Maternal diet enriched with African walnuts confers neurodevelopmental resilience to MnCl2-induced neurotoxic cascades in rats

Maternal diet enriched with African walnuts confers neurodevelopmental resilience to MnCl2-induced neurotoxic cascades in rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Maternal diet enriched with African walnuts confers neurodevelopmental resilience to MnCl 2 -induced neurotoxic cascades in rats Tolulope Timothy Arogundade, Ismail Gbadamosi, Aminat Atoyebi, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2503533/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : Early experiences at critical milestones significantly impact neurocognitive outcomes by altering brain development. Such issues can affect children’s academic achievement, disturb their behaviour, lower their quality of life, and raise their risk of derangement in adulthood. These problems are linked to many possible neurotoxicants, including high ambient manganese (Mn) exposure. Walnuts possess high levels of ω-3 fatty acids and a high content of potent phytochemicals, all of which play an essential role in brain health. This present study explored the ability of a maternal walnut-enriched diet (WED) to protect against MnCl 2 -induced developmental neurotoxicity in utero vis-à-vis early postnatal stages in rats. Dams were exposed to diet and Mn treatment during gestation and/or preweaning periods. At the onset of adolescence (~postnatal day 28), offspring of dams were examined on the Y-maze and elevated-plus maze to evaluate working memory and anxiety levels. After euthanasia, cortical and hippocampal tissues were harvested for subsequent analyses by histology, histochemistry, PCR, and spectrophotometry methods. All data were analyzed using One-way ANOVA followed by Tukey’s test for multiple comparisons. Significance was set at p<0.05. Results : Offspring of dams treated with MnCl 2 exhibited a significant reduction in working memory and a loss of emotional stability, which was restored by WED; Mn aberrations in histomorphology of the PFC and hippocampus were abated by WED; dysregulation in gene expression of DNMT3A, H2Ax, BDNF, and OPA1 was prevented by developmental WED; upregulated levels of pro-inflammatory cytokines which correlated with MnCl 2 exposure was significantly reduced by walnut supplementation and; finally, accompanied perturbation of the cholinergic system (AChE) by MnCl 2 was significantly counteracted by WED. Conclusion : Our data suggest that WED intervened and forestalled deficits in behaviour, structural alterations, and functional dysregulation arising from manganese neurotoxicity in developing rats. neurodevelopment manganese neurotoxicity nutrition walnuts neuroprotection enhancement epigenetics Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Background Several metals, including those involved in normal cellular physiology, have been associated with adverse neurodevelopmental effects. They also play a role in the pathogenesis of neurodegenerative diseases ( 1 ). Manganese (Mn) is a vital micronutrient required for the normal development of many organs, including the brain ( 2 ). While its roles in maintaining optimal physiology and as a cofactor in several enzymes are well-known, Mn’s overall biological functions are poorly understood ( 2 , 3 ). Nonetheless, correlations between Mn dyshomeostasis, altered neuronal structure and function, and cognition are typically found in humans and animals ( 1 , 4 , 5 ). Since adult brain structure is primarily established in early life, environmental exposures in gestation and infancy can perturb brain anatomy and neurochemistry to influence the risk for neuropathology later in life ( 6 ). Therefore, children are at serious risk from pervasive exposure to even low levels of metals like Mn ( 7 ). Due to the complexities of the nervous system and the essential role of timing in the final product, minimal changes in any specific cell type or process caused by environmental exposures to Mn at critical periods can result in long-term disruption of the system’s overall functioning ( 8 , 9 ). On the other hand, some studies have highlighted the critical significance of early-life nurturing for optimal social and emotional development ( 10 , 11 ). It is known that factors such as maternal diet during and immediately after pregnancy impact the fetus’ development through programming , from the likelihood of cardiometabolic problems to the risk for or against psychopathology ( 12 – 14 ). Although it is unclear how exactly this occurs, mounting evidence suggests that epigenetic modifications are crucial for disease susceptibility or resilience ( 14 – 17 ). Previously, we reported that perinatal (gestation/lactation) dietary supplementation with African walnuts enhances cortico-hippocampal gene expression and histomorphology in rats ( https://doi.org/10.1080/1028415X.2023.2166804 ). Building on this work, we explored how the timing of preventative or developmental enhancement interventions may be employed to generate more significant and long-lasting neuroprotective effects against adversity-related unfavourable outcomes. Given that walnuts are enriched with omega-3 fatty acids, antioxidants, anticancer, and anti-inflammatory phytochemicals shown to maintain brain structure and function even with normal brain ageing ( 18 – 22 ), we hypothesized that a walnut-enriched diet (WED) would significantly induce factors in the cytoprotective pathway, intervene and correct possible alterations in behaviour, epigenetic regulation, neuronal morphology, and neurochemistry caused by excessive exposure to manganese chloride (MnCl 2 ) during gestation and preweaning in offspring of Wistar rats. Results WED improved working memory and reduced anxiety-like behaviour in rats Given the rodents’ inherent propensity to explore three-arm mazes by methodically moving into each arm, we investigated the behaviour of rats’ offspring in the Y-maze following developmental Mn overexposure with and without WED experience. Percentage correct spontaneous alternation was defined as successive, non-repeated entries into the three arms relative to the total arm entry for 300 seconds following a trial period ( 23 ). We observed a marked reduction of percentage correct spontaneous alternation in rats of the MnCl 2 group compared to the control and WED groups, suggesting that MnCl 2 impaired working memory and cognition in these rats (Fig. 1 a). However, offspring whose mothers were maintained on WED after prenatal MnCl 2 treatment (MnCl 2 //WED) showed significant improvement in alternating sequences when compared to animals whose mothers were treated with MnCl 2 alone, signifying that WED abated alterations in working memory induced by Mn overexposure. Following up on the hypothesis that developmental Mn overexposure would elicit anxiety behaviour in rat offspring ( 24 ), the potential of WED in preventing such Mn-induced effects was examined in the elevated plus maze. Results revealed similar patterns with control and WED alone rats (Fig. 1 b). These rats frequented the open arm of the maze, which could be extrapolated to mean lower anxiety levels. However, rats whose dams received MnCl 2 during early development had significantly reduced open-arm entry frequency, suggesting anxiety-like behaviour. Effective prevention and counteraction of Mn effects were seen in animals whose dams were maintained on prenatal WED before postnatal Mn treatment (WED//MnCl 2 ) and those whose mothers received combined exposure to WED and Mn (WED + MnCl 2 ) throughout gestation and preweaning. Taken together, developmental exposure to manganese caused a reduction in working memory and induced anxiety-like behaviour, both of which were abated by dietary supplementation with walnuts. Prenatal walnut supplementation normalizes blood and brain manganese levels Blood and whole brain Mn concentrations were measured in the present study. Data showed significantly higher Mn levels in the blood and brains (Fig. 2 b) of rats prenatally exposed to MnCl 2 compared with offspring from the Ctrl and WED groups. In comparison, the experimental groups that were treated with WED before, after or alongside MnCl 2 showed a significant reduction in blood and brain level of manganese. This finding suggests that it prevented bioaccumulation of Mn in the tissues examined, further buttressed by results from profiling neuroinflammation in the PFC and hippocampus (see next section). Prenatal WED supplementation is protective against Mn-induced neuroinflammation The upregulation of pro-inflammatory cytokines in tissues is one of the mechanisms by which Mn exerts its neurotoxicity ( 2 , 25 – 28 ). In the present study, we observed a significantly increased expression of cortical TNF-α in offspring of dams overexposed to Mn, compared with the control and WED groups. Also, it appears that prenatal and postnatal exposure to WED were respectively able to counteract and lessen the overexpression of TNF-α in the PFC of these rats (Fig. 3 a). Hippocampal TNF-α levels also revealed a similar trend (Fig. 3 e). Our data also revealed significant increase (p < 0.05) in inducible nitric oxide synthase (iNOS) levels in experimental animal groups’ PFC and hippocampus of rats whose mothers were treated with MnCl 2 during development, compared to the control and WED groups (Fig. 3 b & f). Expectedly, results revealed an MnCl 2 -induced increase in the levels of interleukin-1β in experimental animal groups’ PFC and hippocampus (Fig. 3 c & g). The concurrent interaction with WED seems to suppress this upregulation during embryonic development. Furthermore, levels of cyclooxygenase COX-2 in the PFC and hippocampus of experimental animal groups were markedly elevated in offspring of dams overexposed to Mn during development (Fig. 3 d & h). These were significantly downregulated by treatment with WED during prenatal and postnatal life and a combination of both. These findings suggest that cholinergic signalling might be impaired because of MnCl 2 -induced cytokine overexpression. WED attenuated Mn-induced cholinergic transmission perturbation Metabolically active brain cells are sensitive to their environment during development and maturation, and subtle dyshomeostasis can result in severe neuropathological consequences ( 29 ). Acetylcholinesterase (AChE) inhibits choline uptake/release at presynaptic terminals, altering neurotransmission as indicated by significant neocortical deficiencies in the enzyme responsible for acetylcholine (ACh) synthesis – choline acetyltransferase (ChAT) ( 29 ). Following treatments of dams, the differential expression of AChE in the PFC (Fig. 4 a) and hippocampus (Fig. 4 b) of offspring were quantified. Analyses showed significant elevations in AChE levels in both brain regions, corresponding with the MnCl 2 treatment (Fig. 4 a & b). This outcome supported the finding that the rats in this group had poorer working memory. However, AChE overexpression was normalized to baseline levels, mainly by postnatal (MnCl 2 //WED) and concurrent (WED + MnCl 2 ) WED exposure. WED significantly mitigated cortico-hippocampal gene expression dysregulated by developmental Mn exposure in rats Adverse experiences associated with the early developmental environment have been suggested to play an important role in increased risk for psychopathology across the lifespan ( 30 ). This role played by the environment during critical periods of development is brought about by alterations in the expression of genes during the development of the brain and throughout the lifespan ( 30 ). Due to its potential significant roles in memory functions, DNA methyltransferase 3a (DNMT3a) was investigated, along with histone protein 2A variation (H2Ax), which is crucial for maintaining genomic stability; brain-derived neurotrophic factor (BDNF), due to its significance in accumulating a reserve for/of neuroplasticity to safeguard against future adversity (neural resilience); and optic atrophy 1 (OPA1) gene due to its role in oxidative phosphorylation, mitochondrial fusion, and maintenance of the DNA within mitochondria – processes that improve cells’ adaptability. Developmental exposure to excess Mn caused a significant reduction in DNMT3a expression in the PFC and hippocampus of offspring of exposed dams (Fig. 5 a & 6 a, respectively). Comparatively, combined exposure to MnCl 2 and WED through early development prevented reduced DNMT3a expression significantly. Additionally, prenatal dietary supplementation with WED significantly prevented postnatal MnCl 2 -induced hypomethylation in the hippocampus but not in the PFC (Fig. 5 a). However, postnatal WED did not significantly remediate DNMT3a expression in the PFC and hippocampus. Furthermore, MnCl 2 led to a significant diminution of fold-change relative expression of H2AX in the PFC and hippocampus of rat offspring (Fig. 5 b & 6 b). However, there were substantial decreases in the effect of MnCl 2 on the hippocampus of rat offspring following gestational supplementation with African walnuts (Fig. 6 b). This result was not replicated in the PFC (Fig. 5 b), where a modest effect was observed. Nonetheless, concurrent WED supplementation was significantly effective (p < 0.05) in counteracting neurotoxic cascades of MnCl 2 . Similarly, developmental MnCl 2 exposure led to repression of the OPA1 gene in the PFC and hippocampus of rat offspring (Fig. 5 c & 6 c, respectively). According to Sarkar et al . (2018), Mn exposure instigates neuroinflammation by interfering with mitochondrial dynamics ( 31 ). Maintenance of dams on WED with manganese treatment throughout gestation and early postnatal life (WED + MnCl 2 ) effectively (p < 0.05) prevented dysregulation of OPA1 expression in PFC and hippocampus, potentially abrogating mitochondrial deficits and mitigating cell death. Nonetheless, prenatal WED and postnatal manganese overexposure (WED//MnCl 2 ), and prenatal manganese overexposure and postnatal walnut-enriched diet (MnCl 2 //WED) did not significantly impact OPA1 mRNA expression in the PFC and hippocampus, compared to the control. The influence exerted by WED in both groups was modest compared to the group concomitantly exposed to Mn overexposure and WED through gestation and preweaning. Lastly, MnCl 2 overexposure caused significant diminution (p < 0.05) in the mRNA expression of BDNF in the PFC and hippocampus (Fig. 5 d & 6 d, respectively). However, this effect of MnCl 2 on BDNF expression in the rat PFC and hippocampus was significantly reversed by WED, potentially suggesting a role for walnuts in fostering neuroplasticity. WED supplementation attenuates MnCl 2 -induced neuropathology in the PFC and hippocampal area The prefrontal cortex and hippocampus possess a distinct histological appearance that invariably alters after inflammatory reactions and oxidative stress dysregulation. Comparative examination of thin sections of the cortex, hippocampus, and dentate gyrus was done utilizing H&E, Nissl, and Congo Red staining methods. As we anticipated, the cortical and hippocampal milieu of offspring of MnCl 2 -treated dams were characterized by the fragmentation of neuropil, distortion of layering, and some spongiosis. Furthermore, we observed diffuse plaques and a marked reduction in the deposition of Nissl proteins in this group’s PFC and hippocampal sections compared to rats born to dams maintained on a control or walnut-enriched diet. Interestingly, simultaneous exposure to WED protected cortical and hippocampal neurons against Mn-induced alterations, bearing some similarities to the control group. Furthermore, prenatal WED exposure before postnatal Mn neurotoxicity and postnatal WED exposure after excess prenatal MnCl 2 exposure is partially protected against these changes. Sections revealed normal cells; however, occasional degenerated pyramidal cells with dark-folded nuclei were still demonstrated. Discussion Newborn and growing brains are more prone to Mn toxicity ( 32 , 33 ). The upregulation of pro-inflammatory biomarkers, reactive nitrogen, and oxygen species because of exposures during crucial developmental stages can reverberate in adulthood and may result in the emergence of neurodegenerative diseases ( 34 – 36 ). As a result, it is hypothesized that primary prevention can be accomplished in early life to avert disorders in the future ( 37 ). PUFAs (ALA & LA) and phytochemicals, including flavonoids, polyphenols, melatonin, resveratrol, etc., are abundant in walnuts. These and numerous other factors add to walnuts’ well-known health advantages, earning the local moniker “brain food.” According to several epidemiological research, eating more foods high in omega-3 fatty acids is strongly linked to a decreased prevalence of brain disorders ( 37 – 39 ). To our knowledge, no studies have been done on the possible neuroprotective effects of a walnut-enriched diet during pregnancy or preweaning against Mn-induced developmental neurotoxicity. Therefore, this study examined the effects of a maternal diet supplemented with African walnuts on changes in behaviour, cortico-hippocampal structure, and function brought on by manganese. Understanding the unique functional abnormalities brought on by neurotoxicants like Mn is vital to devise efficient treatment and prevention strategies. An increasing body of evidence suggests that prenatal and early childhood neurobehavioral outcomes are negatively impacted by historical Mn exposure. According to these studies, developmental Mn exposure is associated with hyperactivity, impulsivity, rebellious behaviour, inattentiveness, and reduced fine motor abilities ( 40 – 44 ). Like the control group, the offspring of dams maintained on WED scored significantly higher in correct spontaneous alternation performance percentage than those of dams treated with MnCl 2 (Fig. 4.13). This observation suggests substantial effects of developmental Mn neurotoxicity on short-term spatial memory. Like the report by Hogas et al . (2011), significant deficits in spontaneous alternation percentage in rats administered high-dose manganese was observed ( 24 ). Furthermore, Schneider et al . (2015) found that manganese exposure resulted in impairments in spatial working memory with more substantial deficits in non-spatial working memory in macaque monkeys ( 45 ). Expressly, those whose mothers were maintained on WED after prenatal MnCl 2 treatment (MnCl 2 //WED) showed significant improvement in alternating sequences compared to animals whose mothers were treated with MnCl 2 alone, suggesting that WED forestalled alterations in spatial working memory induced by development Mn overexposure. One of the rodent’s most significant behavioural paradigms to assess anxiety behaviour is the elevated plus-maze (EPM). Since rats’ natural propensity is to hide in the closed components of the EPM apparatus due to anxiety generated by a novel environment, it is commonly known that anxiolytic agents improve the frequency of entrances and the period spent in the EPM’s open arms ( 46 , 47 ). In the current study, offspring of control and WED-maintained dams significantly frequented the open arm portion of the maze more than those whose mothers were treated with MnCl 2 during early development. This latter observation suggests a higher level of anxiety or decreased impulsivity induced by developmental Mn neurotoxicity in offspring of these dams, likely by deficits in inhibition control. Hence, the prolonged time spent in the closed arms by offspring of Mn-treated rats. Notably, these findings contrast with those of Pappas et al . (1997) ( 48 ), who reported that neither the 2 mg/ml prenatal manganese-exposed rats nor the 10 mg/ml perinatal manganese-exposed rats differed from controls on the elevated plus apparatus, the Morris water maze, or the radial arm maze and Kern et al . (2010) ( 49 ), who found no behavioural effects following Mn exposure via the EPM test. These disparities in results are likely due to different exposure protocols and routes of administration (i.e., direct oral administration to the pups) vs transplacental and lactational transfer in the present study. Nonetheless, prenatal exposure to WED significantly prevented postnatal Mn-induced anxiety. Similarly, concurrent WED with MnCl 2 treatment significantly counteracted the anxiogenic effects of excess developmental Mn. Although there was no significant influence of postnatal WED on anxiety measures following prenatal exposure to MnCl 2 , there was an insignificant trend toward increased open-arms exploration, all indicative of an anxiolytic property of WED. Just as important, several studies have revealed that Mn can exacerbate the effects of cytokines on the activation of both microglia and astrocytes that causes dramatic potentiation in the production of TNFα, IL-1β, ROS, and NOS2 expression ( 2 , 25 , 26 , 28 ). Increased levels of these and other inflammatory genes have been measured in both rodent ( 50 , 51 ) and nonhuman primate ( 52 ) studies, with deletion or inhibition of these pathways showing neuroprotection ( 51 , 53 ). Notably, results from this current study revealed an Mn-correlated significant uptrend in the levels of inflammatory biomarkers (iNOS, TNF-α, IL-1β, and COX-2) in the PFC and hippocampus of rat offspring (Fig. 3 ). Mn levels in the blood and brain of developmentally exposed rats were significantly higher than in the offspring of the control and WED animals. Interestingly, prenatal supplementation delayed treatment, and prophylactic/postnatal exposure of dams to WED significantly inhibited the overexpression of these pro-inflammatory cytokines in the PFC and hippocampus of rat offspring, respectively. Moreover, only concurrent treatment with WED showed no significant difference with the control and WED-only groups. While pre-treatment and post-treatment significantly reduced Mn levels compared to the MnCl 2 group, there were still significant differences (p < 0.05) between these groups and the control and WED groups. Additionally, studies indicate that the cholinergic system may be significantly involved in PD and Manganism through choline uptake, release, and acetyltransferase activity, even though it is not the primary target in Mn toxicity and several symptoms are primarily related to effects on the dopaminergic system ( 29 ). Specifically, MnCl 2 significantly altered cortical and hippocampal cholinergic homeostasis in this study (Fig. 4 a & b), which is consistent with the impairment in spatial working memory in this study’s Y-maze spontaneous alternation test and the raised levels of inflammatory biomarkers. Neurotransmitter metabolism disruption is correlated with Mn-induced behavioural abnormalities, such as motor incoordination or emotional and cognitive impairment, shown in both human and animal models ( 54 ). Different processes, such as neurotransmitter release inhibition, changes in neurotransmitter clearance from the synaptic cleft, or receptor modification, can lead to impaired neurotransmitter signalling ( 54 ). Acetylcholine (ACh) is an excitatory neurotransmitter that modulates important cognitive activities such as learning, memory, and movement in the central and peripheral nervous systems, all of which may be hampered due to Mn’s effects on cholinergic signalling ( 54 , 55 ). Still, WED was significantly effective in repressing Mn-induced upregulation of AChE in the cortex and hippocampus of rat offspring. This effect was observed at the studied exposure time points and is most likely potentiated by the synergy of African walnuts’ antioxidant and anti-inflammatory phytochemicals. Conversely, developmental exposure to excess Mn caused a significant reduction in DNMT3a expression in the PFC and hippocampus of offspring of exposed dams (Fig. 5 a & 6 a, respectively). DNMT3a expression in offspring of dams on WED from gestation through weaning with simultaneous exposure to MnCl 2 was modestly impacted compared to the offspring of dams treated with MnCl 2 alone. There was no significant difference between this group and the control or WED group. This expression was comparable in both PFC and hippocampal tissues (Fig. 5 a & 6 a, respectively). Age-related decline in the protein levels of DNMT3a is reported to be reduced in the cortex and hippocampus of mice. It is linked to memory decline that can be salvaged by restoring DNMT3a levels ( 56 ). In addition, prenatal dietary supplementation alone significantly prevented postnatal MnCl 2 -induced hypomethylation in the hippocampus but not in the PFC (Fig. 5 a). Furthermore, postnatal WED supplementation after prenatal MnCl 2 exposure did not significantly remediate DNMT3a expression in the PFC and hippocampus. While potential mitigation is apparent in both groups, it was statistically insignificant. A possible inference that could be drawn concerns the duration of exposure to WED. Then again, MnCl 2 correlated with the diminution of fold-change relative expression of H2AX in the PFC and hippocampus of rat offspring (Fig. 5 b & 6 b). Nevertheless, there were substantial decreases in this effect of MnCl 2 on the hippocampus of rat offspring following prenatal supplementation with African walnuts (Fig. 6 b). However, this result was not replicated in the PFC (Fig. 5 b), where a modest effect was observed. Nonetheless, concurrent WED supplementation was significantly effective (p < 0.05) in counteracting neurotoxic cascades of MnCl 2 . This observation is quite interesting because several studies have reported that H2AX mutant mice, apart from being more sensitive to DNA damage, were uniquely vulnerable to mitochondrial injury in the brain, and mitochondrial defects constitute a significant source of impaired redox homeostasis, which are usually associated with age-related neurological diseases ( 57 , 58 ). Therefore, WED appears involved in mitochondrial integrity and consequent maintenance of redox homeostasis. Per the study’s goals and because mitochondrial abnormalities significantly cause redox dyshomeostasis, the mitochondrial dynamics gene OPA1 was assessed in each experimental group. Through the fusion process, OPA1 shapes and preserves mitochondrial morphology ( 59 ). Developmental MnCl 2 exposure led to repression of the OPA1 gene in the PFC and hippocampus of rat offspring (Fig. 5 c & 6 c, respectively), which confirms the results for H2AX (Fig. 5 b & 6 b). Attendant maintenance on WED with manganese treatment throughout gestation and early postnatal life (WED + MnCl 2 ) effectively restored OPA1 expression in PFC and hippocampus, potentially abrogating mitochondrial deficits and mitigating cell death. Accordingly, MnCl 2 exposure caused a significant diminution in the expression of the BDNF gene in the PFC and hippocampus (Fig. 5 d & 6 d, respectively). This observation was speculated because a study examining the effects of prenatal stress reported decreased BDNF expression, specifically in the hippocampus and amygdala ( 30 , 60 ). In addition, mice deficient in TrkB, the BDNF receptor, show increased anxiety-like behaviour ( 61 ). Similarly, A study using overexpression and knockdown of BDNF in rats showed that BDNF overexpression could rescue depression-like behaviour in chronically stressed rats. In contrast, the knockdown of BDNF in the hippocampus, at least in young animals, produced a depression-like phenotype ( 62 , 63 ). The repression of BDNF induced by MnCl 2 might explain the perceived level of anxiety in this group, indicated by the low frequency of entry into the open arm (Fig. 1 b). Nonetheless, WED significantly (p < 0.05) mitigated this effect of MnCl 2 on BDNF expression in the PFC and hippocampus of rats. Histological sections of rat offspring; control and WED-treated rats’ prefrontal cortices demonstrated the same cortical layers containing medium/large pyramidal and non-pyramidal cells scattered in a background formed by neuroglia cells and myelinated axons (Fig. 7 ). In contrast, sections of offspring of MnCl 2 -treated rats revealed shrunken pyramidal cells, vacuolated cytoplasm (spongiosis), perineural neuroglia, and ill-defined axons (Fig. 7 , 8 , & 9 ). Guilarte (2010) reported observing AD-like pathology and neurodegeneration in the frontal cortex of manganese-exposed nonhuman primates ( 64 ), and Lazrishvili et al. (2009) also noted alteration in the histoarchitecture of rat pups’ brains following subchronic poisoning with manganese chloride ( 65 ). Conclusion The results of this work suggest that neuroinflammation, mitochondrial dysfunction, and oxidative injury are the fundamental processes driving Mn-induced developmental neurotoxicity, which confirms worries about the severe effects of Mn exposure on development. More significantly, however, developmental Mn-induced neuronal susceptibility is also influenced by epigenetic pathways, cholinergic dyshomeostasis, and neurotrophin downregulation. A non-pharmacological, effective, and reasonably priced prophylactic option in the field of developmental neurotoxicology is a nutritional intervention with African walnuts, which appears to mediate these pathways. Methods Animals and care Male sires (250-300g) and nulliparous female Wistar rats (180-200g) were acquired from a private animal facility to serve as the parent generation. The Central Research Laboratory at the University of Ilorin provided animal care for the rats. Except where otherwise noted, ad libitum rat food and water were available. The animals’ home cages were stocked with wood shavings throughout the trial and changed twice a week. The desired environmental conditions were a conventional 24-hour light-dark cycle (12/12, with lights on at 7 am), relative humidity of 50 ± 10%, and a temperature of 23 ± 2°C. Preparation of diets and treatment Manganese Molychem Industries in Mumbai, India, supplied the manganese (II) chloride tetrahydrate (MnCl2.4H2O) with batch number MCR- 18314 and product code 15590. The crystalline salt was dissolved in distilled water (20 mg/ml) to create the solution, which was then pH-adjusted with 0.1 M PBS to 7.4. Treatment was 100 mg/kg/d administered orally through a cannula. Diets We bought African walnuts from a community market in Osogbo, Osun State. The nuts were verified by the Department of Plant Biology at the University of Ilorin. The nuts were then de-husked, chopped into pieces, and dried at a tropical room temperature. Before being added to diets, the dry nuts were ground up. This study changed a typical rat diet shown by Hardman and colleagues ( 20 ) and added walnuts to it. The diet was designed to be isocaloric and isonutrient, balanced in terms of nutrients, protein, fat, and carbohydrate relative to the control. The main distinction between the two diets was whether one included walnuts and one did not (see Table 1 ). We used a similar diet formulation in a previous study ( https://doi.org/10.1080/1028415X.2023.2166804 ). Table 1 Formulation of diets ( modified from ( 20 )) Ingredient % of Weight Control Diet Amount/100 g Walnut Diet Amount/100 g Groundnut cake 25% 25 g 24.4 g Palm kernel cake 25% 25 g 24.4 g Corn starch 15% 15 g 13.5 g Industrial Soya 10% 10 g 9.4 g Bone meal 5% 5 g 5 g Wheat (fibre) 5% 5 g 4.8 g Lysine 0.2% 0.2 g 0.2 g Methionine 0.3% 0.3 g 0.3 g Concentrate 4.5% 4.5 g 4.5 g Ground walnut 0 11 g Corn oil 10% 10 g 2.63 g Total 100% 100 g 100.1 g Experimental design The presumptive pregnant dams were randomly assigned to one of six ( 6 ) experimental groups after estrus phases were determined and mating was confirmed (Table 2 ). A free application that may be accessed from http://www.openepi.com was used for randomization and sample size computations. All pregnant dams were mated with a different control male before being housed in pairs with another pregnant dam in the same experimental setup—two rats per cage. At gestational day 20, the dams were divided and housed separately for the duration of the pregnancy and weaning. Pups were housed in six condition-matched cages at weaning (Table 2 ). Offspring for the first condition (control) were delivered in a typical setting – to dams with ad libitum access to water and conventional rat food during pregnancy and preweaning. Pups in the second condition were offspring of dams treated with manganese chloride (MnCl 2 ) through development. The third group comprised animals born to dams kept on the walnut-enriched diet (WED) throughout gestation and preweaning. Rats in the fourth group were born to dams fed a diet supplemented with walnuts prenatally and then received postnatal MnCl 2 treatment (WED//MnCl 2 ). The fifth group included rat offspring of dams that received prenatal MnCl 2 treatment and postnatal WED (MnCl 2 //WED). Finally, the last experimental group comprised offspring of dams concurrently maintained on WED and Mn from gestation through preweaning (WED + MnCl 2 ). Dams were carefully monitored to ensure they stayed healthy during pregnancy and weaning. Table 2 Animal grouping S/N Treatment Group Timepoint No. of Animals 1 Control - 7 2 MnCl 2 Gestation and preweaning 7 3 WED Gestation and preweaning 7 4 WED//MnCl 2 Gestation//preweaning 7 5 MnCl 2 //WED Gestation//preweaning 7 6 WED + MnCl 2 Gestation and preweaning 7 Key: Control = animals receiving control diet throughout the experimental duration; MnCl 2 = animals treated with Mn from gestation day 0 (GD 0) to postnatal day 21 (PND 21); WED = animals maintained on the walnut-enriched diet (WED) from GD 0 to PND 21; WED//MnCl 2 = animals kept on the walnut diet from GD 0 till birth, then treated with Mn from birth till PND 21; MnCl 2 //WED = animals treated with Mn from GD 0 till parturition, then put on WED from birth till PND 21; WED + MnCl 2 = animals maintained on WED from GD 0 – PND 21 concomitantly with Mn treatment for the same period. Sacrifice Rats used for histological analysis were euthanized after injections with 20 mg/kg ketamine (intraperitoneal). When the left ventricle was exposed, 0.1 M PBS (pH 7.4) was supplied at a rate of 25 ml/min, and then perfusion with 4% paraformaldehyde (PFA)/PBS solution continued for 10 min at the same rate. The removed brains were postfixed in 4% PFA for 24 hours and kept in 30% sucrose at 4°C until further processing. The removed brains were then washed in 0.25 M sucrose three times for five minutes each. Each brain’s PFC and hippocampus’ coronal sections (5 µm thick) were obtained stereotaxically (+ 4 mm). AAS Briefly, tissues were digested in 1M HCI and then injected into the liquid suction module of the AAS machine. The flame atomizer vaporized free gaseous atoms in the samples. The atomized particles in the machine’s vacuum were by light spectrum emitted by a lamp in the light emitter. A detector picks up the dispersed light as a function of the Mn concentration in the blood or brain. ELISA Enzymatic profiles in experimental animals’ PFC and hippocampal lysates were quantified using enzyme-linked immunosorbent assay (ELISA). The levels of acetylcholinesterase (AChE), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumour necrotic factor- (TNF- α), interleukin-1 (IL-1β) were quantified using spectrophotometric techniques as specified in their respective assay kits. Total RNA isolation Using a technique outlined by Omotuyi et al . (2018), total RNA was extracted from the entire tissue. TRI reagent (4°C; Zymo Research, USA; Cat. R2050-1-50; Lot. ZRC186885) was used to homogenize the tissues quickly ( 66 ). Centrifugation at 15,000 rpm for 15 minutes resulted in the partitioning of total RNA into chloroform (BDH Analytical Chemicals, Poole, England Cat: 10076-6B) (Abbott Laboratories, Model: 3531, Lake Bluff, Illinois, United States). Using an equivalent volume of isopropanol, RNA was precipitated from the clear supernatant (Burgoyne Urbidges & Co, India, Cat: 67-63-0). In 30 cc of nuclease-free water, the RNA pellet was washed twice in 70% ethanol (BDH Analytical Chemicals, Poole, England Cat: 10107-7Y) (Inqaba Biotec, West Africa, Lot no: 0596C320, code: E476-500ML). After being air-dried for five minutes, the pellets were dissolved in RNA buffer (1 mM sodium citrate, pH 6.4) cDNA conversion Total RNA concentration (µg/ml = 40 * A260) and quality (≥ 1.8) were determined prior to cDNA conversion using the ratio of A260/A230 (A = absorbance) and read using a spectrophotometer (Jen-way UV-VIS spectrophotometer model 6305, UK). After DNAse I treatment (NEB, Cat: M0303S), as directed by the manufacturer’s instructions, DNA contamination from RNA was eliminated. M-MuLV Reverse Transcriptase Kit (NEB, Cat: M0253S) was used to create cDNA from a 2 µl solution containing 100 ng of DNA-free RNA in a 20 µl final volume (2 µl of N9 random primer mix, 2 µl of 10X M-MuLV buffer, 2 µl of 10 mM dNTP, 0.2 µl of RNase Inhibitor. The reaction was carried out O/N at room temperature. M-MuLV reverse transcriptase was inactivated for 20 minutes at 65°C. PCR amplification and agarose gel electrophoresis We utilized the methodology of Ye et al. (2012) for PCR amplification and detection of genes ( 67 ) whose primers are listed in Table 3 . In a total volume reaction mixture of 25 µl, PCR amplification was carried out using 2 µl of cDNA (40 ng) and 2 µl of primer (100 pmol), One Taq Quick-Load 2x, master mix, NEB, Cat: M0486S, 12.5 µl Ready Mix Taq PCR master mix, and 8.5 µl nuclease-free water. Twenty cycles of amplification (denaturation at 95°C for 30 seconds, annealing ( see list of primers in supplementary information ) for 30 seconds, and extension at 72°C for 60 seconds) were performed after an initial denaturation at 95°C for 5 minutes. The process was completed with a final extension at 72°C for 10 minutes. Negative controls were used in every experiment where the reaction mixture contained no cDNA. The amplicons were resolved in Tris (RGT reagent, China, Lot: 20170605) on a 2.0% agarose gel (Cleaver Scientific Limited: Lot: 14170811). Borate (JHD chemicals, China, Lot 20141117) with EDTA buffer (pH 8.4). Table 3 : List of primers S/N Gene Forward Primer sequence (5’-3’) Reverse Primer sequence (5’-3’) Tm °C Amplicon Size (bp) 1 H2AX CCCTTTTAAGGGCCACCACC GAGAACGGCGAAGCGATGTC 60 132 2 OPA-1 TCTTCACTGCGGGTACACCT TCCTTCTCCAAACGCTCCAG 57 146 3 DNMT3A CTTTTTGGACACCCCAAGGCAG TGGTCTTTGTGAGCAAGAGCTA 58 172 4 BDNF TGCAGGGGCATAGACAAAAGG CTTATGAATCGCCAGCCAATTCTC 60 148 Amplicon image processing and semi-quantification Images of in-gel amplicon bands were processed using the Keynote platform. Utilizing Image-J software, gel density quantification was carried out ( 68 ). Using the Numbers software (Mac OSX version), each point reflects relative expression as defined by the test gene band intensity compared to the internal control band intensity. Statistical analyses Statistical significance was determined using p ≤ .05 for all analyses. Any descriptive data presented in the text represents the mean ± standard error (SEM). Data analyses were performed with one-way ANOVA followed by Tukey’s multiple comparisons tests using GraphPad Prism 9 (GraphPad Software, Inc.) statistical program. Microscopy Using an Olympus binocular research microscope (Olympus, New Jersey, USA) coupled to a 5.0 MP Amscope camera, histological and histochemical images of the hippocampus and PFC were obtained (Amscope Inc, USA). List Of Abbreviations WED walnut-enriched diet PFC prefrontal cortex EPM elevated plus maze AChE acetylcholinesterase TNF-α tumour necrotic factor-alpha iNOS inducible nitric oxide synthase IL-1β interleukin 1 beta COX-2 cyclooxygenase 2 DNMT 3a DNA methyltransferase 3a H2Ax histone protein 2Ax OPA1 mitochondrial dynamin-like GTPase BDNF brand-derived neurotrophic factor Declarations Ethics approval The Ethical Review Committee of the University of Ilorin authorized the experimental protocols outlined in this article (approval number: UERC/ASN/2019/1855), confirming that they adhered to all institutional policies and laws concerning the care and use of animals in research. Consent for publication Not applicable Availability of data and materials This published article [including its supplemental information files] contains all data produced or analyzed during this investigation. Funding There was no funding for this study. Competing interests The authors declare that they have no competing interests Author’s contributions TTA, OJO, and BU are responsible for research ideation; OJO refined methodology; benchwork and data curation were performed by AA, OB, FSL, EL, and OA; EY, OT, and IG performed data analyses and image visualization; TTA wrote the original manuscript draft; TTA, IG, and OA did review and editing; OJO and BU performed supervisory roles. All authors have read and approved the final draft of this work. Acknowledgements We sincerely thank Prof. Olaposi Omotuyi of the Drug and Research and Development, Afe Babalola University, Ado-Ekiti, Nigeria, for his technical support with gene expression assays. References Chen P, Bornhorst J, Aschner M. Manganese metabolism in humans. Frontiers in Bioscience - Landmark. 2018;23(9). Balachandran RC, Mukhopadhyay S, McBride D, Veevers J, Harrison FE, Aschner M, et al. Brain manganese and the balance between essential roles and neurotoxicity. Journal of Biological Chemistry. 2020;295(19):6312–29. Mezzaroba L, Alfieri DF, Colado Simão AN, Vissoci Reiche EM. The role of zinc, copper, manganese and iron in neurodegenerative diseases. Neurotoxicology. 2019 Sep 1;74:230–41. Toni M, Massimino ML, de Mario A, Angiulli E, Spisni E. Metal dyshomeostasis and their pathological role in prion and prion-like diseases: The basis for a nutritional approach. Vol. 11, Frontiers in Neuroscience. 2017. Li Y, Jiao Q, Xu H, Du X, Shi L, Jia F, et al. Biometal dyshomeostasis and toxic metal accumulations in the development of alzheimer’s disease. Vol. 10, Frontiers in Molecular Neuroscience. 2017. Adwan L, Zawia NH. Epigenetics: A novel therapeutic approach for the treatment of Alzheimer’s disease. Pharmacol Ther [Internet]. 2013;139(1):41–50. Available from: http://dx.doi.org/10.1016/j.pharmthera.2013.03.010 Tu H, Fan C, Chen X, Liu J, Wang B, Huang Z, et al. Effects of cadmium, manganese, and lead on locomotor activity and neurexin 2a expression in zebrafish. Environ Toxicol Chem. 2017;36(8):2147–54. Heyer DB, Meredith RM. Environmental toxicology: Sensitive periods of development and neurodevelopmental disorders. Vol. 58, NeuroToxicology. 2017. Stansfield KH, Richard Pilsner J, Lu Q, Wright RO, Guilarte TR. Dysregulation of BDNF-TrkB signaling in developing hippocampal neurons by Pb2+: Implications for an environmental basis of neurodevelopmental disorders. Toxicological Sciences. 2012;127(1). Luthar SS, Eisenberg N. Resilient adaptation among at-risk children: Harnessing science toward maximizing salutary environments. Child Dev. 2017;88(2). Luby JL, Baram TZ, Rogers CE, Barch DM. Neurodevelopmental Optimization after Early-Life Adversity: Cross-Species Studies to Elucidate Sensitive Periods and Brain Mechanisms to Inform Early Intervention. Vol. 43, Trends in Neurosciences. 2020. van Abeelen AFM, Elias SG, Bossuyt PMM, Grobbee DE, van der Schouw YT, Roseboom TJ, et al. Famine exposure in the young and the risk of type 2 diabetes in adulthood. Diabetes. 2012;61(9). Borge TC, Aase H, Brantsæter AL, Biele G. The importance of maternal diet quality during pregnancy on cognitive and behavioural outcomes in children: A systematic review and meta-analysis. Vol. 7, BMJ Open. 2017. Meyer HC, Lee FS. Translating developmental neuroscience to understand risk for psychiatric disorders. Vol. 176, American Journal of Psychiatry. 2019. Franklin TB, Russig H, Weiss IC, Grff J, Linder N, Michalon A, et al. Epigenetic transmission of the impact of early stress across generations. Biol Psychiatry. 2010;68(5). Murgatroyd C, Spengler D. Epigenetics of early child development. Vol. 2, Frontiers in Psychiatry. 2011. Mansuy IM, Mohanna S. Epigenetics and the human brain: where nurture meets nature. Cerebrum. 2011;2011. Pereira JA, Oliveira I, Sousa A, Ferreira ICFR, Bento A, Estevinho L. Bioactive properties and chemical composition of six walnut (Juglans regia L.) cultivars. Food and Chemical Toxicology. 2008;46(6):2103–11. Willis LM, Bielinski DF, Fisher DR, Matthan NR, Joseph JA. Walnut extract inhibits LPS-induced activation of Bv-2 microglia via internalization of TLR4: Possible involvement of phospholipase D2. Inflammation. 2010;33(5):325–33. Hardman WE, Ion G, Akinsete JA, Witte TR. Dietary walnut suppressed mammary gland tumorigenesis in the C(3)1 TAg mouse. Nutr Cancer. 2011;63(6). Chijioke OC, Anosike Chioma A, Collins AC. Studies on the phytochemical and nutritional properties of tetracarpidium conophorum (black walnut) seeds. Journal of Global Biosciences. 2015;4(2). Igbokwe UV, Ejike DE, Adams MD, Rabiu KM, Iliya E, Ajeka PO, et al. Tetracarpidium conophorum extract exhibits anti-fatigue activity in rats via reduced protein catabolism, increased antioxidant status and delayed lactate elevation. Fudma journal of sciences. 2021;5(2). Kraeuter AK, Guest PC, Sarnyai Z. The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. In: Methods in Molecular Biology. 2019. Hogas M, Ciobica A, Hogas S, Bild V, Hritcu L. The effects of the administration of two different doses of manganese on short-term spatial memory and anxiety-like behavior in rats. Arch Biol Sci. 2011;63(4). Chen CJ, Ou YC, Lin SY, Liao SL, Chen SY, Chen JH. Manganese modulates pro-inflammatory gene expression in activated glia. Neurochem Int. 2006;49(1). Moreno JA, Sullivan KA, Carbone DL, Hanneman WH, Tjalkens RB. Manganese potentiates nuclear factor-κB-dependent expression of nitric oxide synthase 2 in astrocytes by activating soluble guanylate cyclase and extracellular responsive kinase signaling pathways. J Neurosci Res. 2008;86(9). Moreno JA, Streifel KM, Sullivan KA, Hanneman WH, Tjalkens RB. Manganese-induced NF-κB activation and nitrosative stress is decreased by estrogen in juvenile mice. Toxicological Sciences. 2011;122(1):121–33. Filipov NM, Dodd CA. Role of glial cells in manganese neurotoxicity. Vol. 32, Journal of Applied Toxicology. 2012. Soares ATG, Silva A de C, Tinkov AA, Khan H, Santamaría A, Skalnaya MG, et al. The impact of manganese on neurotransmitter systems. Journal of Trace Elements in Medicine and Biology. 2020;61. Boersma GJ, Lee RS, Cordner ZA, Ewald ER, Purcell RH, Moghadam AA, et al. Prenatal stress decreases Bdnf expression and increases methylation of Bdnf exon IV in rats. Epigenetics. 2013;9(3). Sarkar S, Malovic E, Harischandra DS, Ngwa HA, Ghosh A, Hogan C, et al. Manganese exposure induces neuroinflammation by impairing mitochondrial dynamics in astrocytes. Neurotoxicology. 2018;64. Molina RM, Phattanarudee S, Kim J, Thompson K, Wessling-Resnick M, Maher TJ, et al. Ingestion of Mn and Pb by rats during and after pregnancy alters iron metabolism and behavior in offspring. Neurotoxicology. 2011; Lucchini RG, Aschner M, Landrigan PJ, Cranmer JM. Neurotoxicity of manganese: Indications for future research and public health intervention from the Manganese 2016 conference. Neurotoxicology. 2018;64:1–4. Bouchard MF, Sauvé S, Barbeau B, Legrand M, Brodeur MÈ, Bouffard T, et al. Intellectual impairment in school-age children exposed to manganese from drinking water. Environ Health Perspect. 2011;119(1). Torres-Agustín R, Rodríguez-Agudelo Y, Schilmann A, Solís-Vivanco R, Montes S, Riojas-Rodríguez H, et al. Effect of environmental manganese exposure on verbal learning and memory in Mexican children. Environ Res. 2013;121. Sprowles JLN, Amos-Kroohs RM, Braun AA, Sugimoto C, Vorhees C v., Williams MT. Developmental manganese, lead, and barren cage exposure have adverse long-term neurocognitive, behavioral and monoamine effects in Sprague-Dawley rats. Neurotoxicol Teratol [Internet]. 2018;67(December 2017):50–64. Available from: https://doi.org/10.1016/j.ntt.2018.04.001 Casas-Agustench P, Fernandes FS, Tavares Do Carmo MG, Visioli F, Herrera E, Dávalos A. Consumption of distinct dietary lipids during early pregnancy differentially modulates the expression of microRNAs in mothers and offspring. PLoS One. 2015;10(2). Carey AN, Fisher DR, Joseph JA, Shukitt-Hale B. The ability of walnut extract and fatty acids to protect against the deleterious effects of oxidative stress and inflammation in hippocampal cells. Nutr Neurosci [Internet]. 2013;16(1):13–20. Available from: http://www.tandfonline.com/doi/full/10.1179/1476830512Y.0000000023 Sánchez-González C, Ciudad CJ, Noé V, Izquierdo-Pulido M. Health benefits of walnut polyphenols: An exploration beyond their lipid profile. Vol. 57, Critical Reviews in Food Science and Nutrition. 2017. Erikson KM, Aschner M. Manganese neurotoxicity and glutamate-GABA interaction. Neurochem Int. 2003;43(4–5):475–80. Lucchini RG, Dorman DC, Elder A, Veronesi B. Neurological impacts from inhalation of pollutants and the nose-brain connection. Neurotoxicology. 2012;33(4). Bhang SY, Cho SC, Kim JW, Hong YC, Shin MS, Yoo HJ, et al. Relationship between blood manganese levels and children’s attention, cognition, behavior, and academic performance-A nationwide cross-sectional study. Environ Res. 2013;126. Oulhote Y, Mergler D, Barbeau B, Bellinger DC, Bouffard T, Brodeur MÈ, et al. Neurobehavioral function in school-age children exposed to manganese in drinking water. Environ Health Perspect. 2015;122(12). Beaudin SA, Strupp BJ, Strawderman M, Smith DR. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect. 2017;125(2). Schneider JS, Williams C, Ault M, Guilarte TR. Effects of chronic manganese exposure on attention and working memory in non-human primates. Neurotoxicology. 2015;48. Netto SM, Warela RWB, Fechine MF, Queiroga MN, Quintans-Júnior LJ. Anxiolytic-like effect of Rauvolfia ligustrina Willd. ex Roem. & Schult., Apocynaceae, in the elevated plus-maze and hole-board tests. Revista Brasileira de Farmacognosia. 2009;19(4). Souto-Maior FN, de Carvalho FLD, de Morais LCSL, Netto SM, de Sousa DP, de Almeida RN. Anxiolytic-like effects of inhaled linalool oxide in experimental mouse anxiety models. Pharmacol Biochem Behav. 2011;100(2). Pappas BA, Zhang D, Davidson CM, Crowder T, Park GAS, Fortin T. Perinatal manganese exposure: Behavioral, neurochemical, and histopathological effects in the rat. Neurotoxicol Teratol. 1997;19(1). Kern CH, Stanwood GD, Smith DR. Preweaning manganese exposure causes hyperactivity, disinhibition, and spatial learning and memory deficits associated with altered dopamine receptor and transporter levels. Synapse. 2010;64(5). Moreno JA, Streifel KM, Sullivan KA, Legare ME, Tjalkens RB. Developmental exposure to manganese increases adult susceptibility to inflammatory activation of glia and neuronal protein nitration. Toxicological Sciences. 2009;112(2):405–15. Zhao F, Cai T, Liu M, Zheng G, Luo W, Chen J. Manganese induces dopaminergic neurodegeneration via microglial activation in a rat model of manganism. Toxicological Sciences. 2009; Verina T, Kiihl SF, Schneider JS, Guilarte TR. Manganese exposure induces microglia activation and dystrophy in the substantia nigra of non-human primates. Neurotoxicology. 2011;32(2). Streifel KM, Moreno JA, Hanneman WH, Legare ME, Tjalkens RB. Gene deletion of nos2 protects against manganese-induced neurological dysfunction in juvenile mice. Toxicological Sciences. 2012;126(1). Peres T v., Schettinger MRC, Chen P, Carvalho F, Avila DS, Bowman AB, et al. “Manganese-induced neurotoxicity: A review of its behavioral consequences and neuroprotective strategies.” BMC Pharmacol Toxicol [Internet]. 2016;17(1). Available from: http://dx.doi.org/10.1186/s40360-016-0099-0 Benedetto A, Au C, Avila DS, Milatovic D, Aschner M. Extracellular dopamine potentiates Mn-induced oxidative stress, lifespan reduction, and dopaminergic neurodegeneration in a BLI-3-dependent manner in caenorhabditis elegans. PLoS Genet. 2010;6(8). Oliveira AMM, Hemstedt TJ, Bading H. Rescue of aging-associated decline in Dnmt3a2 expression restores cognitive abilities. Nat Neurosci. 2012;15(8). Weyemi U, Paul BD, Bhattacharya D, Malla AP, Boufraqech M, Harraz MM, et al. Histone H2AX promotes neuronal health by controlling mitochondrial homeostasis. Proc Natl Acad Sci U S A. 2019;116(15). Nakamura T, Lipton SA. ’sNO’-Storms Compromise Protein Activity and Mitochondrial Metabolism in Neurodegenerative Disorders. Vol. 28, Trends in Endocrinology and Metabolism. 2017. Sanjuán Szklarz LK, Scorrano L. The antiapoptotic OPA1/Parl couple participates in mitochondrial adaptation to heat shock. In: Biochimica et Biophysica Acta - Bioenergetics. 2012. Lindholm JSO, Castrén E. Mice with altered BDNF signaling as models for mood disorders and antidepressant effects. Vol. 8, Frontiers in Behavioral Neuroscience. 2014. Carim-Todd L, Bath KG, Fulgenzi G, Yanpallewar S, Jing D, Barrick CA, et al. Endogenous Truncated TrkB.T1 Receptor Regulates Neuronal Complexity and TrkB Kinase Receptor Function In Vivo. Journal of Neuroscience [Internet]. 2009 Jan 21 [cited 2023 Jan 15];29(3):678–85. Available from: https://www.jneurosci.org/content/29/3/678 Taliaz D, Stall N, Dar DE, Zangen A. Knockdown of brain-derived neurotrophic factor in specific brain sites precipitates behaviors associated with depression and reduces neurogenesis. Mol Psychiatry. 2010;15(1). Taliaz D, Loya A, Gersner R, Haramati S, Chen A, Zangen A. Resilience to chronic stress is mediated by hippocampal brain-derived neurotrophic factor. Journal of Neuroscience. 2011;31(12). Guilarte TR. APLP1, Alzheimer’s-like pathology and neurodegeneration in the frontal cortex of manganese-exposed non-human primates. Neurotoxicology. 2010;31(5). Lazrishvili IL, Shukakidze AA, Chkhartishvili NN, Bikashvili TZ. Morphological changes and manganese content in the brains of rat pups subjected to subchronic poisoning with manganese chloride. Neurosci Behav Physiol. 2009;39(1). Omotuyi OI, Nash O, Inyang OK, Ogidigo J, Enejoh O, Okpalefe O, et al. Flavonoid-rich extract of Chromolaena odorata modulate circulating GLP-1 in Wistar rats: computational evaluation of TGR5 involvement. Vol. 8, 3 Biotech. 2018. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13. Rueden CT, Schindelin J, Hiner MC, DeZonia BE, Walter AE, Arena ET, et al. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinformatics. 2017;18(1). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2503533","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":169895648,"identity":"cd442b29-86db-4ac7-b7d8-5223c50a3dc9","order_by":0,"name":"Tolulope Timothy Arogundade","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGklEQVRIiWNgGAWjYPACZgaGA0DqAYMFiANiSsgQoQWIExgkgBy2BJAWHlK08BiAhHBq4Z99+PBr3h3W8nzH+w8+SGyTkDNn7/n86kaNBQ8D++GjG7BokTiXlmbNeybdcOaZw8wGQC3Glj1nt1nnHAM6jCct7QY2a87wmBnzth1m3HAjmU0CqCVxw43cbcY5bEAtEjxm2LTIQ7XYb7j/GKrl/ptnxjn/cGsxOMNj/BioBWg4M8wWHubHuW24tRieYUtjnNuWnjzzTLKxQcI5kF/SzJhz+yR42HD4Re4M8+EPb9usbfuOH3z44EOZDTDEDj/+nPOtTo6f/fAxrN4HxpwEqlNhImzYlYMA8wd0LWgio2AUjIJRMNIBAGU5ZBrFMbr4AAAAAElFTkSuQmCC","orcid":"","institution":"University of Ilorin","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Tolulope","middleName":"Timothy","lastName":"Arogundade","suffix":""},{"id":169895649,"identity":"291068e2-349f-4125-9f57-65f6afeff558","order_by":1,"name":"Ismail Gbadamosi","email":"","orcid":"","institution":"University of Ilorin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ismail","middleName":"","lastName":"Gbadamosi","suffix":""},{"id":169895650,"identity":"fde21a51-9ccd-409d-9cad-9260f334c5fe","order_by":2,"name":"Aminat Atoyebi","email":"","orcid":"","institution":"University of Ilorin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Aminat","middleName":"","lastName":"Atoyebi","suffix":""},{"id":169895651,"identity":"91bcd16e-6d57-4f7d-8a6c-fcb9fe257373","order_by":3,"name":"Olawande Bamisi","email":"","orcid":"","institution":"Ekiti State University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Olawande","middleName":"","lastName":"Bamisi","suffix":""},{"id":169895653,"identity":"4b94cb07-7660-432e-9f0d-6d476e1e4dcf","order_by":4,"name":"Folasade Susan Lewu","email":"","orcid":"","institution":"University of Ilorin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Folasade","middleName":"Susan","lastName":"Lewu","suffix":""},{"id":169895654,"identity":"8802f79c-880c-46d7-a863-a27198fe678f","order_by":5,"name":"Olorunfemi Tokunbo","email":"","orcid":"","institution":"Osun State University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Olorunfemi","middleName":"","lastName":"Tokunbo","suffix":""},{"id":169895655,"identity":"3febb65c-996a-41ad-9a70-210c677cbd6f","order_by":6,"name":"Emmanuel Yawson","email":"","orcid":"","institution":"Redeemer’s University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Emmanuel","middleName":"","lastName":"Yawson","suffix":""},{"id":169895657,"identity":"6734a35e-cbe1-4fde-812c-5b7aabdd3369","order_by":7,"name":"Ezra Lambe","email":"","orcid":"","institution":"Adeleke University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ezra","middleName":"","lastName":"Lambe","suffix":""},{"id":169895659,"identity":"8ea49899-0375-4f02-9f84-53a15c67602c","order_by":8,"name":"Olutayo Arogundade","email":"","orcid":"","institution":"Osun State Teaching Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Olutayo","middleName":"","lastName":"Arogundade","suffix":""},{"id":169895661,"identity":"9ae3d9e1-a5cc-4c0a-948e-4010599834be","order_by":9,"name":"Olayemi Joseph Olajide","email":"","orcid":"","institution":"University of Ilorin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Olayemi","middleName":"Joseph","lastName":"Olajide","suffix":""},{"id":169895663,"identity":"d3e863da-7646-44f1-8f96-037ab07f8e3b","order_by":10,"name":"Bernard Enaibe","email":"","orcid":"","institution":"University of Ilorin","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bernard","middleName":"","lastName":"Enaibe","suffix":""}],"badges":[],"createdAt":"2023-01-22 05:44:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2503533/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2503533/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":32004758,"identity":"033f0680-d897-4364-80f3-6c69a8738bb4","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":85477,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(a) spontaneous alternation performance (SAP) \u0026amp; (b) elevated plus-maze results in rat offspring.\u003c/strong\u003e Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). * = p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/74971aa7be5cf3aec04a9f3e.png"},{"id":32004765,"identity":"96c16bc0-4047-4b00-ba3b-30f9948431d9","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":201442,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMn levels in (a) blood and (b) brain of juvenile rats at PND 28. \u003c/strong\u003eStandard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and preweaning (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). * = p \u0026lt; 0.05. Significant differences exist between the MnCl\u003csub\u003e2\u003c/sub\u003e group and the pre-treatment, delayed treatment, and concurrent WED groups.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/2cecc4eef1650dbf95246818.png"},{"id":32004759,"identity":"9363f50a-4782-437f-b318-2c2c060da968","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":346766,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea – h:\u003c/strong\u003e \u003cstrong\u003eProfiles of neuroinflammatory biomarkers in (top) PFC and (bottom) hippocampus. \u003c/strong\u003eStandard diet (Ctrl), manganese overexposure from gestation through preweaning (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and preweaning (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). * = p \u0026lt; 0.05. Significant differences exist between the MnCl\u003csub\u003e2\u003c/sub\u003e group and the pre-treatment, delayed treatment, and concurrent WED groups.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/21eaba7330c9117358605fbb.png"},{"id":32004760,"identity":"5753728a-afeb-4264-9dd8-945081e1125c","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":90196,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCortical (a) and hippocampal (b) levels of acetylcholinesterase i\u003c/strong\u003en the experimental animal groups maintained on a standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and preweaning (WED+MnCl2). * = p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/0e856b7399f205476bb58736.png"},{"id":32005799,"identity":"43c74caa-8cc6-4b79-9744-8cabc8b477c9","added_by":"auto","created_at":"2023-01-24 15:32:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":222285,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea – d: mRNA expression of selected genes in the PFC.\u003c/strong\u003e Profile of DNMT 3A (a), H2AX (b), OPA1 (c), and BDNF (d) levels in the PFC of rat offspring developmentally exposed to either MnCl2 or WED. * = p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/e5ddc995bb3b6d67828d15b7.png"},{"id":32004762,"identity":"943b4106-8488-43f4-af58-f9420e7cff3d","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":217281,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea – d: mRNA expression levels and band densities of selected genes in the hippocampus.\u003c/strong\u003e Profile of DNMT 3A (a), H2AX (b), OPA1 (c), and BDNF (d) levels in the PFC of rat offspring developmentally exposed to either MnCl2 or WED. * = p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/cfde81ad8d12b39c3583ba83.png"},{"id":32004767,"identity":"49244e1a-dc48-4492-b4e4-bd941cd0e011","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1471120,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eH\u0026amp;E-stained sections of layers II and III of the PFC.\u003c/strong\u003e Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl2). MnCl\u003csub\u003e2\u003c/sub\u003e photomicrograph reveals charred neuropil. Black arrows = degenerating neurons/karyolysis; yellow dotted circles = vacuolations. The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/54d7b9c9c9ee636aee9bc31b.png"},{"id":32006087,"identity":"c86c4e96-462d-4eaa-8be2-3e37c90c9d83","added_by":"auto","created_at":"2023-01-24 15:40:54","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2388017,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNissl-stained sections of the PFC.\u003c/strong\u003e Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/ec0f8725214793d4b36af094.png"},{"id":32006088,"identity":"3669bd10-eeb1-4ffb-8f8a-7c2ab486b0b7","added_by":"auto","created_at":"2023-01-24 15:40:54","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1129507,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCongo Red-stained sections of layers II and III of the PFC\u003c/strong\u003e. Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). Black arrows = plaques. The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/ad5fef25cb0df10c9882dc54.png"},{"id":32004772,"identity":"d7d409b8-5634-4cc3-9c62-ab42bfdda52c","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":897078,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eH\u0026amp;E-stained sections of the dentate gyrus.\u003c/strong\u003e Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet (MnCl\u003csub\u003e2\u003c/sub\u003e//WED), and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). Note the well-laminated and tightly-packed granule cells with intact nuclei in WED and Ctrl groups; granule cells in MnCl\u003csub\u003e2\u003c/sub\u003e appear sparse and deranged; black arrows showcase vacuolations. The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/921f05eda73a606c78f0f59c.png"},{"id":32006085,"identity":"266902c0-f638-4e51-aa83-b0c8591028fe","added_by":"auto","created_at":"2023-01-24 15:40:53","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":811071,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNissl-stained sections of the dentate gyrus. \u003c/strong\u003eStandard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet (MnCl\u003csub\u003e2\u003c/sub\u003e//WED), and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/319dae33f9596a4a94db679d.png"},{"id":32005801,"identity":"397a2453-9e47-48f8-9696-252c640d772a","added_by":"auto","created_at":"2023-01-24 15:32:53","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":860138,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNissl-stained sections of the CA2 hippocampal area\u003c/strong\u003e. Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet (MnCl\u003csub\u003e2\u003c/sub\u003e//WED), and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). Red arrows indicate peripheral vacuolation; black arrows show neuronal processes; dotted circles point out deficient lamination. The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/467b4c45b54df6d0d783b9e0.png"},{"id":32004770,"identity":"09a9c32b-284e-477f-9ce3-b7bd137aaf02","added_by":"auto","created_at":"2023-01-24 15:24:53","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":817475,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNissl-stained sections of the CA3 hippocampal area.\u003c/strong\u003e Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet (MnCl\u003csub\u003e2\u003c/sub\u003e//WED), and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage13.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/be7079234330f0f3a0ed3906.png"},{"id":32006084,"identity":"0333bbf5-eeba-42e1-b5a1-e6a17a9c23cb","added_by":"auto","created_at":"2023-01-24 15:40:53","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":858044,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCongo Red-stained sections of the dentate gyrus.\u003c/strong\u003e Standard diet (Ctrl), manganese overexposure from gestation through early postnatal life (MnCl\u003csub\u003e2\u003c/sub\u003e), walnut-enriched diet (WED), prenatal walnut-enriched diet, and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), prenatal manganese overexposure and postnatal walnut-enriched diet, and a combination of walnut-enriched diet and manganese overexposure throughout gestation and early postnatal life (WED+MnCl\u003csub\u003e2\u003c/sub\u003e). Black arrows = plaques; brown asterisk = charred neuropil. The scale bar is at 25 µ.\u003c/p\u003e","description":"","filename":"floatimage14.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/c0b9f908275a7a252c3d4f07.png"},{"id":32005803,"identity":"4e2bb902-d6ef-4794-b510-d09c3af9f1e0","added_by":"auto","created_at":"2023-01-24 15:32:53","extension":"png","order_by":15,"title":"Figure 15","display":"","copyAsset":false,"role":"figure","size":325558,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical abstract\u003c/p\u003e","description":"","filename":"floatimage15.png","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/4b343c113f4c62356c9a9725.png"},{"id":45701137,"identity":"db494552-3f7b-4500-9a98-b21c81e0e5a5","added_by":"auto","created_at":"2023-11-02 03:59:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":12658119,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2503533/v1/19d9dfb6-e188-42e5-8b8b-a14799d58fa7.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eMaternal diet enriched with African walnuts confers neurodevelopmental resilience to MnCl\u003csub\u003e2\u003c/sub\u003e-induced neurotoxic cascades in rats\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eSeveral metals, including those involved in normal cellular physiology, have been associated with adverse neurodevelopmental effects. They also play a role in the pathogenesis of neurodegenerative diseases (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Manganese (Mn) is a vital micronutrient required for the normal development of many organs, including the brain (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). While its roles in maintaining optimal physiology and as a cofactor in several enzymes are well-known, Mn\u0026rsquo;s overall biological functions are poorly understood (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Nonetheless, correlations between Mn dyshomeostasis, altered neuronal structure and function, and cognition are typically found in humans and animals (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSince adult brain structure is primarily established in early life, environmental exposures in gestation and infancy can perturb brain anatomy and neurochemistry to influence the risk for neuropathology later in life (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Therefore, children are at serious risk from pervasive exposure to even low levels of metals like Mn (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Due to the complexities of the nervous system and the essential role of timing in the final product, minimal changes in any specific cell type or process caused by environmental exposures to Mn at critical periods can result in long-term disruption of the system\u0026rsquo;s overall functioning (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOn the other hand, some studies have highlighted the critical significance of early-life nurturing for optimal social and emotional development (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). It is known that factors such as maternal diet during and immediately after pregnancy impact the fetus\u0026rsquo; development through \u003cem\u003eprogramming\u003c/em\u003e, from the likelihood of cardiometabolic problems to the risk for or against psychopathology (\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Although it is unclear how exactly this occurs, mounting evidence suggests that epigenetic modifications are crucial for disease susceptibility or resilience (\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePreviously, we reported that perinatal (gestation/lactation) dietary supplementation with African walnuts enhances cortico-hippocampal gene expression and histomorphology in rats (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/1028415X.2023.2166804\u003c/span\u003e\u003cspan address=\"10.1080/1028415X.2023.2166804\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Building on this work, we explored how the timing of preventative or developmental enhancement interventions may be employed to generate more significant and long-lasting neuroprotective effects against adversity-related unfavourable outcomes.\u003c/p\u003e \u003cp\u003eGiven that walnuts are enriched with omega-3 fatty acids, antioxidants, anticancer, and anti-inflammatory phytochemicals shown to maintain brain structure and function even with normal brain ageing (\u003cspan additionalcitationids=\"CR19 CR20 CR21\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), we hypothesized that a walnut-enriched diet (WED) would significantly induce factors in the cytoprotective pathway, intervene and correct possible alterations in behaviour, epigenetic regulation, neuronal morphology, and neurochemistry caused by excessive exposure to manganese chloride (MnCl\u003csub\u003e2\u003c/sub\u003e) during gestation and preweaning in offspring of Wistar rats.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003eWED improved working memory and reduced anxiety-like behaviour in rats\u003c/h2\u003e\n \u003cp\u003eGiven the rodents\u0026rsquo; inherent propensity to explore three-arm mazes by methodically moving into each arm, we investigated the behaviour of rats\u0026rsquo; offspring in the Y-maze following developmental Mn overexposure with and without WED experience. Percentage correct spontaneous alternation was defined as successive, non-repeated entries into the three arms relative to the total arm entry for 300 seconds following a trial period (\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e). We observed a marked reduction of percentage correct spontaneous alternation in rats of the MnCl\u003csub\u003e2\u003c/sub\u003e group compared to the control and WED groups, suggesting that MnCl\u003csub\u003e2\u003c/sub\u003e impaired working memory and cognition in these rats (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea). However, offspring whose mothers were maintained on WED after prenatal MnCl\u003csub\u003e2\u003c/sub\u003e treatment (MnCl\u003csub\u003e2\u003c/sub\u003e//WED) showed significant improvement in alternating sequences when compared to animals whose mothers were treated with MnCl\u003csub\u003e2\u003c/sub\u003e alone, signifying that WED abated alterations in working memory induced by Mn overexposure.\u003c/p\u003e\n \u003cp\u003eFollowing up on the hypothesis that developmental Mn overexposure would elicit anxiety behaviour in rat offspring (\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e), the potential of WED in preventing such Mn-induced effects was examined in the elevated plus maze. Results revealed similar patterns with control and WED alone rats (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). These rats frequented the open arm of the maze, which could be extrapolated to mean lower anxiety levels. However, rats whose dams received MnCl\u003csub\u003e2\u003c/sub\u003e during early development had significantly reduced open-arm entry frequency, suggesting anxiety-like behaviour. Effective prevention and counteraction of Mn effects were seen in animals whose dams were maintained on prenatal WED before postnatal Mn treatment (WED//MnCl\u003csub\u003e2\u003c/sub\u003e) and those whose mothers received combined exposure to WED and Mn (WED\u0026thinsp;+\u0026thinsp;MnCl\u003csub\u003e2\u003c/sub\u003e) throughout gestation and preweaning. Taken together, developmental exposure to manganese caused a reduction in working memory and induced anxiety-like behaviour, both of which were abated by dietary supplementation with walnuts.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003ePrenatal walnut supplementation normalizes blood and brain manganese levels\u003c/h2\u003e\n \u003cp\u003eBlood and whole brain Mn concentrations were measured in the present study. Data showed significantly higher Mn levels in the blood and brains (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb) of rats prenatally exposed to MnCl\u003csub\u003e2\u003c/sub\u003e compared with offspring from the Ctrl and WED groups. In comparison, the experimental groups that were treated with WED before, after or alongside MnCl\u003csub\u003e2\u003c/sub\u003e showed a significant reduction in blood and brain level of manganese. This finding suggests that it prevented bioaccumulation of Mn in the tissues examined, further buttressed by results from profiling neuroinflammation in the PFC and hippocampus (see next section).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003ePrenatal WED supplementation is protective against Mn-induced neuroinflammation\u003c/h2\u003e\n \u003cp\u003eThe upregulation of pro-inflammatory cytokines in tissues is one of the mechanisms by which Mn exerts its neurotoxicity (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e). In the present study, we observed a significantly increased expression of cortical TNF-\u0026alpha; in offspring of dams overexposed to Mn, compared with the control and WED groups. Also, it appears that prenatal and postnatal exposure to WED were respectively able to counteract and lessen the overexpression of TNF-\u0026alpha; in the PFC of these rats (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). Hippocampal TNF-\u0026alpha; levels also revealed a similar trend (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ee). Our data also revealed significant increase (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in inducible nitric oxide synthase (iNOS) levels in experimental animal groups\u0026rsquo; PFC and hippocampus of rats whose mothers were treated with MnCl\u003csub\u003e2\u003c/sub\u003e during development, compared to the control and WED groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb \u0026amp; f).\u003c/p\u003e\n \u003cp\u003eExpectedly, results revealed an MnCl\u003csub\u003e2\u003c/sub\u003e-induced increase in the levels of interleukin-1\u0026beta; in experimental animal groups\u0026rsquo; PFC and hippocampus (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec \u0026amp; g). The concurrent interaction with WED seems to suppress this upregulation during embryonic development.\u003c/p\u003e\n \u003cp\u003eFurthermore, levels of cyclooxygenase COX-2 in the PFC and hippocampus of experimental animal groups were markedly elevated in offspring of dams overexposed to Mn during development (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed \u0026amp; h). These were significantly downregulated by treatment with WED during prenatal and postnatal life and a combination of both. These findings suggest that cholinergic signalling might be impaired because of MnCl\u003csub\u003e2\u003c/sub\u003e-induced cytokine overexpression.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003eWED attenuated Mn-induced cholinergic transmission perturbation\u003c/h2\u003e\n \u003cp\u003eMetabolically active brain cells are sensitive to their environment during development and maturation, and subtle dyshomeostasis can result in severe neuropathological consequences (\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e). Acetylcholinesterase (AChE) inhibits choline uptake/release at presynaptic terminals, altering neurotransmission as indicated by significant neocortical deficiencies in the enzyme responsible for acetylcholine (ACh) synthesis \u0026ndash; choline acetyltransferase (ChAT) (\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eFollowing treatments of dams, the differential expression of AChE in the PFC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea) and hippocampus (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb) of offspring were quantified. Analyses showed significant elevations in AChE levels in both brain regions, corresponding with the MnCl\u003csub\u003e2\u003c/sub\u003e treatment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea \u0026amp; b). This outcome supported the finding that the rats in this group had poorer working memory. However, AChE overexpression was normalized to baseline levels, mainly by postnatal (MnCl\u003csub\u003e2\u003c/sub\u003e//WED) and concurrent (WED\u0026thinsp;+\u0026thinsp;MnCl\u003csub\u003e2\u003c/sub\u003e) WED exposure.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003eWED significantly mitigated cortico-hippocampal gene expression dysregulated by developmental Mn exposure in rats\u003c/h2\u003e\n \u003cp\u003eAdverse experiences associated with the early developmental environment have been suggested to play an important role in increased risk for psychopathology across the lifespan (\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e). This role played by the environment during critical periods of development is brought about by alterations in the expression of genes during the development of the brain and throughout the lifespan (\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eDue to its potential significant roles in memory functions, DNA methyltransferase 3a (DNMT3a) was investigated, along with histone protein 2A variation (H2Ax), which is crucial for maintaining genomic stability; brain-derived neurotrophic factor (BDNF), due to its significance in accumulating a reserve for/of neuroplasticity to safeguard against future adversity (neural resilience); and optic atrophy 1 (OPA1) gene due to its role in oxidative phosphorylation, mitochondrial fusion, and maintenance of the DNA within mitochondria \u0026ndash; processes that improve cells\u0026rsquo; adaptability.\u003c/p\u003e\n \u003cp\u003eDevelopmental exposure to excess Mn caused a significant reduction in DNMT3a expression in the PFC and hippocampus of offspring of exposed dams (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea \u0026amp; \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ea, respectively). Comparatively, combined exposure to MnCl\u003csub\u003e2\u003c/sub\u003e and WED through early development prevented reduced DNMT3a expression significantly. Additionally, prenatal dietary supplementation with WED significantly prevented postnatal MnCl\u003csub\u003e2\u003c/sub\u003e-induced hypomethylation in the hippocampus but not in the PFC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). However, postnatal WED did not significantly remediate DNMT3a expression in the PFC and hippocampus.\u003c/p\u003e\n \u003cp\u003eFurthermore, MnCl\u003csub\u003e2\u003c/sub\u003e led to a significant diminution of fold-change relative expression of H2AX in the PFC and hippocampus of rat offspring (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb \u0026amp; \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eb). However, there were substantial decreases in the effect of MnCl\u003csub\u003e2\u003c/sub\u003e on the hippocampus of rat offspring following gestational supplementation with African walnuts (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eb). This result was not replicated in the PFC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb), where a modest effect was observed. Nonetheless, concurrent WED supplementation was significantly effective (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in counteracting neurotoxic cascades of MnCl\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\n \u003cp\u003eSimilarly, developmental MnCl\u003csub\u003e2\u003c/sub\u003e exposure led to repression of the OPA1 gene in the PFC and hippocampus of rat offspring (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec \u0026amp; \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ec, respectively). According to Sarkar \u003cem\u003eet al\u003c/em\u003e. (2018), Mn exposure instigates neuroinflammation by interfering with mitochondrial dynamics (\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e). Maintenance of dams on WED with manganese treatment throughout gestation and early postnatal life (WED\u0026thinsp;+\u0026thinsp;MnCl\u003csub\u003e2\u003c/sub\u003e) effectively (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) prevented dysregulation of OPA1 expression in PFC and hippocampus, potentially abrogating mitochondrial deficits and mitigating cell death. Nonetheless, prenatal WED and postnatal manganese overexposure (WED//MnCl\u003csub\u003e2\u003c/sub\u003e), and prenatal manganese overexposure and postnatal walnut-enriched diet (MnCl\u003csub\u003e2\u003c/sub\u003e//WED) did not significantly impact OPA1 mRNA expression in the PFC and hippocampus, compared to the control. The influence exerted by WED in both groups was modest compared to the group concomitantly exposed to Mn overexposure and WED through gestation and preweaning.\u003c/p\u003e\n \u003cp\u003eLastly, MnCl\u003csub\u003e2\u003c/sub\u003e overexposure caused significant diminution (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the mRNA expression of BDNF in the PFC and hippocampus (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ed \u0026amp; \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ed, respectively). However, this effect of MnCl\u003csub\u003e2\u003c/sub\u003e on BDNF expression in the rat PFC and hippocampus was significantly reversed by WED, potentially suggesting a role for walnuts in fostering neuroplasticity.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003eWED supplementation attenuates MnCl\u003csub\u003e2\u003c/sub\u003e-induced neuropathology in the PFC and hippocampal area\u003c/h2\u003e\n \u003cp\u003eThe prefrontal cortex and hippocampus possess a distinct histological appearance that invariably alters after inflammatory reactions and oxidative stress dysregulation. Comparative examination of thin sections of the cortex, hippocampus, and dentate gyrus was done utilizing H\u0026amp;E, Nissl, and Congo Red staining methods.\u003c/p\u003e\n \u003cp\u003eAs we anticipated, the cortical and hippocampal milieu of offspring of MnCl\u003csub\u003e2\u003c/sub\u003e-treated dams were characterized by the fragmentation of neuropil, distortion of layering, and some spongiosis. Furthermore, we observed diffuse plaques and a marked reduction in the deposition of Nissl proteins in this group\u0026rsquo;s PFC and hippocampal sections compared to rats born to dams maintained on a control or walnut-enriched diet. Interestingly, simultaneous exposure to WED protected cortical and hippocampal neurons against Mn-induced alterations, bearing some similarities to the control group. Furthermore, prenatal WED exposure before postnatal Mn neurotoxicity and postnatal WED exposure after excess prenatal MnCl\u003csub\u003e2\u003c/sub\u003e exposure is partially protected against these changes. Sections revealed normal cells; however, occasional degenerated pyramidal cells with dark-folded nuclei were still demonstrated.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eNewborn and growing brains are more prone to Mn toxicity (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). The upregulation of pro-inflammatory biomarkers, reactive nitrogen, and oxygen species because of exposures during crucial developmental stages can reverberate in adulthood and may result in the emergence of neurodegenerative diseases (\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). As a result, it is hypothesized that primary prevention can be accomplished in early life to avert disorders in the future (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePUFAs (ALA \u0026amp; LA) and phytochemicals, including flavonoids, polyphenols, melatonin, resveratrol, etc., are abundant in walnuts. These and numerous other factors add to walnuts\u0026rsquo; well-known health advantages, earning the local moniker \u0026ldquo;brain food.\u0026rdquo; According to several epidemiological research, eating more foods high in omega-3 fatty acids is strongly linked to a decreased prevalence of brain disorders (\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). To our knowledge, no studies have been done on the possible neuroprotective effects of a walnut-enriched diet during pregnancy or preweaning against Mn-induced developmental neurotoxicity. Therefore, this study examined the effects of a maternal diet supplemented with African walnuts on changes in behaviour, cortico-hippocampal structure, and function brought on by manganese.\u003c/p\u003e \u003cp\u003eUnderstanding the unique functional abnormalities brought on by neurotoxicants like Mn is vital to devise efficient treatment and prevention strategies. An increasing body of evidence suggests that prenatal and early childhood neurobehavioral outcomes are negatively impacted by historical Mn exposure. According to these studies, developmental Mn exposure is associated with hyperactivity, impulsivity, rebellious behaviour, inattentiveness, and reduced fine motor abilities (\u003cspan additionalcitationids=\"CR41 CR42 CR43\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eLike the control group, the offspring of dams maintained on WED scored significantly higher in correct spontaneous alternation performance percentage than those of dams treated with MnCl\u003csub\u003e2\u003c/sub\u003e (Fig.\u0026nbsp;4.13). This observation suggests substantial effects of developmental Mn neurotoxicity on short-term spatial memory. Like the report by Hogas \u003cem\u003eet al\u003c/em\u003e. (2011), significant deficits in spontaneous alternation percentage in rats administered high-dose manganese was observed (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). Furthermore, Schneider \u003cem\u003eet al\u003c/em\u003e. (2015) found that manganese exposure resulted in impairments in spatial working memory with more substantial deficits in non-spatial working memory in macaque monkeys (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). Expressly, those whose mothers were maintained on WED after prenatal MnCl\u003csub\u003e2\u003c/sub\u003e treatment (MnCl\u003csub\u003e2\u003c/sub\u003e//WED) showed significant improvement in alternating sequences compared to animals whose mothers were treated with MnCl\u003csub\u003e2\u003c/sub\u003e alone, suggesting that WED forestalled alterations in spatial working memory induced by development Mn overexposure.\u003c/p\u003e \u003cp\u003eOne of the rodent\u0026rsquo;s most significant behavioural paradigms to assess anxiety behaviour is the elevated plus-maze (EPM). Since rats\u0026rsquo; natural propensity is to hide in the closed components of the EPM apparatus due to anxiety generated by a novel environment, it is commonly known that anxiolytic agents improve the frequency of entrances and the period spent in the EPM\u0026rsquo;s open arms (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e). In the current study, offspring of control and WED-maintained dams significantly frequented the open arm portion of the maze more than those whose mothers were treated with MnCl\u003csub\u003e2\u003c/sub\u003e during early development. This latter observation suggests a higher level of anxiety or decreased impulsivity induced by developmental Mn neurotoxicity in offspring of these dams, likely by deficits in inhibition control. Hence, the prolonged time spent in the closed arms by offspring of Mn-treated rats. Notably, these findings contrast with those of Pappas \u003cem\u003eet al\u003c/em\u003e. (1997) (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e), who reported that neither the 2 mg/ml prenatal manganese-exposed rats nor the 10 mg/ml perinatal manganese-exposed rats differed from controls on the elevated plus apparatus, the Morris water maze, or the radial arm maze and Kern \u003cem\u003eet al\u003c/em\u003e. (2010) (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e), who found no behavioural effects following Mn exposure via the EPM test. These disparities in results are likely due to different exposure protocols and routes of administration (i.e., direct oral administration to the pups) vs transplacental and lactational transfer in the present study.\u003c/p\u003e \u003cp\u003eNonetheless, prenatal exposure to WED significantly prevented postnatal Mn-induced anxiety. Similarly, concurrent WED with MnCl\u003csub\u003e2\u003c/sub\u003e treatment significantly counteracted the anxiogenic effects of excess developmental Mn. Although there was no significant influence of postnatal WED on anxiety measures following prenatal exposure to MnCl\u003csub\u003e2\u003c/sub\u003e, there was an insignificant trend toward increased open-arms exploration, all indicative of an anxiolytic property of WED.\u003c/p\u003e \u003cp\u003eJust as important, several studies have revealed that Mn can exacerbate the effects of cytokines on the activation of both microglia and astrocytes that causes dramatic potentiation in the production of TNFα, IL-1β, ROS, and NOS2 expression (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Increased levels of these and other inflammatory genes have been measured in both rodent (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e) and nonhuman primate (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e) studies, with deletion or inhibition of these pathways showing neuroprotection (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). Notably, results from this current study revealed an Mn-correlated significant uptrend in the levels of inflammatory biomarkers (iNOS, TNF-α, IL-1β, and COX-2) in the PFC and hippocampus of rat offspring (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Mn levels in the blood and brain of developmentally exposed rats were significantly higher than in the offspring of the control and WED animals.\u003c/p\u003e \u003cp\u003eInterestingly, prenatal supplementation delayed treatment, and prophylactic/postnatal exposure of dams to WED significantly inhibited the overexpression of these pro-inflammatory cytokines in the PFC and hippocampus of rat offspring, respectively. Moreover, only concurrent treatment with WED showed no significant difference with the control and WED-only groups. While pre-treatment and post-treatment significantly reduced Mn levels compared to the MnCl\u003csub\u003e2\u003c/sub\u003e group, there were still significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between these groups and the control and WED groups.\u003c/p\u003e \u003cp\u003eAdditionally, studies indicate that the cholinergic system may be significantly involved in PD and Manganism through choline uptake, release, and acetyltransferase activity, even though it is not the primary target in Mn toxicity and several symptoms are primarily related to effects on the dopaminergic system (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Specifically, MnCl\u003csub\u003e2\u003c/sub\u003e significantly altered cortical and hippocampal cholinergic homeostasis in this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea \u0026amp; b), which is consistent with the impairment in spatial working memory in this study\u0026rsquo;s Y-maze spontaneous alternation test and the raised levels of inflammatory biomarkers. Neurotransmitter metabolism disruption is correlated with Mn-induced behavioural abnormalities, such as motor incoordination or emotional and cognitive impairment, shown in both human and animal models (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). Different processes, such as neurotransmitter release inhibition, changes in neurotransmitter clearance from the synaptic cleft, or receptor modification, can lead to impaired neurotransmitter signalling (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). Acetylcholine (ACh) is an excitatory neurotransmitter that modulates important cognitive activities such as learning, memory, and movement in the central and peripheral nervous systems, all of which may be hampered due to Mn\u0026rsquo;s effects on cholinergic signalling (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStill, WED was significantly effective in repressing Mn-induced upregulation of AChE in the cortex and hippocampus of rat offspring. This effect was observed at the studied exposure time points and is most likely potentiated by the synergy of African walnuts\u0026rsquo; antioxidant and anti-inflammatory phytochemicals.\u003c/p\u003e \u003cp\u003eConversely, developmental exposure to excess Mn caused a significant reduction in DNMT3a expression in the PFC and hippocampus of offspring of exposed dams (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, respectively). DNMT3a expression in offspring of dams on WED from gestation through weaning with simultaneous exposure to MnCl\u003csub\u003e2\u003c/sub\u003e was modestly impacted compared to the offspring of dams treated with MnCl\u003csub\u003e2\u003c/sub\u003e alone. There was no significant difference between this group and the control or WED group. This expression was comparable in both PFC and hippocampal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea, respectively). Age-related decline in the protein levels of DNMT3a is reported to be reduced in the cortex and hippocampus of mice. It is linked to memory decline that can be salvaged by restoring DNMT3a levels (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition, prenatal dietary supplementation alone significantly prevented postnatal MnCl\u003csub\u003e2\u003c/sub\u003e-induced hypomethylation in the hippocampus but not in the PFC (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Furthermore, postnatal WED supplementation after prenatal MnCl\u003csub\u003e2\u003c/sub\u003e exposure did not significantly remediate DNMT3a expression in the PFC and hippocampus. While potential mitigation is apparent in both groups, it was statistically insignificant. A possible inference that could be drawn concerns the duration of exposure to WED.\u003c/p\u003e \u003cp\u003eThen again, MnCl\u003csub\u003e2\u003c/sub\u003e correlated with the diminution of fold-change relative expression of H2AX in the PFC and hippocampus of rat offspring (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). Nevertheless, there were substantial decreases in this effect of MnCl\u003csub\u003e2\u003c/sub\u003e on the hippocampus of rat offspring following prenatal supplementation with African walnuts (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). However, this result was not replicated in the PFC (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb), where a modest effect was observed. Nonetheless, concurrent WED supplementation was significantly effective (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in counteracting neurotoxic cascades of MnCl\u003csub\u003e2\u003c/sub\u003e. This observation is quite interesting because several studies have reported that H2AX mutant mice, apart from being more sensitive to DNA damage, were uniquely vulnerable to mitochondrial injury in the brain, and mitochondrial defects constitute a significant source of impaired redox homeostasis, which are usually associated with age-related neurological diseases (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). Therefore, WED appears involved in mitochondrial integrity and consequent maintenance of redox homeostasis.\u003c/p\u003e \u003cp\u003ePer the study\u0026rsquo;s goals and because mitochondrial abnormalities significantly cause redox dyshomeostasis, the mitochondrial dynamics gene OPA1 was assessed in each experimental group. Through the fusion process, OPA1 shapes and preserves mitochondrial morphology (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). Developmental MnCl\u003csub\u003e2\u003c/sub\u003e exposure led to repression of the OPA1 gene in the PFC and hippocampus of rat offspring (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec, respectively), which confirms the results for H2AX (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). Attendant maintenance on WED with manganese treatment throughout gestation and early postnatal life (WED\u0026thinsp;+\u0026thinsp;MnCl\u003csub\u003e2\u003c/sub\u003e) effectively restored OPA1 expression in PFC and hippocampus, potentially abrogating mitochondrial deficits and mitigating cell death.\u003c/p\u003e \u003cp\u003eAccordingly, MnCl\u003csub\u003e2\u003c/sub\u003e exposure caused a significant diminution in the expression of the BDNF gene in the PFC and hippocampus (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed \u0026amp; \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed, respectively). This observation was speculated because a study examining the effects of prenatal stress reported decreased BDNF expression, specifically in the hippocampus and amygdala (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e). In addition, mice deficient in TrkB, the BDNF receptor, show increased anxiety-like behaviour (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e). Similarly, A study using overexpression and knockdown of BDNF in rats showed that BDNF overexpression could rescue depression-like behaviour in chronically stressed rats. In contrast, the knockdown of BDNF in the hippocampus, at least in young animals, produced a depression-like phenotype (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e). The repression of BDNF induced by MnCl\u003csub\u003e2\u003c/sub\u003e might explain the perceived level of anxiety in this group, indicated by the low frequency of entry into the open arm (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Nonetheless, WED significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) mitigated this effect of MnCl\u003csub\u003e2\u003c/sub\u003e on BDNF expression in the PFC and hippocampus of rats.\u003c/p\u003e \u003cp\u003eHistological sections of rat offspring; control and WED-treated rats\u0026rsquo; prefrontal cortices demonstrated the same cortical layers containing medium/large pyramidal and non-pyramidal cells scattered in a background formed by neuroglia cells and myelinated axons (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). In contrast, sections of offspring of MnCl\u003csub\u003e2\u003c/sub\u003e-treated rats revealed shrunken pyramidal cells, vacuolated cytoplasm (spongiosis), perineural neuroglia, and ill-defined axons (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, \u0026amp; \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Guilarte (2010) reported observing AD-like pathology and neurodegeneration in the frontal cortex of manganese-exposed nonhuman primates (\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e), and Lazrishvili \u003cem\u003eet al.\u003c/em\u003e (2009) also noted alteration in the histoarchitecture of rat pups\u0026rsquo; brains following subchronic poisoning with manganese chloride (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe results of this work suggest that neuroinflammation, mitochondrial dysfunction, and oxidative injury are the fundamental processes driving Mn-induced developmental neurotoxicity, which confirms worries about the severe effects of Mn exposure on development. More significantly, however, developmental Mn-induced neuronal susceptibility is also influenced by epigenetic pathways, cholinergic dyshomeostasis, and neurotrophin downregulation. A non-pharmacological, effective, and reasonably priced prophylactic option in the field of developmental neurotoxicology is a nutritional intervention with African walnuts, which appears to mediate these pathways.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and care\u003c/h2\u003e \u003cp\u003eMale sires (250-300g) and nulliparous female Wistar rats (180-200g) were acquired from a private animal facility to serve as the parent generation. The Central Research Laboratory at the University of Ilorin provided animal care for the rats. Except where otherwise noted, \u003cem\u003ead libitum\u003c/em\u003e rat food and water were available. The animals\u0026rsquo; home cages were stocked with wood shavings throughout the trial and changed twice a week. The desired environmental conditions were a conventional 24-hour light-dark cycle (12/12, with lights on at 7 am), relative humidity of 50\u0026thinsp;\u0026plusmn;\u0026thinsp;10%, and a temperature of 23\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of diets and treatment\u003c/h2\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003eManganese\u003c/h2\u003e \u003cp\u003eMolychem Industries in Mumbai, India, supplied the manganese (II) chloride tetrahydrate (MnCl2.4H2O) with batch number MCR- 18314 and product code 15590. The crystalline salt was dissolved in distilled water (20 mg/ml) to create the solution, which was then pH-adjusted with 0.1 M PBS to 7.4. Treatment was 100 mg/kg/d administered orally through a cannula.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003eDiets\u003c/h2\u003e \u003cp\u003eWe bought African walnuts from a community market in Osogbo, Osun State. The nuts were verified by the Department of Plant Biology at the University of Ilorin. The nuts were then de-husked, chopped into pieces, and dried at a tropical room temperature. Before being added to diets, the dry nuts were ground up.\u003c/p\u003e \u003cp\u003eThis study changed a typical rat diet shown by Hardman and colleagues (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) and added walnuts to it. The diet was designed to be isocaloric and isonutrient, balanced in terms of nutrients, protein, fat, and carbohydrate relative to the control. The main distinction between the two diets was whether one included walnuts and one did not (see Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). We used a similar diet formulation in a previous study (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/1028415X.2023.2166804\u003c/span\u003e\u003cspan address=\"10.1080/1028415X.2023.2166804\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFormulation of diets\u003c/p\u003e \u003cdiv class=\"Credit\"\u003e\u003cp\u003e(\u003cem\u003emodified from\u003c/em\u003e (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e))\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIngredient\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e% of Weight\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eControl Diet\u003c/p\u003e \u003cp\u003eAmount/100 g\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eWalnut Diet\u003c/p\u003e \u003cp\u003eAmount/100 g\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroundnut cake\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24.4 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePalm kernel cake\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24.4 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn starch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.5 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIndustrial Soya\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.4 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBone meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWheat (fibre)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.8 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.2 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.2 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMethionine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.3%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.3 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.3 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eConcentrate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.5 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.5 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGround walnut\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.63 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100 g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100.1 g\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eExperimental design\u003c/h2\u003e \u003cp\u003eThe presumptive pregnant dams were randomly assigned to one of six (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) experimental groups after estrus phases were determined and mating was confirmed (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). A free application that may be accessed from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.openepi.com\u003c/span\u003e\u003cspan address=\"http://www.openepi.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e was used for randomization and sample size computations. All pregnant dams were mated with a different control male before being housed in pairs with another pregnant dam in the same experimental setup\u0026mdash;two rats per cage. At gestational day 20, the dams were divided and housed separately for the duration of the pregnancy and weaning.\u003c/p\u003e \u003cp\u003ePups were housed in six condition-matched cages at weaning (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Offspring for the first condition (control) were delivered in a typical setting \u0026ndash; to dams with \u003cem\u003ead libitum\u003c/em\u003e access to water and conventional rat food during pregnancy and preweaning. Pups in the second condition were offspring of dams treated with manganese chloride (MnCl\u003csub\u003e2\u003c/sub\u003e) through development. The third group comprised animals born to dams kept on the walnut-enriched diet (WED) throughout gestation and preweaning. Rats in the fourth group were born to dams fed a diet supplemented with walnuts prenatally and then received postnatal MnCl\u003csub\u003e2\u003c/sub\u003e treatment (WED//MnCl\u003csub\u003e2\u003c/sub\u003e). The fifth group included rat offspring of dams that received prenatal MnCl\u003csub\u003e2\u003c/sub\u003e treatment and postnatal WED (MnCl\u003csub\u003e2\u003c/sub\u003e//WED). Finally, the last experimental group comprised offspring of dams concurrently maintained on WED and Mn from gestation through preweaning (WED\u0026thinsp;+\u0026thinsp;MnCl\u003csub\u003e2\u003c/sub\u003e). Dams were carefully monitored to ensure they stayed healthy during pregnancy and weaning.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnimal grouping\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS/N\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTreatment Group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTimepoint\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNo. of Animals\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMnCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGestation and preweaning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWED\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGestation and preweaning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWED//MnCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGestation//preweaning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMnCl\u003csub\u003e2\u003c/sub\u003e//WED\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGestation//preweaning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWED\u0026thinsp;+\u0026thinsp;MnCl\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGestation and preweaning\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eKey: \u003cb\u003eControl\u003c/b\u003e\u0026thinsp;=\u0026thinsp;animals receiving control diet throughout the experimental duration; \u003cb\u003eMnCl\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;animals treated with Mn from gestation day 0 (GD 0) to postnatal day 21 (PND 21); \u003cb\u003eWED\u003c/b\u003e\u0026thinsp;=\u0026thinsp;animals maintained on the walnut-enriched diet (WED) from GD 0 to PND 21; \u003cb\u003eWED//MnCl\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;animals kept on the walnut diet from GD 0 till birth, then treated with Mn from birth till PND 21; \u003cb\u003eMnCl\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u003cb\u003e//WED\u003c/b\u003e\u0026thinsp;=\u0026thinsp;animals treated with Mn from GD 0 till parturition, then put on WED from birth till PND 21; \u003cb\u003eWED\u0026thinsp;+\u0026thinsp;MnCl\u003c/b\u003e\u003csub\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;animals maintained on WED from GD 0 \u0026ndash; PND 21 concomitantly with Mn treatment for the same period.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eSacrifice\u003c/h2\u003e \u003cp\u003eRats used for histological analysis were euthanized after injections with 20 mg/kg ketamine (intraperitoneal). When the left ventricle was exposed, 0.1 M PBS (pH 7.4) was supplied at a rate of 25 ml/min, and then perfusion with 4% paraformaldehyde (PFA)/PBS solution continued for 10 min at the same rate. The removed brains were postfixed in 4% PFA for 24 hours and kept in 30% sucrose at 4\u0026deg;C until further processing. The removed brains were then washed in 0.25 M sucrose three times for five minutes each. Each brain\u0026rsquo;s PFC and hippocampus\u0026rsquo; coronal sections (5 \u0026micro;m thick) were obtained stereotaxically (+\u0026thinsp;4 mm).\u003c/p\u003e \u003cdiv id=\"Sec18\" class=\"Section3\"\u003e \u003ch2\u003eAAS\u003c/h2\u003e \u003cp\u003eBriefly, tissues were digested in 1M HCI and then injected into the liquid suction module of the AAS machine. The flame atomizer vaporized free gaseous atoms in the samples. The atomized particles in the machine\u0026rsquo;s vacuum were by light spectrum emitted by a lamp in the light emitter. A detector picks up the dispersed light as a function of the Mn concentration in the blood or brain.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section3\"\u003e \u003ch2\u003eELISA\u003c/h2\u003e \u003cp\u003eEnzymatic profiles in experimental animals\u0026rsquo; PFC and hippocampal lysates were quantified using enzyme-linked immunosorbent assay (ELISA). The levels of acetylcholinesterase (AChE), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumour necrotic factor- (TNF- α), interleukin-1 (IL-1β) were quantified using spectrophotometric techniques as specified in their respective assay kits.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eTotal RNA isolation\u003c/h2\u003e \u003cp\u003eUsing a technique outlined by Omotuyi \u003cem\u003eet al\u003c/em\u003e. (2018), total RNA was extracted from the entire tissue. TRI reagent (4\u0026deg;C; Zymo Research, USA; Cat. R2050-1-50; Lot. ZRC186885) was used to homogenize the tissues quickly (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e). Centrifugation at 15,000 rpm for 15 minutes resulted in the partitioning of total RNA into chloroform (BDH Analytical Chemicals, Poole, England Cat: 10076-6B) (Abbott Laboratories, Model: 3531, Lake Bluff, Illinois, United States). Using an equivalent volume of isopropanol, RNA was precipitated from the clear supernatant (Burgoyne Urbidges \u0026amp; Co, India, Cat: 67-63-0). In 30 cc of nuclease-free water, the RNA pellet was washed twice in 70% ethanol (BDH Analytical Chemicals, Poole, England Cat: 10107-7Y) (Inqaba Biotec, West Africa, Lot no: 0596C320, code: E476-500ML). After being air-dried for five minutes, the pellets were dissolved in RNA buffer (1 mM sodium citrate, pH 6.4)\u003c/p\u003e \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e \u003ch2\u003ecDNA conversion\u003c/h2\u003e \u003cp\u003eTotal RNA concentration (\u0026micro;g/ml\u0026thinsp;=\u0026thinsp;40 * A260) and quality (\u0026ge;\u0026thinsp;1.8) were determined prior to cDNA conversion using the ratio of A260/A230 (A\u0026thinsp;=\u0026thinsp;absorbance) and read using a spectrophotometer (Jen-way UV-VIS spectrophotometer model 6305, UK).\u003c/p\u003e \u003cp\u003eAfter DNAse I treatment (NEB, Cat: M0303S), as directed by the manufacturer\u0026rsquo;s instructions, DNA contamination from RNA was eliminated. M-MuLV Reverse Transcriptase Kit (NEB, Cat: M0253S) was used to create cDNA from a 2 \u0026micro;l solution containing 100 ng of DNA-free RNA in a 20 \u0026micro;l final volume (2 \u0026micro;l of N9 random primer mix, 2 \u0026micro;l of 10X M-MuLV buffer, 2 \u0026micro;l of 10 mM dNTP, 0.2 \u0026micro;l of RNase Inhibitor. The reaction was carried out O/N at room temperature. M-MuLV reverse transcriptase was inactivated for 20 minutes at 65\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003ePCR amplification and agarose gel electrophoresis\u003c/h2\u003e \u003cp\u003eWe utilized the methodology of Ye \u003cem\u003eet al.\u003c/em\u003e (2012) for PCR amplification and detection of genes (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e) whose primers are listed in \u003cem\u003eTable\u0026nbsp;3\u003c/em\u003e. In a total volume reaction mixture of 25 \u0026micro;l, PCR amplification was carried out using 2 \u0026micro;l of cDNA (40 ng) and 2 \u0026micro;l of primer (100 pmol), One Taq Quick-Load 2x, master mix, NEB, Cat: M0486S, 12.5 \u0026micro;l Ready Mix Taq PCR master mix, and 8.5 \u0026micro;l nuclease-free water. Twenty cycles of amplification (denaturation at 95\u0026deg;C for 30 seconds, annealing (\u003cem\u003esee list of primers in supplementary information\u003c/em\u003e) for 30 seconds, and extension at 72\u0026deg;C for 60 seconds) were performed after an initial denaturation at 95\u0026deg;C for 5 minutes. The process was completed with a final extension at 72\u0026deg;C for 10 minutes. Negative controls were used in every experiment where the reaction mixture contained no cDNA. The amplicons were resolved in Tris (RGT reagent, China, Lot: 20170605) on a 2.0% agarose gel (Cleaver Scientific Limited: Lot: 14170811). Borate (JHD chemicals, China, Lot 20141117) with EDTA buffer (pH 8.4).\u003c/p\u003e \u003c/div\u003e \n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eTable 3\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e: List of primers\u003c/em\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"648\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"6.481481481481482%\"\u003e\n \u003cp\u003e\u003cstrong\u003eS/N\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.11111111111111%\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"30.246913580246915%\"\u003e\n \u003cp\u003eForward Primer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.790123456790123%\"\u003e\n \u003cp\u003eReverse Primer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"5.401234567901234%\"\u003e\n \u003cp\u003eTm\u0026nbsp;\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.969135802469136%\"\u003e\n \u003cp\u003eAmplicon Size (bp)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"6.481481481481482%\"\u003e\n \u003cp\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.11111111111111%\"\u003e\n \u003cp\u003e\u003cem\u003eH2AX\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"30.246913580246915%\"\u003e\n \u003cp\u003eCCCTTTTAAGGGCCACCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.790123456790123%\"\u003e\n \u003cp\u003eGAGAACGGCGAAGCGATGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"5.401234567901234%\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.969135802469136%\"\u003e\n \u003cp\u003e132\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"6.481481481481482%\"\u003e\n \u003cp\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.11111111111111%\"\u003e\n \u003cp\u003e\u003cem\u003eOPA-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"30.246913580246915%\"\u003e\n \u003cp\u003eTCTTCACTGCGGGTACACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.790123456790123%\"\u003e\n \u003cp\u003eTCCTTCTCCAAACGCTCCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"5.401234567901234%\"\u003e\n \u003cp\u003e57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.969135802469136%\"\u003e\n \u003cp\u003e146\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"6.481481481481482%\"\u003e\n \u003cp\u003e\u003cstrong\u003e3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.11111111111111%\"\u003e\n \u003cp\u003e\u003cem\u003eDNMT3A\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"30.246913580246915%\"\u003e\n \u003cp\u003eCTTTTTGGACACCCCAAGGCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"31.790123456790123%\"\u003e\n \u003cp\u003eTGGTCTTTGTGAGCAAGAGCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"5.401234567901234%\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.969135802469136%\"\u003e\n \u003cp\u003e172\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"6.481481481481482%\"\u003e\n \u003cp\u003e\u003cstrong\u003e4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.11111111111111%\"\u003e\n \u003cp\u003e\u003cem\u003eBDNF\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"30.246913580246915%\"\u003e\n \u003cp\u003eTGCAGGGGCATAGACAAAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"31.790123456790123%\"\u003e\n \u003cp\u003eCTTATGAATCGCCAGCCAATTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"5.401234567901234%\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"14.969135802469136%\"\u003e\n \u003cp\u003e148\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\u003c/br\u003e\n\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eAmplicon image processing and semi-quantification\u003c/h2\u003e \u003cp\u003eImages of in-gel amplicon bands were processed using the Keynote platform. Utilizing Image-J software, gel density quantification was carried out (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e). Using the Numbers software (Mac OSX version), each point reflects relative expression as defined by the test gene band intensity compared to the internal control band intensity.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eStatistical significance was determined using \u003cem\u003ep\u0026thinsp;\u0026le;\u0026thinsp;.05\u003c/em\u003e for all analyses. Any descriptive data presented in the text represents the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SEM). Data analyses were performed with one-way ANOVA followed by Tukey\u0026rsquo;s multiple comparisons tests using GraphPad Prism 9 (GraphPad Software, Inc.) statistical program.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003eMicroscopy\u003c/h2\u003e \u003cp\u003eUsing an Olympus binocular research microscope (Olympus, New Jersey, USA) coupled to a 5.0 MP Amscope camera, histological and histochemical images of the hippocampus and PFC were obtained (Amscope Inc, USA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"List Of Abbreviations","content":"\u003cp\u003eWED\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;walnut-enriched diet\u003c/p\u003e\n\u003cp\u003ePFC\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;prefrontal cortex\u003c/p\u003e\n\u003cp\u003eEPM\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;elevated plus maze\u003c/p\u003e\n\u003cp\u003eAChE\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;acetylcholinesterase\u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha;\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;tumour necrotic factor-alpha\u003c/p\u003e\n\u003cp\u003eiNOS\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;inducible nitric oxide synthase\u003c/p\u003e\n\u003cp\u003eIL-1\u0026beta;\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;interleukin 1 beta\u003c/p\u003e\n\u003cp\u003eCOX-2\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;cyclooxygenase 2\u003c/p\u003e\n\u003cp\u003eDNMT 3a\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;DNA methyltransferase 3a\u003c/p\u003e\n\u003cp\u003eH2Ax\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;histone protein 2Ax\u003c/p\u003e\n\u003cp\u003eOPA1\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;mitochondrial dynamin-like GTPase\u003c/p\u003e\n\u003cp\u003eBDNF \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; brand-derived neurotrophic factor\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthics approval\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethical Review Committee of the University of Ilorin authorized the experimental protocols outlined in this article (approval number: UERC/ASN/2019/1855), confirming that they adhered to all institutional policies and laws concerning the care and use of animals in research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis published article [including its supplemental information files] contains all data produced or analyzed during this investigation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere was no funding for this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTTA, OJO, and BU are responsible for research ideation; OJO refined methodology; benchwork and data curation were performed by AA, OB, FSL, EL, and OA; EY, OT, and IG performed data analyses and image visualization; TTA wrote the original manuscript draft; TTA, IG, and OA did review and editing; OJO and BU performed supervisory roles. All authors have read and approved the final draft of this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe sincerely thank Prof. Olaposi Omotuyi of the Drug and Research and Development, Afe Babalola University, Ado-Ekiti, Nigeria, for his technical support with gene expression assays.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChen P, Bornhorst J, Aschner M. Manganese metabolism in humans. Frontiers in Bioscience - Landmark. 2018;23(9). \u003c/li\u003e\n\u003cli\u003eBalachandran RC, Mukhopadhyay S, McBride D, Veevers J, Harrison FE, Aschner M, et al. Brain manganese and the balance between essential roles and neurotoxicity. Journal of Biological Chemistry. 2020;295(19):6312\u0026ndash;29. \u003c/li\u003e\n\u003cli\u003eMezzaroba L, Alfieri DF, Colado Sim\u0026atilde;o AN, Vissoci Reiche EM. The role of zinc, copper, manganese and iron in neurodegenerative diseases. Neurotoxicology. 2019 Sep 1;74:230\u0026ndash;41. \u003c/li\u003e\n\u003cli\u003eToni M, Massimino ML, de Mario A, Angiulli E, Spisni E. Metal dyshomeostasis and their pathological role in prion and prion-like diseases: The basis for a nutritional approach. Vol. 11, Frontiers in Neuroscience. 2017. \u003c/li\u003e\n\u003cli\u003eLi Y, Jiao Q, Xu H, Du X, Shi L, Jia F, et al. Biometal dyshomeostasis and toxic metal accumulations in the development of alzheimer\u0026rsquo;s disease. Vol. 10, Frontiers in Molecular Neuroscience. 2017. \u003c/li\u003e\n\u003cli\u003eAdwan L, Zawia NH. Epigenetics: A novel therapeutic approach for the treatment of Alzheimer\u0026rsquo;s disease. Pharmacol Ther [Internet]. 2013;139(1):41\u0026ndash;50. Available from: http://dx.doi.org/10.1016/j.pharmthera.2013.03.010\u003c/li\u003e\n\u003cli\u003eTu H, Fan C, Chen X, Liu J, Wang B, Huang Z, et al. Effects of cadmium, manganese, and lead on locomotor activity and neurexin 2a expression in zebrafish. Environ Toxicol Chem. 2017;36(8):2147\u0026ndash;54. \u003c/li\u003e\n\u003cli\u003eHeyer DB, Meredith RM. Environmental toxicology: Sensitive periods of development and neurodevelopmental disorders. Vol. 58, NeuroToxicology. 2017. \u003c/li\u003e\n\u003cli\u003eStansfield KH, Richard Pilsner J, Lu Q, Wright RO, Guilarte TR. Dysregulation of BDNF-TrkB signaling in developing hippocampal neurons by Pb2+: Implications for an environmental basis of neurodevelopmental disorders. Toxicological Sciences. 2012;127(1). \u003c/li\u003e\n\u003cli\u003eLuthar SS, Eisenberg N. Resilient adaptation among at-risk children: Harnessing science toward maximizing salutary environments. Child Dev. 2017;88(2). \u003c/li\u003e\n\u003cli\u003eLuby JL, Baram TZ, Rogers CE, Barch DM. Neurodevelopmental Optimization after Early-Life Adversity: Cross-Species Studies to Elucidate Sensitive Periods and Brain Mechanisms to Inform Early Intervention. Vol. 43, Trends in Neurosciences. 2020. \u003c/li\u003e\n\u003cli\u003evan Abeelen AFM, Elias SG, Bossuyt PMM, Grobbee DE, van der Schouw YT, Roseboom TJ, et al. Famine exposure in the young and the risk of type 2 diabetes in adulthood. Diabetes. 2012;61(9). \u003c/li\u003e\n\u003cli\u003eBorge TC, Aase H, Brants\u0026aelig;ter AL, Biele G. The importance of maternal diet quality during pregnancy on cognitive and behavioural outcomes in children: A systematic review and meta-analysis. Vol. 7, BMJ Open. 2017. \u003c/li\u003e\n\u003cli\u003eMeyer HC, Lee FS. Translating developmental neuroscience to understand risk for psychiatric disorders. Vol. 176, American Journal of Psychiatry. 2019. \u003c/li\u003e\n\u003cli\u003eFranklin TB, Russig H, Weiss IC, Grff J, Linder N, Michalon A, et al. Epigenetic transmission of the impact of early stress across generations. Biol Psychiatry. 2010;68(5). \u003c/li\u003e\n\u003cli\u003eMurgatroyd C, Spengler D. Epigenetics of early child development. Vol. 2, Frontiers in Psychiatry. 2011. \u003c/li\u003e\n\u003cli\u003eMansuy IM, Mohanna S. Epigenetics and the human brain: where nurture meets nature. Cerebrum. 2011;2011. \u003c/li\u003e\n\u003cli\u003ePereira JA, Oliveira I, Sousa A, Ferreira ICFR, Bento A, Estevinho L. Bioactive properties and chemical composition of six walnut (Juglans regia L.) cultivars. Food and Chemical Toxicology. 2008;46(6):2103\u0026ndash;11. \u003c/li\u003e\n\u003cli\u003eWillis LM, Bielinski DF, Fisher DR, Matthan NR, Joseph JA. Walnut extract inhibits LPS-induced activation of Bv-2 microglia via internalization of TLR4: Possible involvement of phospholipase D2. Inflammation. 2010;33(5):325\u0026ndash;33. \u003c/li\u003e\n\u003cli\u003eHardman WE, Ion G, Akinsete JA, Witte TR. Dietary walnut suppressed mammary gland tumorigenesis in the C(3)1 TAg mouse. Nutr Cancer. 2011;63(6). \u003c/li\u003e\n\u003cli\u003eChijioke OC, Anosike Chioma A, Collins AC. Studies on the phytochemical and nutritional properties of tetracarpidium conophorum (black walnut) seeds. Journal of Global Biosciences. 2015;4(2). \u003c/li\u003e\n\u003cli\u003eIgbokwe UV, Ejike DE, Adams MD, Rabiu KM, Iliya E, Ajeka PO, et al. Tetracarpidium conophorum extract exhibits anti-fatigue activity in rats via reduced protein catabolism, increased antioxidant status and delayed lactate elevation. Fudma journal of sciences. 2021;5(2). \u003c/li\u003e\n\u003cli\u003eKraeuter AK, Guest PC, Sarnyai Z. The Y-Maze for Assessment of Spatial Working and Reference Memory in Mice. In: Methods in Molecular Biology. 2019. \u003c/li\u003e\n\u003cli\u003eHogas M, Ciobica A, Hogas S, Bild V, Hritcu L. The effects of the administration of two different doses of manganese on short-term spatial memory and anxiety-like behavior in rats. Arch Biol Sci. 2011;63(4). \u003c/li\u003e\n\u003cli\u003eChen CJ, Ou YC, Lin SY, Liao SL, Chen SY, Chen JH. Manganese modulates pro-inflammatory gene expression in activated glia. Neurochem Int. 2006;49(1). \u003c/li\u003e\n\u003cli\u003eMoreno JA, Sullivan KA, Carbone DL, Hanneman WH, Tjalkens RB. Manganese potentiates nuclear factor-\u0026kappa;B-dependent expression of nitric oxide synthase 2 in astrocytes by activating soluble guanylate cyclase and extracellular responsive kinase signaling pathways. J Neurosci Res. 2008;86(9). \u003c/li\u003e\n\u003cli\u003eMoreno JA, Streifel KM, Sullivan KA, Hanneman WH, Tjalkens RB. Manganese-induced NF-\u0026kappa;B activation and nitrosative stress is decreased by estrogen in juvenile mice. Toxicological Sciences. 2011;122(1):121\u0026ndash;33. \u003c/li\u003e\n\u003cli\u003eFilipov NM, Dodd CA. Role of glial cells in manganese neurotoxicity. Vol. 32, Journal of Applied Toxicology. 2012. \u003c/li\u003e\n\u003cli\u003eSoares ATG, Silva A de C, Tinkov AA, Khan H, Santamar\u0026iacute;a A, Skalnaya MG, et al. The impact of manganese on neurotransmitter systems. Journal of Trace Elements in Medicine and Biology. 2020;61. \u003c/li\u003e\n\u003cli\u003eBoersma GJ, Lee RS, Cordner ZA, Ewald ER, Purcell RH, Moghadam AA, et al. Prenatal stress decreases Bdnf expression and increases methylation of Bdnf exon IV in rats. Epigenetics. 2013;9(3). \u003c/li\u003e\n\u003cli\u003eSarkar S, Malovic E, Harischandra DS, Ngwa HA, Ghosh A, Hogan C, et al. Manganese exposure induces neuroinflammation by impairing mitochondrial dynamics in astrocytes. Neurotoxicology. 2018;64. \u003c/li\u003e\n\u003cli\u003eMolina RM, Phattanarudee S, Kim J, Thompson K, Wessling-Resnick M, Maher TJ, et al. Ingestion of Mn and Pb by rats during and after pregnancy alters iron metabolism and behavior in offspring. Neurotoxicology. 2011; \u003c/li\u003e\n\u003cli\u003eLucchini RG, Aschner M, Landrigan PJ, Cranmer JM. Neurotoxicity of manganese: Indications for future research and public health intervention from the Manganese 2016 conference. Neurotoxicology. 2018;64:1\u0026ndash;4. \u003c/li\u003e\n\u003cli\u003eBouchard MF, Sauv\u0026eacute; S, Barbeau B, Legrand M, Brodeur M\u0026Egrave;, Bouffard T, et al. Intellectual impairment in school-age children exposed to manganese from drinking water. Environ Health Perspect. 2011;119(1). \u003c/li\u003e\n\u003cli\u003eTorres-Agust\u0026iacute;n R, Rodr\u0026iacute;guez-Agudelo Y, Schilmann A, Sol\u0026iacute;s-Vivanco R, Montes S, Riojas-Rodr\u0026iacute;guez H, et al. Effect of environmental manganese exposure on verbal learning and memory in Mexican children. Environ Res. 2013;121. \u003c/li\u003e\n\u003cli\u003eSprowles JLN, Amos-Kroohs RM, Braun AA, Sugimoto C, Vorhees C v., Williams MT. Developmental manganese, lead, and barren cage exposure have adverse long-term neurocognitive, behavioral and monoamine effects in Sprague-Dawley rats. Neurotoxicol Teratol [Internet]. 2018;67(December 2017):50\u0026ndash;64. Available from: https://doi.org/10.1016/j.ntt.2018.04.001\u003c/li\u003e\n\u003cli\u003eCasas-Agustench P, Fernandes FS, Tavares Do Carmo MG, Visioli F, Herrera E, D\u0026aacute;valos A. Consumption of distinct dietary lipids during early pregnancy differentially modulates the expression of microRNAs in mothers and offspring. PLoS One. 2015;10(2). \u003c/li\u003e\n\u003cli\u003eCarey AN, Fisher DR, Joseph JA, Shukitt-Hale B. The ability of walnut extract and fatty acids to protect against the deleterious effects of oxidative stress and inflammation in hippocampal cells. Nutr Neurosci [Internet]. 2013;16(1):13\u0026ndash;20. Available from: http://www.tandfonline.com/doi/full/10.1179/1476830512Y.0000000023\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez-Gonz\u0026aacute;lez C, Ciudad CJ, No\u0026eacute; V, Izquierdo-Pulido M. Health benefits of walnut polyphenols: An exploration beyond their lipid profile. Vol. 57, Critical Reviews in Food Science and Nutrition. 2017. \u003c/li\u003e\n\u003cli\u003eErikson KM, Aschner M. Manganese neurotoxicity and glutamate-GABA interaction. Neurochem Int. 2003;43(4\u0026ndash;5):475\u0026ndash;80. \u003c/li\u003e\n\u003cli\u003eLucchini RG, Dorman DC, Elder A, Veronesi B. Neurological impacts from inhalation of pollutants and the nose-brain connection. Neurotoxicology. 2012;33(4). \u003c/li\u003e\n\u003cli\u003eBhang SY, Cho SC, Kim JW, Hong YC, Shin MS, Yoo HJ, et al. Relationship between blood manganese levels and children\u0026rsquo;s attention, cognition, behavior, and academic performance-A nationwide cross-sectional study. Environ Res. 2013;126. \u003c/li\u003e\n\u003cli\u003eOulhote Y, Mergler D, Barbeau B, Bellinger DC, Bouffard T, Brodeur M\u0026Egrave;, et al. Neurobehavioral function in school-age children exposed to manganese in drinking water. Environ Health Perspect. 2015;122(12). \u003c/li\u003e\n\u003cli\u003eBeaudin SA, Strupp BJ, Strawderman M, Smith DR. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect. 2017;125(2). \u003c/li\u003e\n\u003cli\u003eSchneider JS, Williams C, Ault M, Guilarte TR. Effects of chronic manganese exposure on attention and working memory in non-human primates. Neurotoxicology. 2015;48. \u003c/li\u003e\n\u003cli\u003eNetto SM, Warela RWB, Fechine MF, Queiroga MN, Quintans-J\u0026uacute;nior LJ. Anxiolytic-like effect of Rauvolfia ligustrina Willd. ex Roem. \u0026amp; Schult., Apocynaceae, in the elevated plus-maze and hole-board tests. Revista Brasileira de Farmacognosia. 2009;19(4). \u003c/li\u003e\n\u003cli\u003eSouto-Maior FN, de Carvalho FLD, de Morais LCSL, Netto SM, de Sousa DP, de Almeida RN. Anxiolytic-like effects of inhaled linalool oxide in experimental mouse anxiety models. Pharmacol Biochem Behav. 2011;100(2). \u003c/li\u003e\n\u003cli\u003ePappas BA, Zhang D, Davidson CM, Crowder T, Park GAS, Fortin T. Perinatal manganese exposure: Behavioral, neurochemical, and histopathological effects in the rat. Neurotoxicol Teratol. 1997;19(1). \u003c/li\u003e\n\u003cli\u003eKern CH, Stanwood GD, Smith DR. Preweaning manganese exposure causes hyperactivity, disinhibition, and spatial learning and memory deficits associated with altered dopamine receptor and transporter levels. Synapse. 2010;64(5). \u003c/li\u003e\n\u003cli\u003eMoreno JA, Streifel KM, Sullivan KA, Legare ME, Tjalkens RB. Developmental exposure to manganese increases adult susceptibility to inflammatory activation of glia and neuronal protein nitration. Toxicological Sciences. 2009;112(2):405\u0026ndash;15. \u003c/li\u003e\n\u003cli\u003eZhao F, Cai T, Liu M, Zheng G, Luo W, Chen J. Manganese induces dopaminergic neurodegeneration via microglial activation in a rat model of manganism. Toxicological Sciences. 2009; \u003c/li\u003e\n\u003cli\u003eVerina T, Kiihl SF, Schneider JS, Guilarte TR. Manganese exposure induces microglia activation and dystrophy in the substantia nigra of non-human primates. Neurotoxicology. 2011;32(2). \u003c/li\u003e\n\u003cli\u003eStreifel KM, Moreno JA, Hanneman WH, Legare ME, Tjalkens RB. Gene deletion of nos2 protects against manganese-induced neurological dysfunction in juvenile mice. Toxicological Sciences. 2012;126(1). \u003c/li\u003e\n\u003cli\u003ePeres T v., Schettinger MRC, Chen P, Carvalho F, Avila DS, Bowman AB, et al. \u0026ldquo;Manganese-induced neurotoxicity: A review of its behavioral consequences and neuroprotective strategies.\u0026rdquo; BMC Pharmacol Toxicol [Internet]. 2016;17(1). Available from: http://dx.doi.org/10.1186/s40360-016-0099-0\u003c/li\u003e\n\u003cli\u003eBenedetto A, Au C, Avila DS, Milatovic D, Aschner M. Extracellular dopamine potentiates Mn-induced oxidative stress, lifespan reduction, and dopaminergic neurodegeneration in a BLI-3-dependent manner in caenorhabditis elegans. PLoS Genet. 2010;6(8). \u003c/li\u003e\n\u003cli\u003eOliveira AMM, Hemstedt TJ, Bading H. Rescue of aging-associated decline in Dnmt3a2 expression restores cognitive abilities. Nat Neurosci. 2012;15(8). \u003c/li\u003e\n\u003cli\u003eWeyemi U, Paul BD, Bhattacharya D, Malla AP, Boufraqech M, Harraz MM, et al. Histone H2AX promotes neuronal health by controlling mitochondrial homeostasis. Proc Natl Acad Sci U S A. 2019;116(15). \u003c/li\u003e\n\u003cli\u003eNakamura T, Lipton SA. \u0026rsquo;sNO\u0026rsquo;-Storms Compromise Protein Activity and Mitochondrial Metabolism in Neurodegenerative Disorders. Vol. 28, Trends in Endocrinology and Metabolism. 2017. \u003c/li\u003e\n\u003cli\u003eSanju\u0026aacute;n Szklarz LK, Scorrano L. The antiapoptotic OPA1/Parl couple participates in mitochondrial adaptation to heat shock. In: Biochimica et Biophysica Acta - Bioenergetics. 2012. \u003c/li\u003e\n\u003cli\u003eLindholm JSO, Castr\u0026eacute;n E. Mice with altered BDNF signaling as models for mood disorders and antidepressant effects. Vol. 8, Frontiers in Behavioral Neuroscience. 2014. \u003c/li\u003e\n\u003cli\u003eCarim-Todd L, Bath KG, Fulgenzi G, Yanpallewar S, Jing D, Barrick CA, et al. Endogenous Truncated TrkB.T1 Receptor Regulates Neuronal Complexity and TrkB Kinase Receptor Function In Vivo. Journal of Neuroscience [Internet]. 2009 Jan 21 [cited 2023 Jan 15];29(3):678\u0026ndash;85. Available from: https://www.jneurosci.org/content/29/3/678\u003c/li\u003e\n\u003cli\u003eTaliaz D, Stall N, Dar DE, Zangen A. Knockdown of brain-derived neurotrophic factor in specific brain sites precipitates behaviors associated with depression and reduces neurogenesis. Mol Psychiatry. 2010;15(1). \u003c/li\u003e\n\u003cli\u003eTaliaz D, Loya A, Gersner R, Haramati S, Chen A, Zangen A. Resilience to chronic stress is mediated by hippocampal brain-derived neurotrophic factor. Journal of Neuroscience. 2011;31(12). \u003c/li\u003e\n\u003cli\u003eGuilarte TR. APLP1, Alzheimer\u0026rsquo;s-like pathology and neurodegeneration in the frontal cortex of manganese-exposed non-human primates. Neurotoxicology. 2010;31(5). \u003c/li\u003e\n\u003cli\u003eLazrishvili IL, Shukakidze AA, Chkhartishvili NN, Bikashvili TZ. Morphological changes and manganese content in the brains of rat pups subjected to subchronic poisoning with manganese chloride. Neurosci Behav Physiol. 2009;39(1). \u003c/li\u003e\n\u003cli\u003eOmotuyi OI, Nash O, Inyang OK, Ogidigo J, Enejoh O, Okpalefe O, et al. Flavonoid-rich extract of Chromolaena odorata modulate circulating GLP-1 in Wistar rats: computational evaluation of TGR5 involvement. Vol. 8, 3 Biotech. 2018. \u003c/li\u003e\n\u003cli\u003eYe J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13. \u003c/li\u003e\n\u003cli\u003eRueden CT, Schindelin J, Hiner MC, DeZonia BE, Walter AE, Arena ET, et al. ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinformatics. 2017;18(1). \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"neurodevelopment, manganese, neurotoxicity, nutrition, walnuts, neuroprotection, enhancement, epigenetics","lastPublishedDoi":"10.21203/rs.3.rs-2503533/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2503533/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: Early experiences at critical milestones significantly impact neurocognitive outcomes by altering brain development. Such issues can affect children’s academic achievement, disturb their behaviour, lower their quality of life, and raise their risk of derangement in adulthood. These problems are linked to many possible neurotoxicants, including high ambient manganese (Mn) exposure. Walnuts possess high levels of ω-3 fatty acids and a high content of potent phytochemicals, all of which play an essential role in brain health. This present study explored the ability of a maternal walnut-enriched diet (WED) to protect against MnCl\u003csub\u003e2\u003c/sub\u003e-induced developmental neurotoxicity \u003cem\u003ein utero \u003c/em\u003evis-à-vis early postnatal stages in rats. Dams were exposed to diet and Mn treatment during gestation and/or preweaning periods. At the onset of adolescence (~postnatal day 28), offspring of dams were examined on the Y-maze and elevated-plus maze to evaluate working memory and anxiety levels. After euthanasia, cortical and hippocampal tissues were harvested for subsequent analyses by histology, histochemistry, PCR, and spectrophotometry methods. All data were analyzed using One-way ANOVA followed by Tukey’s test for multiple comparisons. Significance was set at p\u0026lt;0.05.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: Offspring of dams treated with MnCl\u003csub\u003e2\u003c/sub\u003e exhibited a significant reduction in working memory and a loss of emotional stability, which was restored by WED; Mn aberrations in histomorphology of the PFC and hippocampus were abated by WED; dysregulation in gene expression of DNMT3A,\u0026nbsp; H2Ax, BDNF, and OPA1 was prevented by developmental WED; upregulated levels of pro-inflammatory cytokines which correlated with MnCl\u003csub\u003e2\u003c/sub\u003e exposure was significantly reduced by walnut supplementation and; finally, accompanied perturbation of the cholinergic system (AChE) by MnCl\u003csub\u003e2\u003c/sub\u003e was significantly counteracted by WED.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Our data suggest that WED intervened and forestalled deficits in behaviour, structural alterations, and functional dysregulation arising from manganese neurotoxicity in developing rats.\u003c/p\u003e","manuscriptTitle":"Maternal diet enriched with African walnuts confers neurodevelopmental resilience to MnCl2-induced neurotoxic cascades in rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-01-24 15:24:48","doi":"10.21203/rs.3.rs-2503533/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9241af9b-ab75-402d-be07-1430e3b35bf4","owner":[],"postedDate":"January 24th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-11-02T03:59:16+00:00","versionOfRecord":[],"versionCreatedAt":"2023-01-24 15:24:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2503533","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2503533","identity":"rs-2503533","version":["v1"]},"buildId":"369fNeqWncA4NS6XSWjrt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}