Cellular and molecular basis for stress-induced depression. Mol. Psychiatry 22 , 1440–1447 (2017). Seo, M.K., Lee, J.G. & Park, S.W. Effects of escitalopram and ibuprofen on a depression-like phenotype induced by chronic stress in rats. Neurosci. Lett. 696 , 168–173 (2019). Shrestha, S.S., et al . Antidepressant effects on serotonin 1A/1B receptors in the rat brain using a gene x environment model. Neurosci. Lett. 559 , 163–168 (2014). Suri, D., Bhattacharya, A. & Vaidya, V.A. Early stress evokes temporally distinct consequences on the hippocampal transcriptome, anxiety and cognitive behaviour. Int. J. Neuropsychopharmacol. 17 , 289–301 (2014). Li, Y. & Tollefsbol, T.O. Age-related epigenetic drift and phenotypic plasticity loss: implications in prevention of age-related human diseases. Epigenomics 8 , 1637–1651 (2016). Maures, T.J., Greer, E.L., Hauswirth, A.G. & Brunet, A. The H3K27 demethylase UTX-1 regulates C. elegans lifespan in a germline-independent, insulin-dependent manner. Aging Cell 10 , 980–990 (2011). Dang, W., et al . Histone H4 lysine 16 acetylation regulates cellular lifespan. Nature 459 , 802–807 (2009). Melas, P.A., et al . Antidepressant treatment is associated with epigenetic alterations in the promoter of P11 in a genetic model of depression. Int. J. Neuropsychopharmacol. 15 , 669–679 (2012). Liu, D., et al . Maternal care, hippocampal glucocorticoid receptors, and hypothalamic-pituitary-adrenal responses to stress. Science 277 , 1659–1662 (1997). Weaver, I.C., et al . Epigenetic programming by maternal behavior. Nat. Neurosci. 7 , 847–854 (2004). McGowan, P.O., et al . Epigenetic regulation of the glucocorticoid receptor in human brain associates with childhood abuse. Nat. Neurosci. 12 , 342–348 (2009). Perroud, N., et al . Increased methylation of glucocorticoid receptor gene (NR3C1) in adults with a history of childhood maltreatment: a link with the severity and type of trauma. Transl. Psychiatry 1 , e59; 10.1038/tp.2011.60 (2009). Newton, R. & Holden, N.S. Separating transrepression and transactivation: a distressing divorce for the glucocorticoid receptor? Mol. Pharmacol. 72 , 799–809 (2007). Zhang, L., et al . p11 is up-regulated in the forebrain of stressed rats by glucocorticoid acting via two specific glucocorticoid response elements in the p11 promoter. Neuroscience 153 , 1126–1134 (2008). Kilkenny. C., Browne, W.J., Cuthill, I.C., Emerson, M. & Altman, D.G. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. PLoS Biol . 8, e1000412; 10.1371/journal.pbio.1000412 . (2010). Seo, M.K., et al . Early life stress increases stress vulnerability through BDNF gene epigenetic changes in the rat hippocampus. Neuropharmacology 105 , 388–397 (2016). Theilmann, W., et al . Behavioral differences of male Wistar rats from different vendors in vulnerability and resilience to chronic mild stress are reflected in epigenetic regulation and expression of p11. Brain Res. 1642 , 505–515 (2016). Farré, D., et al . Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 31 , 3651–3653 (2003). Messeguer, X., et al . PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 18 , 333–334 (2002). Daily, K., Patel, V.R., Rigor, P., Xie, X. & Baldi, P. MotifMap: integrative genome-wide maps of regulatory motif sites for model species. BMC Bioinformatics 12 , 495; 10.1186/1471-2105-12-495 (2011). Xie, X., Rigor, P. & Baldi, P. MotifMap: a human genome-wide map of candidate regulatory motif sites. Bioinformatics 25 , 167–174 (2009). Li, L.C. & Dahiya, R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 18 , 1427–1431 (2002). Brkic, Z., et al . Distinct modifications of hippocampal glucocorticoid receptor phosphorylation and FKBPs by lipopolysaccharide in depressive female and male rats. J. Psychopharmacol. 31 , 1234–1249 (2017). Schmidt, H.D., et al . Increased brain-derived neurotrophic factor (BDNF) expression in the ventral tegmental area during cocaine abstinence is associated with increased histone acetylation at BDNF exon I-containing promoters. J Neurochem . 120 , 202–209 (2012). Supplementary Files SupplementalInformation201207.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 28 Jan, 2021 Reviews received at journal 27 Dec, 2020 Reviewers agreed at journal 17 Dec, 2020 Reviewers invited by journal 15 Dec, 2020 Editor assigned by journal 14 Dec, 2020 Editor invited by journal 07 Dec, 2020 Submission checks completed at journal 07 Dec, 2020 First submitted to journal 30 Nov, 2020 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-118558","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":5987251,"identity":"634acc5b-af2d-4385-9c60-11a55b66f188","order_by":0,"name":"Mi Kyoung Seo","email":"","orcid":"","institution":"Paik Institute for Clinical Research, Inje University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mi","middleName":"Kyoung","lastName":"Seo","suffix":""},{"id":5987252,"identity":"0d6c2ede-c36b-494e-b02c-44633055bf3d","order_by":1,"name":"Jung Goo Lee","email":"","orcid":"","institution":"Inje University Haeundae Paik Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jung","middleName":"Goo","lastName":"Lee","suffix":""},{"id":5987253,"identity":"1719f6d3-25a7-45d9-b94a-73de849e00b5","order_by":2,"name":"Sung Woo Park","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYNCCAzY8QALMNCBWSxrpWg7DmYS1yM/IPfi54sx5GXPGwwcYftQwGJs3ENBicCMvWfLMjds8lg3HEhh7jjGYyRwgpEU6x0Cy4cNtHoMDZwwYeBsYbCQIOmx2jvHPhg/ngFrOf2D8S4wWhts5ZpINNw6AbGFgBtpiRlCLwf13aZYNZ5KBWo4ZHJY5JmFM2GE9Zw/fbDhmZ29w4/DDh29qbAxnEHQYAw+UljgAikzCPkHSwt9AjOpRMApGwSgYiQAAOqZCsTud+jwAAAAASUVORK5CYII=","orcid":"","institution":"Inje University, College of Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Sung","middleName":"Woo","lastName":"Park","suffix":""}],"badges":[],"createdAt":"2020-11-30 08:44:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-118558/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-118558/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":4129583,"identity":"a91f0e1f-6aae-4b26-9697-0e38853fa24b","added_by":"auto","created_at":"2020-12-09 16:30:07","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":40569,"visible":true,"origin":"","legend":"Experimental design timeline.\nPups were separated from their mothers for 3 h daily from postnatal day (PND) 1 to PND 21. When the pups reached young adulthood (2 months) or middle age (8 months), they were subjected to the forced swimming test (FST). Following the FST, the mice were sacrificed for the p11 molecular analysis. \n","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-118558/v1/fd2c931f8b67f7f46eb49ca7.jpg"},{"id":4129585,"identity":"22dd526d-555c-4ecd-afb2-ba9e8548fe0c","added_by":"auto","created_at":"2020-12-09 16:30:08","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":219392,"visible":true,"origin":"","legend":"p11 proximal DNA sequence.\nThis sequence represents the promoter region (bases 1–660) and exon I (bases 760~) sequence, corresponding to bases 93554358–93555257 of the NCBI reference sequence NC_000069.6 (latest) investigated. H\u003e\u003e\u003e\u003e\u003e and H\u003c\u003c\u003c\u003c are forward (bases 284–303) and reverse (bases 453–472) primer regions, respectively, for histone modifications of the p11 promoter. M\u003e\u003e\u003e\u003e and M\u003c\u003c\u003c\u003c are forward methylation-specific (bases 353–376) and reverse methylation-specific (bases 479–502) primer regions, respectively, for DNA methylation of the p11 promoter. U\u003e\u003e\u003e\u003e and U\u003c\u003c\u003c\u003c are forward unmethylation-specific (bases 352–376) and reverse unmethylation-specific (bases 480–506) primer regions, respectively, for DNA methylation of the p11 promoter. The first encircled region is the putative androgen receptor binding site, and the second encircled region is the putative glucocorticoid receptor binding site. CpG sites investigated in this study are underlined and bolded.\n","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-118558/v1/5b7b48030f183e66f52ce87b.jpg"},{"id":4129586,"identity":"c3389db0-a894-499d-9567-6fe2054c377a","added_by":"auto","created_at":"2020-12-09 16:30:08","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":53505,"visible":true,"origin":"","legend":"Changes in depression-like behavior and hippocampal p11 levels in young adult and middle-aged mice following maternal separation (MS) exposure. \n(A) Immobility time in the FST was measured at 2 months (young adulthood) or 8 months (middle adulthood). (B) p11 mRNA levels in the hippocampus were measured using quantitative real-time polymerase chain reaction (qRT-PCR). All quantities were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Data are expressed as values relative to the control group using the 2−△△Ct method and are presented as mean ± standard error of the mean (SEM; n = 10–12/group, young adulthood; n = 11–13/group, middle adulthood; *p \u003c 0.05, **p \u003c 0.01, ***p \u003c 0.001, unpaired Student’s t-test). \n","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-118558/v1/16f357f63ef8d346b530fccc.jpg"},{"id":4129587,"identity":"9f4c3700-dc02-439b-9be5-4546232b7df9","added_by":"auto","created_at":"2020-12-09 16:30:08","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":87354,"visible":true,"origin":"","legend":"Alterations in histone acetylation and methylation of the hippocampal p11 promoter in young adult and middle-aged mice following MS exposure. \nThe levels of histone H3 acetylation (AcH3, A), histone H3 trimethylation at lysine residue 4 (H3K4me3, B), and histone H3 trimethylation at lysine residue 27 (H3K27me3, C) at the p11 promoter in the hippocampus were measured using a chromatin immunoprecipitation assay with antibodies to AcH3, H3K4me3, and H3K27me3. Data were normalized to input DNA and are expressed as values relative to the control group using the 2−△△Ct method. The data are presented as mean ± SEM (n = 10–12/group, young adulthood; n = 11–13/group; middle adulthood; **p \u003c 0.01, ***p \u003c 0.001, unpaired Student’s t-test).\n","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-118558/v1/d8a8343214527ac64599bdf4.jpg"},{"id":4129588,"identity":"fe6410f5-a699-4f49-8ca7-94317dcfbf66","added_by":"auto","created_at":"2020-12-09 16:30:08","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":31784,"visible":true,"origin":"","legend":"Alterations in DNA methylation at the hippocampal p11 promoter in young adult and middle-aged mice following MS exposure.\nDNA methylation levels at the hippocampal p11 promoter were measured using methylation-specific polymerase chain reaction (MSP). All quantities were normalized to GAPDH. Data are expressed as values relative to the control group using the 2−△△Ct method and are represented as mean ± SEM (n = 10–12/group, young adulthood; n = 11–13/group, middle adulthood; **p \u003c 0.01, unpaired Student’s t-test).\n","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-118558/v1/f7733edd52f26b4ea95689d2.jpg"},{"id":13630134,"identity":"6d9ceef8-0653-4281-989b-1aa279f04dc8","added_by":"auto","created_at":"2021-09-17 08:10:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":623242,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-118558/v1/70f57c75-8a0a-4c52-844f-b702fedf4a8b.pdf"},{"id":4129584,"identity":"2a702f76-5080-41b5-9204-bf0f3aa5a8dc","added_by":"auto","created_at":"2020-12-09 16:30:08","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1510041,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalInformation201207.docx","url":"https://assets-eu.researchsquare.com/files/rs-118558/v1/878f0e2d1c345c28438a7dd5.docx"}],"financialInterests":"","formattedTitle":"Early life stress induces age-dependent epigenetic changes in p11 gene expression","fulltext":[{"header":"Introduction","content":" \u003cp\u003eChildren exposed to early life stress (ELS) such as neglect and abuse have a significantly increased risk of developing depression\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e,\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In human and animal studies, ELS has been reported to induce a depression-like phenotype in adulthood\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. These studies are focused on the epigenetic mechanisms, for example, DNA methylation and histone modification, by which ELS may alter the expression of genes involved in the stress response, including brain-derived neurotrophic factor (BDNF), glucocorticoid receptor (GR; \u003cem\u003eNR3C1\u003c/em\u003e), and corticotrophin-releasing factor\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. The emphasis of these papers is mainly on the detrimental effects of ELS. However, little is known regarding the effects of ELS on behaviors and epigenetic mechanisms over the lifespan, especially among different adult age groups.\u003c/p\u003e \u003cp\u003eDNA methylation and histone modification, two representative epigenetic mechanisms, control gene transcription by affecting chromatin remodeling\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. DNA methylation at the 5'-C-phosphate-G-3' (CpG) dinucleotide is classically associated with transcriptional repression\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Regions with a high density of CpGs are known as CpG islands; they are often found in the gene regulatory regions of promoters. Methylated CpGs in a promoter can induce gene silencing by blocking transcription factor binding or by attracting proteins that cause chromatin remodeling\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Histone modifications affect chromatin structure via post-translational modification, for example, acetylation and methylation, of the lysine (K) residues in the histone tails\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Acetylation of histone H3 or H4 relaxes the interaction between DNA and histone, allowing the transcriptional machinery access to the promoter, thereby activating transcription\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. K4 and K19 on histone H3 are commonly modified in gene transcription activation\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Histone methylation, in contrast, is associated with both gene activation (H3K4 and H3K36) and repression (H3K9, H3K27, and H4K20), depending on the K residue methylated and its valence state (i.e., mono-, di-, or tri-methylation)\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn animals that had experienced ELS, those in young adulthood exhibit decreased H3K9 dimethylation (me2) at the BNDF IV promoter and, accordingly, increased BDNF IV expression, whereas those in middle adulthood show increased repressive H3K9me2 at the BDNF IV promoter and concurrent decreased BDNF IV expression\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Additionally, ELS was found to be associated with an age-dependent decline in cognition. In another study, ELS was demonstrated to be associated with long-term deleterious effects on the regulation of GR expression via histone acetylation and methylation as well as on depression-like behavior\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. The effects of ELS on the epigenetic regulation of other stress-related genes besides BDNF and GR are less well-known and warrant further investigation.\u003c/p\u003e \u003cp\u003eP11 (\u003cem\u003eS100A10\u003c/em\u003e) plays an important role in depression and antidepressant action\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Patients with depression show reduced p11 levels in the brain, and p11 knockout mice display a depression-like phenotype\u003csup\u003e\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Antidepressant therapy, including selective serotonin reuptake inhibitors, enhances p11 expression\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Furthermore, p11 gene transfer therapy effectively reverses depression-like behavior in mice\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. In addition, p11 is critical in the antidepressant actions of BDNF\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. However, whether epigenetic regulation of the p11 gene following ELS is altered across the life span is unknown. Maternal separation (MS) is widely used as a model to examine the effects of ELS\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. In this study, the effects of MS on histone modification and DNA methylation at the p11 promoter in the hippocampus was investigated as the animals aged.\u003c/p\u003e "},{"header":"Results","content":" \u003cp\u003e \u003cb\u003eEffects of MS on depression-like behavior and hippocampal p11 expression in young adult and middle-aged mice\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFST was used to evaluate depression-like phenotypes. Control and MS animals in young adulthood did not significantly differ in immobility time. Conversely, middle aged-MS animals were significantly more immobile than controls, indicating a depression-like phenotype (control\u0026thinsp;=\u0026thinsp;31.03\u0026thinsp;\u0026plusmn;\u0026thinsp;7.86 sec, MS\u0026thinsp;=\u0026thinsp;78.18\u0026thinsp;\u0026plusmn;\u0026thinsp;10.82 sec; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3.411, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.003; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHippocampal p11 mRNA expression levels between control and MS animals in young and middle adulthood were assessed. MS animals showed a significant reduction in p11 mRNA in young (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13, MS\u0026thinsp;=\u0026thinsp;0.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;2.277, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.034) and middle (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11, MS\u0026thinsp;=\u0026thinsp;0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8.644, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) adulthood (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Moreover, the reduction was about 43% higher in middle-aged than in young adult MS animals.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of MS on histone acetylation and methylation at the hippocampal p11 promoter of young adult and middle-aged mice\u003c/b\u003e \u003c/p\u003e \u003cp\u003eEpigenetic histone modifications at the p11 promoter were examined in control and MS mice in young and middle adulthood. Histone acetylation at the hippocampal p11 promoter was reduced in both young adult (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11, MS\u0026thinsp;=\u0026thinsp;0.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3.172, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.005) and middle-aged (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09, MS\u0026thinsp;=\u0026thinsp;0.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8.378, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) MS mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The reduction was about 45% greater in middle-aged MS animals compared to those in young adulthood.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSimilarly, H3K4 trimethylation, a marker of histone modification activation, of the p11 promoter was reduced in MS mice in young (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08, MS\u0026thinsp;=\u0026thinsp;0.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8.063, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and middle adulthood (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13, MS\u0026thinsp;=\u0026thinsp;0.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3.997, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). In contrast, H3K27 trimethylation, a marker of histone modification repression, was increased greatly in the MS group of both young (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12, MS\u0026thinsp;=\u0026thinsp;1.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3.422, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.003) and middle adulthood (control\u0026thinsp;=\u0026thinsp;1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14, MS\u0026thinsp;=\u0026thinsp;1.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3.882, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of MS on DNA methylation at the hippocampal p11 promoter of young adult and middle-aged mice\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCpG methylation at the p11 promoter was examined in the hippocampus of young adult and middle-aged MS and control animals. While DNA methylation at the p11 promoter did not differ between MS and control mice in young adulthood, it was significantly increased in the middle-aged MS group (control\u0026thinsp;=\u0026thinsp;100\u0026thinsp;\u0026plusmn;\u0026thinsp;11.36%, MS\u0026thinsp;=\u0026thinsp;141.20\u0026thinsp;\u0026plusmn;\u0026thinsp;7.89%; \u003cem\u003et\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3.051, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.006; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e "},{"header":"Discussion","content":" \u003cp\u003eThis paper reports that MS in early life exerts persistent effects on depression-like behavior and on epigenetic mechanisms associated with decreased p11 expression in adulthood, and these effects become more pronounced with age. MS had no effect on behavior in young adult mice, but depression-like behavior appeared in middle age. The distinct behavioral changes observed between young adult and middle-aged MS mice are likely to be due to long-term deleterious effects associated with changes in hippocampal p11 expression via histone modification and DNA methylation at its promoter.\u003c/p\u003e \u003cp\u003eIn a past study, young adult (2 months) MS mice did not exhibit depression-like behavior in the FST; however, MS mice in middle adulthood (8 months) showed increased immobility time\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, a finding replicated here. Most MS studies report depression-like behaviors in the FST in young adult animals\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, although some papers are inconsistent. The findings seem to depend on the strain of mice used in the study. Similar to the MS model used here, Ruiz \u003cem\u003eet al\u003c/em\u003e. (2018) found that MS (3\u0026nbsp;h daily from PND 1 to PND 14) in rats increased immobility time at two ages; furthermore, middle-aged (10 months) rats had longer immobility times than young adult (4 months) rats\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Taken together, early MS seems to induce more severe depressive-like behaviors in middle than in young adulthood.\u003c/p\u003e \u003cp\u003eIn this study, MS is associated with a reduction of hippocampal p11 expression at two time points in adulthood. Previous studies have demonstrated that chronic stress in adults induces p11 loss, as well as depression-like behaviors\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. This study is the first to show an association between ELS and p11 levels. In a study using yeast two-hybrid screening, p11 was initially identified as a binding protein to the serotonin 1B (5-HT\u003csub\u003e1B\u003c/sub\u003e) receptor; the 5-HT\u003csub\u003e1B\u003c/sub\u003e receptor regulates serotonin neurotransmission\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. p11 interacts with the 5-HT\u003csub\u003e1B\u003c/sub\u003e receptor by increasing its trafficking to the cell surface, where it binds to serotonin released from presynaptic neurons. Consequently, 5-HT\u003csub\u003e1B\u003c/sub\u003e receptor signaling efficacy is enhanced. In mice, p11 overexpression increases 5-HT\u003csub\u003e1B\u003c/sub\u003e receptor function and is associated with reduced immobility in the tail suspension test. In contrast, in p11 knockout mice, the number of 5-HT\u003csub\u003e1B\u003c/sub\u003e receptors is reduced at the cell membrane. Notably, MS (3\u0026nbsp;h daily from PDN 2 to PND 13) in a rat ELS model reduced hippocampal 5-HT\u003csub\u003e1B\u003c/sub\u003e receptor binding when assayed through [\u003csup\u003e125\u003c/sup\u003eI] cyanopindolol autoradiography\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. The reduced binding may result from ELS-induced reductions of p11 levels.\u003c/p\u003e \u003cp\u003eReduced hippocampal p11 expression in young adult and middle-aged MS animals was associated with altered histone modifications (i.e., significant decreases in H3 acetylation and H3K4me3 and a significant increase in H3K27me3) at the p11 promoter region. Moreover, p11 expression levels and H3 acetylation after MS were more severely perturbed in middle adulthood. Suri \u003cem\u003eet al\u003c/em\u003e. (2014) demonstrated that MS induces opposing age-dependent effects on the expression of histone modifying enzymes such as histone deacetylase (\u003cem\u003eHdac1\u003c/em\u003e to \u003cem\u003eHdac11\u003c/em\u003e) and histone methyltransferase (\u003cem\u003eG9a\u003c/em\u003e and \u003cem\u003eSuv391\u003c/em\u003e) in young adulthood (2 months) versus middle adulthood\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Nonetheless, the altered expression of these enzymes did not affect overall H3 acetylation, H3K9me2, and H3K9me3 at either of the ages. Although histone modifying enzymes may not globally change histone modification across the lifespan, these enzymes may differentially regulate histone modifications at the promoters of stress-related genes during aging. A loss of balance between epigenetic modifications during aging is referred to as \u0026ldquo;epigenetic drift\u0026rdquo;\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. The global distribution of many histone acetylation and methylation modifications (i.e., H3K27me3, H3K56ac, and H4K16ac) has been found to be altered during aging in various organisms\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Accordingly, MS animals in middle age, but not young adulthood, show histone modifications associated with decreased BDNF IV expression concurrent with impairments in hippocampal-dependent cognition\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. A similar age-dependent effect on histone acetylation and methylation at the GR exon I\u003csub\u003e7\u003c/sub\u003e promoter has been observed\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Taken together, middle-aged MS animals may exhibit more severe changes in histone modification than young adult MS animals due to age-related epigenetic drift.\u003c/p\u003e \u003cp\u003eIncreased DNA methylation in p11 promoter regions following MS were only present in middle-aged mice, not those in young adulthood. The increased DNA methylation, along with the altered histone modifications, could account for the reduced p11 expression in middle-aged MS animals. In accordance, a negative correlation between p11 gene transcription and CpG DNA methylation at the p11 promoter has been reported\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Moreover, reduced p11 levels in a genetic rodent model of depression were associated with higher DNA methylation, while escitalopram treatment elevated p11 levels and reduced DNA methylation of the p11 promoter.\u003c/p\u003e \u003cp\u003eIn rodents, the absence of maternal care such as licking, grooming, and arched-back nursing, is associated with hypothalamic-pituitary-adrenal (HPA) axis dysregulation as identified by increased glucocorticoid levels\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. The lack of maternal care modifies DNA methylation, resulting in decreased hippocampal GR expression\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Accordingly, adults with histories of childhood maltreatment show increased DNA methylation of the GR exon I\u003csub\u003eF\u003c/sub\u003e promoter and, consequently, increased HPA activity\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. GR acts as a ligand-activated transcription factor. When activated by glucocorticoids, GR translocates to the nucleus and binds to GR binding sites within the promoters of target genes, thereby activating or repressing their expression\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. p11 is a target gene for GRs. Putative GR binding sites were identified using the web-based tools described in the Materials and \u003cspan refid=\"Sec4\" class=\"InternalRef\"\u003eMethods\u003c/span\u003e section; this site includes one CpG site (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Zhang \u003cem\u003eet al\u003c/em\u003e. (2008) reported that GR increases p11 promoter activity via the interaction of glucocorticoid-bound GR with GR binding sites\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Thus, elevated GR levels may activate p11 transcription. Hippocampal GR expression levels have been found to be reduced in young adult and middle-aged MS animals and, furthermore, the reduction in middle adulthood was remarkably higher than in young adulthood\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Thus, the differential reduction in p11 levels in middle-aged MS animals could be due to CpG methylation of the GR binding site, which prevents GR from easily accessing the p11 promoter, resulting in reduced p11 transcriptional activity. Nevertheless, further experiments are needed to address whether MS causes an age-dependent decrease in nuclear GR levels.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn conclusion, this study demonstrates that ELS induces long-term deleterious effects on depression-like behavior and hippocampal p11 expression through altered epigenetic modifications of the p11 promoter during adulthood. Furthermore, the deleterious effects are more severe with age.\u003c/p\u003e "},{"header":"Methods","content":" \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eThe animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at the College of Medicine Inje University (approval no. 2016-053) and performed in accordance with the IACUC and the ARRIVE\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e guidelines. All animals were anesthetized with carbon dioxide (CO\u003csub\u003e2\u003c/sub\u003e) according to the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020 Edition). Pregnant C57BL/6J mice (Daehan Biolink, Chungbuk, Korea) arrived at the Inje Medical College animal facility on gestation day 15. Each dam and its litter were housed in standard cages under standard laboratory conditions (21\u0026nbsp;\u0026deg;C, 12\u0026nbsp;h/12\u0026nbsp;h light/dark cycle, food and water available ad libitum).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMaternal separation (MS)\u003c/h2\u003e \u003cp\u003eLitters were divided randomly into control and MS groups. Pups in the MS group were separated from their mothers for 3\u0026nbsp;h daily starting on postnatal day (PND) 1 to PND 21 as described previously\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Pups in the control group were left undisturbed except during routine animal facility handling. Male control and MS mice were assayed at either 2 months old (young adulthood) or at 8 months old (middle adulthood; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eForced swimming test (FST)\u003c/h2\u003e \u003cp\u003eTo assess depression-like behavior, the FST was performed in control and MS mice at either young (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;10\u0026ndash;12/group) or middle (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;11\u0026ndash;13/group) adulthood as described previously\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Mice were individually placed in transparent plastic cylinders (25\u0026nbsp;cm height\u0026thinsp;\u0026times;\u0026thinsp;10\u0026nbsp;cm diameter) containing 12\u0026nbsp;cm of water (23\u0026ndash;25\u0026nbsp;\u0026deg;C) for 7\u0026nbsp;min and recorded on video. After an initial 2-min habituation period, the time spent immobile during the remaining 5\u0026nbsp;min was analyzed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of mRNA levels using quantitative real-time polymerase chain reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003eFollowing the FST, whole brains were extracted (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;10\u0026ndash;12/group, young adulthood; \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;11\u0026ndash;13/group, middle adulthood). The hippocampus was dissected from the brain; RNA isolation, cDNA synthesis, and qRT-PCR were performed on the hippocampal tissue as described previously\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Gene-specific primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) for p11 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used under the following conditions: 95\u0026nbsp;\u0026deg;C for 10\u0026nbsp;min, followed by 40 cycles of 95\u0026nbsp;\u0026deg;C for 15 sec, 55\u0026nbsp;\u0026deg;C for 35 sec, and 72\u0026nbsp;\u0026deg;C for 35 sec. The cycle threshold (Ct) values were calculated automatically. Relative quantification was performed using the 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e comparative Ct method, where ΔCt\u0026thinsp;=\u0026thinsp;Ct \u003csub\u003etarget gene\u003c/sub\u003e \u0026minus; Ct \u003csub\u003eGAPDH\u003c/sub\u003e. Final values are expressed relative to the control group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in the study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo;\u0026ndash;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003equantitative real-time polymerase chain reaction (qRT-PCR) for mRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP11 mRNA\u003csup\u003e44\u003cb\u003e*\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward TGCTCATGGAAAGGGAGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse CCCCGCCACTATTGATAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH mRNA\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003cb\u003e#\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward AACAGCAACTCCCATTCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse TGGTCCAGGGTTTCTTACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqRT-PCR for histone modification (chromatin immunoprecipitation [ChIP] assay)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP11 promoter \u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003cp\u003e(189 base-pair [bp]; base 93554641\u0026ndash;93554829)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward CGTTCCTCCTGCTTATCTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse GCTCTTAGTATTTCAGGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqRT-PCR for DNA methylation (methylation-specific polymerase chain reaction [MSP] analysis)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP11 promoter \u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMethylation-Specific:\u003c/p\u003e \u003cp\u003e(150\u0026nbsp;bp; base 93554710\u0026ndash;93554859)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward TTTGGTTATTGTGTTTTTCGAGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse ACCCTATTATAAACGTCCCTACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eUnmethylation-Specific:\u003c/p\u003e \u003cp\u003e(155\u0026nbsp;bp; 93554609\u0026ndash;93554863)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward TTTTGGTTATTGTGTTTTTTGAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse AACAACCCTATTATAAACATCCCTACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003e* \u003cem\u003eMus musculus\u003c/em\u003e S100 calcium binding protein A10 (calpactin; S100a10), mRNA; NCBI Reference Sequence: NM_009112.2\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003e# \u003cem\u003eMus musculus\u003c/em\u003e glyceraldehyde-3-phosphate dehydrogenase (GAPDH), pesudogene 14 (Gapdh-ps14) on chromosome 8; NCBI Reference Sequence: NG_007829.2\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"2\"\u003e\u0026dagger; \u003cem\u003eMus musculus\u003c/em\u003e strain C57BL/6J chromosome 3, GRCm38.p4 C57BL/6J; NCBI Reference Sequence: NC_000069.6 (GenBank Assembly ID: GCF_000001635.24)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eChromatin immunoprecipitation (ChIP) assays\u003c/h2\u003e \u003cp\u003eChromatin was extracted from the isolated hippocampus using a standard protocol (SimpleChIP\u0026reg; Plus Enzymatic Chromatic IP Kit; Cell Signaling, Beverly, MA, USA) as described previously (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;10\u0026ndash;12/group, young adulthood; \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;11\u0026ndash;13/group, middle adulthood)\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Primers were designed around a putative p11 promoter region (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Because the p11 promoter is not well characterized in mice, the region of interest was created based on previous data on epigenetic alterations in the rat p11 promoter\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e,\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. The putative proximal promoter of the p11 gene (~\u0026thinsp;700 base-pair upstream region) includes transcription factor binding sites generated by PROMO\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e and MotifMap\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, two freely available web-based tools that identify presumptive transcription factor binding sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eChromatin was immunoprecipitated with antibodies against histone H3 acetylated at K9 and K14 (AcH3, 06-599; Millipore Sigma, Billerica, MA, USA)\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e, histone H3 trimethylated at K4 (H3K4me3, ab8580; Abcam, Cambridge, MA, USA)\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, and histone H3 trimethylated at K27 (H3K27me3, ab6002; Abcam)\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e using a SimpleChIP\u0026reg; Plus Enzymatic Chromatic IP Kit. To confirm antibody specificity, chromatin samples were immunoprecipitated with ChIP antibodies and normal rabbit IgG (#2729; Cell Signaling). qRT-PCR was performed on purified DNA using a control primer set (SimpleChIP\u0026reg; Mouse RPL30 Intron 2 Primers #7015; Cell Signaling) and p11 promoter primers (Figure S1). Ct values were normalized to input DNA. The 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e comparative Ct method was used for relative quantification, where ΔCt\u0026thinsp;=\u0026thinsp;Ct \u003csub\u003eimmunoprecipitation\u003c/sub\u003e \u0026ndash; Ct \u003csub\u003einput\u003c/sub\u003e. Final values are expressed relative to control group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMethylation-specific polymerase chain reaction (MSP) analysis\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from the hippocampus using a QIAGEN DNA prep kit (51036; Valencia, CA, USA) and treated with bisulfite using an EpiTect\u0026reg; Bisulfite kit (59104; QIAGEN). To determine the DNA methylation status of CpG in the p11 promoter region, a qRT-PCR was performed on the same amount of bisulfite-treated DNA using an EpiScope\u0026reg; MSP kit (#R100A; TaKaRa, Otsu, Japan) containing SYBR green (TaKaRa). Specific primers for methylated or unmethylated p11 promoters were designed using MethPrimer\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Primers include either a 150 base-pair (methylation-specific) or 155 base-pair (unmethylation-specific) region with 5 CpGs sites in the p11 promoter region (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The p11 promoter region was confirmed to be amplified with methylation- and unmethylation-specific primers (Figure S2). The qPCR reaction conditions were as follows: initial denaturation at 95\u0026nbsp;\u0026deg;C for 30 sec, followed by 40 cycles of denaturation at 98\u0026nbsp;\u0026deg;C for 5 sec, annealing at 53\u0026nbsp;\u0026deg;C for 30 sec, and extension at 72\u0026nbsp;\u0026deg;C for 1\u0026nbsp;min. Ct values were normalized to GAPDH, and differences in methylation and unmethylation between control and MS groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;10\u0026ndash;12/group, young adulthood; \u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;11\u0026ndash;13/group, middle adulthood) were calculated using the 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e comparative Ct method. Relative levels of methylated DNA (%) were calculated according to the following formula: methylated rate (%)\u0026thinsp;=\u0026thinsp;methylated DNA / (methylated DNA\u0026thinsp;+\u0026thinsp;unmethylated DNA)\u0026thinsp;\u0026times;\u0026thinsp;100.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prim 8.0 (La Jolla, USA) was used for statistical analysis. All data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Because control and MS groups were compared in young \u003cem\u003eor\u003c/em\u003e middle adulthood, the data were analyzed using unpaired Student\u0026rsquo;s t-tests.\u003c/p\u003e \u003c/div\u003e \n\u003ch2\u003eData Availability\u003c/h2\u003e\n \u003cp\u003eThe data ate availability from the corresponding author upon request.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2018R1D1A1B07049481 to J.G. Lee and NRF-2020R1I1A3060731 to M.K. Seo) \u0026amp; the Korea government (MIST) (NRF-2020R1A2C1010148 to S.W. Park).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, S.W.P. and J.G.L.; Experiments and Analysis, M.K.S., S.W.P, and J.G.L.; Writing \u0026ndash; Original Draft, S.W.P.; Writing-Assistance, M.K.S.; Supervision, S.W.P. and J.G.L.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBernet, C.Z. \u0026amp; Stein, M.B. Relationship of childhood maltreatment to the onset and course of major depression in adulthood. \u003cem\u003eDepress. Anxiety\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 169\u0026ndash;174 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurgess, R.L. \u0026amp; Conger, R.D. Family interaction in abusive, neglectful, and normal families. \u003cem\u003eChild Dev.\u003c/em\u003e \u003cb\u003e49\u003c/b\u003e, 1163\u0026ndash;1173 (1978).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLutz, P.E. \u0026amp; Turecki, G. DNA methylation and childhood maltreatment: from animal models to human studies. \u003cem\u003eNeuroscience\u003c/em\u003e \u003cb\u003e264\u003c/b\u003e, 142\u0026ndash;156 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZannas, A.S. \u0026amp; West, A.E. Epigenetics and the regulation of stress vulnerability and resilience. \u003cem\u003eNeuroscience\u003c/em\u003e \u003cb\u003e264\u003c/b\u003e, 157\u0026ndash;170 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJaenisch, R. \u0026amp; Bird, A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cb\u003e33\u003c/b\u003e, 245\u0026ndash;254 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJones, P.A. Functions of DNA methylation: islands, start sites, gene bodies and beyond. \u003cem\u003eNat. Rev. Genet.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 484\u0026ndash;492 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKouzarides, T. Chromatin modifications and their function. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e128\u003c/b\u003e, 693\u0026ndash;705 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurner, B.M. Cellular memory and the histone code. \u003cem\u003eCell\u003c/em\u003e \u003cb\u003e111\u003c/b\u003e, 285\u0026ndash;291 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIzzo, A. \u0026amp; Schneider, R. Chatting histone modifications in mammals. \u003cem\u003eBrief Funct. Genomics\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 429\u0026ndash;443 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuri, D., \u003cem\u003eet al\u003c/em\u003e. Early stress evokes age-dependent biphasic changes in hippocampal neurogenesis, BDNF expression, and cognition. \u003cem\u003eBiol. Psychiatry\u003c/em\u003e \u003cb\u003e73\u003c/b\u003e, 658\u0026ndash;666 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo, M.K., \u003cem\u003eet al\u003c/em\u003e. Effects of early life stress on epigenetic changes of the glucocorticoid receptor 1\u003csub\u003e7\u003c/sub\u003e promoter during adulthood. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 6331; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21176331\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvenningsson, P., Kim, Y., Warner-Schmidt, J., Oh, Y.S. \u0026amp; Greengard, P. p11 and its role in depression and therapeutic responses to antidepressants. \u003cem\u003eNat. Rev. Neurosci.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 673\u0026ndash;680 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnisman, H., \u003cem\u003eet al\u003c/em\u003e. Seroto-nin receptor subtype and p11 mRNA expression in stress-relevant brain regions of suicide and control sub-jects. \u003cem\u003eJ. Psychiatry Neurosci\u003c/em\u003e. \u003cb\u003e33\u003c/b\u003e, 131\u0026ndash;141 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlexander, B., \u003cem\u003eet al\u003c/em\u003e. Reversal of depressed behaviors in mice by p11 gene therapy in the nucleus accumbens. \u003cem\u003eSci. Transl. Med.\u003c/em\u003e \u003cb\u003e2\u003c/b\u003e, 54ra76; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/scitranslmed.3001079\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvenningsson, P., \u003cem\u003eet al\u003c/em\u003e. Alterations in 5-HT1B receptor function by p11 in depression-like states. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e311\u003c/b\u003e, 77\u0026ndash;80 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, L., \u003cem\u003eet al\u003c/em\u003e. P11 (S100A10) as a potential biomarker of psychiatric patients at risk of suicide. \u003cem\u003eJ. Psychiatr. Res.\u003c/em\u003e \u003cb\u003e45\u003c/b\u003e, 435\u0026ndash;441 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEgeland, M., Warner-Schmidt, J., Greengard, P. \u0026amp; Svenningsson, P. Neurogenic effects of fluoxetine are attenuated in p11 (S100A10) knockout mice. \u003cem\u003eBiol. Psychiatry\u003c/em\u003e \u003cb\u003e67\u003c/b\u003e, 1048\u0026ndash;1056 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWarner-Schmidt, J.L., \u003cem\u003eet al\u003c/em\u003e. A role for p11 in the antidepressant action of brain-derived neurotrophic factor. \u003cem\u003eBiol. Psychiatry\u003c/em\u003e \u003cb\u003e68\u003c/b\u003e, 528\u0026ndash;535 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLevine, S. Developmental determinants of sensitivity and resistance to stress. \u003cem\u003ePsychoneuroendocrinology\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e, 939\u0026ndash;946 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTractenberg, S.G., \u003cem\u003eet al\u003c/em\u003e. An overview of maternal separation effects on behavioural outcomes in mice: Evidence from a four-stage methodological systematic review. \u003cem\u003eNeurosci. Biobehav. Rev.\u003c/em\u003e \u003cb\u003e68\u003c/b\u003e, 489\u0026ndash;503 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuiz, R., \u003cem\u003eet al\u003c/em\u003e. Early life stress accelerates age-induced effects on neurogenesis, depression, and metabolic risk. \u003cem\u003ePsychoneuroendocrinology\u003c/em\u003e \u003cb\u003e96\u003c/b\u003e, 203\u0026ndash;211 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo, J.S., \u003cem\u003eet al\u003c/em\u003e. Cellular and molecular basis for stress-induced depression. \u003cem\u003eMol. Psychiatry\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 1440\u0026ndash;1447 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo, M.K., Lee, J.G. \u0026amp; Park, S.W. Effects of escitalopram and ibuprofen on a depression-like phenotype induced by chronic stress in rats. \u003cem\u003eNeurosci. Lett.\u003c/em\u003e \u003cb\u003e696\u003c/b\u003e, 168\u0026ndash;173 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShrestha, S.S., \u003cem\u003eet al\u003c/em\u003e. Antidepressant effects on serotonin 1A/1B receptors in the rat brain using a gene x environment model. \u003cem\u003eNeurosci. Lett.\u003c/em\u003e \u003cb\u003e559\u003c/b\u003e, 163\u0026ndash;168 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuri, D., Bhattacharya, A. \u0026amp; Vaidya, V.A. Early stress evokes temporally distinct consequences on the hippocampal transcriptome, anxiety and cognitive behaviour. \u003cem\u003eInt. J. Neuropsychopharmacol.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 289\u0026ndash;301 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, Y. \u0026amp; Tollefsbol, T.O. Age-related epigenetic drift and phenotypic plasticity loss: implications in prevention of age-related human diseases. \u003cem\u003eEpigenomics\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 1637\u0026ndash;1651 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaures, T.J., Greer, E.L., Hauswirth, A.G. \u0026amp; Brunet, A. The H3K27 demethylase UTX-1 regulates C. elegans lifespan in a germline-independent, insulin-dependent manner. \u003cem\u003eAging Cell\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 980\u0026ndash;990 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDang, W., \u003cem\u003eet al\u003c/em\u003e. Histone H4 lysine 16 acetylation regulates cellular lifespan. \u003cem\u003eNature\u003c/em\u003e \u003cb\u003e459\u003c/b\u003e, 802\u0026ndash;807 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMelas, P.A., \u003cem\u003eet al\u003c/em\u003e. Antidepressant treatment is associated with epigenetic alterations in the promoter of P11 in a genetic model of depression. \u003cem\u003eInt. J. Neuropsychopharmacol.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 669\u0026ndash;679 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, D., \u003cem\u003eet al\u003c/em\u003e. Maternal care, hippocampal glucocorticoid receptors, and hypothalamic-pituitary-adrenal responses to stress. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e277\u003c/b\u003e, 1659\u0026ndash;1662 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeaver, I.C., \u003cem\u003eet al\u003c/em\u003e. Epigenetic programming by maternal behavior. \u003cem\u003eNat. Neurosci.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 847\u0026ndash;854 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcGowan, P.O., \u003cem\u003eet al\u003c/em\u003e. Epigenetic regulation of the glucocorticoid receptor in human brain associates with childhood abuse. \u003cem\u003eNat. Neurosci.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 342\u0026ndash;348 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerroud, N., \u003cem\u003eet al\u003c/em\u003e. Increased methylation of glucocorticoid receptor gene (NR3C1) in adults with a history of childhood maltreatment: a link with the severity and type of trauma. \u003cem\u003eTransl. Psychiatry\u003c/em\u003e \u003cb\u003e1\u003c/b\u003e, e59; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/tp.2011.60\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNewton, R. \u0026amp; Holden, N.S. Separating transrepression and transactivation: a distressing divorce for the glucocorticoid receptor? \u003cem\u003eMol. Pharmacol.\u003c/em\u003e \u003cb\u003e72\u003c/b\u003e, 799\u0026ndash;809 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, L., \u003cem\u003eet al\u003c/em\u003e. p11 is up-regulated in the forebrain of stressed rats by glucocorticoid acting via two specific glucocorticoid response elements in the p11 promoter. \u003cem\u003eNeuroscience\u003c/em\u003e \u003cb\u003e153\u003c/b\u003e, 1126\u0026ndash;1134 (2008).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKilkenny. C., Browne, W.J., Cuthill, I.C., Emerson, M. \u0026amp; Altman, D.G. Improving bioscience research reporting: the ARRIVE guidelines for reporting animal research. \u003cem\u003ePLoS Biol\u003c/em\u003e. 8, e1000412; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pbio.1000412\u003c/span\u003e\u003c/span\u003e. (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo, M.K., \u003cem\u003eet al\u003c/em\u003e. Early life stress increases stress vulnerability through BDNF gene epigenetic changes in the rat hippocampus. \u003cem\u003eNeuropharmacology\u003c/em\u003e \u003cb\u003e105\u003c/b\u003e, 388\u0026ndash;397 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTheilmann, W., \u003cem\u003eet al\u003c/em\u003e. Behavioral differences of male Wistar rats from different vendors in vulnerability and resilience to chronic mild stress are reflected in epigenetic regulation and expression of p11. \u003cem\u003eBrain Res.\u003c/em\u003e \u003cb\u003e1642\u003c/b\u003e, 505\u0026ndash;515 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarr\u0026eacute;, D., \u003cem\u003eet al\u003c/em\u003e. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 3651\u0026ndash;3653 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMesseguer, X., \u003cem\u003eet al\u003c/em\u003e. PROMO: detection of known transcription regulatory elements using species-tailored searches. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 333\u0026ndash;334 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaily, K., Patel, V.R., Rigor, P., Xie, X. \u0026amp; Baldi, P. MotifMap: integrative genome-wide maps of regulatory motif sites for model species. \u003cem\u003eBMC Bioinformatics\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 495; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2105-12-495\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie, X., Rigor, P. \u0026amp; Baldi, P. MotifMap: a human genome-wide map of candidate regulatory motif sites. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 167\u0026ndash;174 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, L.C. \u0026amp; Dahiya, R. MethPrimer: designing primers for methylation PCRs. \u003cem\u003eBioinformatics\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 1427\u0026ndash;1431 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrkic, Z., \u003cem\u003eet al\u003c/em\u003e. Distinct modifications of hippocampal glucocorticoid receptor phosphorylation and FKBPs by lipopolysaccharide in depressive female and male rats. \u003cem\u003eJ. Psychopharmacol.\u003c/em\u003e \u003cb\u003e31\u003c/b\u003e, 1234\u0026ndash;1249 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt, H.D., \u003cem\u003eet al\u003c/em\u003e. Increased brain-derived neurotrophic factor (BDNF) expression in the ventral tegmental area during cocaine abstinence is associated with increased histone acetylation at BDNF exon I-containing promoters. \u003cem\u003eJ Neurochem\u003c/em\u003e. \u003cb\u003e120\u003c/b\u003e, 202\u0026ndash;209 (2012).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Depression, DNA methylation, early life stress, histone modification, maternal separation, p11 ","lastPublishedDoi":"10.21203/rs.3.rs-118558/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-118558/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEarly life stress (ELS) causes long-lasting changes in depression-like behaviors through epigenetic mechanisms. However, little is known about the effects of ELS in adulthood, specifically across different age groups. In this study, the epigenetic modifications of p11 expression in adult mice subjected to ELS were investigated in different stages of adulthood. Pups experienced maternal separation (MS) for 3 h daily from postnatal day 1 to 21. At young and middle adulthood, behavior phenotypes, hippocampal p11 expression levels, and levels of histone acetylation and methylation and DNA methylation at the hippocampal p11 promoter were measured. Middle-aged, but not young adult, MS mice exhibited depression-like behavior in the forced swimming test. Concurrent with reduced hippocampal p11 levels, mice in both age groups showed decreases in histone acetylation and activating histone methylation as well as increases in repressive histone methylation at the p11 promoter. The extent of the reduction in gene expression and histone acetylation was much higher in middle than in young adulthood. Moreover, DNA methylation analysis of the p11 promoter revealed increased CpG methylation in middle-aged MS mice only. The results highlight the age-dependent deleterious effects of ELS on depression-like behavior and on the epigenetic modifications of p11 transcription.\u003c/p\u003e","manuscriptTitle":"Early life stress induces age-dependent epigenetic changes in p11 gene expression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-12-09 16:30:06","doi":"10.21203/rs.3.rs-118558/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2021-01-28T14:13:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-12-27T20:46:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"419f3276-2c0f-4be3-be6b-c78b93d622cc","date":"2020-12-17T15:38:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-12-15T10:58:19+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2020-12-14T20:12:50+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-12-07T13:56:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-12-07T13:47:45+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2020-11-30T08:37:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3bd7bd63-9913-47df-9d7b-fa1cd566e1ef","owner":[],"postedDate":"December 9th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":1363645,"name":"Biological sciences/Genetics"},{"id":1363646,"name":"Biological sciences/Neuroscience"}],"tags":[],"updatedAt":"2021-04-22T15:59:13+00:00","versionOfRecord":[],"versionCreatedAt":"2020-12-09 16:30:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-118558","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-118558","identity":"rs-118558","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}