The COL6A5-p.Glu2272* mutation induces chronic itch in mice

The COL6A5-p.Glu2272* mutation induces chronic itch in mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The COL6A5-p.Glu2272* mutation induces chronic itch in mice Ameer Abu Bakr Rasheed, Marie-Christine Birling, Giuseppe Lauria, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3551110/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Mar, 2024 Read the published version in Mammalian Genome → Version 1 posted You are reading this latest preprint version Abstract Pruritus is a common irritating sensation that provokes the desire to scratch. Environmental and genetic factors, altering barrier skin dysfunction, or hypersensitivity of sensory nerves, contribute to the onset of pruritus. However, the itch can become a major burden when it becomes chronic, like in neuropathic itch. The rare Collagen VI alpha 5 ( COL6A5 ) gene variant p.Glu2272* was recently identified in two families and an independent patient with chronic neuropathic itch. These patients showed reduced COL6A5 expression in the skin and normal skin morphology. However, little progress has been made until now toward understanding the relationships between this mutation and chronic itch. Therefore, we developed the first mouse model that recapitulates COL6A5- p.Glu2272* mutation using the CRISPR-Cas technology and characterized this new mouse model. The mutant mRNA, measured by RT-ddPCR, was expressed at normal levels in dorsal root ganglia and decreased in skin. The functional exploration showed changes in the behavior of control individuals kept with mutant carriers and confirmed the effect in the mutant mice with some sex dysmorphology. Spontaneous scratching was detected in male and female mutants, with increased anxiety-like behavior in female mutants and despair-like behavior in sex-grouped mutants. These results suggest that the COL6A5- p.Glu2272* mutation found in patients contributes to chronic itch and probably induces additional behavioral changes. The COL6A5 -p.Glu2272* mouse model could elucidate the pathophysiological mechanisms underlying COL6A5 role in neuropathic itch and help identify potential new therapeutic targets. COL6A5 chronic neuropathic itch pruritus CRISPR-Cas technology scratching spontaneous itch Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Itch (pruritus) is a common, irritating, unpleasant sensation that elicits the desire or reflex to scratch (Weisshaar et al. 2019 ). Clinically, the itch can be characterized as acute or chronic when it lasts more than 6 weeks (Yosipovitch et al. 2018 ). A European study revealed that the prevalence of acute itch in the general population is 8%, while it is 13% for chronic itch. Moreover, chronic itch with lifetime prevalence is 22% in the general population, indicating that more than 1 in 5 people experience chronic itch once in their life (Weisshaar et al. 2019 ). Moreover, the chronic itch greatly impacts the quality of life. Chronic itch is considered neuropathic when neuronal damage is responsible for the symptom (Stumpf and Ständer 2013 ). Damages at any site of the somatosensory system, including peripheral nerve fibers and ganglia, and the central nervous system, including the spinal cord, brainstem, thalamus, and cortex, may lead to neuropathic itch (Misery et al. 2014 ). Several conditions affecting the nervous system are associated with neuropathic itch. These include small fiber neuropathy (SFN), metabolic (e.g., diabetes), infections, and autoimmune and genetic diseases (Oaklander, 2011). The epidemiological studies investigating the prevalence and incidence of neuropathic itch have estimated that 8%-19% of chronic itch cases have a neuropathic origin (Meixiong et al. 2020 ; Pereira et al. 2021 ). In recent years new insights have been gained. In particular, rare collagen VI alpha 5 ( COL6A5 , previously known as COL29A1 ) gene variants were identified in patients suffering from neuropathic itch (Martinelli-Boneschi et al. 2017 ). COL6A5 is a member of the collagen protein superfamily. Collagens contain domains with VWA motifs that form filaments and are mainly associated with protein-ligand interactions for organizing tissue architecture and cell adhesion (Söderhäll et al. 2007 ). COL6A5 is expressed in epithelial tissues, including the lungs and gastrointestinal tract (Fitzgerald et al. 2008 ), with a high expression at the dermal-epidermal junction (Philippeos et al. 2018 ) and around the vessels of the reticular dermis (Sabatelli et al. 2011 ). Previously, Martinelli-Boneschi and colleagues identified a heterozygous c.6814G > T transversion in the COL6A5 gene of chronic neuropathic itch patients, resulting in a p.Glu2272-to-Ter (E2272X) substitution. Autosomal dominant transmission of chronic neuropathic itch was reported in 5 patients from 2 unrelated families (families 1 and 2) using whole-exome sequencing (Martinelli-Boneschi et al. 2017 ). These patients carrying the p.Glu2272* nonsense mutation also showed reduced COL6A5 expression in the skin. However, due to the complex nature of neuropathic itch, progress in understanding the mechanisms leading to chronic itch in these patients has not been made yet. In order to investigate the consequence of this mutation, we developed a new mouse model for the COL6A5- p.Glu2272* mutation using the CRISPR-Cas9 technology. Our data provide evidence for augmented spontaneous scratching behavior and increased anxiety and despair-like behaviors in mutant mice. This report demonstrates that the COL6A5 -p.Glu2272* mutation contributes to itching, with anxio-depressive consequences. Material and method Animal research Animal research was performed in agreement with the EC directive 2010/63/UE86/609/CEE, in compliance with the animal welfare policies of the French Ministry of Agriculture (Art. R. 214 − 107 and 214 − 122). Animal were bred and maintained in our animal facility which is accredited by the French Ministry for Superior Education and Research and the French Ministry of Agriculture (agreement #C67-218-40) following the French Law (Decree n° 2013 − 118 01 and its supporting annexes entered into legislation on 01 February 2013) relative with the protection of animals used in scientific experimentation. All experiments were done in agreement with the local ethical committee. Studies are reported in accordance with the ARRIVE 2.0 guidelines. Mouse breeding and behavior experiments were conducted in SPF (Specific Pathogen Free) conditions in our animal facility at PHENOMIN-ICS, following the 3R principle. Mice were kept grouped in two to five animals in each cage. Mice were kept in the controlled light cycle at 12 h light and 12 h dark (light turned on at 7 AM and off at 7 PM through an automated control system). Mice were kept under a controlled temperature of 21 ± 1°C and humidity of 55 ± 10% and had free access to food (standard chow) and autoclaved tap water. For all experiments, mice were transferred to the experimental facility of ICS two weeks prior to behavior tests so that they have some time for habituation to the experimental facility of ICS. Animals were transferred to the experimental room 30 min before each experimental test. Generating the COL6A5 -p.Glu2272* mice model using CRISPR/Cas9 The mutant mouse line Col6a5 em1YahICS , also named Col6a5 E2302* , for the human COL6A5 -p.Glu2272* mutation, was generated in ICS using CRISPR-Cas9 technology. In the mouse, the mutant codon is located in exon 38 (Ensembl ID ENSMUSE00000891350.1; figure S1 ). The guide RNA had to drive the double strand break generated by the Cas9 protein very close to the site of insertion of the selection mutation (leading to a STOP codon). We used the CRISPOR online software ( http://crispor.tefor.net/crispor.py ) to select high specificity-score sgRNAs with a low number of predicted off-target sequences. This guide RNA, AGTCATGGCAGAGAAGAACT, had a specificity score of 52 (internal name gR52). The guide RNA was validated in vitro for its ability to drive DSB (Double Strand Break) on a PCR fragment containing the targeted sequence in the presence of Cas9 protein. A donor single-stranded oligonucleotide (donor ssODN) was designed that bares the expected mutation (G > T, corresponding to the rs11537567 human variant) as well as 2 silent mutations (A > G and A > C). Its sequence was AGCCACGTCCATGTAATATTCTTGAAGAGAAGCATCCCCAGGCT-CATGAGCAAGACCCAGCTCTTATCGGCCATGACTTTCATGTTCTGCAACAGAATAACTTTAGTCACTAGTGGTGAAAGGGTTAACTTG. Together, these 2 mutations generate a new HaeIII restriction site. In addition, a third A > G mutation was introduced after the new STOP codon. These 3 mutations generated 3 mismatches in the donor DNA that allowed to avoid new double strand breaks after the occurrence of homology directed repair. The CRISPR guide efficiency was tested in vitro using a Sureguide kit (Agilent Technologies 5190–7716). In the presence of the Cas9 protein, the PCR product, including the region of interest, should be cut. A guide is validated if it cuts the target PCR fragment. A mix containing the Cas9 mRNA, the guide RNA and the ssODN was microinjected in fertilized C57BL/6N oocytes, and PCR screened the newborn offspring. The microinjection of a mix of gR52 guide RNA (12 ng/µl), spCas9 mRNA (25 g/µl), and 10 ng/µl ssODN in the male pronuclei of 355 C57BL/6N fertilized oocytes led to 28 pups. PCR followed by HaeIII restriction digests, screened the pups. Primers F1 (AATGGAAATAATTCTGCACCAAGTG) and R1 (TAAGACAGAGGTCAGTGGAGCTGGG) were used to amplify a PCR fragment of expected size 426 bps. In the presence of the mutations of interest, 2 fragments of 245 bps and 181 bps were detected after HaeIII restriction digest. All undigested PCR products from pups showing HaeIII digests were subsequently sequenced by Sanger sequence. The insertion of the new STOP codon was confirmed by Sanger sequencing. Eleven F0 pups (> 39%) had the expected mutations. Five F0 animals were bred with wild type (wt) C57BL/6N mice to generate F1 founders. F1 mice were analyzed for germline transmission by Sanger Sequencing to establish the Col6a5 em1 − E2302* mouse line. All founders gave heterozygous pups. Two lines were fully established and cryopreserved, and one was further studied, as shown in the present paper. Determination of genotype Crude genomic DNA was extracted from mouse tail samples through Direct PCR Lysis Reagent-Tail (Viagen Biotech, Cat # 101-T) according to the manufacturer’s instructions. Subsequently, the Phusion Hot Start II High-Fidelity DNA polymerase kit (Thermo Scientific) was used with primers specific for the wt (+) and mutant ( Col6a5 E2302* ) alleles. Moreover, PCR reaction containing the following: 500 ng genomic DNA extracted from a wt or mutant mouse, 4 µl 5×Phusion HF Buffer, 0.4 µl dNTP mix (dATP, dCTP, dGTP, dTTP at 10 mM, Thermo Scientific), 0.2 µl each primer at 0.5 µM and H2O in a total volume of 20 µl. Using a T100 thermocycler (Bio-Rad), PCR was performed with the following thermal condition: 96°C for 5min followed by 30 cycles of 96°C for 8s, 62°C for 10s and 68°C for 45s, and then annealing temperature as 68°C for 5min with final elongation step for 5min at 72°C. Next, 10 µl of PCR outcome was used to digest with enzyme HaeIII 0.2 µl, 10X Buffer of volume 2 µl, and remaining H2O to make a total volume of 20 µl for each reaction and kept at 37°C incubator for 15min. 2% agarose gel was run for both digested and non-digested PCR outcomes and differentiated between wt and mutant mice. Our point mutation (PM) containing sequence of DNA was digested by HaeIII restriction enzyme into further 236 bps and 190 bps Col6a5 E2302* allele along with 426 bps wt allele. In contrast, the non-digested = uncut PCR outcome gave only a wt allele of 426 bps. Mice genomic DNA showing only one band of the wt allele (+) of 426 bps in digested PCR outcomes were identified as wild-type littermate mice (wt lit). When both the wt allele band of 426 bps and the 236 bps & 190 bps PM alleles (mut) in digested PCR outcome, mice were heterozygous. Similarly, when mice genomic DNA showed no wt allele of 426 bps and only two bands of 236 bps and 190 bps of PM allele in digested PCR outcome they were genotyped as homozygous mice. Primer sequence information is shown in Table S1 . Analysis of transcript expression level by Droplet digital PCR (ddPCR) We determined Col6a5 mRNA expression using Real-Time droplet digital PCR (RT-ddPCR) on 42-week aged mice that underwent the previous behavioral characterization. Eight control (wt), 5 heterozygotes (hets) and 6 homozygotes (homs) males, plus 10 wt, 7 hets and 6 homs females were used. Dorsal root ganglions (DRGs) were collected from wt and mutant mice and frozen in liquid nitrogen. Later, samples were lysed in TRIzol Reagent through magnetic beads containing Precellys®CK14 tubes. Total RNA was collected and purified using RNeasy Mini Kit (Qiagen) according to the protocol of the manufacturer company. Afterward, cDNA was synthesized by using the cDNA synthesis Kit “SuperScript™VILO™cDA Synthesis Kit” (Invitrogen). Then, ddPCR was performed for mRNA amplification in the volume of 20µL reactions for each sample. According to the manufacturer's recommendation, 250 nM specific primers, 125 nM of each probe, 1× ddPCR Supermix for Probes, and 50 ng DNA were used. PCR machine was run with the thermal condition as following: 10 min at 95°C, 40 cycles of 20s at 95°C, 30s at 59.2°C, 2min at 72°C, and 10min at 98°C. Droplet Digital PCR System (Bio-Rad) was used for droplet generation and quantification. Data were further analyzed using QuantaSoft Software (Bio-Rad). The sequences of primers and probes are shown in Table S2. Evans Blue dye penetration assay for skin permeability To examine the skin barrier integrity of mice, the Evans blue dye assay was performed on 42-week aged mice that underwent the previous behavioral characterization. This assay allows to detect skin barrier impairment as described previously (Zhang et al. 2018 ). Ten wt, 9 hets and 10 homs males, with 14 wt, 12 hets and 11 homs females were used. Just after euthanasia with cervical dislocation, the back of each individual was shaved, and Evans blue dye (Sigma, Ref# E2129) was applied as 1% in PBS and 50 µl/mouse. After two hours, the skin was collected and homogenized in formamide (Sigma, Ref#7503-). Subsequently, Evans blue dye extracted from skin samples was quantified by recording each sample by optical density (OD) at 620nm with a microplate reader. Functional exploration and assessment The behavioral characterization was performed on two experimental cohorts of males and females, ages 6 to 32 weeks. We used 13 B6N wt from the commercial breeders, 10 wt littermates, 12 hets and 10 homs males to evaluate scratching and grooming behaviors. For the female, 13 B6N wt, 14 wt littermates, 12 hets and 11 homs females were used. The same cohorts or parts of these cohorts were used for recording anxiety- and despair-like behaviors and social behavior. The experimenter was blind to the mouse genotype. Scratching and grooming behaviors Scratching and grooming behaviors were recorded during different sessions at 6, 12, 18, 26 and 32 weeks of age. To assess behaviors, mice were given 2 weeks in the experimental facility for adaption before assessment. For each session, mice were transferred 30 min prior to the beginning of the observations in the experimental room. Further, one day before the scratching observation, mice were placed for 30 min in transparent plastic experimental boxes for habituation. On the day of the experiment, mice were given 10 min in transparent plastic boxes for habituation before the evaluation began. Behind the transparent plastic boxes, a mirror was also positioned to assess mice behavior from the front and back view, as mentioned previously (Shimada and LaMotte 2008 ). Subsequently, mice behavior was video-recorded in the plastic box for 30 min as previously reported (Sun and Chen 2007 ; Shimada and LaMotte 2008 ; Liu et al. 2016 ). While analyzing the videos, different parameters were scored, including scratching time (i.e. the time of lifting of the hind paw to the region of the body that is scratched (back and face) and returning to the cage floor) (Figure S2) . While grooming behavior was analyzed for whipping mice with forelimbs and licking their body and tail (Shimada and LaMotte 2008 ). All scratching and grooming tests were performed between 8:00 AM and 2:00 PM. Exploration and anxiety-like behaviors Anxiety-related behavior was evaluated at 36 weeks of age on the same animals as those used for scoring scratching and grooming behaviors through an elevated plus maze experiment as previously described (Dubos et al. 2018 ). For locomotor and exploration activity, we also performed an open field test (Dubos et al. 2018 ). In an open-field experiment, a square apparatus (Panlab Harvard apparatus IR ACTIMETER, Bioseb, Vitrolles, France) containing all required sensors was used, and a polypropylene sheet covered the arena. Light for the open-field experiment was measured and kept at 150 lux in the center of the arena. Mice were placed at the periphery of the open field apparatus and were allowed to explore the arena freely for 30 min. The experiment was performed in a closed room without any experimenter disturbance. The automated system measured the total distance, number of rearings, and time spent in center and peripheral regions with video tracking and infrared sensors. Mice activity was recorded with a video tracking system (Ethovision, Noldus, France) during this session of 30 min. Further, anxiety-like behavior was assessed with the elevated plus maze. The elevated plus maze apparatus was placed at a height of 50 cm above the floor. It was made of PVC and completely automated (Imetronic, Pessac, France). It has two enclosed arms with dimensions (30 X 5 X 15 cm) and two open arms with dimensions (30 X 5 cm). The apparatus has infrared sensors to detect different parameters for anxiety, such as the number of entries in open arms, time spent in the open or closed arms, and the number of attempts made by mice etc. Mice were placed on a central platform and their exploration of the maze was recorded for 5 min. Despair-like behavior Despair-like behavior was evaluated at the age of 38 weeks on the same animals as those used for scoring scratching, grooming, and anxiety-like behaviors through the tail suspension test as described previously (Dubos et al. 2018 ). In this experiment, mice were suspended with the help of tape and hanged for 6min, and immobility time was monitored using video recording. An increased immobility time is indicative of a despair-like phenotype. Social behavior Social behavior was determined at the age of 38-weeks on the same cohorts and before scoring of despair-like behavior. The Stoelting system (Dublin, Ireland) was composed of three successive identical chambers (20 cm × 40 cm × 22 cm) with (5 cm × 8 cm) openings to allow access between the chambers. The protocol used was similar to the previously described (Duchon et al. 2011 ; Arbogast et al. 2016 ). We used adult C57BL/6N mice as stranger mice (unfamiliar mice). The age and sex of stranger mice and the mice tested for their social behavior were the same. Stranger mice were kept separately to avoid any olfactory or visual contact with test mice. Before the day of the experiment, stranger mice were habituated in wire cages for 10min for 3–5 days until they felt comfortable staying in wire cages. The experiment was divided into three phases. In the first phase, test mice were placed in the middle chamber and allowed to habituate for 10min. In the second phase (social exploration), the test mouse was enclosed in the central box, an unfamiliar mouse (stranger 1 or S1) was placed randomly in one of the wire cages, and on another side, an empty wire cage was placed. The doors were re-opened, and the test mouse was allowed to explore the entire social test box for 10 min. Time spent in each chamber, the number of entries into each chamber and the time spent sniffing each wire cage were recorded. In the third phase (social discrimination), a new, unfamiliar mouse (stranger 2 or S2) was placed by replacing the empty wire cage, and the test mouse was allowed to explore for 10 more min. During this time, the test mouse could explore or sniff the already-investigated mouse (S1) and the novel unfamiliar mouse (S2). The entire social test box was washed with tap water and dried with absorbent paper between each test to remove odors. Statistical analysis The results are expressed as mean ± standard error of the mean (SEM) for each experimental group. Student's t-test (two-tailed) was used to compare the two groups' differences. In addition, multiple groups were compared using one-way or two-way repeated measures analysis of variance (ANOVA) with a Tukey post-hoc test where appropriate. Data was analyzed by using GraphPad Prism 9 software. For all analyses, a p-value was considered significant as * p < 0.05, ** p < 0.01, and *** p T (ID rs115535867) p.Glu2272* was generated by homologous directed repair through a CRISPR/Cas9 approach in the exon 38 (Fig. 1 A). The Col6a5 em1 (E2302*) carrier mice line displayed the mutation as shown by both PCR analysis and Sanger sequencing (Fig. 1 B-D). Mutant heterozygous mice were inter-crossed to obtain wt, heterozygous and homozygous littermates. The Col6a5 transcript expression level was evaluated in DRGs isolated from individuals with different genotypes through RT-ddPCR, and the results are shown in Fig. 1 E. Col6a5 transcripts from the wt allele were detected in control littermate mice of both sexes. In homozygous mice, only the mutant transcripts were found expressed. In heterozygous mice, both wt and mutant alleles were expressed at comparable levels in both sexes. On the other hand, in skin, mRNA expression was decreased significantly in mutants as compared to controls (Fig. 1 F). This observation was similar to that for patients with chronic neuropathic itch harboring the p.Glu2272* mutation: COL6A5 expression was reduced in the papillary dermis and around the dermal vessels compared to controls (Martinelli-Boneschi et al. 2017 ). Nevertheless, it is important to indicate that there was no significant sex difference in the reduction of Col6a5 expression in the skin. Col6a5 transcript expression levels were similarly decreased in both sexes. Yet, the expression of Col6a5/Tbp in the skin was noticeably lower in wt females vs males, with a value of 0.014 compared to 0.05 in wt males, implying that Col6a5/Tbp expression in wt females is approximately 3.57 times lower than in wt males. This baseline difference in Col6a5 expression between wt males and females may result in a more pronounced impact of the mutation in females. Increased skin permeability in COL6A5-p.Glu2272* mutant mice To assess the impact of the mutation on the skin barrier, we investigated skin permeability in wt and mutant animals using the Evans blue dye assay. We observed that both heterozygous and homozygous females showed a significant increase in skin permeability compared to wt females (Fig. 2 ). However, no difference was found between mutant and wt male mice. Control wt females had lower skin permeability compared to wt males. Altogether, these results indicate a sexually dimorphic effect of the p.Glu2272* mutation on skin permeability in mice. COL6A5 -p.Glu2272* mice displayed spontaneous scratching behavior The patients with the COL6A5- p.Glu2272* mutation complained of spontaneous chronic itch appearing at ages ranging from 5 to 40 years (Martinelli-Boneschi et al. 2017 ). To investigate spontaneous itch in mutant mice, we scored their scratching behavior (time of scratching and number of bouts during 30 min) at different ages, starting from 6 weeks until 32 weeks (Fig. 3 ). Because scratching behavior was previously shown to be contagious and imitative in mice (Yu et al. 2017 ), we defined two different types of controls: a first set made of B6N unrelated wt aged-match controls (B6-Unr), that were kept in separate cages to prevent any physical or visual contact with the mice of the mutant line; and a second set of controls were the wt littermates (B6-Lit) of the mutant mice bred in the same cage with mutant carriers. The comparison of the B6-Unr and B6-Lit showed that B6-Unr female mice had an effect of age and an interaction between age and genotype but no genotype effect (two-way RM ANOVA, P = 0.01 and P = 0.006, respectively). Interestingly, B6-Lit males had increased scratching in littermates as compared to unrelated B6 (two-way RM ANOVA P = 0.032 for genotype). On sex-grouped animals, we observed a comparable scratching behavior in B6-Unr and B6-Lit (two-way RM ANOVA P = 0.015 for age). Altogether, we could not detect a strong effect between the two groups of control by analyzing at each time point. We tested whether the Col6a5 em1 (E2302*) mutant mice showed altered scratching at 6, 12, 18, 26, and 32 weeks. For this, we observed the time spent scratching of the four groups, i.e. the 2 controls as well as heterozygotes and homozygotes. Because we observed some variation of scratching over the weeks, we also calculated the Area Under the Curve (AUC) for further statistical analysis. An increase in the time spent scratching over the weeks was unraveled when comparing heterozygote or homozygote females with both wt control groups (One-way ANOVA with Tukey's multiple comparisons test; (F(3, 46) = 12.27; P < 0.0001; Fig. 3 left panels). No difference was observed between Het and Hom mutant females. An effect on scratching time was also detected in Het males (F(3,40) = 17.68; P < 0.0001), with increased time of scratching, and the increase was slightly lower in male homozygotes compared to heterozygotes. When considering the two sexes together, the increase of scratching in mutants versus the two wt controls was more significant (F(3,90) = 23.36; P < 0.0001), that may be due to the increased number of individuals as compared to single-sex analysis. Further, we compared the number of bouts per 30 min with a similar analysis and calculation of the AUC (Fig. 3 , right panel). Briefly, the number of bouts was increased in heterozygotes and homozygote mutant females as compared to the 2 wt controls (F (3,46) = 14.36; P < 0.0001). The genotype effect was also observed in the males (F(3,41) = 15.57; P < 0.0001) and when both sexes were analyzed together (sex-grouped, (F(3,91) = 25.37; P < 0.0001). Overall, despite the lack of patients described with homozygous mutation, homozygous mice showed similar scratching behavior as heterozygous mice. These results obtained on the Col6a5 em1 (E2302*) mouse model confirmed the dominant effect of the mutation. A relation of causality can now be drawn with one copy of the COL6A5- p.Glu2272* mutation being enough to produce the scratching phenotype. COL6A5 -p.Glu2272* mice showed increased grooming behavior Induction of chronic itch in mice also led to increased grooming behavior (Wang et al. 2018 ). Therefore, we decided to investigate the spontaneous self-grooming behavior without administering any external inducer. Grooming behavior was recorded for 30min through video recording (Fig. 4 ). Increased grooming was detected in homozygous females (One-way ANOVA; F(3, 46) = 3.773; P = 0.0167) and males (One-way ANOVA; F(3, 41) = 3,300; P = 0.0297). Combining the two sexes showed more significant differences (One-way ANOVA; F(3, 91) = 4.820; P = 0.004). Overall, the data demonstrate that the p.Glu2272* mutation leads to augmented grooming. Increased anxiety and despair-like behaviors in COL6A5 -p.Glu2272* mice Chronic itch is clinically correlated with mood disorders such as anxiety and depression (Wang et al. 2018 ; Long et al. 2022 ). Such itch-associated mood disorders have already been studied to characterize the affective consequences of chronic itch in mice (Zhao et al. 2018 ). Therefore, we also investigated these disorders in the mutant mice and performed anxiety and despair-like behavioral tests. We tested the mutant mice in the elevated plus maze (EPM) to assess anxiety-like behavior. We evaluated three different parameters of the EPM, 1) % of open arms entries, 2) % of the time in open arms, and 3) the number of attempts (Fig. 5 ). We observed that male mutant mice showed no difference in all three parameters. On the other hand, female homozygous mice showed significant anxiety-like behaviors by reduced entries into open arms and less time spent in open arms than their wild-type counterparts. We also tested the mutant mice for their behavior in the open field test measured to assess the basic status of mice. There was no difference between mutant and wt mice for any of the parameters studied which were the time spent in the center, rearing number, and total distance traveled (Figure S3). Overall, these results indicate that the p.Glu2272* mutation induced more anxiety in females as measured in the EPM. In chronic pruritus, the “itch-scratch-itch” cycles may lead to a depressive state which was also studied in mice previously (Wang et al. 2018 ). To investigate the despair-like behavior in < p.Glu2272* mutant mice, we tested them in the tail suspension test (Figure S4). No difference was found between genotypes (One-way ANOVA). COL6A5 -p.Glu2272* mice show no deficit in social preference but male mutant displayed altered social discrimination We have also investigated the social behavior of mutant mice by using the three-chamber test. In the first experiment, it was found that mice of all three genotypes, wt, heterozygous and homozygous mice, had a higher sniffing time toward a stranger mouse (S1) than in the empty compartment (E) (Figure S5). This showed that mutant animals had a social preference behavior comparable to their wt counterparts. In the second part of the test, the preference for social novelty was measured by placing another novel stranger mouse (S2) in the empty compartment and comparing the interactions of the test mouse with the familiar stranger (S1) mouse and a novel stranger (S2) mouse. We observed that wt male mice showed more sniffing time towards the novel stranger mouse. In contrast, mutant males did not show any preference for a novel stranger (Fig. 6 ), suggesting that the mutant males have a deficit in social discrimination. For females, none of the genotypes preferred the novel stranger (S2) vs the familiar stranger (S1), precluding any conclusion. Overall, the results from the two phases of the three-chamber test indicate no alteration of social exploration in the mutant males and females and a deficit in social discrimination in the mutant males. Discussion We successfully generated the Col6a5 E2302* mutant mouse model corresponding to the human COL6A5- p.Glu2272* mutation using the CRISPR/Cas9 technology. We used this genetic model we confirmed the genotype-phenotype association of this mutation with chronic itching in mice. We explored molecular aspects of this mutation and its consequences on other behaviors. We found that the wt and mutant Col6a5 transcripts were expressed at similar levels in DRGs. However, mutant transcripts were expressed at lower levels in the skin, in accordance with the decreased level of COL6A5 expression found in patients’ fibroblasts of the affected families in the clinical study (Martinelli-Boneschi et al. 2017 ). We also found enhanced skin permeability in mutant female mice. Further, we observed spontaneous itch in adult p.Glu2272* mutant mice, providing evidence of long-lasting itch with consequences on emotional behaviors. Mutant female mice showed enhanced skin permeability compared to their wt littermates, which could be due to several factors. For instance, a study in Human reported that in skin dermis higher concentration of collagen in the skin was correlated with the thickness of the skin. Another study reported the differences in skin structure in male and female mice (Azzi et al. 2005 ). These observations were also confirmed in other studies (Calabro et al. 2011 ; Arai et al. 2017 ). Interestingly, this article (Arai et al. 2017 ) demonstrated that the expression of Col1a1, Col1a2 , and Col3a1 was higher in the skin of male mice than in female mice, while Col5a1 and Col4a1 were expressed similarly in both sexes. Our results show a similar expression of wt Col6a5 transcripts in male and female skin. We can hypothesize that being expressed close to the skin barrier, a change in COL6A5 structure may affect the permeability of the skin. This is an interesting hypothesis to follow, considering the association of COL6A5 polymorphisms with atopic dermatitis (Szalus et al. 2023 ) and an additional hypothesis based on COL6A5 + dermis fibroblasts contributing to skin inflammation (Li et al. 2023 ). The clinical study by Martinelli-Boneschi and colleagues showed that all individuals in the two families with the p.Glu2272* mutation showed chronic itch at various ages. Family 1 had three patients, including one female and two males, and family 2 had two female patients. In all five patients, the onset age for the appearance of spontaneous chronic itch was different but shared similar characteristics. In family 1, two males and one female patients reported onset age for chronic itch as 30, 33, and 40 years respectively. In family 2, the two patients reported age onsets for itch 5 and 8 years (Martinelli-Boneschi et al. 2017 ). Considering these early and adult ages for the onset of itch, in this study, we observed the scratching behavior of mutant mice over an extended period from early age to late age (6 weeks to 32 weeks). When the analysis started, at six weeks of age, the mice were still considered at a young age. Though many of the physiological systems were mature, the immune and nervous systems continued to be settled within the next 2 weeks. Indeed, before 8 and 11 weeks of age, the mouse systems were under ongoing maturation, marking by the end of rapid changes in mass and cell number in the mouse central nervous system and getting the various brain structures to reach their adult-like states during this age (Fu et al. 2013 ). Therefore, in this study, mice scratching behavior was observed not at a specific age but for an extended period. In our study, we have monitored for extended and continuous period as compared to other chronic itch model studies where often the tests are only done for a few weeks. For example, Ueda and colleagues produced a chronic itch mice model and observed scratching behavior till 8 weeks (Ueda et al. 2006 ). To gain a deeper understanding of spontaneous chronic itch, we argue that it is crucial to conduct analysis over an extended period of time. For instance, another study was performed for spontaneous chronic itch till 14 to 20 weeks of age (Zhao et al. 2013 ). For this reason, our study's approach of conducting a more prolonged and continuous assessment of genetically induced spontaneous chronic itch is more valuable in this context, enabling a more comprehensive exploration of chronic itch. Recently, mood impairment was reported for the first time in male mice with chronic itch induced by a repetitive treatment with acetone and diethyl ether followed by water which models dry skin, the AEW model (Zhao et al. 2018 ). Also, anxiety-like behaviors were detected in mice with histamine or serotonin-induced acute itch (Sanders et al. 2019 ). When analyzed for mood alterations, only the female Col6a5 E2302* homozygotes showed anxiety in the elevated plus maze but no despair-like phenotypes, while males were not affected. Interestingly, both Col6a5 E2302* heterozygous and homozygous male mutants showed a deficit in social preference in the three-chamber test. This defect in discrimination may be due to attention deficit as a result of increased itch. Further exploration of the emotional and social behaviors of Col6a5 E2302* mutant mice is needed to decipher whether these altered behaviors are a direct or indirect effect of increased itch or a secondary effect of the Col6a5 mutation itself. This is the first study to report a mouse model of chronic itch developed from a mutation in a collagen gene identified in chronic neuropathic itch patients. Previously, another mutation, the L811P mutation in the SCN11A gene, has been identified in patients with chronic itch and shown to cause chronic itch in the Scn11a L811P mouse model (Salvatierra et al. 2018 ; Ebbinghaus et al. 2020 ). Our mouse model provided useful insight for investigating the pathophysiology of human mutation COL6A5- p.Glu2272* as well as chronic neuropathic itch. Further, this study provided evidence that chronic neuropathic itch can be associated with other behavioral phenotypes, affecting anxiety and sociability. Together, these findings may open novel avenues for the study of chronic neuropathic itch and its underlying mechanisms and help identify new therapeutic targets for treating chronic itch. Declarations Acknowledgments We thank Romain Lorentz and Valérie Erbs in the ICS genetic engineering team, Sylvie Jacquot and all members of the ICS genotyping team, and all ICS teams for their help in creating the mutant mouse model. We also thank Loïc Lindner and Pauline Cayrou for their help in ddPCR design and training. We thank the animal caretakers Sophie Brignon, Charley Pinault, and Dalila Ali-Hadji at PHENOMIN-ICS and IGBMC animal facility for their services. We thank the team of Marie-Christine Birling's laboratory at ICS for generating this mouse model. Elodie EY at ICS for her kind help for mice live tracking. Funding The Molecule-to-Man Pain Network has funded this work, a European Commission Multi-Center Collaborative Project, through the European Union’s Horizon 2020 research and innovation program under the Marie Skłodowska-Curie grant agreement No. 721841-Pain-Net. This work has been supported by the National Centre for Scientific Research (CNRS), the French National Institute of health and medical research (INSERM), and the University of Strasbourg (Unistra). The French state funds through the “Agence Nationale de la Recherche” under the frame of Programme Investissements d’Avenir labelled ANR-10-IDEX-0002-02, ANR-10-LABX-0030-INRT, ANR-10-INBS-07 PHENOMIN. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. References Arai KY, Hara T, Nagatsuka T, et al (2017) Postnatal changes and sexual dimorphism in collagen expression in mouse skin. PLoS ONE 12:1–21. https://doi.org/10.1371/journal.pone.0177534 Arbogast T, Ouagazzal A-M, Chevalier C, et al (2016) Reciprocal Effects on Neurocognitive and Metabolic Phenotypes in Mouse Models of 16p11.2 Deletion and Duplication Syndromes. PLoS Genet 12:e1005709. https://doi.org/10.1371/journal.pgen.1005709 Azzi L, El-Alfy M, Martel C, Labrie F (2005) Gender differences in mouse skin morphology and specific effects of sex steroids and dehydroepiandrosterone. Journal of Investigative Dermatology 124:22–27. https://doi.org/10.1111/j.0022-202X.2004.23545.x Calabro K, Curtis A, Galarneau J-R, et al (2011) Gender variations in the optical properties of skin in murine animal models. Journal of Biomedical Optics 16:011008. https://doi.org/10.1117/1.3525565 Dubos A, Meziane H, Iacono G, et al (2018) A new mouse model of ARX dup24 recapitulates the patients’ behavioral and fine motor alterations. Human Molecular Genetics 27:2138–2153. https://doi.org/10.1093/hmg/ddy122 Duchon A, Pothion S, Brault V, et al (2011) The telomeric part of the human chromosome 21 from Cstb to Prmt2 is not necessary for the locomotor and short-term memory deficits observed in the Tc1 mouse model of Down syndrome. Behavioural Brain Research 217:271–281. https://doi.org/10.1016/j.bbr.2010.10.023 Ebbinghaus M, Tuchscherr L, von Banchet GS, et al (2020) Gain-of-function mutation in SCN11A causes itch and affects neurogenic inflammation and muscle function in Scn11a+/L799P mice. PLoS ONE 15:1–17. https://doi.org/10.1371/journal.pone.0237101 Fitzgerald J, Rich C, Zhou FH, Hansen U (2008) Three novel collagen VI chains, α4(VI), α5(VI), and α6(VI). Journal of Biological Chemistry 283:20170–20180. https://doi.org/10.1074/jbc.M710139200 Fu Y, Rusznák Z, Herculano-Houzel S, et al (2013) Cellular composition characterizing postnatal development and maturation of the mouse brain and spinal cord. Brain Structure and Function 218:1337–1354. https://doi.org/10.1007/s00429-012-0462-x Li Z, Cao T, Li Q, et al (2023) Cross-disease characterization of fibroblast heterogeneities and their pathogenic roles in skin inflammation. Clinical Immunology 255:109742. https://doi.org/10.1016/j.clim.2023.109742 Liu T, Han Q, Chen G, et al (2016) Alloknesis , and Spinal Astrocyte Activation in Male Mice. 157:806–817 Long Q, Jin H, You X, et al (2022) Eczema is a shared risk factor for anxiety and depression: A meta-analysis and systematic review. PLoS ONE 17:. https://doi.org/10.1371/journal.pone.0263334 Martinelli-Boneschi F, Colombi M, Castori M, et al (2017) COL6A5 variants in familial neuropathic chronic itch. Brain 140:555–567. https://doi.org/10.1093/brain/aww343 Meixiong J, Dong X, Weng HJ (2020) Neuropathic Itch. Cells 9:5–7. https://doi.org/10.3390/cells9102263 Misery L, Brenaut E, Le Garrec R, et al (2014) Neuropathic pruritus. Nature Reviews Neurology 10:408–416. https://doi.org/10.1038/nrneurol.2014.99 Pereira MP, Wiegmann H, Agelopoulos K, Ständer S (2021) Neuropathic Itch: Routes to Clinical Diagnosis. Frontiers in Medicine 8:. https://doi.org/10.3389/fmed.2021.641746 Philippeos C, Telerman SB, Oulès B, et al (2018) Spatial and Single-Cell Transcriptional Profiling Identifies Functionally Distinct Human Dermal Fibroblast Subpopulations. Journal of Investigative Dermatology 138:811–825. https://doi.org/10.1016/j.jid.2018.01.016 Sabatelli P, Gara SK, Grumati P, et al (2011) Expression of the collagen VI α5 and α6 Chains in normal human skin and in skin of patients with collagen VI-related myopathies. Journal of Investigative Dermatology 131:99–107. https://doi.org/10.1038/jid.2010.284 Salvatierra J, Dong X, Bosmans F (2018) A disease mutation reveals a role for Na V 1.9 in acute itch The Journal of Clinical Investigation. J Clin Invest 128:5434–5447 Sanders KM, Sakai K, Henry TD, et al (2019) A subpopulation of amygdala neurons mediates the affective component of itch. Journal of Neuroscience 39:3345–3356. https://doi.org/10.1523/JNEUROSCI.2759-18.2019 Shimada SG, LaMotte RH (2008) Behavioral differentiation between itch and pain in mouse. Pain 139:681–687. https://doi.org/10.1016/j.pain.2008.08.002 Söderhäll C, Marenholz I, Kerscher T, et al (2007) Variants in a novel epidermal collagen gene (COL29A1) are associated with atopic dermatitis. PLoS Biology 5:1952–1961. https://doi.org/10.1371/journal.pbio.0050242 Stumpf A, Ständer S (2013) Neuropathic itch: diagnosis and management Sun YG, Chen ZF (2007) A gastrin-releasing peptide receptor mediates the itch sensation in the spinal cord. Nature 448:700–703. https://doi.org/10.1038/nature06029 Szalus K, Zysk W, Gleń J, et al (2023) The Associations of Single Nucleotide Polymorphisms of the COL3A1, COL6A5, and COL8A1 Genes with Atopic Dermatitis. Journal of Personalized Medicine 13:. https://doi.org/10.3390/jpm13040661 Ueda Y, Inoue T, Rahman MA, et al (2006) A new chronic itch model accompanied by skin lesions in hairless mice. International Immunopharmacology 6:1609–1615. https://doi.org/10.1016/j.intimp.2006.06.002 Wang XD, Yang G, Bai Y, et al (2018) The behavioral study on the interactive aggravation between pruritus and depression. Brain and Behavior 8:1–9. https://doi.org/10.1002/brb3.964 Weisshaar E, Szepietowski JC, Dalgard FJ, et al (2019) European S2k Guideline on Chronic Pruritus. Acta dermato-venereologica 99:469–506. https://doi.org/10.2340/00015555-3164 Yosipovitch G, Rosen JD, Hashimoto T (2018) Itch: From mechanism to (novel) therapeutic approaches. Journal of Allergy and Clinical Immunology 142:1375–1390. https://doi.org/10.1016/j.jaci.2018.09.005 Yu YQ, Barry DM, Hao Y, et al (2017) Molecular and neural basis of contagious itch behavior in mice. Science 355:1072–1076. https://doi.org/10.1126/science.aak9748 Zhang Y, Hwang BJ, Liu Z, et al (2018) BP180 dysfunction triggers spontaneous skin inflammation in mice. Proceedings of the National Academy of Sciences of the United States of America 115:6434–6439. https://doi.org/10.1073/pnas.1721805115 Zhao X, Yu C, Ye F, et al (2018) Chronic itch impairs mood and HPA axis function in mice: Modulation by CRFR1 antagonist. Pain 159:2201–2213. https://doi.org/10.1097/j.pain.0000000000001319 Zhao ZQ, Huo FQ, Jeffry J, et al (2013) Chronic itch development in sensory neurons requires BRAF signaling pathways. Journal of Clinical Investigation 123:4769–4780. https://doi.org/10.1172/JCI70528 Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials.docx Cite Share Download PDF Status: Published Journal Publication published 25 Mar, 2024 Read the published version in Mammalian Genome → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3551110","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":245787923,"identity":"656559a0-770f-4434-b8ef-a44a8a51c3c2","order_by":0,"name":"Ameer Abu Bakr Rasheed","email":"","orcid":"","institution":"Université de Strasbourg, CNRS, INSERM Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)","correspondingAuthor":false,"prefix":"","firstName":"Ameer","middleName":"Abu Bakr","lastName":"Rasheed","suffix":""},{"id":245787924,"identity":"15c05db8-1176-4af0-9201-e3cfbaf652f1","order_by":1,"name":"Marie-Christine Birling","email":"","orcid":"","institution":"Université de Strasbourg, CNRS, INSERM Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)","correspondingAuthor":false,"prefix":"","firstName":"Marie-Christine","middleName":"","lastName":"Birling","suffix":""},{"id":245787925,"identity":"0bd92314-c8eb-4564-ab3f-0b8ec0ea4723","order_by":2,"name":"Giuseppe Lauria","email":"","orcid":"","institution":"IRCCS Foundation \"Carlo Besta\" Neurological Institute","correspondingAuthor":false,"prefix":"","firstName":"Giuseppe","middleName":"","lastName":"Lauria","suffix":""},{"id":245787926,"identity":"cae95e31-2411-4ad2-b0b8-02ee20486d53","order_by":3,"name":"Claire Gaveriaux-Ruff","email":"","orcid":"","institution":"Université de Strasbourg, CNRS, INSERM Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)","correspondingAuthor":false,"prefix":"","firstName":"Claire","middleName":"","lastName":"Gaveriaux-Ruff","suffix":""},{"id":245787927,"identity":"ba2e22c4-3cbc-42b7-9353-cb1b1e5fa2b3","order_by":4,"name":"Yann Herault","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAt0lEQVRIiWNgGAWjYBACAzBZwCDHxsADYskRq8XAwBiqxZh4LYkNRGsxZ+99+JnH4E96H//aoxt+MBjkE9Ri2XPcWJrHwCC3TeJd2s0eBgPLBoIOu5HGANVyxuw2A8MfA4K2GNx/xvwbqCWdDaLFgAgtN9jYQLYksPH3EKvlTBqb5RwDY8M2CT6gXwyI0XL8GPONNxVy8vL9Z4/d+FFBhBYEkEhggEUTsYD/AEnKR8EoGAWjYAQBAMBSM9YOszvhAAAAAElFTkSuQmCC","orcid":"","institution":"Université de Strasbourg, CNRS, INSERM Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)","correspondingAuthor":true,"prefix":"","firstName":"Yann","middleName":"","lastName":"Herault","suffix":""}],"badges":[],"createdAt":"2023-11-03 11:29:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3551110/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3551110/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00335-024-10032-9","type":"published","date":"2024-03-25T20:31:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":46153829,"identity":"06e30b8e-98cb-4c4a-87ec-a4a26f461732","added_by":"auto","created_at":"2023-11-09 12:00:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":320051,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration and validation of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCOL6A5\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-p.Glu2272* mouse model. \u003c/strong\u003eA) Organization of the murine \u003cem\u003eCol6a5\u003c/em\u003e gene. The numbers indicate the position of exons. The target exon (exon 38) is shown in red color. B) A donor single stranded oligonucleotide (ssODN) was designed. This donor bares the expected mutation (G\u0026gt;T, corresponding to the rs11537567 human variant) as well as 2 silent mutations (A\u0026gt;G and A\u0026gt;C). These 3 mutations also create 3 mismatches so that no new DSBs (double-stranded breaks) could occur after. Using CRISPOR online software, high specificity-score sgRNAs (gR52) were selected with low predicted off-target sequences. C) The DNA sequence containing point mutation (PM) was digested by HaeIII enzyme “c (cut)” into further 236 bps and 190 bps PM allele along with 426 bps wt allele. In comparison, the non-digested “u(un-cut)” PCR outcome only gave wt allele of 426 bps. D) Through Sanger sequencing, PM mutation was confirmed and is shown with the stop codon (*). The wild-type (+) and mutant allele (mut) mRNA expression in DRG (E) or skin (F) isolated from \u003cem\u003eCol6a5 \u003c/em\u003elittermates (from 5 to 10 individuals per group) with the three genotypes: wt, heterozygous (het), and homozygous (hom) mice. \u003cem\u003eCol6a5\u003c/em\u003e mRNA expression was normalized to \u003cem\u003eTbp \u003c/em\u003eexpression as a control. In the DRG, Homozygous mutant mice expressed \u003cem\u003eCol6a5\u003c/em\u003e mutant transcripts at levels comparable to “+” transcripts in wt mice, and heterozygous mice expressed comparable levels of each allele. F)\u003cstrong\u003e \u003c/strong\u003eThe wt and mutant allele (Mut) mRNA expression in the skin of wt littermate, heterozygous (Het), and homozygous (Homo) mice for \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003eem1\u003c/sup\u003e(E2302*). Mutant mice have significantly decreased \u003cem\u003eCol6a5\u003c/em\u003e mRNA expression in the skin. Males, n=9-10/group; females, n=9-10/group. Student’s t-test.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/250a33d8736654cbf1153e97.png"},{"id":46153828,"identity":"8c648b5e-2317-41e9-971f-064d9724821e","added_by":"auto","created_at":"2023-11-09 12:00:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":365266,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased skin permeability in COL6A5-p.Glu2272* mice.\u003c/strong\u003e The permeabilization assay done on skin, on heterozygous (Hetero) and homozygous (Homo) skin mice showed significant differences in female mutants compared to wt littermates (wt) (n=11-14 /group; unpaired t test,*P \u0026lt; 0.05). No genotype difference was found in males (n=7-10 /group). Wt females had lower skin permeability compared to wt males (unpaired t test,P=0.002).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/08ce9d8c31cf80ea1b869321.png"},{"id":46153824,"identity":"087e4aeb-825f-4c8e-89cd-b868ee70cc9f","added_by":"auto","created_at":"2023-11-09 12:00:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":155475,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eCOL6A5\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-p.Glu2272* mice\u003c/strong\u003e \u003cstrong\u003emice showed increased spontaneous scratching behavior.\u003c/strong\u003e Scratching times (s) (A) and number of bouts (B) were scored at 6, 12, 18, 26 and 32 weeks of age on individuals, from both sexes of unrelated B6N wt (B6-Unr) mice and of the different littermates, either wt (B6-Lit), heterozygous (Het) or homozygous littermate (Hom) genotypes, derived from \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003eem1\u003c/sup\u003e(E2302*) heterozygous crosses. Overall, the mutant mice, either het or hom, showed significantly increased scratching, as evaluated by calculating the Area Under the Curve (AUC) for the scratching times (left) or the number of bouts (right) and determined by One-way ANOVA with Tukey's multiple comparisons test. (Male, n=9-13 /group; Female, n=11-14 /group). Data presented as mean +/- sem. P-value as indicated with * P \u0026lt; 0.05, ** P \u0026lt; 0.01, and *** P\u0026lt; 0.001 and **** P\u0026lt;0.00001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/650662b4f0e320f4e079fc42.png"},{"id":46153800,"identity":"3e8a3e76-4dc3-4ba6-b37e-8d518b955c9a","added_by":"auto","created_at":"2023-11-09 11:59:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":84336,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased grooming behavior in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCOL6A5\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-p.Glu2272*\u003c/strong\u003e \u003cstrong\u003ehomozygote mice\u003c/strong\u003e. Spontaneous self-grooming behavior was evaluated in\u003cstrong\u003e \u003c/strong\u003eB6N unrelated wt (B6-Unr), wt littermate (B6-Lit), heterozygote (het) and homozygote mutant mice over 6 weeks to 32 weeks of age by session of 30min (left panel). The Area Under the Curve (AUC) of grooming along the period showed that homozygotes displayed a significant increase, compared to het littermate in females and B6-Unr in males. When comparing males and females together the significance was observed between homozygotes and all the other genotypes. Male, n=9-13 /group; Female, n=11-13 /group. A p-value was considered as significant as *p \u0026lt; 0.05 and **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/4c286dcffb6d741b68214130.png"},{"id":46153799,"identity":"1c575cca-3206-412b-923c-2c04c39b59c9","added_by":"auto","created_at":"2023-11-09 11:59:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":141420,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIncreased anxiety-like behavior in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eCOL6A5\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-p.Glu2272*\u003c/strong\u003e \u003cstrong\u003ehomozygous females.\u003c/strong\u003e Mutant and wt littermates control mice were assessed in the elevated plus maze test through three different parameters. \u003cstrong\u003eA)\u003c/strong\u003e % of open arms entries, \u003cstrong\u003eB\u003c/strong\u003e) % of the time in open arms, and \u003cstrong\u003eC) \u003c/strong\u003ethe\u003cstrong\u003e \u003c/strong\u003enumber of attempts. It was observed that female homozygous mice showed significant anxiety-like behavior by reduced entries into the open arm and spent less time in open arms as compared to wt mice. Overall results showed that homozygous mice have an anxiety-like behavior phenotype compared to wild-type mice. Male, n=9-10 /group; Female, n=9-14 /group. wt littermate (wt), heterozygous (Hetero), and homozygous (Homo) mice were compared. A p-value was considered as significant as *p \u0026lt; 0.05 and **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/f6eb824ba33ec6d29c818d1a.png"},{"id":46153826,"identity":"87d1058d-29f3-4c09-9e8c-37880da1c6c3","added_by":"auto","created_at":"2023-11-09 12:00:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":233229,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eCOL6A5\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-p.Glu2272*\u003c/strong\u003e \u003cstrong\u003emale mice showed a deficit in social discrimination. \u003c/strong\u003eIn the three-chamber test, the preference for social novelty was measured by placing a new stranger mouse in the empty compartment and comparing the interactions of the test mice with the familiar stranger 1 (S1) mouse and the novel stranger 2 (S2) mouse. Male wt littermates (wt) mice showed more sniffing time towards the novel stranger S2, while mutant males did not. All of the female mice groups were impaired for discriminating social novelty. Heterozygous (Het) and homozygous (Hom) mice. Males, n=7-10 /group; females, n=12-16 /group. A p-value was considered as significant as **p \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/51c0afdf5ea14c19b430f7b3.png"},{"id":57229230,"identity":"4028c4e0-8bd6-4256-a961-95b45734f77b","added_by":"auto","created_at":"2024-05-27 20:31:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1802279,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/86c6cb40-9ea2-4e2e-806a-d108b3262148.pdf"},{"id":46153825,"identity":"85599619-1997-4c44-b5b4-b607894c866d","added_by":"auto","created_at":"2023-11-09 12:00:00","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1519962,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-3551110/v1/d69f9f159f13f1320cfc718f.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"The COL6A5-p.Glu2272* mutation induces chronic itch in mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eItch (pruritus) is a common, irritating, unpleasant sensation that elicits the desire or reflex to scratch (Weisshaar et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Clinically, the itch can be characterized as acute or chronic when it lasts more than 6 weeks (Yosipovitch et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). A European study revealed that the prevalence of acute itch in the general population is 8%, while it is 13% for chronic itch. Moreover, chronic itch with lifetime prevalence is 22% in the general population, indicating that more than 1 in 5 people experience chronic itch once in their life (Weisshaar et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Moreover, the chronic itch greatly impacts the quality of life. Chronic itch is considered neuropathic when neuronal damage is responsible for the symptom (Stumpf and St\u0026auml;nder \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Damages at any site of the somatosensory system, including peripheral nerve fibers and ganglia, and the central nervous system, including the spinal cord, brainstem, thalamus, and cortex, may lead to neuropathic itch (Misery et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Several conditions affecting the nervous system are associated with neuropathic itch. These include small fiber neuropathy (SFN), metabolic (e.g., diabetes), infections, and autoimmune and genetic diseases (Oaklander, 2011). The epidemiological studies investigating the prevalence and incidence of neuropathic itch have estimated that 8%-19% of chronic itch cases have a neuropathic origin (Meixiong et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Pereira et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn recent years new insights have been gained. In particular, rare collagen VI alpha 5 (\u003cem\u003eCOL6A5\u003c/em\u003e, previously known as \u003cem\u003eCOL29A1\u003c/em\u003e) gene variants were identified in patients suffering from neuropathic itch (Martinelli-Boneschi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). \u003cem\u003eCOL6A5\u003c/em\u003e is a member of the collagen protein superfamily. Collagens contain domains with VWA motifs that form filaments and are mainly associated with protein-ligand interactions for organizing tissue architecture and cell adhesion (S\u0026ouml;derh\u0026auml;ll et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). COL6A5 is expressed in epithelial tissues, including the lungs and gastrointestinal tract (Fitzgerald et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), with a high expression at the dermal-epidermal junction (Philippeos et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) and around the vessels of the reticular dermis (Sabatelli et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Previously, Martinelli-Boneschi and colleagues identified a heterozygous c.6814G\u0026thinsp;\u0026gt;\u0026thinsp;T transversion in the \u003cem\u003eCOL6A5\u003c/em\u003e gene of chronic neuropathic itch patients, resulting in a p.Glu2272-to-Ter (E2272X) substitution. Autosomal dominant transmission of chronic neuropathic itch was reported in 5 patients from 2 unrelated families (families 1 and 2) using whole-exome sequencing (Martinelli-Boneschi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). These patients carrying the p.Glu2272* nonsense mutation also showed reduced COL6A5 expression in the skin. However, due to the complex nature of neuropathic itch, progress in understanding the mechanisms leading to chronic itch in these patients has not been made yet.\u003c/p\u003e \u003cp\u003eIn order to investigate the consequence of this mutation, we developed a new mouse model for the \u003cem\u003eCOL6A5-\u003c/em\u003ep.Glu2272* mutation using the CRISPR-Cas9 technology. Our data provide evidence for augmented spontaneous scratching behavior and increased anxiety and despair-like behaviors in mutant mice. This report demonstrates that the \u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mutation contributes to itching, with anxio-depressive consequences.\u003c/p\u003e"},{"header":"Material and method","content":"\u003cp\u003eAnimal research\u003c/p\u003e \u003cp\u003e Animal research was performed in agreement with the EC directive 2010/63/UE86/609/CEE, in compliance with the animal welfare policies of the French Ministry of Agriculture (Art. R. 214\u0026thinsp;\u0026minus;\u0026thinsp;107 and 214\u0026thinsp;\u0026minus;\u0026thinsp;122). Animal were bred and maintained in our animal facility which is accredited by the French Ministry for Superior Education and Research and the French Ministry of Agriculture (agreement #C67-218-40) following the French Law (Decree n\u0026deg; 2013\u0026thinsp;\u0026minus;\u0026thinsp;118 01 and its supporting annexes entered into legislation on 01 February 2013) relative with the protection of animals used in scientific experimentation. All experiments were done in agreement with the local ethical committee. Studies are reported in accordance with the ARRIVE 2.0 guidelines. Mouse breeding and behavior experiments were conducted in SPF (Specific Pathogen Free) conditions in our animal facility at PHENOMIN-ICS, following the 3R principle. Mice were kept grouped in two to five animals in each cage. Mice were kept in the controlled light cycle at 12 h light and 12 h dark (light turned on at 7 AM and off at 7 PM through an automated control system). Mice were kept under a controlled temperature of 21\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C and humidity of 55\u0026thinsp;\u0026plusmn;\u0026thinsp;10% and had free access to food (standard chow) and autoclaved tap water. For all experiments, mice were transferred to the experimental facility of ICS two weeks prior to behavior tests so that they have some time for habituation to the experimental facility of ICS. Animals were transferred to the experimental room 30 min before each experimental test.\u003c/p\u003e \u003cp\u003eGenerating the \u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mice model using CRISPR/Cas9\u003c/p\u003e \u003cp\u003eThe mutant mouse line \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eem1YahICS\u003c/em\u003e\u003c/sup\u003e, also named \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eE2302*\u003c/em\u003e\u003c/sup\u003e, for the human \u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mutation, was generated in ICS using CRISPR-Cas9 technology. In the mouse, the mutant codon is located in exon 38 (Ensembl ID ENSMUSE00000891350.1; \u003cb\u003efigure S1\u003c/b\u003e). The guide RNA had to drive the double strand break generated by the Cas9 protein very close to the site of insertion of the selection mutation (leading to a STOP codon). We used the CRISPOR online software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://crispor.tefor.net/crispor.py\u003c/span\u003e\u003cspan address=\"http://crispor.tefor.net/crispor.py\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to select high specificity-score sgRNAs with a low number of predicted off-target sequences. This guide RNA, AGTCATGGCAGAGAAGAACT, had a specificity score of 52 (internal name gR52). The guide RNA was validated \u003cem\u003ein vitro\u003c/em\u003e for its ability to drive DSB (Double Strand Break) on a PCR fragment containing the targeted sequence in the presence of Cas9 protein. A donor single-stranded oligonucleotide (donor ssODN) was designed that bares the expected mutation (G\u0026thinsp;\u0026gt;\u0026thinsp;T, corresponding to the rs11537567 human variant) as well as 2 silent mutations (A\u0026thinsp;\u0026gt;\u0026thinsp;G and A\u0026thinsp;\u0026gt;\u0026thinsp;C). Its sequence was AGCCACGTCCATGTAATATTCTTGAAGAGAAGCATCCCCAGGCT-CATGAGCAAGACCCAGCTCTTATCGGCCATGACTTTCATGTTCTGCAACAGAATAACTTTAGTCACTAGTGGTGAAAGGGTTAACTTG. Together, these 2 mutations generate a new HaeIII restriction site. In addition, a third A\u0026thinsp;\u0026gt;\u0026thinsp;G mutation was introduced after the new STOP codon. These 3 mutations generated 3 mismatches in the donor DNA that allowed to avoid new double strand breaks after the occurrence of homology directed repair.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe CRISPR guide efficiency was tested \u003cem\u003ein vitro\u003c/em\u003e using a Sureguide kit (Agilent Technologies 5190\u0026ndash;7716). In the presence of the Cas9 protein, the PCR product, including the region of interest, should be cut. A guide is validated if it cuts the target PCR fragment. A mix containing the Cas9 mRNA, the guide RNA and the ssODN was microinjected in fertilized C57BL/6N oocytes, and PCR screened the newborn offspring. The microinjection of a mix of gR52 guide RNA (12 ng/\u0026micro;l), spCas9 mRNA (25 g/\u0026micro;l), and 10 ng/\u0026micro;l ssODN in the male pronuclei of 355 C57BL/6N fertilized oocytes led to 28 pups. PCR followed by HaeIII restriction digests, screened the pups. Primers F1 (AATGGAAATAATTCTGCACCAAGTG) and R1 (TAAGACAGAGGTCAGTGGAGCTGGG) were used to amplify a PCR fragment of expected size 426 bps. In the presence of the mutations of interest, 2 fragments of 245 bps and 181 bps were detected after HaeIII restriction digest. All undigested PCR products from pups showing HaeIII digests were subsequently sequenced by Sanger sequence. The insertion of the new STOP codon was confirmed by Sanger sequencing. Eleven F0 pups (\u0026gt;\u0026thinsp;39%) had the expected mutations. Five F0 animals were bred with wild type (wt) C57BL/6N mice to generate F1 founders. F1 mice were analyzed for germline transmission by Sanger Sequencing to establish the \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eem1\u0026thinsp;\u0026minus;\u0026thinsp;E2302*\u003c/em\u003e\u003c/sup\u003e mouse line. All founders gave heterozygous pups. Two lines were fully established and cryopreserved, and one was further studied, as shown in the present paper.\u003c/p\u003e \u003cp\u003eDetermination of genotype\u003c/p\u003e \u003cp\u003eCrude genomic DNA was extracted from mouse tail samples through Direct PCR Lysis Reagent-Tail (Viagen Biotech, Cat # 101-T) according to the manufacturer\u0026rsquo;s instructions. Subsequently, the Phusion Hot Start II High-Fidelity DNA polymerase kit (Thermo Scientific) was used with primers specific for the wt (+) and mutant (\u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eE2302*\u003c/em\u003e\u003c/sup\u003e) alleles. Moreover, PCR reaction containing the following: 500 ng genomic DNA extracted from a wt or mutant mouse, 4 \u0026micro;l 5\u0026times;Phusion HF Buffer, 0.4 \u0026micro;l dNTP mix (dATP, dCTP, dGTP, dTTP at 10 mM, Thermo Scientific), 0.2 \u0026micro;l each primer at 0.5 \u0026micro;M and H2O in a total volume of 20 \u0026micro;l. Using a T100 thermocycler (Bio-Rad), PCR was performed with the following thermal condition: 96\u0026deg;C for 5min followed by 30 cycles of 96\u0026deg;C for 8s, 62\u0026deg;C for 10s and 68\u0026deg;C for 45s, and then annealing temperature as 68\u0026deg;C for 5min with final elongation step for 5min at 72\u0026deg;C. Next, 10 \u0026micro;l of PCR outcome was used to digest with enzyme HaeIII 0.2 \u0026micro;l, 10X Buffer of volume 2 \u0026micro;l, and remaining H2O to make a total volume of 20 \u0026micro;l for each reaction and kept at 37\u0026deg;C incubator for 15min. 2% agarose gel was run for both digested and non-digested PCR outcomes and differentiated between wt and mutant mice. Our point mutation (PM) containing sequence of DNA was digested by HaeIII restriction enzyme into further 236 bps and 190 bps \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eE2302*\u003c/em\u003e\u003c/sup\u003eallele along with 426 bps wt allele. In contrast, the non-digested\u0026thinsp;=\u0026thinsp;uncut PCR outcome gave only a wt allele of 426 bps. Mice genomic DNA showing only one band of the wt allele (+) of 426 bps in digested PCR outcomes were identified as wild-type littermate mice (wt lit). When both the wt allele band of 426 bps and the 236 bps \u0026amp; 190 bps PM alleles (mut) in digested PCR outcome, mice were heterozygous. Similarly, when mice genomic DNA showed no wt allele of 426 bps and only two bands of 236 bps and 190 bps of PM allele in digested PCR outcome they were genotyped as homozygous mice. Primer sequence information is shown in \u003cb\u003eTable S1\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eAnalysis of transcript expression level by Droplet digital PCR (ddPCR)\u003c/p\u003e \u003cp\u003eWe determined \u003cem\u003eCol6a5\u003c/em\u003e mRNA expression using Real-Time droplet digital PCR (RT-ddPCR) on 42-week aged mice that underwent the previous behavioral characterization. Eight control (wt), 5 heterozygotes (hets) and 6 homozygotes (homs) males, plus 10 wt, 7 hets and 6 homs females were used. Dorsal root ganglions (DRGs) were collected from wt and mutant mice and frozen in liquid nitrogen. Later, samples were lysed in TRIzol Reagent through magnetic beads containing Precellys\u0026reg;CK14 tubes. Total RNA was collected and purified using RNeasy Mini Kit (Qiagen) according to the protocol of the manufacturer company. Afterward, cDNA was synthesized by using the cDNA synthesis Kit \u0026ldquo;SuperScript\u0026trade;VILO\u0026trade;cDA Synthesis Kit\u0026rdquo; (Invitrogen). Then, ddPCR was performed for mRNA amplification in the volume of 20\u0026micro;L reactions for each sample. According to the manufacturer's recommendation, 250 nM specific primers, 125 nM of each probe, 1\u0026times; ddPCR Supermix for Probes, and 50 ng DNA were used. PCR machine was run with the thermal condition as following: 10 min at 95\u0026deg;C, 40 cycles of 20s at 95\u0026deg;C, 30s at 59.2\u0026deg;C, 2min at 72\u0026deg;C, and 10min at 98\u0026deg;C. Droplet Digital PCR System (Bio-Rad) was used for droplet generation and quantification. Data were further analyzed using QuantaSoft Software (Bio-Rad). The sequences of primers and probes are shown in \u003cb\u003eTable S2.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eEvans Blue dye penetration assay for skin permeability\u003c/p\u003e \u003cp\u003eTo examine the skin barrier integrity of mice, the Evans blue dye assay was performed on 42-week aged mice that underwent the previous behavioral characterization. This assay allows to detect skin barrier impairment as described previously (Zhang et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Ten wt, 9 hets and 10 homs males, with 14 wt, 12 hets and 11 homs females were used. Just after euthanasia with cervical dislocation, the back of each individual was shaved, and Evans blue dye (Sigma, Ref# E2129) was applied as 1% in PBS and 50 \u0026micro;l/mouse. After two hours, the skin was collected and homogenized in formamide (Sigma, Ref#7503-). Subsequently, Evans blue dye extracted from skin samples was quantified by recording each sample by optical density (OD) at 620nm with a microplate reader.\u003c/p\u003e \u003cp\u003eFunctional exploration and assessment\u003c/p\u003e \u003cp\u003eThe behavioral characterization was performed on two experimental cohorts of males and females, ages 6 to 32 weeks. We used 13 B6N wt from the commercial breeders, 10 wt littermates, 12 hets and 10 homs males to evaluate scratching and grooming behaviors. For the female, 13 B6N wt, 14 wt littermates, 12 hets and 11 homs females were used. The same cohorts or parts of these cohorts were used for recording anxiety- and despair-like behaviors and social behavior. The experimenter was blind to the mouse genotype.\u003c/p\u003e \u003cp\u003eScratching and grooming behaviors\u003c/p\u003e \u003cp\u003eScratching and grooming behaviors were recorded during different sessions at 6, 12, 18, 26 and 32 weeks of age. To assess behaviors, mice were given 2 weeks in the experimental facility for adaption before assessment. For each session, mice were transferred 30 min prior to the beginning of the observations in the experimental room. Further, one day before the scratching observation, mice were placed for 30 min in transparent plastic experimental boxes for habituation. On the day of the experiment, mice were given 10 min in transparent plastic boxes for habituation before the evaluation began. Behind the transparent plastic boxes, a mirror was also positioned to assess mice behavior from the front and back view, as mentioned previously (Shimada and LaMotte \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Subsequently, mice behavior was video-recorded in the plastic box for 30 min as previously reported (Sun and Chen \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Shimada and LaMotte \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). While analyzing the videos, different parameters were scored, including scratching time (i.e. the time of lifting of the hind paw to the region of the body that is scratched (back and face) and returning to the cage floor) \u003cb\u003e(Figure S2)\u003c/b\u003e. While grooming behavior was analyzed for whipping mice with forelimbs and licking their body and tail (Shimada and LaMotte \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). All scratching and grooming tests were performed between 8:00 AM and 2:00 PM.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eExploration and anxiety-like behaviors\u003c/p\u003e \u003cp\u003eAnxiety-related behavior was evaluated at 36 weeks of age on the same animals as those used for scoring scratching and grooming behaviors through an elevated plus maze experiment as previously described (Dubos et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). For locomotor and exploration activity, we also performed an open field test (Dubos et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In an open-field experiment, a square apparatus (Panlab Harvard apparatus IR ACTIMETER, Bioseb, Vitrolles, France) containing all required sensors was used, and a polypropylene sheet covered the arena. Light for the open-field experiment was measured and kept at 150 lux in the center of the arena. Mice were placed at the periphery of the open field apparatus and were allowed to explore the arena freely for 30 min. The experiment was performed in a closed room without any experimenter disturbance. The automated system measured the total distance, number of rearings, and time spent in center and peripheral regions with video tracking and infrared sensors. Mice activity was recorded with a video tracking system (Ethovision, Noldus, France) during this session of 30 min.\u003c/p\u003e \u003cp\u003eFurther, anxiety-like behavior was assessed with the elevated plus maze. The elevated plus maze apparatus was placed at a height of 50 cm above the floor. It was made of PVC and completely automated (Imetronic, Pessac, France). It has two enclosed arms with dimensions (30 X 5 X 15 cm) and two open arms with dimensions (30 X 5 cm). The apparatus has infrared sensors to detect different parameters for anxiety, such as the number of entries in open arms, time spent in the open or closed arms, and the number of attempts made by mice etc. Mice were placed on a central platform and their exploration of the maze was recorded for 5 min.\u003c/p\u003e \u003cp\u003eDespair-like behavior\u003c/p\u003e \u003cp\u003eDespair-like behavior was evaluated at the age of 38 weeks on the same animals as those used for scoring scratching, grooming, and anxiety-like behaviors through the tail suspension test as described previously (Dubos et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In this experiment, mice were suspended with the help of tape and hanged for 6min, and immobility time was monitored using video recording. An increased immobility time is indicative of a despair-like phenotype.\u003c/p\u003e \u003cp\u003eSocial behavior\u003c/p\u003e \u003cp\u003eSocial behavior was determined at the age of 38-weeks on the same cohorts and before scoring of despair-like behavior. The Stoelting system (Dublin, Ireland) was composed of three successive identical chambers (20 cm \u0026times; 40 cm \u0026times; 22 cm) with (5 cm \u0026times; 8 cm) openings to allow access between the chambers. The protocol used was similar to the previously described (Duchon et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Arbogast et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). We used adult C57BL/6N mice as stranger mice (unfamiliar mice). The age and sex of stranger mice and the mice tested for their social behavior were the same. Stranger mice were kept separately to avoid any olfactory or visual contact with test mice. Before the day of the experiment, stranger mice were habituated in wire cages for 10min for 3\u0026ndash;5 days until they felt comfortable staying in wire cages. The experiment was divided into three phases. In the first phase, test mice were placed in the middle chamber and allowed to habituate for 10min. In the second phase (social exploration), the test mouse was enclosed in the central box, an unfamiliar mouse (stranger 1 or S1) was placed randomly in one of the wire cages, and on another side, an empty wire cage was placed. The doors were re-opened, and the test mouse was allowed to explore the entire social test box for 10 min. Time spent in each chamber, the number of entries into each chamber and the time spent sniffing each wire cage were recorded. In the third phase (social discrimination), a new, unfamiliar mouse (stranger 2 or S2) was placed by replacing the empty wire cage, and the test mouse was allowed to explore for 10 more min. During this time, the test mouse could explore or sniff the already-investigated mouse (S1) and the novel unfamiliar mouse (S2). The entire social test box was washed with tap water and dried with absorbent paper between each test to remove odors.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe results are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM) for each experimental group. Student's t-test (two-tailed) was used to compare the two groups' differences. In addition, multiple groups were compared using one-way or two-way repeated measures analysis of variance (ANOVA) with a Tukey post-hoc test where appropriate. Data was analyzed by using GraphPad Prism 9 software. For all analyses, a p-value was considered significant as *\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eGeneration of the COL6A5-p.Glu2272* mice model\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mouse model for the human mutation c.6814G\u0026thinsp;\u0026gt;\u0026thinsp;T (ID rs115535867) p.Glu2272* was generated by homologous directed repair through a CRISPR/Cas9 approach in the exon 38 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). The \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003eem1\u003c/sup\u003e (E2302*) carrier mice line displayed the mutation as shown by both PCR analysis and Sanger sequencing (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB-D). Mutant heterozygous mice were inter-crossed to obtain wt, heterozygous and homozygous littermates. The \u003cem\u003eCol6a5\u003c/em\u003e transcript expression level was evaluated in DRGs isolated from individuals with different genotypes through RT-ddPCR, and the results are shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eE. \u003cem\u003eCol6a5\u003c/em\u003e transcripts from the wt allele were detected in control littermate mice of both sexes. In homozygous mice, only the mutant transcripts were found expressed. In heterozygous mice, both wt and mutant\u0026nbsp;alleles were expressed at comparable levels in both sexes. On the other hand, in skin, mRNA expression was decreased significantly in mutants as compared to controls (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eF). This observation was similar to that for patients with chronic neuropathic itch harboring the p.Glu2272* mutation: COL6A5 expression was reduced in the papillary dermis and around the dermal vessels compared to controls (Martinelli-Boneschi et al. \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e). Nevertheless, it is important to indicate that there was no significant sex difference in the reduction of \u003cem\u003eCol6a5\u003c/em\u003e expression in the skin. \u003cem\u003eCol6a5\u003c/em\u003e transcript expression levels were similarly decreased in both sexes. Yet, the expression of \u003cem\u003eCol6a5/Tbp\u003c/em\u003e in the skin was noticeably lower in wt females vs males, with a value of 0.014 compared to 0.05 in wt males, implying that \u003cem\u003eCol6a5/Tbp\u003c/em\u003e expression in wt females is approximately 3.57 times lower than in wt males. This baseline difference in \u003cem\u003eCol6a5\u003c/em\u003e expression between wt males and females may result in a more pronounced impact of the mutation in females.\u003c/p\u003e\n\u003cp\u003eIncreased skin permeability in COL6A5-p.Glu2272* mutant mice\u003c/p\u003e\n\u003cp\u003eTo assess the impact of the mutation on the skin barrier, we investigated skin permeability in wt and mutant animals using the Evans blue dye assay. We observed that both heterozygous and homozygous females showed a significant increase in skin permeability compared to wt females (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). However, no difference was found between mutant and wt male mice. Control wt females had lower skin permeability compared to wt males. Altogether, these results indicate a sexually dimorphic effect of the p.Glu2272* mutation on skin permeability in mice.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mice displayed spontaneous scratching behavior\u003c/p\u003e\n\u003cp\u003eThe patients with the \u003cem\u003eCOL6A5-\u003c/em\u003ep.Glu2272* mutation complained of spontaneous chronic itch appearing at ages ranging from 5 to 40 years (Martinelli-Boneschi et al. \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e). To investigate spontaneous itch in mutant mice, we scored their scratching behavior (time of scratching and number of bouts during 30 min) at different ages, starting from 6 weeks until 32 weeks (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Because scratching behavior was previously shown to be contagious and imitative in mice (Yu et al. \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e), we defined two different types of controls: a first set made of B6N unrelated wt aged-match controls (B6-Unr), that were kept in separate cages to prevent any physical or visual contact with the mice of the mutant line; and a second set of controls were the wt littermates (B6-Lit) of the mutant mice bred in the same cage with mutant carriers. The comparison of the B6-Unr and B6-Lit showed that B6-Unr female mice had an effect of age and an interaction between age and genotype but no genotype effect (two-way RM ANOVA, P\u0026thinsp;=\u0026thinsp;0.01 and P\u0026thinsp;=\u0026thinsp;0.006, respectively). Interestingly, B6-Lit males had increased scratching in littermates as compared to unrelated B6 (two-way RM ANOVA P\u0026thinsp;=\u0026thinsp;0.032 for genotype). On sex-grouped animals, we observed a comparable scratching behavior in B6-Unr and B6-Lit (two-way RM ANOVA P\u0026thinsp;=\u0026thinsp;0.015 for age). Altogether, we could not detect a strong effect between the two groups of control by analyzing at each time point.\u003c/p\u003e\n\u003cp\u003eWe tested whether the \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003eem1\u003c/sup\u003e(E2302*) mutant mice showed altered scratching at 6, 12, 18, 26, and 32 weeks. For this, we observed the time spent scratching of the four groups, i.e. the 2 controls as well as heterozygotes and homozygotes. Because we observed some variation of scratching over the weeks, we also calculated the Area Under the Curve (AUC) for further statistical analysis. An increase in the time spent scratching over the weeks was unraveled when comparing heterozygote or homozygote females with both wt control groups\u0026nbsp;(One-way ANOVA with Tukey's multiple comparisons test; (F(3, 46)\u0026thinsp;=\u0026thinsp;12.27; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e left panels). No difference was observed between Het and Hom mutant females. An effect on scratching time was also detected in Het males (F(3,40)\u0026thinsp;=\u0026thinsp;17.68; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), with increased time of scratching, and the increase was slightly lower in male homozygotes compared to heterozygotes. When considering the two sexes together, the increase of scratching in mutants versus the two wt controls was more significant (F(3,90)\u0026thinsp;=\u0026thinsp;23.36; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), that may be due to the increased number of individuals as compared to single-sex analysis.\u003c/p\u003e\n\u003cp\u003eFurther, we compared the number of bouts per 30 min with a similar analysis and calculation of the AUC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, right panel). Briefly, the number of bouts was increased in heterozygotes and homozygote mutant females as compared to the 2 wt controls (F (3,46)\u0026thinsp;=\u0026thinsp;14.36; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). The genotype effect was also observed in the males (F(3,41)\u0026thinsp;=\u0026thinsp;15.57; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and when both sexes were analyzed together (sex-grouped, (F(3,91)\u0026thinsp;=\u0026thinsp;25.37; P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). Overall, despite the lack of patients described with homozygous mutation, homozygous mice showed similar scratching behavior as heterozygous mice. These results obtained on the \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003eem1\u003c/sup\u003e(E2302*) mouse model confirmed the dominant effect of the mutation. A relation of causality can now be drawn with one copy of the \u003cem\u003eCOL6A5-\u003c/em\u003ep.Glu2272* mutation being enough to produce the scratching phenotype.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mice showed increased grooming behavior\u003c/p\u003e\n\u003cp\u003eInduction of chronic itch in mice also led to increased grooming behavior (Wang et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). Therefore, we decided to investigate the spontaneous self-grooming behavior without administering any external inducer. Grooming behavior was recorded for 30min through video\u0026nbsp;recording (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). Increased grooming was detected in homozygous females (One-way ANOVA; F(3, 46)\u0026thinsp;=\u0026thinsp;3.773; P\u0026thinsp;=\u0026thinsp;0.0167) and males (One-way ANOVA; F(3, 41)\u0026thinsp;=\u0026thinsp;3,300; P\u0026thinsp;=\u0026thinsp;0.0297). Combining the two sexes showed more significant differences (One-way ANOVA; F(3, 91)\u0026thinsp;=\u0026thinsp;4.820; P\u0026thinsp;=\u0026thinsp;0.004). Overall, the data demonstrate that the p.Glu2272* mutation leads to augmented grooming.\u003c/p\u003e\n\u003cp\u003eIncreased anxiety and despair-like behaviors in \u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mice\u003c/p\u003e\n\u003cp\u003eChronic itch is clinically correlated with mood disorders such as anxiety and depression (Wang et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e; Long et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Such itch-associated mood disorders have already been studied to characterize the affective consequences of chronic itch in mice (Zhao et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). Therefore, we also investigated these disorders in the mutant mice and performed anxiety and despair-like behavioral tests. We tested the mutant mice in the elevated plus maze (EPM) to assess anxiety-like behavior. We evaluated three different parameters of the EPM, 1) % of open arms entries, 2) % of the time in open arms, and 3) the number of attempts (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). We observed that male mutant mice showed no difference in all three parameters. On the other hand, female homozygous mice showed significant anxiety-like behaviors by reduced entries into open arms and less time spent in open arms than their wild-type counterparts.\u003c/p\u003e\n\u003cp\u003eWe also tested the mutant mice for their behavior in the open field test measured to assess the basic status of mice. There was no difference between mutant and wt mice for any of the parameters studied which were the time spent in the center, rearing number, and total distance traveled (Figure S3). Overall, these results indicate that the p.Glu2272* mutation induced more anxiety in females as measured in the EPM.\u003c/p\u003e\n\u003cp\u003eIn chronic pruritus, the \u0026ldquo;itch-scratch-itch\u0026rdquo; cycles may lead to a depressive state which was also studied in mice previously (Wang et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). To investigate the despair-like behavior in \u0026lt;\u0026thinsp;p.Glu2272* mutant mice, we tested them in the tail suspension test (Figure S4). No difference was found between genotypes (One-way ANOVA).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mice show no deficit in social preference but male mutant displayed altered social discrimination\u003c/p\u003e\n\u003cp\u003eWe have also investigated the social behavior of mutant mice by using the three-chamber test. In the first experiment, it was found that mice of all three genotypes, wt, heterozygous and homozygous mice, had a higher sniffing time toward a stranger mouse (S1) than in the empty compartment (E) (Figure S5). This showed that mutant animals had a social preference behavior comparable to their wt counterparts. In the second part of the test, the preference for social novelty was measured by placing another novel stranger mouse (S2) in the empty compartment and comparing the interactions of the test mouse with the familiar stranger (S1) mouse and a novel stranger (S2) mouse. We observed that wt male mice showed more sniffing time towards the novel stranger mouse. In contrast, mutant males did not show any preference for a novel stranger (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e), suggesting that the mutant males have a deficit in social discrimination. For females, none of the genotypes preferred the novel stranger (S2) vs the familiar stranger (S1), precluding any conclusion. Overall, the results from the two phases of the three-chamber test indicate no alteration of social exploration in the mutant males and females and a deficit in social discrimination in the mutant males.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eWe successfully generated the \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eE2302*\u003c/em\u003e\u003c/sup\u003e mutant mouse model corresponding to the human \u003cem\u003eCOL6A5-\u003c/em\u003ep.Glu2272* mutation using the CRISPR/Cas9 technology. We used this genetic model we confirmed the genotype-phenotype association of this mutation with chronic itching in mice. We explored molecular aspects of this mutation and its consequences on other behaviors. We found that the wt and mutant \u003cem\u003eCol6a5\u003c/em\u003e transcripts were expressed at similar levels in DRGs. However, mutant transcripts were expressed at lower levels in the skin, in accordance with the decreased level of COL6A5 expression found in patients\u0026rsquo; fibroblasts of the affected families in the clinical study (Martinelli-Boneschi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). We also found enhanced skin permeability in mutant female mice. Further, we observed spontaneous itch in adult p.Glu2272* mutant mice, providing evidence of long-lasting itch with consequences on emotional behaviors.\u003c/p\u003e \u003cp\u003eMutant female mice showed enhanced skin permeability compared to their wt littermates, which could be due to several factors. For instance, a study in Human reported that in skin dermis higher concentration of collagen in the skin was correlated with the thickness of the skin. Another study reported the differences in skin structure in male and female mice (Azzi et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). These observations were also confirmed in other studies (Calabro et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Arai et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Interestingly, this article (Arai et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) demonstrated that the expression of \u003cem\u003eCol1a1, Col1a2\u003c/em\u003e, and \u003cem\u003eCol3a1\u003c/em\u003e was higher in the skin of male mice than in female mice, while \u003cem\u003eCol5a1\u003c/em\u003e and \u003cem\u003eCol4a1\u003c/em\u003e were expressed similarly in both sexes. Our results show a similar expression of wt \u003cem\u003eCol6a5\u003c/em\u003e transcripts in male and female skin. We can hypothesize that being expressed close to the skin barrier, a change in COL6A5 structure may affect the permeability of the skin. This is an interesting hypothesis to follow, considering the association of COL6A5 polymorphisms with atopic dermatitis (Szalus et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and an additional hypothesis based on COL6A5\u0026thinsp;+\u0026thinsp;dermis fibroblasts contributing to skin inflammation (Li et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe clinical study by Martinelli-Boneschi and colleagues showed that all individuals in the two families with the p.Glu2272* mutation showed chronic itch at various ages. Family 1 had three patients, including one female and two males, and family 2 had two female patients. In all five patients, the onset age for the appearance of spontaneous chronic itch was different but shared similar characteristics. In family 1, two males and one female patients reported onset age for chronic itch as 30, 33, and 40 years respectively. In family 2, the two patients reported age onsets for itch 5 and 8 years (Martinelli-Boneschi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Considering these early and adult ages for the onset of itch, in this study, we observed the scratching behavior of mutant mice over an extended period from early age to late age (6 weeks to 32 weeks). When the analysis started, at six weeks of age, the mice were still considered at a young age. Though many of the physiological systems were mature, the immune and nervous systems continued to be settled within the next 2 weeks. Indeed, before 8 and 11 weeks of age, the mouse systems were under ongoing maturation, marking by the end of rapid changes in mass and cell number in the mouse central nervous system and getting the various brain structures to reach their adult-like states during this age (Fu et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Therefore, in this study, mice scratching behavior was observed not at a specific age but for an extended period. In our study, we have monitored for extended and continuous period as compared to other chronic itch model studies where often the tests are only done for a few weeks. For example, Ueda and colleagues produced a chronic itch mice model and observed scratching behavior till 8 weeks (Ueda et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). To gain a deeper understanding of spontaneous chronic itch, we argue that it is crucial to conduct analysis over an extended period of time. For instance, another study was performed for spontaneous chronic itch till 14 to 20 weeks of age (Zhao et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). For this reason, our study's approach of conducting a more prolonged and continuous assessment of genetically induced spontaneous chronic itch is more valuable in this context, enabling a more comprehensive exploration of chronic itch.\u003c/p\u003e \u003cp\u003eRecently, mood impairment was reported for the first time in male mice with chronic itch induced by a repetitive treatment with acetone and diethyl ether followed by water which models dry skin, the AEW model (Zhao et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Also, anxiety-like behaviors were detected in mice with histamine or serotonin-induced acute itch (Sanders et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). When analyzed for mood alterations, only the female \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eE2302*\u003c/em\u003e\u003c/sup\u003e homozygotes showed anxiety in the elevated plus maze but no despair-like phenotypes, while males were not affected. Interestingly, both \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eE2302*\u003c/em\u003e\u003c/sup\u003e heterozygous and homozygous male mutants showed a deficit in social preference in the three-chamber test. This defect in discrimination may be due to attention deficit as a result of increased itch. Further exploration of the emotional and social behaviors of \u003cem\u003eCol6a5\u003c/em\u003e\u003csup\u003e\u003cem\u003eE2302*\u003c/em\u003e\u003c/sup\u003e mutant mice is needed to decipher whether these altered behaviors are a direct or indirect effect of increased itch or a secondary effect of the \u003cem\u003eCol6a5\u003c/em\u003e mutation itself.\u003c/p\u003e \u003cp\u003eThis is the first study to report a mouse model of chronic itch developed from a mutation in a collagen gene identified in chronic neuropathic itch patients. Previously, another mutation, the L811P mutation in the \u003cem\u003eSCN11A\u003c/em\u003e gene, has been identified in patients with chronic itch and shown to cause chronic itch in the \u003cem\u003eScn11a\u003c/em\u003e\u003csup\u003e\u003cem\u003eL811P\u003c/em\u003e\u003c/sup\u003e mouse model (Salvatierra et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Ebbinghaus et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Our mouse model provided useful insight for investigating the pathophysiology of human mutation \u003cem\u003eCOL6A5-\u003c/em\u003ep.Glu2272* as well as chronic neuropathic itch. Further, this study provided evidence that chronic neuropathic itch can be associated with other behavioral phenotypes, affecting anxiety and sociability. Together, these findings may open novel avenues for the study of chronic neuropathic itch and its underlying mechanisms and help identify new therapeutic targets for treating chronic itch.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAcknowledgments\u003c/h2\u003e\n\u003cp\u003eWe thank Romain Lorentz and Val\u0026eacute;rie Erbs in the ICS genetic engineering team, Sylvie Jacquot and all members of the ICS genotyping team, and all ICS teams for their help in creating the mutant mouse model. We also thank Lo\u0026iuml;c Lindner and Pauline Cayrou for their help in ddPCR design and training. We thank the animal caretakers Sophie Brignon, Charley Pinault, and Dalila Ali-Hadji at PHENOMIN-ICS and IGBMC animal facility for their services. We thank the team of Marie-Christine Birling\u0026apos;s laboratory at ICS for generating this mouse model. Elodie EY at ICS for her kind help for mice live tracking.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThe Molecule-to-Man Pain Network has funded this work, a European Commission Multi-Center Collaborative Project, through the European Union\u0026rsquo;s Horizon 2020 research and innovation program under the Marie Skłodowska-Curie grant agreement No. 721841-Pain-Net. This work has been supported by the National Centre for Scientific Research (CNRS), the French National Institute of health and medical research (INSERM), and the University of Strasbourg (Unistra). The French state funds through the \u0026ldquo;Agence Nationale de la Recherche\u0026rdquo; under the frame of Programme Investissements d\u0026rsquo;Avenir labelled ANR-10-IDEX-0002-02, ANR-10-LABX-0030-INRT, ANR-10-INBS-07 PHENOMIN. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eArai KY, Hara T, Nagatsuka T, et al (2017) Postnatal changes and sexual dimorphism in collagen expression in mouse skin. PLoS ONE 12:1\u0026ndash;21. https://doi.org/10.1371/journal.pone.0177534\u003c/li\u003e\n\u003cli\u003eArbogast T, Ouagazzal A-M, Chevalier C, et al (2016) Reciprocal Effects on Neurocognitive and Metabolic Phenotypes in Mouse Models of 16p11.2 Deletion and Duplication Syndromes. PLoS Genet 12:e1005709. https://doi.org/10.1371/journal.pgen.1005709\u003c/li\u003e\n\u003cli\u003eAzzi L, El-Alfy M, Martel C, Labrie F (2005) Gender differences in mouse skin morphology and specific effects of sex steroids and dehydroepiandrosterone. Journal of Investigative Dermatology 124:22\u0026ndash;27. https://doi.org/10.1111/j.0022-202X.2004.23545.x\u003c/li\u003e\n\u003cli\u003eCalabro K, Curtis A, Galarneau J-R, et al (2011) Gender variations in the optical properties of skin in murine animal models. Journal of Biomedical Optics 16:011008. https://doi.org/10.1117/1.3525565\u003c/li\u003e\n\u003cli\u003eDubos A, Meziane H, Iacono G, et al (2018) A new mouse model of ARX dup24 recapitulates the patients\u0026rsquo; behavioral and fine motor alterations. Human Molecular Genetics 27:2138\u0026ndash;2153. https://doi.org/10.1093/hmg/ddy122\u003c/li\u003e\n\u003cli\u003eDuchon A, Pothion S, Brault V, et al (2011) The telomeric part of the human chromosome 21 from Cstb to Prmt2 is not necessary for the locomotor and short-term memory deficits observed in the Tc1 mouse model of Down syndrome. Behavioural Brain Research 217:271\u0026ndash;281. https://doi.org/10.1016/j.bbr.2010.10.023\u003c/li\u003e\n\u003cli\u003eEbbinghaus M, Tuchscherr L, von Banchet GS, et al (2020) Gain-of-function mutation in SCN11A causes itch and affects neurogenic inflammation and muscle function in Scn11a+/L799P mice. PLoS ONE 15:1\u0026ndash;17. https://doi.org/10.1371/journal.pone.0237101\u003c/li\u003e\n\u003cli\u003eFitzgerald J, Rich C, Zhou FH, Hansen U (2008) Three novel collagen VI chains, \u0026alpha;4(VI), \u0026alpha;5(VI), and \u0026alpha;6(VI). Journal of Biological Chemistry 283:20170\u0026ndash;20180. https://doi.org/10.1074/jbc.M710139200\u003c/li\u003e\n\u003cli\u003eFu Y, Ruszn\u0026aacute;k Z, Herculano-Houzel S, et al (2013) Cellular composition characterizing postnatal development and maturation of the mouse brain and spinal cord. Brain Structure and Function 218:1337\u0026ndash;1354. https://doi.org/10.1007/s00429-012-0462-x\u003c/li\u003e\n\u003cli\u003eLi Z, Cao T, Li Q, et al (2023) Cross-disease characterization of fibroblast heterogeneities and their pathogenic roles in skin inflammation. Clinical Immunology 255:109742. https://doi.org/10.1016/j.clim.2023.109742\u003c/li\u003e\n\u003cli\u003eLiu T, Han Q, Chen G, et al (2016) Alloknesis , and Spinal Astrocyte Activation in Male Mice. 157:806\u0026ndash;817\u003c/li\u003e\n\u003cli\u003eLong Q, Jin H, You X, et al (2022) Eczema is a shared risk factor for anxiety and depression: A meta-analysis and systematic review. PLoS ONE 17:. https://doi.org/10.1371/journal.pone.0263334\u003c/li\u003e\n\u003cli\u003eMartinelli-Boneschi F, Colombi M, Castori M, et al (2017) COL6A5 variants in familial neuropathic chronic itch. Brain 140:555\u0026ndash;567. https://doi.org/10.1093/brain/aww343\u003c/li\u003e\n\u003cli\u003eMeixiong J, Dong X, Weng HJ (2020) Neuropathic Itch. Cells 9:5\u0026ndash;7. https://doi.org/10.3390/cells9102263\u003c/li\u003e\n\u003cli\u003eMisery L, Brenaut E, Le Garrec R, et al (2014) Neuropathic pruritus. Nature Reviews Neurology 10:408\u0026ndash;416. https://doi.org/10.1038/nrneurol.2014.99\u003c/li\u003e\n\u003cli\u003ePereira MP, Wiegmann H, Agelopoulos K, St\u0026auml;nder S (2021) Neuropathic Itch: Routes to Clinical Diagnosis. Frontiers in Medicine 8:. https://doi.org/10.3389/fmed.2021.641746\u003c/li\u003e\n\u003cli\u003ePhilippeos C, Telerman SB, Oul\u0026egrave;s B, et al (2018) Spatial and Single-Cell Transcriptional Profiling Identifies Functionally Distinct Human Dermal Fibroblast Subpopulations. Journal of Investigative Dermatology 138:811\u0026ndash;825. https://doi.org/10.1016/j.jid.2018.01.016\u003c/li\u003e\n\u003cli\u003eSabatelli P, Gara SK, Grumati P, et al (2011) Expression of the collagen VI \u0026alpha;5 and \u0026alpha;6 Chains in normal human skin and in skin of patients with collagen VI-related myopathies. Journal of Investigative Dermatology 131:99\u0026ndash;107. https://doi.org/10.1038/jid.2010.284\u003c/li\u003e\n\u003cli\u003eSalvatierra J, Dong X, Bosmans F (2018) A disease mutation reveals a role for Na V 1.9 in acute itch The Journal of Clinical Investigation. J Clin Invest 128:5434\u0026ndash;5447\u003c/li\u003e\n\u003cli\u003eSanders KM, Sakai K, Henry TD, et al (2019) A subpopulation of amygdala neurons mediates the affective component of itch. Journal of Neuroscience 39:3345\u0026ndash;3356. https://doi.org/10.1523/JNEUROSCI.2759-18.2019\u003c/li\u003e\n\u003cli\u003eShimada SG, LaMotte RH (2008) Behavioral differentiation between itch and pain in mouse. Pain 139:681\u0026ndash;687. https://doi.org/10.1016/j.pain.2008.08.002\u003c/li\u003e\n\u003cli\u003eS\u0026ouml;derh\u0026auml;ll C, Marenholz I, Kerscher T, et al (2007) Variants in a novel epidermal collagen gene (COL29A1) are associated with atopic dermatitis. PLoS Biology 5:1952\u0026ndash;1961. https://doi.org/10.1371/journal.pbio.0050242\u003c/li\u003e\n\u003cli\u003eStumpf A, St\u0026auml;nder S (2013) Neuropathic itch: diagnosis and management\u003c/li\u003e\n\u003cli\u003eSun YG, Chen ZF (2007) A gastrin-releasing peptide receptor mediates the itch sensation in the spinal cord. Nature 448:700\u0026ndash;703. https://doi.org/10.1038/nature06029\u003c/li\u003e\n\u003cli\u003eSzalus K, Zysk W, Gleń J, et al (2023) The Associations of Single Nucleotide Polymorphisms of the COL3A1, COL6A5, and COL8A1 Genes with Atopic Dermatitis. Journal of Personalized Medicine 13:. https://doi.org/10.3390/jpm13040661\u003c/li\u003e\n\u003cli\u003eUeda Y, Inoue T, Rahman MA, et al (2006) A new chronic itch model accompanied by skin lesions in hairless mice. International Immunopharmacology 6:1609\u0026ndash;1615. https://doi.org/10.1016/j.intimp.2006.06.002\u003c/li\u003e\n\u003cli\u003eWang XD, Yang G, Bai Y, et al (2018) The behavioral study on the interactive aggravation between pruritus and depression. Brain and Behavior 8:1\u0026ndash;9. https://doi.org/10.1002/brb3.964\u003c/li\u003e\n\u003cli\u003eWeisshaar E, Szepietowski JC, Dalgard FJ, et al (2019) European S2k Guideline on Chronic Pruritus. Acta dermato-venereologica 99:469\u0026ndash;506. https://doi.org/10.2340/00015555-3164\u003c/li\u003e\n\u003cli\u003eYosipovitch G, Rosen JD, Hashimoto T (2018) Itch: From mechanism to (novel) therapeutic approaches. Journal of Allergy and Clinical Immunology 142:1375\u0026ndash;1390. https://doi.org/10.1016/j.jaci.2018.09.005\u003c/li\u003e\n\u003cli\u003eYu YQ, Barry DM, Hao Y, et al (2017) Molecular and neural basis of contagious itch behavior in mice. Science 355:1072\u0026ndash;1076. https://doi.org/10.1126/science.aak9748\u003c/li\u003e\n\u003cli\u003eZhang Y, Hwang BJ, Liu Z, et al (2018) BP180 dysfunction triggers spontaneous skin inflammation in mice. Proceedings of the National Academy of Sciences of the United States of America 115:6434\u0026ndash;6439. https://doi.org/10.1073/pnas.1721805115\u003c/li\u003e\n\u003cli\u003eZhao X, Yu C, Ye F, et al (2018) Chronic itch impairs mood and HPA axis function in mice: Modulation by CRFR1 antagonist. Pain 159:2201\u0026ndash;2213. https://doi.org/10.1097/j.pain.0000000000001319\u003c/li\u003e\n\u003cli\u003eZhao ZQ, Huo FQ, Jeffry J, et al (2013) Chronic itch development in sensory neurons requires BRAF signaling pathways. Journal of Clinical Investigation 123:4769\u0026ndash;4780. https://doi.org/10.1172/JCI70528\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"COL6A5, chronic neuropathic itch, pruritus, CRISPR-Cas technology, scratching, spontaneous itch","lastPublishedDoi":"10.21203/rs.3.rs-3551110/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3551110/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePruritus is a common irritating sensation that provokes the desire to scratch. Environmental and genetic factors, altering barrier skin dysfunction, or hypersensitivity of sensory nerves, contribute to the onset of pruritus. However, the itch can become a major burden when it becomes chronic, like in neuropathic itch. The rare Collagen VI alpha 5 (\u003cem\u003eCOL6A5\u003c/em\u003e) gene variant p.Glu2272* was recently identified in two families and an independent patient with chronic neuropathic itch. These patients showed reduced COL6A5 expression in the skin and normal skin morphology. However, little progress has been made until now toward understanding the relationships between this mutation and chronic itch. Therefore, we developed the first mouse model that recapitulates \u003cem\u003eCOL6A5-\u003c/em\u003ep.Glu2272* mutation using the CRISPR-Cas technology and characterized this new mouse model. The mutant mRNA, measured by RT-ddPCR, was expressed at normal levels in dorsal root ganglia and decreased in skin. The functional exploration showed changes in the behavior of control individuals kept with mutant carriers and confirmed the effect in the mutant mice with some sex dysmorphology. Spontaneous scratching was detected in male and female mutants, with increased anxiety-like behavior in female mutants and despair-like behavior in sex-grouped mutants. These results suggest that the \u003cem\u003eCOL6A5-\u003c/em\u003ep.Glu2272* mutation found in patients contributes to chronic itch and probably induces additional behavioral changes. The \u003cem\u003eCOL6A5\u003c/em\u003e-p.Glu2272* mouse model could elucidate the pathophysiological mechanisms underlying \u003cem\u003eCOL6A5\u003c/em\u003e role in neuropathic itch and help identify potential new therapeutic targets.\u003c/p\u003e","manuscriptTitle":"The COL6A5-p.Glu2272* mutation induces chronic itch in mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-11-09 11:59:40","doi":"10.21203/rs.3.rs-3551110/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"79685a40-7935-4896-be8f-3b7172e3bd30","owner":[],"postedDate":"November 9th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-05-27T20:31:52+00:00","versionOfRecord":{"articleIdentity":"rs-3551110","link":"https://doi.org/10.1007/s00335-024-10032-9","journal":{"identity":"mammalian-genome","isVorOnly":false,"title":"Mammalian Genome"},"publishedOn":"2024-03-25 20:31:52","publishedOnDateReadable":"March 25th, 2024"},"versionCreatedAt":"2023-11-09 11:59:40","video":"","vorDoi":"10.1007/s00335-024-10032-9","vorDoiUrl":"https://doi.org/10.1007/s00335-024-10032-9","workflowStages":[]},"version":"v1","identity":"rs-3551110","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3551110","identity":"rs-3551110","version":["v1"]},"buildId":"J0_U0BvcaRcwD8yVFaRlm","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}