Synergistic Suppression of Inflammation by AZA, Rice Bran Oil, and AntimiR-466l through IL-6/NF-κβ/TLR4 Pathways in Mice Model of Ulcerative Colitis

Synergistic Suppression of Inflammation by AZA, Rice Bran Oil, and AntimiR-466l through IL-6/NF-κβ/TLR4 Pathways in Mice Model of Ulcerative Colitis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Synergistic Suppression of Inflammation by AZA, Rice Bran Oil, and AntimiR-466l through IL-6/NF-κβ/TLR4 Pathways in Mice Model of Ulcerative Colitis GIZEM ESENTURK, SÜHEYLA ESRA ÖZKOÇER, ODUL EGRITAS, ECE KONAC This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7845870/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This study aimed to evaluate the anti-inflammatory effects of azathioprine (AZA), rice bran oil (RBO), and antisense miR-466l in a dextran sulfate sodium (DSS)-induced ulcerative colitis (UC) model. The synergistic effect of AZA with RBO and the therapeutic potential of miR-466l inhibition were investigated. Forty male C57BL/6 mice were assigned to six groups: control, UC, UC + AZA, UC + RBO, UC + AZA + RBO, and UC + anti-miR-466l. Disease severity was evaluated by colon length, Disease Activity Index (DAI), and histopathological scoring. Expression levels of IL-6/IL-10/NF-κβ/TLR4 and miR-466l were analyzed using qRT-PCR. DSS exposure resulted in severe inflammation, colon shortening, and increased DAI scores, along with upregulation of IL-6/TLR4/NF-κβ, and miR-466l, and a marked reduction in IL-10. AZA and RBO treatments attenuated these effects, improving mucosal architecture and restoring cytokine balance. The combined AZA + RBO therapy exhibited the strongest anti-inflammatory response, significantly suppressing pro-inflammatory markers and enhancing IL-10 expression. Anti-miR-466l treatment improved both molecular and histological parameters, highlighting its role in inflammation regulation. The combination therapy provided superior outcomes compared to monotherapies, suggesting a synergistic modulation of immune and oxidative pathways. Overall, integrating AZA, RBO, and miR-466l inhibition may offer a promising and synergistic therapeutic strategy for ulcerative colitis management. Health sciences/Diseases Health sciences/Gastroenterology Biological sciences/Immunology Ulcerative colitis Rice bran oil Anti-miR-466l TLR4/NF-ĸβ Signaling IL-6/10 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The etiology of inflammatory bowel disease (IBD) is multifactorial, including environmental, microbiota, genetic, and immunological factors. IBD includes chronic, relapsing gastrointestinal disorders, mainly Crohn’s disease (CD) and ulcerative colitis (UC), along with rarer forms like indeterminate colitis (IC) and unclassified colitis (IBD-U), which share clinical and histopathological features but affect different regions of the gastrointestinal tract [ 1 ]. Despite clinical, endoscopic, and histological differences between UC and CD, reliable molecular biomarkers for definitive differentiation are not yet in routine use. Phenotypic overlap, especially in early stages, complicates diagnosis. Recent transcriptomic, epigenetic, and microbiome approaches may aid molecular differentiation but are not yet standardized, limiting accurate diagnosis and personalized treatment in UC. Azathioprine (AZA), a purine analog and immunosuppressant, is commonly used to maintain remission in UC by reducing immune cell infiltration [ 2 , 3 ]. It is also crucial as a steroid-sparing agent in steroid-dependent, chronically active IBD patients. In a rabbit colitis model, AZA-loaded beads showed better therapeutic outcomes, including improved clinical activity, reduced tissue edema, lower mortality, and improved colon histopathology, compared to crude AZA and controls [ 4 ]. Zhao et al. (2023) reported increased expression of neutrophil, monocyte, and macrophage-related genes in the colon tissues of UC patients, with AZA treatment significantly reducing immune cell infiltration [ 5 ]. However, about 10–20% of patients discontinued AZA due to drug-induced toxicity, leaving many questions about the optimal AZA treatment regimens [ 6 ]. Due to the severe side effects, low remission rates, and AZA intolerance in current UC treatments, identifying new natural compounds and investigating gene expression signatures are critical for developing safer and more effective therapeutic options. Rice bran oil (RBO) is an edible oil from rice’s outer layer, containing natural antioxidants like γ-oryzanol and tocopherols [ 7 ]. The anti-inflammatory effects of γ-oryzanol in RBO were seen in rat macrophages, with dietary RBO reducing inflammatory mediators [ 8 ]. γ-oryzanol significantly reduced the upregulated expression of IL-1β, IL-6, TNF-α, and COX-2 mRNA in mice with dextran sulphate sodium (DSS)-induced colitis [ 9 ]. Islam et al. (2016) also demonstrated that cycloartenyl ferulate, derived from rice bran, downregulated iNOS mRNA in RAW 264.7 murine macrophages via NF-κβ [ 10 ]. In another study, RBO treatment significantly suppressed IL-6 and TNF-α secretion while upregulating the pro-inflammatory cytokine IL-10 in RWA264.7 murine macrophage cells [ 11 ]. In a DSS-induced colitis model in Wistar rats, RBO supplementation has been shown to reduce oxidative stress, suppress inflammatory mediators, and improve colonic damage [ 12 ]. Although RBO has been shown to protect against inflammation in many diseases [ 13 – 17 ], whether RBO plays a positive role in UC remains unclear. Inflammation is tightly controlled by Toll-like receptor (TLR)-mediated innate immune responses. TLRs are divided by location: surface TLRs (e.g., TLR1, 2, 4–6, 10] detect microbial membranes, while intracellular TLRs (e.g., TLR3, 7–9, 11–13) sense bacterial or viral nucleic acids to trigger inflammation [ 18 ]. The TLR4 gene encodes a protein in the TLR family that detects lipopolysaccharides from Gram-negative bacteria, activating the innate immune system [ 19 ]. Kaempferol, an anti-inflammatory and antioxidant flavonoid, has been shown to alleviate DSS-induced UC in mice by enhancing intestinal barrier function and reducing inflammation via TLR4-NF-κβ downregulation [ 20 ]. Folate-chicory acid liposomes treat UC in mice by downregulating the TLR4/NF-κβ signaling pathway [ 21 ]. Resatorvid (TAK-242), a TLR4 inhibitor, alleviated UC by suppressing inflammation and inhibiting the TLR4/JAK2/STAT3 signaling pathway [ 22 ]. Another study reported that taurine supplementation alleviated UC in DSS-induced mice by enhancing intestinal barrier function and inhibiting TLR4/NF-κβ-mediated inflammation [ 23 ]. Oyster peptides have been shown to alleviate DSS-induced UC in mice by reducing inflammation, restoring intestinal barrier function, and inhibiting TLR4/NF-κβ signaling [ 24 ]. In another study, costunolide and dehydrocostus lactone, the two most abundant components of Aucklandiae radix, reduced UC symptoms in mice by downregulating TLR4, PIK3R1, and RELA expression, mitigating inflammation, and showing potential as UC treatments [ 25 ]. Interleukin-6 (IL-6), a versatile cytokine regulating immunity, drives chronic intestinal inflammation in UC, and is proposed as a key link between inflammation and tumor development [ 26 ]. IL-6 mRNA expression was found to be significantly increased in the brain and colon tissues of UC rats [ 27 ]. When the combined treatment of mesalazine and atorvastatin was administered to rats with UC, gene expression levels of inflammation markers such as IL-6 and TNF-α decreased, while IL-10 increased [ 28 ]. Portulacae Herba and Granati Pericarpium (PGP), a traditional Chinese herbal therapy, has been shown to reduce colitis symptoms in mice by inhibiting the IL-6/STAT3/SOCS3 pathway and enhancing intestinal barrier function [ 29 ]. In rats with UC, the combination of genistein and sulfasalazine was found to alleviate colitis by suppressing the TLR-4/NF-κβ pathway, regulating the IL-6/JAK2/STAT3/COX-2 pathways, and reducing inflammation, oxidative stress, and apoptosis [ 30 ]. A recent study found that the proinflammatory cytokines IL-6 and TNF-α were more highly expressed in treatment-resistant colitis patients than in responders [ 31 ]. Interleukin-10 (IL-10), a key anti-inflammatory cytokine in the intestinal mucosa, acts via the JAK1/STAT3 pathway, and its impaired expression contributes to autoimmune diseases like UC. IL-10 expression has been shown to be significantly reduced in intestinal biopsies of patients with UC compared to the control group [ 32 ]. Ground flaxseed and flaxseed oil reduced inflammation and disease severity in UC patients, with flaxseed oil also significantly increasing IL-10 levels [ 33 ]. A novel polyphenol-assisted delivery strategy was proposed for the effective and non-toxic delivery of IL-10 mRNA In the treatment of UC [ 34 ]. Orally administered chitosan-coated artesunate in UC mice has been shown to suppress the TLR-4/NF-κβ pathway, reduce mRNA levels of pro-inflammatory cytokines, and increase IL-10 levels [ 35 ]. Honokiol, a natural magnolia bark extract, improved colon length, weight loss, disease activity index, and histopathological scores in DSS-induced colitis and IL-10 deficient mice [ 36 ]. As potential non-invasive biomarkers, miRNAs can be used in the diagnosis, prognosis, and management of IBD [ 37 ]. A pioneering study on miRNAs in UC shows that altered miRNA expression regulates inflammation-related genes, particularly miR-192’s role in controlling MIP-2 alpha levels in colonic epithelial cells [ 38 ]. Many studies have identified dysregulated miRNA expression in UC patients, highlighting their role as key factors in disease pathogenesis and potential diagnostic biomarkers [ 39 , 40 ]. Moreover, miRNAs could serve to distinguish UC from CD, with differentially expressed miRNAs providing insights into the unique pathophysiology of each disease [ 41 ]. In this context, a study by Schaefer et al. (2015) demonstrated that the expression levels of miR-31 and miR-375 were significantly elevated in CD, while no significant changes were observed in UC [ 42 ]. Conversely, miR-146a expression was markedly increased in UC but remained unchanged in CD. Furthermore, the same study revealed that, compared to healthy controls, miR-21, miR-31, and miR-146a were significantly downregulated in UC blood samples, whereas miR-19a, miR-101, miR-142-5p, miR-223, miR-375, and miR-494 exhibited statistically significant upregulation. In the study using IL-10−/− mice, the expression levels of miR-21, miR-31, miR-142-5p, and miR-146a were shown to be significantly altered in blood samples from both CD and UC blood specimens [ 43 ]. miR-466l was identified in embryonic stem (ES) cells using high-throughput pyrosequencing [ 44 ]. There are few studies in the literature on the function of miR-466l. One of these studies has shown that miR-466l increases IL-10 expression at both the mRNA and protein levels in TLR-triggered macrophages [ 45 ]. Another study demonstrated that miR-466 mimics significantly reduced the mRNA and protein expression levels of TIRAP and MyD88, key adaptor proteins in the TLR signaling pathway essential for NF-κβ activation, in RAW264.7 mouse macrophage cells [ 46 ]. In our study, we aimed to investigate the relationship between miR-466l and its potential target pathway, TLR4- NF-κβ- IL-6/10, in a DSS-induced UC mice model, and explore the synergistic effect of RBO treatment with AZA. Material and Methods ethical approval All experimental procedures were approved by the Gazi University Local Animal Ethics Committee (Approval date and number: 19.01.2024 - G.U.E.866742) and conducted in compliance with institutional guidelines and the European Convention for the Protection of Vertebrate Animals. animals and study design 40 male C57BL/6 mice (8–12 weeks old) were obtained from the Gazi University Laboratory Animal Center. Mice were housed in a temperature-controlled environment (22 ± 2°C) with a 12-h light/dark cycle and fed ad libitum. UC was induced via administration of 2.5% dextran sulfate sodium (DSS) in drinking water for 7 days, followed by 2 days of regular water. This study was conducted and reported in accordance with the ARRIVE guidelines. drug and compound administration After the formation of the colitis model for 7 days, mice were randomly divided into 6 different groups (n=6). These groups were; unlabeled azathioprine (0.01 mL/g AZA (Aspen (Turkey)) via gavage) + RBO (via oral) treated, unlabeled RBO (Polente Natural (Turkey)) (via oral) treated and unlabeled azathioprine (0.01 mL/g AZA via gavage) treated. The doses given to the treatment groups were determined from previous studies in the literature [5, 47]. Antisense miR-466l (5’ATGTGTGTTGCGTGTATGTAT3’) and negative control (5’AAACGTGACACGTTCG GAGAA3’) mimics (A. B. T. (Turkey)) were synthesized and specially ordered. Antisense miR-466l and miR-NC-antisense were administered by intraperitoneal injection using in vivo-jetPEI® (Polyplus (France)) as transfection reagent according to the manufacturer’s protocol [48]. sample collection On day 20, mice were euthanized using a ketamine (Tekkim (Türkiye)) (45 mg/kg) and xylazine (Tekkim (Türkiye)) (5 mg/kg) combination. Colon and liver tissues were collected and either snap-frozen at –80°C. Colon length was measured post-dissection. Fecal samples were also obtained at baseline, post-induction, and post-treatment. disease activity index The Disease Activity Index (DAI) was calculated by scoring three parameters on a daily basis: body weight loss, stool consistency, and rectal bleeding. Each parameter was rated from 0 to 4, with 0 representing no symptoms and 4 representing the most severe symptoms. The individual scores for each parameter were then summed to calculate a total DAI score, with the maximum possible score being 12 [49]. histopathological examination Colons were fixed in formalin and rinsed with tap water. For tissue processing, samples were dehydrated through increasing concentrations of ethanol. Tissues were cleared with xylene and embedded in paraffin. Formalin-fixed, paraffin-embedded (FFPE) tissue blocks were sectioned at a thickness of 5 µm. Tissue sections were deparaffinised at 56 °C for two hours. After rehydration, sections were stained with haematoxylin and eosin. Six different sections per animal were evaluated and scored [50] using the LEICA DM4000 Image Analysis System (Germany). Histological scores were calculated by summing five different parameters: crypt architecture (0: normal, 1: mild, 2: moderate, 3: severe crypt distortion with loss of entire crypts), degree of inflammatory cell infiltration (0: normal, 1: mild, 2: moderate, 3: dense inflammatory infiltrate), mucosal thickening (0: base of crypt sits on the muscularis mucosae, 1: mild, 2: moderate, 3: marked muscle thickening), crypt abscess (0: absent, 1: present), goblet cell depletion (0: absent, 1: present). cultural analysis of pseudomonas aeuroginosa Feces samples collected before and after treatment were homogenized in sterile PBS and plated on eosin methylene blue agar. Samples were incubated in a CO 2 incubator at 37 °C for at least 36 hours. [51]. RNA isolation from blood and tissue samples Blood samples were stored at +4°C. Manual isolation protocol was applied for RNA isolation. Zirconia beads were used to accelerate homogenization. 300 µl of the blood sample in the EDTA tube was added to the zirconia beads taken into a microcentrifuge tube. Trizol was added to complete 1000 µl. It was homogenized for 20 seconds at 4000 rpm in the homogenizer device (This step was repeated 3 times for tissue samples). Then, 200 µl of chloroform was added to form phase separation, vortexed and incubated for 3 minutes at room temperature. After incubation, it was centrifuged at 12000 g for 15 minutes. After centrifugation, 3 separate phases were formed. The supernatant was transferred to a new tube and 500 µl of isopropanol kept at -20°C was added to precipitate the RNA and incubated at -20°C for 10 minutes. After incubation, it was centrifuged at 12000 g for 10 minutes. After centrifugation, the supernatant was discarded and 100 µl of 75% ethanol was added to the pellet. It was centrifuged again at 12000 g for 10 minutes. The supernatant was discarded and the pellet was incubated at room temperature for 5 minutes to dry. Then 50 µl of elution buffer was added. The samples obtained at the end of the isolation were stored at -20°C until they were studied. cDNA synthesis The purity and concentration of the obtained RNAs were measured by spectrophotometric method in the Nanodrop. The protocol of the cDNA synthesis kit (SOLIScript RT cDNA synthesis KIT (Germany)) was followed. The mixture was prepared by adding 1 µl oligo primer, 0.5 µl dNTP mix, 2 µl RT reaction buffer, 1 µl reverse transcriptase (200 U/µl) and 0.1 µl RNase inhibitor. The amount to be taken from the samples was determined according to the RNA concentrations measured in the Nanodrop and the total volume was completed with distilled water to be 20 µl. Synthesized by setting the Thermal Cycler at 25°C for 3 minutes, 50°C for 15 minutes and 85°C for 5 minutes. The samples were stored at -20°C until they were used. gene expression analysis (qRT-PCR) Total RNA was extracted from colon and blood samples using TRIzol reagent and standard chloroform-isopropanol extraction. RNA was reverse-transcribed using SOLIScript RT cDNA synthesis kit. Quantitative PCR was performed using SYBR Green master mix on a Qiagen Rotor-Gene Q thermocycler. The primers used are listed in Table I. Necessary steps were followed according to the manufacturer's instructions: A total of 15 µl of mixture was prepared; each sample contained 4.5 µl of water, 0.5 µl of primer pair, 10 µl of SYBR master mix (Bioline sensiFAST SYBR 2×; Bioline Reagents Ltd.). The final volume was made up to 20 µl by adding 5 µl of cDNA. Then, 40 cycles of qPCR were performed using the Qiagen rotor-gene-Q instrument (Qiagen GmbH). The thermal cycling conditions were as follows: Denaturation at 95 o C for 1 min, annealing at 58-61 o C for 30 sec and extension at 72 o C for 1 min. Experiments were conducted in triplicate. Expression levels were normalized to reference genes (ACTB and U6). Table I. Primer sequences (A. B. T. (Türkiye)) used for qRT-PCR. GENE Forward Reverse IL10 5’TGTCTAGGTCCTGAGTCCA3' 5’ GGTGAGAAGCTGAAGACCCT‑3' IL6 5’GGTCTTGGTCCTTAGCCAC3' 5’ GCCAGAGTCCTTCAGAGAGA‑3' NF- kB 5’GCTGCCAAAGAAGGACACG ACA3' 5’ GGCAGGCTATTGCTCATCAC AG‑3' TLR4 5’AGCTTCTCCAATTTTTCAGAACTTC3' 5’ TGAGAGGTGGTGTAAGCCAT GC‑3' miR466l 5’ACAGCATATAAATACATGCACA3' 5’GTCGTATCCAGTGCAGGGCGAGGTATTCGCACTGGATACGA3' B-actin 5'GAAGATCAAGATCATTGCTCCT‑3' 5'ACTCGTCATACTCCTGCTT3' U6 5'GCTTCGGCAGCACATATACTA3' 5'CGAATTTGCGTGTCATCCTTG3' statistical analysis After the determination of histological scores, statistical analysis was performed using SPSS 26.0 (IBM, USA). The Mann–Whitney U test was used to compare groups, means and standart deviation were assessed for each group and a p-value < 0.05 was considered statistically significant [52]. The mRNA gene expression levels between groups were analyzed by Pfaffl [53, 54]. Complementary comparison techniques were used to determine which groups caused significant differences. P<0.05 was accepted as a statistically significant difference. Results cultural analysis of pseudomonas aeruginosa In order to investigate the effect of Pseudomonas aeuroginosa on ulcerative colitis, stool collected before colitis was induced, after colitis was induced and finally after treatment was cultured on EMB agar. As a result, it was observed that Pseudomonas aeuroginosa bacteria did not grow on EMB agar. comparative analysis of control and dss-induced colitis groups Thirty C57Bl/6 mice were administered 2.5% DSS for 7 days (Figure 1a). After euthanasia, colon tissues were compared with those of the control groups (Figure 1b), and the colon tissues of the UC group were found to be shorter than those of the control group (**p=0.0052) (Figure 1c). DAI scores were measured during and after administration, and significantly higher DAI scores were observed in the UC group compared to the control group, and statistical significance was found (**p=0.0014) (Figure 1d). In the examination performed after staining, inflammatory cell infiltration, muscularis mucosa and crypt abscess were observed in the UC group (100µm) (Figure 1e). Histological scores of DDS induced colitis group (9± 1.87) had significantly higher scores than control group (0.5± 0.58) (**p<0.01) (Figure 1f). Expression levels of IL6, IL10, TLR4, NF-κβ, and miR-466l were evaluated relative to reference genes ACTB and U6 in UC group (Table S1 in Supplement 1) and control (Table S2 in Supplement 1). Gene expression levels obtained from blood samples of the UC group are presented in Figure 1G. A 2-fold decrease in the expression level of IL10 was observed (*p = 0.038). In contrast, IL6, miR-466l, NF-κβ, and TLR4 expression levels were significantly increased by 6-fold, 8-fold, 3-fold, and 25-fold, respectively (***p = 0.001; *p = 0.01; *p = 0.010; ** p =0.005) ( Figure 1g ). effects of azathioprine treatment on colitis parameters After 2.5% DSS was administered for 7 days, 0.01 mL/g AZA was administered to 6 C57Bl/6 mice for 8 days (Figure 2a). After euthanasia, colon tissues of the UC+AZA group were compared with those of the UC groups (Figure 2b), and the colon tissues of the UC group were found to be shorter than those of the UC+AZA group (****p<0.0001) (Figure 2c). DAI scores were measured during and after administration, and significantly higher DAI scores were observed in the UC group compared to the UC+AZA group, and statistical significance was found (**p=0.0071) (Figure 2d). In the examination performed after staining, inflammatory cell infiltration and muscularis mucosa were observed in the UC+AZA group (100µm) (Figure 2e). Histological scores of UC+AZA (3.67±0,82) was lower than UC (9± 1.87) (**p=0.008) (Figure 2f). Real-time PCR analysis revealed the Ct values of IL6, IL10, TLR4, NF-κβ, miR-466l, ACTB, and U6 genes in the UC + AZA group (Table S3 in Supplement 1). The increase in the IL10 gene was statistically insignificant. In contrast, IL6, miR-466l, NF-κβ, and TLR4 expression levels were significantly decreased by 7-fold, 3-fold, 6-fold, and 9-fold, respectively (***p = 0.001; *p = 0.014; ****p = 0.0001; ***p =0.001) (Figure 2g). effects of rice bran oil supplementation on colitis parameters, After 2.5% DSS was administered for 7 days, 0.1 ml RBO was administered to 6 C57Bl/6 mice for 8 days (Figure 3a). In C57BL/6 mice using a DSS-induced colitis model, daily oral supplementation with 0.1 mL of rice bran oil (RBO) for 7 days significantly preserved colon length (****p<0.0001) (Figure 3b/c) and resulted in a significant reduction in disease activity index (DAI) (**p=0.0018) (Figure 3d). Histological examination revealed that although inflammatory cell infiltration and thickening of the muscle layer were observed in the RBO-treated group, mucosal integrity was partially preserved, and crypt structures were more regular (100µm) (Figure 3e). Histological scores of UC+RBO (5.0±1.10) lower than UC group (p=0.058) (Figure 3f). Expression levels of IL6, IL10, TLR4, NF-κβ, and miR-466l were evaluated relative to reference genes ACTB and U6 (Table S4 in Supplement 1). It was observed that the IL10 expression level in the UC+RBO group was 2-fold higher than in the UC group (**p=0.004). IL6, NF-κβ, miR-466l and TLR4 expression levels were significantly decreased by 4-fold, 5-fold, 1.5-fold and 5-fold, respectively (*p=0.022; ****p<0.0001; p=0.334; ***p =0.001) (Figure 3g). effects of azathioprine and rice bran oil combination therapy on colitis parameters After 2.5% DSS was administered for 7 days, 0.1 ml RBO and 0.01 ml/g AZA were administered to 6 C57Bl/6 mice for 8 days (Figure 4a). The AZA+RBO-supplemented group exhibited a significantly longer colon structure compared to the non-supplemented group (p = 0.0006) (Figure 4b/c), and this group also had a significantly lower DAI score (p = 0.0001) (Figure 4d). Micrographs show mucosa samples of groups which was stained with hematoxylin and eosin. In the examination performed after staining, inflammatory cell infiltration and muscularis mucosa were observed in the AZA+RBO group (100µm) (Figure 4e). Histological scores of UC (9.0±1.87) was also higher than UC+AZA+RBO group (5.25±0.96) (*p=0.037) (Figure 4f). The Ct values of IL6, IL10, TLR4, NF-κβ, miR-466l, ACTB, and U6 genes were determined by real-time PCR in the UC+AZA+RBO group (Table S5 in Supplement 1). It was observed that the IL10 expression level in the UC+RBO group was 3-fold higher than in the UC group (**p=0.002). IL6, NF-κβ, miR-466l and TLR4 expression levels were significantly decreased by 9-fold, 12-fold, 9-fold and 26-fold, respectively (****p<0.0001) (Figure 4g). effects of Anti-miR-466l administration on colitis parameters After 2.5% DSS was administered for 7 days, 100µl (ip injection) antimiR466l were administered to 6 C57Bl/6 mice for 8 days (Figure 5a). The group inhibition with antimiR-466l showed a significantly longer colon compared to the UC group (****p<0.0001) (Figure 5b/c), and a significant improvement in DAI score compared to the control group was also observed (**p = 0.0017) (Figure 5d). In the examination performed after staining, inflammatory cell infiltration and muscularis mucosa were observed in the antimiR466l group (100µm) (Figure 5e). Histological scores of UC+antimiR466l (4.80±0.84) was also lower than UC (*p=0.015) (Figure 5f). The Ct values of IL6, IL10, TLR4, NF-κβ, miR-466l, ACTB, and U6 genes were determined by real-time PCR in the UC+AntimiR-466l group (Table S6 in Supplement 1). A 13-fold increase in the expression level of IL10 was observed (****p<0.0001). Although a 6-fold decrease was observed in the expression level of NF-ᴋβ, no statistical significance was found. In contrast, IL6, NF-ĸβ, miR-466l, and TLR4 expression levels were significantly decreased by 4-fold, 6-fold, 77-fold, and 3-fold, respectively (***p = 0.007; ****p<0.0001 ) ( Figure 5g ). The Ct values of TLR4, NF-ĸβ and ACTB genes were determined by real-time PCR in the UC, UC+AZA+RBO and UC+AntimiR-466l group colon tissue (Table S7 in Supplement 1). The most significant effects in colon tissues were observed on the NF-κβ and TLR4 signaling pathways. AZA+RBO and AntimiR466l treatments suppressed the inflammatory response in colon tissue and significantly reduced NF-κβ and TLR4 gene expression. Specifically, compared to the UC group, an approximately 500-fold reduction in both genes was observed in these treatment groups (****p<0.0001) (Figure 6). Discussion In our study, ulcerative colitis was induced in mice by administering 2.5% DSS, which resulted in a significant shortening of colon length and an increase in the DAI score. In the UC group, peripheral blood gene expression analysis showed a significant decrease in IL-10 expression, while IL-6, TLR4, NF-κβ, and miR-466l expression levels were significantly increased. Histological examinations of the DSS groups revealed crypt damage and intense inflammatory cell infiltration. It has been reported that DSS-induced colitis causes colon shortening and increased mucosal damage [55], while 3% DSS-induced colitis leads to shortened colon length, increased DAI scores, crypt destruction, aggravated inflammation, elevated IL-6 and TNF-α levels, and decreased IL-10 [56]. Similarly, in a 2% DSS-induced rat colitis model, sinomenine treatment was shown to increase colon length, reduce DAI scores, and suppress NF-κβ expression [57]. Moreover, in the DSS colitis model, activation of the TLR4/NF-κβ signaling pathway has been demonstrated, and Higenamine (HG) treatment was found to inhibit this activation [58]. These studies in the literature support our findings of increased IL-6 expression and suppressed IL-10 expression. Overall, our results are consistent with previous reports showing that DSS-induced colitis models are characterized by NF-κβ and TLR4 signaling activation, increased IL-6, and decreased IL-10 expression [56-58]. According to the data obtained in our study, the significantly higher DAI score in the UC group compared to the UC+AZA group indicates that AZA treatment alleviates colitis symptoms and reduces disease severity. Our histological findings showed that the UC+AZA group had a significantly lower histological score compared to the UC group (9 ± 1.87 vs 3.67 ± 0.82), demonstrating that AZA treatment attenuates colitis pathology. In the literature, it has been reported that increased inflammatory infiltration extending from the mucosa to the submucosa and muscularis is a hallmark of severe colitis [59]. Accordingly, while the AZA group showed reduced mucosal inflammation, the control group exhibited almost no inflammation, and histological damage was markedly greater in UC. In our study, AZA treatment significantly reduced the expression of IL-6 (7-fold), miR-466l (3-fold), NF-κβ (6-fold), and TLR4 (9-fold). The efficacy of AZA in DSS-induced colitis has also been reported in previous studies [60]. AZA treatment has been shown to restore colon length toward normal and significantly reduce DAI scores compared to untreated mice [61, 62]. Our findings are consistent with earlier studies demonstrating that AZA suppresses NF-κβ pathways, regulates cytokine production, and modulates TLR4-mediated innate immune responses [63-65]. The AZA-induced reduction in NF-κβ expression likely reflects decreased activation of inflammatory cells and attenuation of colitis severity. In a DSS-induced colitis model, administration of the RBO compound γ-oryzanol has been shown to reduce inflammation by repairing the colonic barrier and suppressing the TLR4/NF-κβ pathway [66]. Findings from our study show that RBO supplementation significantly decreased IL-6, TLR4, and NF-κβ gene expression levels, and significantly increased IL-10 levels. In mice with colitis given RBO supplementation, colon length was preserved, DAI scores were decreased, and IL-6 and NF-κβ gene expression levels were reduced [67]. These findings are consistent with the longer colon tissue, lower DAI scores, and decreased IL-6/NF-κβ expression observed in the UC+RBO group in our study. Our RBO supplementation demonstrates that it may not only suppress inflammatory pathways but also support the production of anti-inflammatory mediators. These effects of RBO are thought to be due to its gamma-oryzanol, tocopherols, and tocotrienols, which suppress the NF-κβ pathway and increase IL-10 levels, thus balancing inflammation [11, 14, 68, 69]. γ-oryzanol has been reported to reduce proinflammatory cytokines by suppressing NF-κβ activation and through antioxidant effects, thereby reducing IL-6, TNF-α, and COX-2 levels in mice with DSS-induced colitis and providing histological improvement [9]. Rice bran derivatives have been shown to modulate the gut microbiota, balance TLR4 signaling pathways, support the proliferation of beneficial bacteria, and regulate the immune system [67, 70]. Our findings suggest that RBO can provide clinical, histological, and molecular therapeutic effects on colitis, even with short-term use, and that this effect may not be independent of dose and duration. The combination of AZA and RBO suppresses inflammation in multiple ways by combining both immunosuppressive and antioxidant mechanisms [69, 71]. Our findings indicate that combination therapy more strongly reduced the expression of miR466l, NF-κβ, and TLR4, while significantly increasing IL-10 levels. The significant reduction in miR466l and NF-κβ gene expression and the increase in IL10 gene expression of the AZA+RBO combination support the synergistic anti-inflammatory effect of this treatment approach [10, 45, 72]. It has been reported that the combination of AZA and natural compounds has a synergistic effect on inflammation and increases its efficacy in the treatment of colitis [73]. The immunosuppressive effect of AZA combined with the antioxidant and anti-inflammatory effects of RBO provided a more effective modulation of inflammation [11, 13, 71]. These findings support the efficacy of the combination of AZA and RBO at the clinical and molecular levels. The regulatory role of miR466l on inflammation has been demonstrated in previous studies. MiR466l is known to modulate inflammation by affecting the expression of proinflammatory cytokines, particularly IL6 and IL10 [74, 75]. The combination of AZA and RBO created a strong synergy in suppressing inflammation by decreasing the expression of miR466l. This result suggests that combination therapy may be more effective in the molecular regulation of inflammation compared to monotherapies. Furthermore, this synergistic effect may be explained by the coordinated regulation of inflammatory pathways at both the genetic and epigenetic levels. Similarly, combinations of natural antioxidants and immunosuppressants have shown superior results in controlling inflammation [76, 77]. For example, studies using tocopherol and AZA together have reported more effective control of intestinal inflammation [78]. This supports the interaction between the components of RBO and the immunomodulatory effects of AZA. While studies integrating various immunosuppressive and antioxidant mechanisms to achieve improved efficacy in the treatment of colitis are available in the literature, our study is the first to demonstrate the therapeutic potential of the combination of AZA and RBO, highlighting a new synergistic strategy. Another novel aspect of our study is the role of microRNA-466l in colitis, observed in the UC-antimiR466l treatment group. Our findings showed that inhibiting miR-466l in colitic mice resulted in significant improvements (longer colons, lower DAI, and reduced histological damage) comparable to the UC group. In our study, when we compared the UC-antimiR-466l group with the UC group, we observed significant decreases in the expression levels of IL-6 (4-fold), TLR4 (3-fold), and miR466l (77-fold), and increased IL10 (13-fold) gene expression. The literature suggests that miR466l and similar microRNAs may be potential therapeutic targets in the treatment of inflammatory diseases [75, 79]. miR-466l appears to be a key regulator in our colitis model, and its inhibition may represent a therapeutic strategy to shift the balance toward resolution. Our findings suggest that the pro-inflammatory effect of miR-466l may be dominant in chronic colitis, and that inhibiting miR-466l provides clear anti-inflammatory benefits. In our study, blocking miR-466l led to a decrease in NF-κβ and IL-6 levels, which in turn led to an increase in IL-10, resulting in overall improvement in colitis. These findings suggest that antimiR466l offers a novel therapeutic option for modulating inflammation. The absence of a specific study in the literature on antimiR-466L in ulcerative colitis makes our study a significant contribution to pioneering innovative microRNA-targeted therapeutic approaches to colitis inflammation. In our study, a significant decrease in NF-κβ and TLR4 mRNA levels, particularly in colonic tissue, was observed with AZA+RBO and antimiR-466l administration. Our findings suggest that miR-466l may play a regulatory role in the NF-κβ/TLR4 pathway and are consistent with findings in the literature that similar miRNAs (e.g., miR-146a, miR-125b, miR-223) suppress inflammation by targeting TLR4/MyD88/NF-κβ signaling [80, 81]. The stronger changes in colonic tissue compared to those in blood reflect the direct effects of local inflammation, different miRNA profiles, cellular diversity, and microbiota interactions. In contrast, weaker profiles detected in blood may be valuable for non-invasive biomarkers [82, 83]. Our results are consistent with the literature indicating the therapeutic potential of strategies targeting the NF-κβ pathway in ulcerative colitis [84] and provide complementary information from both regulatory and diagnostic perspectives. Conclusion Our pioneering study demonstrates for the first time how suppressing miR-466l expression in UC specifically affects the role of increasing the levels of the anti-inflammatory gene IL-10 and decreasing the expression of inflammation-related genes IL-6, TLR4, and NF-κβ. Given that miR-466l is associated with inflammation and the immune system, it can be inferred that patient-based research in this area may have significant implications for the diagnosis, monitoring, and treatment of UC in the future. Furthermore, the combination of AZA treatment and RBO creates a synergistic effect by suppressing inflammation through the IL-6/TLR4–NF-κβ signaling pathways, while simultaneously boosting IL-10 levels. As a result, this combined approach not only enhances inflammation regulation but also improves tolerance to AZA's side effects. Declarations Acknowledgements: Not applicable Funding: The present study was conducted with financial support from the Gazi University Research Fund (Project ID: TDK-2024– 9312). Availability of data and materials: Data is provided within the manuscript or supplementary information files. Author Contribution: EK and GE conceived and designed the research. GE performed the research. EK interpreted the experimental data. Statistical analysis was performed by EK and GE. GE confirmed the authenticity of all the raw data. SEO performed the histological analysis. OE contributed to the design of the UC model and provided expertise on the treatment regimen. EK handled project administration, funding acquisition, and supervision. All authors approved the final manuscript. Ethics approval: The animal experiments were approved by the Gazi University Local Ethics Committee for Animal Experiments (Approval date and number: 19.01.2024 - G.U.E.866742) Patient consent for publication: Not applicable. Competing interests: The authors declare no competing interests. Authors' information: The author ORCID IDs are as follows: Dr Gizem Esenturk, 0000-0002-8041-6633; Dr. Süheyla Esra Özkoçer, 0000-0002-6413-1988; Professor Odul Egritas 0000-0003-0230-7551; and Professor Ece Konac 0000-0001-5129-2515. References Diez-Martin, E. et al. Inflammatory Bowel Disease: A Comprehensive Analysis of Molecular Bases, Predictive Biomarkers, Diagnostic Methods, and Therapeutic Options. Int. J. Mol. Sci. 25 , 7062. 10.3390/ijms25137062 (2024). Marinković, G., Hamers, A. A., de Vries, C. J. & de Waard, V. 6-Mercaptopurine reduces macrophage activation and gut epithelium proliferation through inhibition of GTPase Rac1. Inflamm. Bowel Dis. 20 , 1487–1495. 10.1097/MIB.0000000000000122 (2014). Mallick, B. & Malik, S. Use of Azathioprine in Ulcerative Colitis: A Comprehensive Review. Cureus 14, 24874. (2022). 10.7759/cureus.24874 Helmy, A. M., Elsabahy, M., Soliman, G. M., Mahmoud, M. A. & Ibrahim, E. A. Development and in vivo evaluation of chitosan beads for the colonic delivery of azathioprine for treatment of inflammatory bowel disease. Eur. J. Pharm. Sci. 109 , 269–279. 10.1016/j.ejps.2017.08.025 (2017). Zhao, D., Qin, D., Yin, L. & Yang, Q. Integrated bioinformatics analysis and experimental verification of immune cell infiltration and the related core genes in ulcerative colitis. Pharmgenomics Pers. Med. 16 , 629–643. 10.2147/PGPM.S406644 (2023). Liu, Y. P. et al. Association between thiopurine S-methyltransferase polymorphisms and thiopurine-induced adverse drug reactions in patients with inflammatory bowel disease: a meta-analysis. PLoS One . 10 , e0121745. 10.1371/journal.pone.0121745 (2015). Pestana-Bauer, V. R., Zambiazi, R. C., Mendonça, C. R., Beneito-Cambra, M. & Ramis-Ramos, G. γ-Oryzanol and tocopherol contents in residues of rice bran oil refining. Food Chem. 134 , 1479–1483. 10.1016/j.foodchem.2012.03.059 (2012). Rao, Y. P. C., Sugasini, D. & Lokesh, B. R. Dietary gamma oryzanol plays a significant role in the anti-inflammatory activity of rice bran oil by decreasing pro-inflammatory mediators secreted by peritoneal macrophages of rats. Biochem. Biophys. Res. Commun. 479 , 747–752. 10.1016/j.bbrc.2016.09.140 (2016). Islam, M. S. et al. Anti-inflammatory effects of phytosterylferulates in colitis induced by dextran sulphate sodium in mice. Br. J. Pharmacol. 154 , 812–824. 10.1038/bjp.2008.137 (2008). Islam, M. S., Ushio, H., Hori, M. & Ozaki, H. Cycloartenyl ferulate downregulates lipopolysaccharide-stimulated iNOS mRNA via NF-κβ suppression in RAW 264.7 macrophages. Asian J. Med. Biol. Res. 2 , 523–531. 10.3329/ajmbr.v2i4.30992 (2016). Lee, S. et al. Rice bran oil ameliorates inflammatory responses by enhancing mitochondrial respiration in murine macrophages. PLoS One . 14 , e0222857. 10.1371/journal.pone.0222857 (2019). Reddy, K. V., Maheswaraiah, A. & Naidu, K. A. Rice bran oil and n-3 fatty acid-rich garden cress (Lepidium sativum) seed oil attenuate murine model of ulcerative colitis. Int. J. Colorectal Dis. 29 , 267–269. 10.1007/s00384-013-1785-7 (2014). Park, H., Yu, S. & Kim, W. Rice bran oil attenuates chronic inflammation by inducing M2 macrophage switching in high-fat diet-fed obese mice. Foods 10 , 359. 10.3390/foods10020359 (2021). Kettawan, A. et al. Rice bran oil improves emphysema in cigarette smoke extract-induced mice through anti-inflammatory and antioxidative effects. Nutrients 16 , 433. 10.3390/nu16030433 (2024). Mahdavi-Roshan, M. et al. The effects of rice bran oil on left ventricular systolic function, cardiometabolic risk factors and inflammatory mediators in men with coronary artery disease: a randomized clinical trial. Food Funct. 12 , 4446–4457. 10.1039/d1fo00094b (2021). Yadav, N. V. et al. Sesame oil and rice bran oil ameliorate adjuvant-induced arthritis in rats: distinguishing the role of minor components and fatty acids. Lipids 51 , 1385–1395. 10.1007/s11745-016-4203-4 (2016). Abdel-Rahman, R. F. et al. The involvement of TGF-β1/FAK/α-SMA pathway in the antifibrotic impact of rice bran oil on thioacetamide-induced liver fibrosis in rats. PLoS One . 16 , e0260130. 10.1371/journal.pone.0260130 (2021). Kawai, T. & Akira, S. The role of pattern-recognition receptors in innate immunity: update on toll-like receptors. Nat. Immunol. 11 , 373–384. 10.1038/ni.1863 (2010). Beutler, B., Du, X. & Poltorak, A. Identification of toll-like receptor 4 (Tlr4) as the sole conduit for LPS signal transduction: genetic and evolutionary studies. J. Endotoxin Res. 7 , 277–280. 10.1177/09680519010070040901 (2001). Qu, Y. et al. Kaempferol alleviates murine experimental colitis by restoring gut microbiota and inhibiting the LPS-TLR4-NF-κβ axis. Front. Immunol. 12 , 679897. 10.3389/fimmu.2021.679897 (2021). Yang, S. et al. Effects of folate-chicory acid liposome on macrophage polarization and TLR4/NF-κβ signaling pathway in ulcerative colitis mouse. Phytomedicine 128 , 155415. 10.1016/j.phymed.2024.155415 (2024). Huang, X. et al. Resatorvid (TAK-242) ameliorates ulcerative colitis by modulating macrophage polarization and T helper cell balance via TLR4/JAK2/STAT3 signaling pathway. Inflammation 47 , 2108–2128. 10.1016/j.phymed.2024.155415 (2024). Zheng, J. et al. Taurine alleviates experimental colitis by enhancing intestinal barrier function and inhibiting inflammatory response through TLR4/NF-κB signaling. J. Agric. Food Chem. 72 , 12119–12129. 10.1021/acs.jafc.4c00662 (2024). Guo, H. et al. Oyster peptides ameliorate dextran sulfate sodium-induced ulcerative colitis via modulating the gut microbiota and inhibiting the TLR4/NF-κB pathway. Nutrients 16 , 1591. 10.3390/nu16111591 (2024). Liang, S., Chen, C., Li, R., Jiang, G. & Du, L. Costunolide and dehydrocostus lactone alleviate ulcerative colitis via regulating TLR4, NF-κB and PI3K expression. Sci. Rep. 14 , 29777 (2024). Waldner, M. J. & Neurath, M. F. Master regulator of intestinal disease: IL-6 in chronic inflammation and cancer development. Semin Immunol. 26 , 75–79. 10.1038/s41598-024-77021-5 (2014). Wang, K. et al. Expression of interleukin 6 in brain and colon of rats with TNBS-induced colitis. World J. Gastroenterol. 16 , 2252–2259. 10.3748/wjg.v16.i18.2252 (2010). El-Mahdy, N. A., El-Sayad, M. E., El-Kadem, A. H. & Abu-Risha, S. E. Targeting IL-10, ZO-1 gene expression and IL-6/STAT-3 trans-signaling by a combination of atorvastatin and mesalazine to enhance anti-inflammatory effects and attenuate progression of oxazolone-induced colitis. Fundam Clin. Pharmacol. 35 , 143–155. 10.1111/fcp.12563 (2021). Cheng, Z. et al. Traditional herbal pair Portulacae Herba and Granati Pericarpium alleviates DSS-induced colitis in mice through IL-6/STAT3/SOCS3 pathway. Phytomedicine 126 , 155283. 10.1016/j.phymed.2023.155283 (2024). Elhefnawy, E. A., Zaki, H. F., El Maraghy, N. N., Ahmed, K. A. & Abd El-Haleim, E. A. Genistein and/or sulfasalazine ameliorate acetic acid-induced ulcerative colitis in rats via modulating INF-γ/JAK1/STAT1/IRF-1, TLR-4/NF-κB/IL-6, and JAK2/STAT3/COX-2 crosstalk. Biochem. Pharmacol. 214 , 115673. 10.1016/j.bcp.2023.115673 (2023). Ahmadi, A. et al. Investigating the expression of anti/pro-inflammatory cytokines in the pathogenesis and treatment of ulcerative colitis and its association with serum level of vitamin D. Sci. Rep. 15 , 7569. 10.1038/s41598-025-87551-1 (2025). Aghamohamadi, E. et al. Gene expression analysis of intestinal IL-8, IL-17A and IL-10 in patients with celiac and inflammatory bowel diseases. Mol. Biol. Rep. 49 , 6085–6091. 10.1007/s11033-022-07397-y (2022). Morshedzadeh, N. et al. The effects of flaxseed supplementation on gene expression and inflammation in ulcerative colitis patients: an open-labelled randomised controlled trial. Int. J. Clin. Pract. 75 , e14035. 10.1111/ijcp.14035 (2021). Chen, Z. et al. A polyphenol-assisted IL-10 mRNA delivery system for ulcerative colitis. Acta Pharm. Sin B . 12 , 3367–3382. 10.1016/j.apsb.2022.03.025 (2022). Tao, Y. et al. Chitosan-coated artesunate protects against ulcerative colitis via STAT6-mediated macrophage M2 polarization and intestinal barrier protection. Int. J. Biol. Macromol. 254 , 127680. 10.1016/j.ijbiomac.2023.127680 (2024). Chen, X. et al. SIRT3 activator honokiol inhibits Th17 cell differentiation and alleviates colitis. Inflamm. Bowel Dis. 29 , 1929–1940. 10.1093/ibd/izad099 (2023). Liu, D., Saikam, V., Skrada, K. A., Merlin, D. & Iyer, S. S. Inflammatory bowel disease biomarkers. Med. Res. Rev. 42 , 1856–1887. 10.1002/med.21893 (2022). Wu, F. et al. MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha. Gastroenterology 135 , 1624–1635. 10.1053/j.gastro.2008.07.068 (2008). Fasseu, M. et al. Identification of restricted subsets of mature microRNA abnormally expressed in inactive colonic mucosa of patients with inflammatory bowel disease. PLoS One . 5 , e13160. 10.1371/journal.pone.0013160 (2010). Yang, Y. et al. Overexpression of miR-21 in patients with ulcerative colitis impairs intestinal epithelial barrier function through targeting the Rho GTPase RhoB. Biochem. Biophys. Res. Commun. 434 , 746–752. 10.1016/j.bbrc.2013.03.122 (2013). Quaglio, A. E. V., Santaella, F. J., Rodrigues, M. A. M., Sassaki, L. Y. & Di Stasi, L. C. MicroRNAs expression influence in ulcerative colitis and Crohn's disease: a pilot study for the identification of diagnostic biomarkers. World J. Gastroenterol. 27 , 7801–7812. 10.3748/wjg.v27.i45.7801 (2021). Schaefer, J. S. et al. MicroRNA signatures differentiate Crohn's disease from ulcerative colitis. BMC Immunol. 16 10.1186/s12865-015-0069-0 (2015). 5. Schaefer, J. S., Montufar-Solis, D., Vigneswaran, N. & Klein, J. R. Selective upregulation of microRNA expression in peripheral blood leukocytes in IL-10-/- mice precedes expression in the colon. J. Immunol. 187 , 5834–5841. 10.4049/jimmunol.1100922 (2011). Calabrese, J. M., Seila, A. C., Yeo, G. W. & Sharp, P. A. RNA sequence analysis defines Dicer's role in mouse embryonic stem cells. Proc. Natl. Acad. Sci. U S A . 104 , 18097–18102. 10.1073/pnas.0709193104 (2007). Ma, F. et al. MicroRNA-466l upregulates IL-10 expression in TLR-triggered macrophages by antagonizing RNA-binding protein tristetraprolin-mediated IL-10 mRNA degradation. J. Immunol. 184 , 6053–6059. 10.4049/jimmunol.0902308 (2010). Shi, M. M. et al. Role of miR-466 in mesenchymal stromal cell-derived extracellular vesicles treating inoculation pneumonia caused by multidrug-resistant Pseudomonas aeruginosa. Clin. Transl Med. 11 , e287. 10.1002/ctm2.287 (2021). Tanideh, N. et al. Protection by pure and genistein-fortified extra virgin olive oil, canola oil, and rice bran oil against acetic acid-induced ulcerative colitis in rats. Food Funct. 11 , 860–870. 10.1039/c9fo01951k (2020). Singh, R. et al. miR-10b-5p rescues diabetes and gastrointestinal dysmotility. Gastroenterology 160 , 1662–1678e18. 10.1053/j.gastro.2020.12.062 (2021). Wirtz, S. et al. Chemically induced mouse models of acute and chronic intestinal inflammation. Nat. Protoc. 12 , 1295–1309. 10.1038/nprot.2017.044 (2017). Wen, S. et al. Stigmasterol restores the balance of Treg/Th17 cells by activating the butyrate-PPARγ axis in colitis. Front. Immunol. 12 , 741934. 10.3389/fimmu.2021.741934 (2021). Grunau, A., Escher, U., Kühl, A. A., Bereswill, S. & Heimesaat, M. M. Toll-like receptor-4 differentially mediates intestinal and extra-intestinal immune responses upon multi-drug resistant Pseudomonas aeruginosa association of IL10-/- mice with chronic colitis. Gut Pathog . 9 , 61. 10.1186/s13099-017-0211-z (2017). Golusda, L. et al. Visualization of inflammation in experimental colitis by magnetic resonance imaging using very small superparamagnetic iron oxide particles. Front. Physiol. 13 , 862212. 10.3389/fphys.2022.862212 (2022). Pfaffl, M. W., Horgan, G. W. & Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30 , e36. 10.1093/nar/30.9.e36 (2002). Konac, E. et al. Endometrial mRNA expression of matrix metalloproteinases, their tissue inhibitors and cell adhesion molecules in unexplained infertility and implantation failure patients. Reprod. Biomed. Online . 19 , 391–397. 10.1016/s1472-6483(10)60174-5 (2009). Sun, Q. et al. WKB ameliorates DSS-induced colitis through inhibiting enteric glial cells activation and altering the intestinal microbiota. J. Transl Med. 23 , 93. 10.1186/s12967-025-06085-2 (2025). Mao, N. et al. Matrine ameliorates DSS-induced colitis by suppressing inflammation, modulating oxidative stress and remodeling the gut microbiota. Int. J. Mol. Sci. 25 , 6613. 10.3390/ijms25126613 (2024). Niu, Z., Li, X., Yang, X. & Sun, Z. Protective effects of sinomenine against dextran sulfate sodium-induced ulcerative colitis in rats via alteration of HO-1/Nrf2 and inflammatory pathway. Inflammopharmacology 32 , 2007–2022. 10.1007/s10787-024-01455-6 (2024). Shao, X. X., Xu, Y., Xiao, H. Y., Hu, Y. & Jiang, Y. Higenamine improves DSS-induced ulcerative colitis in mice through the Galectin-3/TLR4/NF-κB pathway. Tissue Cell. 82 , 102111. 10.1016/j.tice.2023.102111 (2023). Erben, U. et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int. J. Clin. Exp. Pathol. 7 , 4557–4576 (2014). ISSN:1936–2625/IJCEP0001236. Morgan, S. et al. Azathioprine has a deleterious effect on the bone health of mice with DSS-induced inflammatory bowel disease. Int. J. Mol. Sci. 20 , 6085. 10.3390/ijms20236085 (2019). Huang, Z. et al. Amomum tsaoko flavonoids attenuate ulcerative colitis by inhibiting TLR4/NF-κB/NLRP3 signaling pathway and modulating gut microbiota in mice. Front. Microbiol. 16 , 1557778. 10.3389/fmicb.2025.1557778 (2025). Kajimura, Y. et al. E4BP4 in macrophages induces an anti-inflammatory phenotype that ameliorates the severity of colitis. Commun. Biol. 7 , 527. 10.1038/s42003-024-06099-4 (2024). Thangavel, J. et al. Epigenetic modifiers reduce inflammation and modulate macrophage phenotype during endotoxemia-induced acute lung injury. J. Cell. Sci. 128 , 3094–3105. 10.1242/jcs.170258 (2015). Chen, Z., Dong, W. H., Wu, Q. & Wang, J. Two-layer regulation of TRAF6 mediated by both TLR4/NF-κβ signaling and miR-589-5p increases proinflammatory cytokines in the pathology of severe acute pancreatitis. Am. J. Transl Res. 12 , 2379–2395 (2020). ISSN:1943–8141/AJTR0107576. Feng, Z., Meng, R., Li, Q., Li, D. & Xu, Q. 5-aza-2'-deoxycytidine may regulate the inflammatory response of human odontoblast-like cells through the NF-κB pathway. Int. Endod J. 54 , 1105–1117. 10.1111/iej.13488 (2021). Xia, X. et al. Oryzanol ameliorates DSS-stimulated gut barrier damage via targeting the gut microbiota accompanied by the TLR4/NF-κB/NLRP3 cascade response in vivo. J. Agric. Food Chem. 70 , 15747–15762. 10.1021/acs.jafc.2c04354 (2022). Tajasuwan, L., Kettawan, A., Rungruang, T., Wunjuntuk, K. & Prombutara, P. Role of dietary defatted rice bran in the modulation of gut microbiota in AOM/DSS-induced colitis-associated colorectal cancer rat model. Nutrients 15 , 1528. 10.3390/nu15061528 (2023). Mastinu, A. et al. Gamma-oryzanol prevents LPS-induced brain inflammation and cognitive impairment in adult mice. Nutrients 11 , 728. 10.3390/nu11040728 (2019). Lo, H. C., Chen, Y. H. & Wu, W. T. Ethanol extracts of rice bran and whole grain adlay seeds mitigate colonic inflammation and damage in mice with colitis. Nutrients 14 , 3877. 10.3390/nu14183877 (2022). Henderson, A. J., Kumar, A., Barnett, B., Dow, S. W. & Ryan, E. P. Consumption of rice bran increases mucosal immunoglobulin A concentrations and numbers of intestinal Lactobacillus spp. J. Med. Food . 15 , 469–475. 10.1089/jmf.2011.0213 (2012). Tajasuwan, L. et al. Inhibitory effect of dietary defatted rice bran in an AOM/DSS-induced colitis-associated colorectal cancer experimental animal model. Foods 11 , 3488. 10.3390/foods11213488 (2022). Lazcano-Silveira, R. et al. Carbon 60 dissolved in grapeseed oil inhibits dextran sodium sulfate-induced experimental colitis. J. Inflamm. Res. 15 , 4185–4198. 10.2147/JIR.S366886 (2022). Kumar, D. et al. A randomized double-blind, placebo-controlled trial of artesunate and curcumin in patients with Crohn’s disease: a pilot study. JGH Open. 9 , e70211. 10.1002/jgh3.70211 (2025). He, X., Jing, Z. & Cheng, G. MicroRNAs: new regulators of Toll-like receptor signalling pathways. Biomed Res Int 945169. (2014). 10.1155/2014/945169 (2014). Li, Y. et al. Plasticity of leukocytic exudates in resolving acute inflammation is regulated by microRNA and proresolving mediators. Immunity 39 , 885–898. 10.1016/j.immuni.2013.10.011 (2013). El-Gowelli, H. M., Saad, E. I., Abdel-Galil, A. G. & Ibrahim, E. R. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade. Toxicol. Appl. Pharmacol. 288 , 300–312. 10.1016/j.taap.2015.08.002 (2015). Karthikeyan, A. et al. Curcumin and its modified formulations on inflammatory bowel disease (IBD): the story so far and future outlook. Pharmaceutics 13 , 484. 10.3390/pharmaceutics13040484 (2021). Mirbagheri, S. A., Nezami, B. G., Assa, S. & Hajimahmoodi, M. Rectal administration of d-alpha tocopherol for active ulcerative colitis: a preliminary report. World J. Gastroenterol. 14 , 5990–5995. 10.3748/wjg.14.5990 (2008). Brown, P. N. & Yin, H. PNA-based microRNA inhibitors elicit anti-inflammatory effects in microglia cells. Chem. Commun. (Camb) . 49 , 4415–4417. 10.1039/c2cc36540e (2013). Wang, J. P., Dong, L. N., Wang, M., Guo, J. & Zhao, Y. Q. miR-146a regulates the development of ulcerative colitis via mediating the TLR4/MyD88/NF-κB signaling pathway. Eur. Rev. Med. Pharmacol. Sci. 23 , 2151–2157. 10.26355/eurrev_201903_17260 (2019). Xiao, X. et al. miRNAs can affect intestinal epithelial barrier in inflammatory bowel disease. Front. Immunol. 13 , 868229. 10.3389/fimmu.2022.868229 (2022). Masi, L. et al. MicroRNAs as innovative biomarkers for inflammatory bowel disease and prediction of colorectal cancer. Int. J. Mol. Sci. 23 , 7991. 10.3390/ijms23147991 (2022). Mi, S., Zhang, J., Zhang, W. & Huang, R. S. Circulating microRNAs as biomarkers for inflammatory diseases. Microrna 2 , 63–71. 10.2174/2211536611302010007 (2013). Lu, P. D. & Zhao, Y. H. Targeting NF-κB pathway for treating ulcerative colitis: comprehensive regulatory characteristics of Chinese medicines. Chin. Med. 15 , 15. 10.1186/s13020-020-0296-z (2020). Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterialTotal.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7845870","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":543505076,"identity":"812390f4-c519-4cb1-b4a8-0c43128ff36b","order_by":0,"name":"GIZEM ESENTURK","email":"","orcid":"","institution":"Gazi University","correspondingAuthor":false,"prefix":"","firstName":"GIZEM","middleName":"","lastName":"ESENTURK","suffix":""},{"id":543505077,"identity":"0a48e3d8-59f8-4f2d-a977-fad244ee5715","order_by":1,"name":"SÜHEYLA ESRA ÖZKOÇER","email":"","orcid":"","institution":"Gazi University","correspondingAuthor":false,"prefix":"","firstName":"SÜHEYLA","middleName":"ESRA","lastName":"ÖZKOÇER","suffix":""},{"id":543505078,"identity":"d0fae749-a2b4-4489-babd-05ca812fb7e7","order_by":2,"name":"ODUL EGRITAS","email":"","orcid":"","institution":"Gazi University","correspondingAuthor":false,"prefix":"","firstName":"ODUL","middleName":"","lastName":"EGRITAS","suffix":""},{"id":543505079,"identity":"806f92d5-8565-4632-bf1a-ecf0f10867ee","order_by":3,"name":"ECE KONAC","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7ElEQVRIiWNgGAWjYJADxgMMFQwMBiTpOcBwhmQtjG1EaOFnP3x0w8c9dvLm7O0XDvPOOwxkNB9g+FGxDacWyZ60tJszniUb7uw5U3CYd9thIONYAmPPmds4tRjc4DG7zXPgAOOGGzkJIC0ghgEzYxtuLfY3+L/d/nPggD1Ey5zD9gS1GEjwsN1mOHAgccON9AOHeRsOJxLUInEmzexmz4Hk5A1nzjAcnHMsHcg4lnAQn1/42w8/u/HjgJ3thuPtDx+8qbEGMpoPPvhRgVsLEuABxUgzmHmAGPVAwP4ASNQRqXgUjIJRMApGEgAApXVm+OPzfn4AAAAASUVORK5CYII=","orcid":"","institution":"Gazi University","correspondingAuthor":true,"prefix":"","firstName":"ECE","middleName":"","lastName":"KONAC","suffix":""}],"badges":[],"createdAt":"2025-10-13 07:38:38","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7845870/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7845870/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96239211,"identity":"469f2f63-b241-4ed8-aee0-823851468af7","added_by":"auto","created_at":"2025-11-19 07:05:30","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4487732,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/5a6f64c4862566d6a4845c6f.docx"},{"id":95826355,"identity":"16af8f5e-8675-4499-821a-a18ac1d0a1df","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6060,"visible":true,"origin":"","legend":"","description":"","filename":"fd40e45e46cd45fa8ce5e207c243e49a.json","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/4d8658d676d33bdc9620d770.json"},{"id":95826357,"identity":"0acb2459-dbf0-451c-9341-6669695b0cf4","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":48920,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterialTotal.docx","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/ea38c5491c34e2628273eb9e.docx"},{"id":95826370,"identity":"ced09da4-db04-40b7-aeca-736db1d9daa1","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":189643,"visible":true,"origin":"","legend":"","description":"","filename":"fd40e45e46cd45fa8ce5e207c243e49a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/ecdef76825524b1f946c689c.xml"},{"id":96239448,"identity":"39c6183d-2406-400c-ba5a-b8f0b094f5f3","added_by":"auto","created_at":"2025-11-19 07:06:39","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":868304,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/88c085a38ba7ffc2704be7b2.jpeg"},{"id":95826360,"identity":"41e955bf-f416-44f0-bd4e-44abbf7ac24a","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":796022,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/1b4f7542666924a5b6a23c87.jpeg"},{"id":95826364,"identity":"6d7e10be-0b56-4090-8c3d-d1af975831d4","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":818032,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/a5acb20a2dcddb06c3e44efd.jpeg"},{"id":96239316,"identity":"c0bf216d-50bf-4b16-b8c4-46d901739efa","added_by":"auto","created_at":"2025-11-19 07:06:06","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":894826,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/a75dba5832eb24d153a863af.jpeg"},{"id":95826373,"identity":"b21d1957-54ac-4151-85e0-e041cbb79faa","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":713599,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/8a1a2d6774b03b6a47a4209d.jpeg"},{"id":96239452,"identity":"485a61bc-bb15-47ca-98bc-57df1547b0a0","added_by":"auto","created_at":"2025-11-19 07:06:41","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130714,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/93b58c6f7cdd55e1513bc2c9.jpeg"},{"id":95826368,"identity":"f64e56e0-6210-4ccc-a56c-6768af82bd95","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":151104,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/e746326e1ecfcdd9ec8d71f3.png"},{"id":95826365,"identity":"a0d4606c-c828-48c7-8cec-094065aab90a","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127957,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/58de7cca871c38ee3cc8ec9c.png"},{"id":96239345,"identity":"897e89a8-1c6b-476c-b8e7-afd1ebffce3f","added_by":"auto","created_at":"2025-11-19 07:06:15","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":133317,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/f5d3a115b03dfc05ae32a3fd.png"},{"id":96239474,"identity":"24e6db37-6711-4b25-a20a-ac2e93b44842","added_by":"auto","created_at":"2025-11-19 07:06:45","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":149258,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/7ed1dfc2e93b6a2399b68538.png"},{"id":96239504,"identity":"e8c36abf-693e-4cb2-9a79-8a4283ef6152","added_by":"auto","created_at":"2025-11-19 07:06:51","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":245469,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/5e0788c25662fe918b0ff982.png"},{"id":96239025,"identity":"4009f51a-2662-44e6-be30-b2d1d16c21e2","added_by":"auto","created_at":"2025-11-19 07:01:27","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21766,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/0243c5975a638deea9ed950c.png"},{"id":95826375,"identity":"955a6fc3-0903-42b6-8034-bdc5b89cc837","added_by":"auto","created_at":"2025-11-13 11:20:25","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":186649,"visible":true,"origin":"","legend":"","description":"","filename":"fd40e45e46cd45fa8ce5e207c243e49a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/7e9a59f591c026a5b715525c.xml"},{"id":96239236,"identity":"b2bb7493-9973-4643-b6f6-6b0c26cb7d15","added_by":"auto","created_at":"2025-11-19 07:05:46","extension":"html","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":205783,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/ea4728010bf6d8dfd55c5cab.html"},{"id":96239253,"identity":"854675c4-0400-4d6d-967f-e067c0ed98f4","added_by":"auto","created_at":"2025-11-19 07:05:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":538970,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of UC group on colon tissue and gene expressions. (a) Experimental timeline of DSS-induced colitis. C57BL/6 mice received 2.5% (w/v) dextran sulfate sodium (DSS) in drinking water for 7 days.\u003cstrong\u003e \u003c/strong\u003e(b) Macroscopic views of colon tissues from the control and antimiR466l-supplemented groups are shown. (c) Colon lengths and (d) DAI scores were compared between the UC and control groups. A statistically significant difference was found in the DAI score and colon length of the UC group. (e) Micrographs show mucosa samples of groups which was stained with hematoxylin and eosin. Micrographs were taken with 200x magnification and the scale represents 100µm. (f) Graph shows mean±SD of histological scores. Histological scores of colitis groups were increased compared to the control groups. Statistically significant differences with control group. (g) A significant increased were found in the miR466l, NF-ĸβ, TLR4 and IL6. A significant decreased was found in the IL10. Statistical significance levels: *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, **p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/2df0b6f148eae4d3c37cc973.png"},{"id":95826351,"identity":"eca0099e-16cf-4c29-b2c2-2a3f14ca81b4","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":470541,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AZA supplementation on colon tissue and gene expressions. (a) Experimental timeline of DSS-induced colitis. C57BL/6 mice were given 2.5% (w/v) dextran sulfate sodium (DSS) in drinking water for 7 days, followed by 0.01 mL/g AZA for 8 days. (b) Macroscopic views of colon tissues from the control and UC+AZA are shown. (c) Colon lengths and (d) DAI (Disease Activity Index) scores were compared for each group. A significant decrease in DAI score and improvement in colon length were observed in the UC+AZA. (e) Micrographs show mucosa samples of groups which was stained with hematoxylin and eosin (100µm). (f) Graph shows mean±SD of histological scores. Histological scores of UC+AZA groups were decreased compared to the UC groups. (g) Significant increases were found in miR466l and NF-ĸβ. Significant decreases were found in TLR4 and IL6. The decrease in IL10 was not significant. Statistical significance levels: *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, **p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/f7e13522b94a3bc00c1c12dc.png"},{"id":95826353,"identity":"e3d5428f-581e-4a9c-8ebb-3e5712c17fa2","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":505766,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of RBO supplementation on colon tissue and gene expressions. (a) Experimental timeline of DSS-induced colitis. C57BL/6 mice were given 2.5% (w/v) dextran sulfate sodium (DSS) in drinking water for 7 days, followed by 0.1 ml RBO for 8 days. (b) Macroscopic views of colon tissues from the control and UC+RBO groups are shown. (c) Colon lengths and (d) DAI (Disease Activity Index) scores were compared for each group. A significant decrease in DAI score and improvement in colon length were observed in the UC+RBO group (e) Micrographs show mucosa samples of groups which was stained with hematoxylin and eosin (100µm). (f) Graph shows mean±SD of histological scores. Histological scores of UC+RBO groups were decreased compared to the UC groups. (g) While the increase observed in the IL-10 gene was significant, the increase observed in the miR466l gene was statistically insignificant. The decrease in the IL6, TLR4 and NF-ᴋβ genes was significant. Statistical significance levels: *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, **p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/b3bd492946ec58231926f28e.png"},{"id":96239482,"identity":"2d985fc6-5eff-460f-8753-f5290c5c7fdb","added_by":"auto","created_at":"2025-11-19 07:06:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":536618,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of AZA+RBO supplementation on colon tissue and gene expressions. (a) Experimental timeline of DSS-induced colitis. C57BL/6 mice were given 2.5% (w/v) dextran sulfate sodium (DSS) in drinking water for 7 days, followed by 0.1 ml RBO and 0.01 mL/g AZA for 8 days. (b) Macroscopic views of colon tissues from the control and UC+AZA+RBO groups are shown. (c) Colon lengths and (d) DAI (Disease Activity Index) scores were compared for each group. A significant decrease in DAI score and improvement in colon length were observed in the UC+AZA+RBO group (e) Micrographs show mucosa samples of groups which was stained with hematoxylin and eosin. Micrographs were taken with 200x magnification and the scale represents 100µm. (f) Graph shows mean±SD of histological scores. Histological scores of UC groups were increased compared to the UC+AZA+RBO group. (g) A significant increase was observed in the IL-10 gene. The decrease in miR466l, IL6, TLR4 and NF-ᴋβ genes was significant. Statistical significance levels: *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, **p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/0bf62ae8d4863e49334012d4.png"},{"id":96239381,"identity":"57fe3a27-2a7f-4a73-bb3c-f8056b469f39","added_by":"auto","created_at":"2025-11-19 07:06:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":838873,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of antimiR466l supplementation on colon tissue and gene expressions. (a) C57BL/6 mice were given 2.5% (w/v) dextran sulfate sodium (DSS) in drinking water for 7 days, followed by a single intraperitoneal injection of 100 µl antimiR-466l. (B) Macroscopic views of colon tissues from the UC and UC+antimiR466l groups are shown. (c) Colon lengths and (d) DAI scores were compared for each group. A significant decrease in DAI score and improvement in colon length were observed in the UC+AntimiR466l group. (e) Micrographs show mucosa samples of groups which was stained with hematoxylin and eosin. Micrographs were taken with 200x magnification and the scale represents 100µm. (f) Graph shows mean±SD of histological scores. Histological scores of UC groups were increased compared to the control groups. Statistically significant differences with UC+AntimiR466l group. (g) A significant increase was observed in the IL-10 gene. The decrease in miR466l, IL6, TLR4 and NF-ᴋβ genes was significant. Statistical significance levels: *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/9fe38ecfa4063bc92d9c6843.png"},{"id":95826358,"identity":"caf39383-1d63-449b-922e-e582b06cffea","added_by":"auto","created_at":"2025-11-13 11:20:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":204608,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression levels of NF-κβ and TLR4 genes in mouse colon tissue in UC+AZA+RBO and UC+AntimiR466l groups. NF-κβ and TLR4 expression levels were significantly decreased in UC+AZA+RBO and UC+AntimiR466l groups compared to the control group. Statistical significance levels: ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/f58c2b87cf092376afafdbb9.png"},{"id":109172160,"identity":"e5ce60db-760c-415a-a441-276c18a0f44a","added_by":"auto","created_at":"2026-05-13 09:03:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3503069,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/218f1757-aa07-4616-ae83-07f83a1c8b66.pdf"},{"id":96239200,"identity":"82467b6a-9c76-44f8-8fb0-c17df9b5c36f","added_by":"auto","created_at":"2025-11-19 07:05:22","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":48920,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterialTotal.docx","url":"https://assets-eu.researchsquare.com/files/rs-7845870/v1/5746e3dc0f3f6dcefe3fa5be.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Synergistic Suppression of Inflammation by AZA, Rice Bran Oil, and AntimiR-466l through IL-6/NF-κβ/TLR4 Pathways in Mice Model of Ulcerative Colitis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe etiology of inflammatory bowel disease (IBD) is multifactorial, including environmental, microbiota, genetic, and immunological factors. IBD includes chronic, relapsing gastrointestinal disorders, mainly Crohn\u0026rsquo;s disease (CD) and ulcerative colitis (UC), along with rarer forms like indeterminate colitis (IC) and unclassified colitis (IBD-U), which share clinical and histopathological features but affect different regions of the gastrointestinal tract [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Despite clinical, endoscopic, and histological differences between UC and CD, reliable molecular biomarkers for definitive differentiation are not yet in routine use. Phenotypic overlap, especially in early stages, complicates diagnosis. Recent transcriptomic, epigenetic, and microbiome approaches may aid molecular differentiation but are not yet standardized, limiting accurate diagnosis and personalized treatment in UC.\u003c/p\u003e\u003cp\u003eAzathioprine (AZA), a purine analog and immunosuppressant, is commonly used to maintain remission in UC by reducing immune cell infiltration [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. It is also crucial as a steroid-sparing agent in steroid-dependent, chronically active IBD patients. In a rabbit colitis model, AZA-loaded beads showed better therapeutic outcomes, including improved clinical activity, reduced tissue edema, lower mortality, and improved colon histopathology, compared to crude AZA and controls [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Zhao et al. (2023) reported increased expression of neutrophil, monocyte, and macrophage-related genes in the colon tissues of UC patients, with AZA treatment significantly reducing immune cell infiltration [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. However, about 10\u0026ndash;20% of patients discontinued AZA due to drug-induced toxicity, leaving many questions about the optimal AZA treatment regimens [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Due to the severe side effects, low remission rates, and AZA intolerance in current UC treatments, identifying new natural compounds and investigating gene expression signatures are critical for developing safer and more effective therapeutic options.\u003c/p\u003e\u003cp\u003eRice bran oil (RBO) is an edible oil from rice\u0026rsquo;s outer layer, containing natural antioxidants like γ-oryzanol and tocopherols [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The anti-inflammatory effects of γ-oryzanol in RBO were seen in rat macrophages, with dietary RBO reducing inflammatory mediators [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. γ-oryzanol significantly reduced the upregulated expression of IL-1β, IL-6, TNF-α, and COX-2 mRNA in mice with dextran sulphate sodium (DSS)-induced colitis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Islam et al. (2016) also demonstrated that cycloartenyl ferulate, derived from rice bran, downregulated iNOS mRNA in RAW 264.7 murine macrophages via NF-κβ [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In another study, RBO treatment significantly suppressed IL-6 and TNF-α secretion while upregulating the pro-inflammatory cytokine IL-10 in RWA264.7 murine macrophage cells [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In a DSS-induced colitis model in Wistar rats, RBO supplementation has been shown to reduce oxidative stress, suppress inflammatory mediators, and improve colonic damage [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Although RBO has been shown to protect against inflammation in many diseases [\u003cspan additionalcitationids=\"CR14 CR15 CR16\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], whether RBO plays a positive role in UC remains unclear.\u003c/p\u003e\u003cp\u003eInflammation is tightly controlled by Toll-like receptor (TLR)-mediated innate immune responses. TLRs are divided by location: surface TLRs (e.g., TLR1, 2, 4\u0026ndash;6, 10] detect microbial membranes, while intracellular TLRs (e.g., TLR3, 7\u0026ndash;9, 11\u0026ndash;13) sense bacterial or viral nucleic acids to trigger inflammation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The TLR4 gene encodes a protein in the TLR family that detects lipopolysaccharides from Gram-negative bacteria, activating the innate immune system [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Kaempferol, an anti-inflammatory and antioxidant flavonoid, has been shown to alleviate DSS-induced UC in mice by enhancing intestinal barrier function and reducing inflammation via TLR4-NF-κβ downregulation [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Folate-chicory acid liposomes treat UC in mice by downregulating the TLR4/NF-κβ signaling pathway [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Resatorvid (TAK-242), a TLR4 inhibitor, alleviated UC by suppressing inflammation and inhibiting the TLR4/JAK2/STAT3 signaling pathway [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Another study reported that taurine supplementation alleviated UC in DSS-induced mice by enhancing intestinal barrier function and inhibiting TLR4/NF-κβ-mediated inflammation [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Oyster peptides have been shown to alleviate DSS-induced UC in mice by reducing inflammation, restoring intestinal barrier function, and inhibiting TLR4/NF-κβ signaling [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In another study, costunolide and dehydrocostus lactone, the two most abundant components of Aucklandiae radix, reduced UC symptoms in mice by downregulating TLR4, PIK3R1, and RELA expression, mitigating inflammation, and showing potential as UC treatments [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eInterleukin-6 (IL-6), a versatile cytokine regulating immunity, drives chronic intestinal inflammation in UC, and is proposed as a key link between inflammation and tumor development [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. IL-6 mRNA expression was found to be significantly increased in the brain and colon tissues of UC rats [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. When the combined treatment of mesalazine and atorvastatin was administered to rats with UC, gene expression levels of inflammation markers such as IL-6 and TNF-α decreased, while IL-10 increased [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Portulacae Herba and Granati \u003cem\u003ePericarpium\u003c/em\u003e (PGP), a traditional Chinese herbal therapy, has been shown to reduce colitis symptoms in mice by inhibiting the IL-6/STAT3/SOCS3 pathway and enhancing intestinal barrier function [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In rats with UC, the combination of genistein and sulfasalazine was found to alleviate colitis by suppressing the TLR-4/NF-κβ pathway, regulating the IL-6/JAK2/STAT3/COX-2 pathways, and reducing inflammation, oxidative stress, and apoptosis [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. A recent study found that the proinflammatory cytokines IL-6 and TNF-α were more highly expressed in treatment-resistant colitis patients than in responders [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eInterleukin-10 (IL-10), a key anti-inflammatory cytokine in the intestinal mucosa, acts via the JAK1/STAT3 pathway, and its impaired expression contributes to autoimmune diseases like UC. IL-10 expression has been shown to be significantly reduced in intestinal biopsies of patients with UC compared to the control group [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Ground flaxseed and flaxseed oil reduced inflammation and disease severity in UC patients, with flaxseed oil also significantly increasing IL-10 levels [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. A novel polyphenol-assisted delivery strategy was proposed for the effective and non-toxic delivery of IL-10 mRNA In the treatment of UC [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Orally administered chitosan-coated artesunate in UC mice has been shown to suppress the TLR-4/NF-κβ pathway, reduce mRNA levels of pro-inflammatory cytokines, and increase IL-10 levels [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Honokiol, a natural magnolia bark extract, improved colon length, weight loss, disease activity index, and histopathological scores in DSS-induced colitis and IL-10 deficient mice [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAs potential non-invasive biomarkers, miRNAs can be used in the diagnosis, prognosis, and management of IBD [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. A pioneering study on miRNAs in UC shows that altered miRNA expression regulates inflammation-related genes, particularly miR-192\u0026rsquo;s role in controlling MIP-2 alpha levels in colonic epithelial cells [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Many studies have identified dysregulated miRNA expression in UC patients, highlighting their role as key factors in disease pathogenesis and potential diagnostic biomarkers [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Moreover, miRNAs could serve to distinguish UC from CD, with differentially expressed miRNAs providing insights into the unique pathophysiology of each disease [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In this context, a study by Schaefer et al. (2015) demonstrated that the expression levels of miR-31 and miR-375 were significantly elevated in CD, while no significant changes were observed in UC [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Conversely, miR-146a expression was markedly increased in UC but remained unchanged in CD. Furthermore, the same study revealed that, compared to healthy controls, miR-21, miR-31, and miR-146a were significantly downregulated in UC blood samples, whereas miR-19a, miR-101, miR-142-5p, miR-223, miR-375, and miR-494 exhibited statistically significant upregulation. In the study using IL-10\u0026minus;/\u0026minus; mice, the expression levels of miR-21, miR-31, miR-142-5p, and miR-146a were shown to be significantly altered in blood samples from both CD and UC blood specimens [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. miR-466l was identified in embryonic stem (ES) cells using high-throughput pyrosequencing [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. There are few studies in the literature on the function of miR-466l. One of these studies has shown that miR-466l increases IL-10 expression at both the mRNA and protein levels in TLR-triggered macrophages [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Another study demonstrated that miR-466 mimics significantly reduced the mRNA and protein expression levels of TIRAP and MyD88, key adaptor proteins in the TLR signaling pathway essential for NF-κβ activation, in RAW264.7 mouse macrophage cells [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn our study, we aimed to investigate the relationship between miR-466l and its potential target pathway, TLR4- NF-κβ- IL-6/10, in a DSS-induced UC mice model, and explore the synergistic effect of RBO treatment with AZA.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eethical approval\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental procedures were approved by the Gazi University Local Animal Ethics Committee (Approval date and number: 19.01.2024 - G.U.E.866742) and conducted in compliance with institutional guidelines and the European Convention for the Protection of Vertebrate Animals.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eanimals and study design\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e40 male C57BL/6 mice (8\u0026ndash;12 weeks old) were obtained from the Gazi University Laboratory Animal Center. Mice were housed in a temperature-controlled environment (22 \u0026plusmn; 2\u0026deg;C) with a 12-h light/dark cycle and fed ad libitum. UC was induced via administration of 2.5% dextran sulfate sodium (DSS) in drinking water for 7 days, followed by 2 days of regular water. This study was conducted and reported in accordance with the ARRIVE guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003edrug and compound administration\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the formation of the colitis model for 7 days, mice were randomly divided into 6 different groups (n=6). These groups were; unlabeled azathioprine (0.01 mL/g AZA (Aspen (Turkey)) via gavage) + RBO (via oral) treated, unlabeled RBO (Polente Natural (Turkey)) (via oral) treated and unlabeled azathioprine (0.01 mL/g AZA via gavage) treated. The doses given to the treatment groups were determined from previous studies in the literature [5, 47]. Antisense miR-466l (5\u0026rsquo;ATGTGTGTTGCGTGTATGTAT3\u0026rsquo;) and negative control (5\u0026rsquo;AAACGTGACACGTTCG GAGAA3\u0026rsquo;) mimics (A. B. T. (Turkey)) were synthesized and specially ordered. Antisense miR-466l and miR-NC-antisense were administered by intraperitoneal injection using in vivo-jetPEI\u0026reg; (Polyplus (France)) as transfection reagent according to the manufacturer\u0026rsquo;s protocol [48].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003esample collection\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn day 20, mice were euthanized using a ketamine (Tekkim (T\u0026uuml;rkiye)) (45 mg/kg) and xylazine (Tekkim (T\u0026uuml;rkiye)) (5 mg/kg) combination. Colon and liver tissues were collected and either snap-frozen at \u0026ndash;80\u0026deg;C. Colon length was measured post-dissection. Fecal samples were also obtained at baseline, post-induction, and post-treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003edisease activity index\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Disease Activity Index (DAI) was calculated by scoring three parameters on a daily basis: body weight loss, stool consistency, and rectal bleeding. Each parameter was rated from 0 to 4, with 0 representing no symptoms and 4 representing the most severe symptoms. The individual scores for each parameter were then summed to calculate a total DAI score, with the maximum possible score being 12 [49].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ehistopathological examination\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eColons were fixed in formalin and rinsed with tap water. For tissue processing, samples were dehydrated through increasing concentrations of ethanol. Tissues were cleared with xylene and embedded in paraffin. Formalin-fixed, paraffin-embedded (FFPE) tissue blocks were sectioned at a thickness of 5 \u0026micro;m. Tissue sections were deparaffinised at 56 \u0026deg;C for two hours. After rehydration, sections were stained with haematoxylin and eosin. Six different sections per animal were evaluated and scored [50] using the LEICA DM4000 Image Analysis System (Germany). Histological scores were calculated by summing five different parameters: crypt architecture (0: normal, 1: mild, 2: moderate, 3: severe crypt distortion with loss of entire crypts), degree of inflammatory cell infiltration (0: normal, 1: mild, 2: moderate, 3: dense inflammatory infiltrate), \u0026nbsp;mucosal thickening (0: base of crypt sits on the muscularis mucosae, 1: mild, 2: moderate, 3: marked muscle thickening), crypt abscess (0: absent, 1: present), goblet cell depletion (0: absent, 1: present).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ecultural analysis of pseudomonas aeuroginosa\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFeces samples collected before and after treatment were homogenized in sterile PBS and plated on eosin methylene blue agar. Samples were incubated in a CO\u003csub\u003e2\u003c/sub\u003e incubator at 37 \u0026deg;C for at least 36 hours. [51].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eRNA isolation from blood and tissue samples\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBlood samples were stored at +4\u0026deg;C. Manual isolation protocol was applied for RNA isolation. Zirconia beads were used to accelerate homogenization. 300 \u0026micro;l of the blood sample in the EDTA tube was added to the zirconia beads taken into a microcentrifuge tube. Trizol was added to complete 1000 \u0026micro;l. It was homogenized for 20 seconds at 4000 rpm in the homogenizer device (This step was repeated 3 times for tissue samples). Then, 200 \u0026micro;l of chloroform was added to form phase separation, vortexed and incubated for 3 minutes at room temperature. After incubation, it was centrifuged at 12000 g for 15 minutes. After centrifugation, 3 separate phases were formed. The supernatant was transferred to a new tube and 500 \u0026micro;l of isopropanol kept at -20\u0026deg;C was added to precipitate the RNA and incubated at -20\u0026deg;C for 10 minutes. After incubation, it was centrifuged at 12000 g for 10 minutes. After centrifugation, the supernatant was discarded and 100 \u0026micro;l of 75% ethanol was added to the pellet. It was centrifuged again at 12000 g for 10 minutes. The supernatant was discarded and the pellet was incubated at room temperature for 5 minutes to dry. Then 50 \u0026micro;l of elution buffer was added. The samples obtained at the end of the isolation were stored at -20\u0026deg;C until they were studied.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ecDNA synthesis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe purity and concentration of the obtained RNAs were measured by spectrophotometric method in the Nanodrop. The protocol of the cDNA synthesis kit (SOLIScript RT cDNA synthesis KIT (Germany)) was followed. The mixture was prepared by adding 1 \u0026micro;l oligo primer, 0.5 \u0026micro;l dNTP mix, 2 \u0026micro;l RT reaction buffer, 1 \u0026micro;l reverse transcriptase (200 U/\u0026micro;l) and 0.1 \u0026micro;l RNase inhibitor. The amount to be taken from the samples was determined according to the RNA concentrations measured in the Nanodrop and the total volume was completed with distilled water to be 20 \u0026micro;l. Synthesized by setting the Thermal Cycler at 25\u0026deg;C for 3 minutes, 50\u0026deg;C for 15 minutes and 85\u0026deg;C for 5 minutes. The samples were stored at -20\u0026deg;C until they were used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003egene expression analysis (qRT-PCR)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from colon and blood samples using TRIzol reagent and standard chloroform-isopropanol extraction. RNA was reverse-transcribed using SOLIScript RT cDNA synthesis kit. Quantitative PCR was performed using SYBR Green master mix on a Qiagen Rotor-Gene Q thermocycler. \u0026nbsp;The primers used are listed in Table I. Necessary steps were followed according to the manufacturer\u0026apos;s instructions: A total of 15 \u0026micro;l of mixture was prepared; each sample contained 4.5 \u0026micro;l of water, 0.5 \u0026micro;l of primer pair, 10 \u0026micro;l of SYBR master mix (Bioline sensiFAST SYBR 2\u0026times;; Bioline Reagents Ltd.). The final volume was made up to 20 \u0026micro;l by adding 5 \u0026micro;l of cDNA. Then, 40 cycles of qPCR were performed using the Qiagen rotor-gene-Q instrument (Qiagen GmbH). The thermal cycling conditions were as follows: Denaturation at 95\u003csup\u003eo\u003c/sup\u003eC for 1 min, annealing at 58-61\u003csup\u003eo\u003c/sup\u003eC for 30 sec and extension at 72\u003csup\u003eo\u003c/sup\u003eC for 1 min. Experiments were conducted in triplicate. Expression levels were normalized to reference genes (ACTB and U6).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable I.\u003c/strong\u003e Primer sequences (A. B. T. (T\u0026uuml;rkiye)) used for qRT-PCR.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"643\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGENE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;TGTCTAGGTCCTGAGTCCA3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo; GGTGAGAAGCTGAAGACCCT‑3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIL6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;GGTCTTGGTCCTTAGCCAC3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo; GCCAGAGTCCTTCAGAGAGA‑3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eNF- kB\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;GCTGCCAAAGAAGGACACG ACA3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo; GGCAGGCTATTGCTCATCAC AG‑3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTLR4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;AGCTTCTCCAATTTTTCAGAACTTC3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo; TGAGAGGTGGTGTAAGCCAT GC‑3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003emiR466l\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;ACAGCATATAAATACATGCACA3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;GTCGTATCCAGTGCAGGGCGAGGTATTCGCACTGGATACGA3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eB-actin\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026apos;GAAGATCAAGATCATTGCTCCT‑3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026apos;ACTCGTCATACTCCTGCTT3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eU6\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026apos;GCTTCGGCAGCACATATACTA3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5\u0026apos;CGAATTTGCGTGTCATCCTTG3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003estatistical analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter the determination of histological scores, statistical analysis was performed using SPSS 26.0 (IBM, USA). The Mann\u0026ndash;Whitney U test was used to compare groups, means and standart deviation were assessed for each group and a p-value \u0026lt; 0.05 was considered statistically significant [52].\u003c/p\u003e\n\u003cp\u003eThe mRNA gene expression levels between groups were analyzed by Pfaffl [53, 54]. Complementary comparison techniques were used to determine which groups caused significant differences. P\u0026lt;0.05 was accepted as a statistically significant difference.\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003ecultural analysis of pseudomonas aeruginosa\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn order to investigate the effect of \u003cem\u003ePseudomonas aeuroginosa\u003c/em\u003e on ulcerative colitis, stool collected before colitis was induced, after colitis was induced and finally after treatment was cultured on EMB agar. As a result, it was observed that \u003cem\u003ePseudomonas aeuroginosa\u003c/em\u003e bacteria did not grow on EMB agar.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ecomparative analysis of control and dss-induced colitis groups\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThirty C57Bl/6 mice were administered 2.5% DSS for 7 days (Figure 1a). After euthanasia, colon tissues were compared with those of the control groups (Figure 1b), and the colon tissues of the UC group were found to be shorter than those of the control group (**p=0.0052) (Figure 1c). DAI scores were measured during and after administration, and significantly higher DAI scores were observed in the UC group compared to the control group, and statistical significance was found (**p=0.0014) (Figure 1d). In the examination performed after staining, inflammatory cell infiltration, muscularis mucosa and crypt abscess were observed in the UC group (100\u0026micro;m) (Figure 1e). Histological scores of DDS induced colitis group (9\u0026plusmn; 1.87) had significantly higher scores than control group (0.5\u0026plusmn; 0.58) (**p\u0026lt;0.01) (Figure 1f). Expression levels of IL6, IL10, TLR4, NF-\u0026kappa;\u0026beta;, and miR-466l were evaluated relative to reference genes ACTB and U6 in UC group (Table S1 in Supplement 1) and control (Table S2 in Supplement 1). Gene expression levels obtained from blood samples of the UC group are presented in Figure 1G. A 2-fold decrease in the expression level of IL10 was observed (*p = 0.038). In contrast, IL6, miR-466l, NF-\u0026kappa;\u0026beta;, and TLR4 expression levels were significantly increased by 6-fold, 8-fold, 3-fold, and 25-fold, respectively (***p = 0.001; *p = 0.01; *p = 0.010; \u003cstrong\u003e**\u003cstrong\u003ep =0.005) (\u003c/strong\u003e\u003c/strong\u003eFigure 1g\u003cstrong\u003e).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eeffects of azathioprine treatment on colitis parameters\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 2.5% DSS was administered for 7 days, 0.01 mL/g AZA was administered to 6 C57Bl/6 mice for 8 days (Figure 2a). After euthanasia, colon tissues of the UC+AZA group were compared with those of the UC groups (Figure 2b), and the colon tissues of the UC group were found to be shorter than those of the UC+AZA group (****p\u0026lt;0.0001) (Figure 2c). DAI scores were measured during and after administration, and significantly higher DAI scores were observed in the UC group compared to the UC+AZA group, and statistical significance was found (**p=0.0071) (Figure 2d). In the examination performed after staining, inflammatory cell infiltration and muscularis mucosa were observed in the UC+AZA group (100\u0026micro;m) (Figure 2e). Histological scores of UC+AZA (3.67\u0026plusmn;0,82) was lower than UC (9\u0026plusmn; 1.87) (**p=0.008) (Figure 2f). Real-time PCR analysis revealed the Ct values of IL6, IL10, TLR4, NF-\u0026kappa;\u0026beta;, miR-466l, ACTB, and U6 genes in the UC + AZA group (Table S3 in Supplement 1). The increase in the IL10 gene was statistically insignificant. In contrast, IL6, miR-466l, NF-\u0026kappa;\u0026beta;, and TLR4 expression levels were significantly decreased by 7-fold, 3-fold, 6-fold, and 9-fold, respectively (***p = 0.001; *p = 0.014; ****p = 0.0001; ***p =0.001) (Figure 2g).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eeffects of rice bran oil supplementation on colitis parameters,\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 2.5% DSS was administered for 7 days, 0.1 ml RBO was administered to 6 C57Bl/6 mice for 8 days (Figure 3a). In C57BL/6 mice using a DSS-induced colitis model, daily oral supplementation with 0.1 mL of rice bran oil (RBO) for 7 days significantly preserved colon length (****p\u0026lt;0.0001) (Figure 3b/c) and resulted in a significant reduction in disease activity index (DAI) (**p=0.0018) (Figure 3d). Histological examination revealed that although inflammatory cell infiltration and thickening of the muscle layer were observed in the RBO-treated group, mucosal integrity was partially preserved, and crypt structures were more regular (100\u0026micro;m) (Figure 3e). Histological scores of UC+RBO (5.0\u0026plusmn;1.10) lower than UC group (p=0.058) (Figure 3f). Expression levels of IL6, IL10, TLR4, NF-\u0026kappa;\u0026beta;, and miR-466l were evaluated relative to reference genes ACTB and U6 (Table S4 in Supplement 1). It was observed that the IL10 expression level in the UC+RBO group was 2-fold higher than in the UC group (**p=0.004). IL6, NF-\u0026kappa;\u0026beta;, miR-466l and TLR4 expression levels were significantly decreased by 4-fold, 5-fold, 1.5-fold and 5-fold, respectively (*p=0.022; ****p\u0026lt;0.0001; p=0.334; ***p =0.001) (Figure 3g).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eeffects of azathioprine and rice bran oil combination therapy on colitis parameters\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 2.5% DSS was administered for 7 days, 0.1 ml RBO and 0.01 ml/g AZA were administered to 6 C57Bl/6 mice for 8 days (Figure 4a). The AZA+RBO-supplemented group exhibited a significantly longer colon structure compared to the non-supplemented group (p = 0.0006) (Figure 4b/c), and this group also had a significantly lower DAI score (p = 0.0001) (Figure 4d). Micrographs show mucosa samples of groups which was stained with hematoxylin and eosin. In the examination performed after staining, inflammatory cell infiltration and muscularis mucosa were observed in the AZA+RBO group (100\u0026micro;m) (Figure 4e). Histological scores of UC (9.0\u0026plusmn;1.87) was also higher than UC+AZA+RBO group (5.25\u0026plusmn;0.96)\u0026nbsp;(*p=0.037) (Figure 4f).\u0026nbsp;The Ct values of IL6, IL10, TLR4, NF-\u0026kappa;\u0026beta;, miR-466l, ACTB, and U6 genes were determined by real-time PCR in the UC+AZA+RBO group (Table S5 in Supplement 1).\u0026nbsp;\u0026nbsp;It was observed that the IL10 expression level in the UC+RBO group was 3-fold higher than in the UC group (**p=0.002). IL6, NF-\u0026kappa;\u0026beta;, miR-466l and TLR4 expression levels were significantly decreased by 9-fold, 12-fold, 9-fold and 26-fold, respectively (****p\u0026lt;0.0001) (Figure 4g).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eeffects of Anti-miR-466l administration on colitis parameters\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter 2.5% DSS was administered for 7 days, 100\u0026micro;l (ip injection) antimiR466l were administered to 6 C57Bl/6 mice for 8 days (Figure 5a). The group inhibition with antimiR-466l showed a significantly longer colon compared to the UC group (****p\u0026lt;0.0001) (Figure 5b/c), and a significant improvement in DAI score compared to the control group was also observed (**p = 0.0017) (Figure 5d). In the examination performed after staining, inflammatory cell infiltration and muscularis mucosa were observed in the antimiR466l group (100\u0026micro;m) (Figure 5e). Histological scores of UC+antimiR466l (4.80\u0026plusmn;0.84) was also lower than UC (*p=0.015) (Figure 5f). The Ct values of IL6, IL10, TLR4, NF-\u0026kappa;\u0026beta;, miR-466l, ACTB, and U6 genes were determined by real-time PCR in the UC+AntimiR-466l group (Table S6 in Supplement 1). A 13-fold increase in the expression level of IL10 was observed (****p\u0026lt;0.0001).\u0026nbsp;Although a 6-fold decrease was observed in the expression level of NF-ᴋ\u0026beta;, no statistical significance was found. In contrast, IL6, NF-ĸ\u0026beta;, miR-466l, and TLR4 expression levels were significantly decreased by 4-fold, 6-fold, 77-fold, and 3-fold, respectively (***p = 0.007; ****p\u0026lt;0.0001\u003cstrong\u003e) (\u003c/strong\u003eFigure 5g\u003cstrong\u003e).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ct values of TLR4, NF-ĸ\u0026beta; and ACTB genes were determined by real-time PCR in the UC, UC+AZA+RBO and UC+AntimiR-466l group colon tissue (Table S7 in Supplement 1). The most significant effects in colon tissues were observed on the NF-\u0026kappa;\u0026beta; and TLR4 signaling pathways. AZA+RBO and AntimiR466l treatments suppressed the inflammatory response in colon tissue and significantly reduced NF-\u0026kappa;\u0026beta; and TLR4 gene expression. Specifically, compared to the UC group, an approximately 500-fold reduction in both genes was observed in these treatment groups (****p\u0026lt;0.0001) (Figure 6).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn our study, ulcerative colitis was induced in mice by administering 2.5% DSS, which resulted in a significant shortening of colon length and an increase in the DAI score. In the UC group, peripheral blood gene expression analysis showed a significant decrease in IL-10 expression, while IL-6, TLR4, NF-\u0026kappa;\u0026beta;, and miR-466l expression levels were significantly increased. Histological examinations of the DSS groups revealed crypt damage and intense inflammatory cell infiltration. It has been reported that DSS-induced colitis causes colon shortening and increased mucosal damage [55], while 3% DSS-induced colitis leads to shortened colon length, increased DAI scores, crypt destruction, aggravated inflammation, elevated IL-6 and TNF-\u0026alpha; levels, and decreased IL-10 [56]. Similarly, in a 2% DSS-induced rat colitis model, sinomenine treatment was shown to increase colon length, reduce DAI scores, and suppress NF-\u0026kappa;\u0026beta; expression [57]. Moreover, in the DSS colitis model, activation of the TLR4/NF-\u0026kappa;\u0026beta; signaling pathway has been demonstrated, and Higenamine (HG) treatment was found to inhibit this activation [58]. These studies in the literature support our findings of increased IL-6 expression and suppressed IL-10 expression. Overall, our results are consistent with previous reports showing that DSS-induced colitis models are characterized by NF-\u0026kappa;\u0026beta; and TLR4 signaling activation, increased IL-6, and decreased IL-10 expression [56-58].\u003c/p\u003e\n\u003cp\u003eAccording to the data obtained in our study, the significantly higher DAI score in the UC group compared to the UC+AZA group indicates that AZA treatment alleviates colitis symptoms and reduces disease severity. Our histological findings showed that the UC+AZA group had a significantly lower histological score compared to the UC group (9 \u0026plusmn; 1.87 vs 3.67 \u0026plusmn; 0.82), demonstrating that AZA treatment attenuates colitis pathology. In the literature, it has been reported that increased inflammatory infiltration extending from the mucosa to the submucosa and muscularis is a hallmark of severe colitis [59]. Accordingly, while the AZA group showed reduced mucosal inflammation, the control group exhibited almost no inflammation, and histological damage was markedly greater in UC. In our study, AZA treatment significantly reduced the expression of IL-6 (7-fold), miR-466l (3-fold), NF-\u0026kappa;\u0026beta; (6-fold), and TLR4 (9-fold). The efficacy of AZA in DSS-induced colitis has also been reported in previous studies [60]. AZA treatment has been shown to restore colon length toward normal and significantly reduce DAI scores compared to untreated mice [61, 62]. Our findings are consistent with earlier studies demonstrating that AZA suppresses NF-\u0026kappa;\u0026beta; pathways, regulates cytokine production, and modulates TLR4-mediated innate immune responses [63-65]. The AZA-induced reduction in NF-\u0026kappa;\u0026beta; expression likely reflects decreased activation of inflammatory cells and attenuation of colitis severity.\u003c/p\u003e\n\u003cp\u003eIn a DSS-induced colitis model, administration of the RBO compound \u0026gamma;-oryzanol has been shown to reduce inflammation by repairing the colonic barrier and suppressing the TLR4/NF-\u0026kappa;\u0026beta; pathway [66]. Findings from our study show that RBO supplementation significantly decreased IL-6, TLR4, and NF-\u0026kappa;\u0026beta; gene expression levels, and significantly increased IL-10 levels. In mice with colitis given RBO supplementation, colon length was preserved, DAI scores were decreased, and IL-6 and NF-\u0026kappa;\u0026beta; gene expression levels were reduced [67]. These findings are consistent with the longer colon tissue, lower DAI scores, and decreased IL-6/NF-\u0026kappa;\u0026beta; expression observed in the UC+RBO group in our study. Our RBO supplementation demonstrates that it may not only suppress inflammatory pathways but also support the production of anti-inflammatory mediators. These effects of RBO are thought to be due to its gamma-oryzanol, tocopherols, and tocotrienols, which suppress the NF-\u0026kappa;\u0026beta; pathway and increase IL-10 levels, thus balancing inflammation [11, 14, 68, 69]. \u0026gamma;-oryzanol has been reported to reduce proinflammatory cytokines by suppressing NF-\u0026kappa;\u0026beta; activation and through antioxidant effects, thereby reducing IL-6, TNF-\u0026alpha;, and COX-2 levels in mice with DSS-induced colitis and providing histological improvement [9]. Rice bran derivatives have been shown to modulate the gut microbiota, balance TLR4 signaling pathways, support the proliferation of beneficial bacteria, and regulate the immune system [67, 70]. Our findings suggest that RBO can provide clinical, histological, and molecular therapeutic effects on colitis, even with short-term use, and that this effect may not be independent of dose and duration.\u003c/p\u003e\n\u003cp\u003eThe combination of AZA and RBO suppresses inflammation in multiple ways by combining both immunosuppressive and antioxidant mechanisms [69, 71]. Our findings indicate that combination therapy more strongly reduced the expression of miR466l, NF-\u0026kappa;\u0026beta;, and TLR4, while significantly increasing IL-10 levels. The significant reduction in miR466l and NF-\u0026kappa;\u0026beta; gene expression and the increase in IL10 gene expression of the AZA+RBO combination support the synergistic anti-inflammatory effect of this treatment approach [10, 45, 72]. It has been reported that the combination of AZA and natural compounds has a synergistic effect on inflammation and increases its efficacy in the treatment of colitis [73]. The immunosuppressive effect of AZA combined with the antioxidant and anti-inflammatory effects of RBO provided a more effective modulation of inflammation [11, 13, 71]. These findings support the efficacy of the combination of AZA and RBO at the clinical and molecular levels. The regulatory role of miR466l on inflammation has been demonstrated in previous studies. MiR466l is known to modulate inflammation by affecting the expression of proinflammatory cytokines, particularly IL6 and IL10 [74, 75]. The combination of AZA and RBO created a strong synergy in suppressing inflammation by decreasing the expression of miR466l. This result suggests that combination therapy may be more effective in the molecular regulation of inflammation compared to monotherapies. Furthermore, this synergistic effect may be explained by the coordinated regulation of inflammatory pathways at both the genetic and epigenetic levels. Similarly, combinations of natural antioxidants and immunosuppressants have shown superior results in controlling inflammation [76, 77]. For example, studies using tocopherol and AZA together have reported more effective control of intestinal inflammation [78]. This supports the interaction between the components of RBO and the immunomodulatory effects of AZA. While studies integrating various immunosuppressive and antioxidant mechanisms to achieve improved efficacy in the treatment of colitis are available in the literature, our study is the first to demonstrate the therapeutic potential of the combination of AZA and RBO, highlighting a new synergistic strategy.\u003c/p\u003e\n\u003cp\u003eAnother novel aspect of our study is the role of microRNA-466l in colitis, observed in the UC-antimiR466l treatment group. Our findings showed that inhibiting miR-466l in colitic mice resulted in significant improvements (longer colons, lower DAI, and reduced histological damage) comparable to the UC group. In our study, when we compared the UC-antimiR-466l group with the UC group, we observed significant decreases in the expression levels of IL-6 (4-fold), TLR4 (3-fold), and miR466l (77-fold), and increased IL10 (13-fold) gene expression. The literature suggests that miR466l and similar microRNAs may be potential therapeutic targets in the treatment of inflammatory diseases [75, 79]. miR-466l appears to be a key regulator in our colitis model, and its inhibition may represent a therapeutic strategy to shift the balance toward resolution. Our findings suggest that the pro-inflammatory effect of miR-466l may be dominant in chronic colitis, and that inhibiting miR-466l provides clear anti-inflammatory benefits. In our study, blocking miR-466l led to a decrease in NF-\u0026kappa;\u0026beta; and IL-6 levels, which in turn led to an increase in IL-10, resulting in overall improvement in colitis. These findings suggest that antimiR466l offers a novel therapeutic option for modulating inflammation. The absence of a specific study in the literature on antimiR-466L in ulcerative colitis makes our study a significant contribution to pioneering innovative microRNA-targeted therapeutic approaches to colitis inflammation.\u003c/p\u003e\n\u003cp\u003eIn our study, a significant decrease in NF-\u0026kappa;\u0026beta; and TLR4 mRNA levels, particularly in colonic tissue, was observed with AZA+RBO and antimiR-466l administration. Our findings suggest that miR-466l may play a regulatory role in the NF-\u0026kappa;\u0026beta;/TLR4 pathway and are consistent with findings in the literature that similar miRNAs (e.g., miR-146a, miR-125b, miR-223) suppress inflammation by targeting TLR4/MyD88/NF-\u0026kappa;\u0026beta; signaling [80, 81]. The stronger changes in colonic tissue compared to those in blood reflect the direct effects of local inflammation, different miRNA profiles, cellular diversity, and microbiota interactions. In contrast, weaker profiles detected in blood may be valuable for non-invasive biomarkers [82, 83]. Our results are consistent with the literature indicating the therapeutic potential of strategies targeting the NF-\u0026kappa;\u0026beta; pathway in ulcerative colitis [84] and provide complementary information from both regulatory and diagnostic perspectives.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur pioneering study demonstrates for the first time how suppressing miR-466l expression in UC specifically affects the role of increasing the levels of the anti-inflammatory gene IL-10 and decreasing the expression of inflammation-related genes IL-6, TLR4, and NF-\u0026kappa;\u0026beta;. Given that miR-466l is associated with inflammation and the immune system, it can be inferred that patient-based research in this area may have significant implications for the diagnosis, monitoring, and treatment of UC in the future. Furthermore, the combination of AZA treatment and RBO creates a synergistic effect by suppressing inflammation through the IL-6/TLR4\u0026ndash;NF-\u0026kappa;\u0026beta; signaling pathways, while simultaneously boosting IL-10 levels. As a result, this combined approach not only enhances inflammation regulation but also improves tolerance to AZA\u0026apos;s side effects.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u003c/strong\u003e Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e The present study was conducted with financial support from the Gazi University Research Fund (Project ID: TDK-2024\u0026ndash;\u0026nbsp;9312).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003eData is provided within the manuscript or supplementary information files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution:\u003c/strong\u003e EK and GE conceived and designed the research. GE performed the research. EK interpreted the experimental data. Statistical analysis was performed by EK and GE. GE confirmed the authenticity of all the raw data. SEO performed the histological analysis. OE contributed to the design of the UC model and provided expertise on the treatment regimen. EK handled project administration, funding acquisition, and supervision. All authors approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval:\u0026nbsp;\u003c/strong\u003eThe animal experiments were approved by the Gazi University Local Ethics Committee for Animal Experiments (Approval date and number: 19.01.2024 - G.U.E.866742)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatient consent for publication:\u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information:\u0026nbsp;\u003c/strong\u003eThe author ORCID IDs are as follows: Dr Gizem Esenturk, 0000-0002-8041-6633; Dr. S\u0026uuml;heyla Esra \u0026Ouml;zko\u0026ccedil;er, 0000-0002-6413-1988; Professor Odul Egritas 0000-0003-0230-7551; and Professor Ece Konac 0000-0001-5129-2515.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDiez-Martin, E. et al. Inflammatory Bowel Disease: A Comprehensive Analysis of Molecular Bases, Predictive Biomarkers, Diagnostic Methods, and Therapeutic Options. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 7062. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25137062\u003c/span\u003e\u003cspan address=\"10.3390/ijms25137062\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarinković, G., Hamers, A. A., de Vries, C. J. \u0026amp; de Waard, V. 6-Mercaptopurine reduces macrophage activation and gut epithelium proliferation through inhibition of GTPase Rac1. \u003cem\u003eInflamm. Bowel Dis.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e, 1487\u0026ndash;1495. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/MIB.0000000000000122\u003c/span\u003e\u003cspan address=\"10.1097/MIB.0000000000000122\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMallick, B. \u0026amp; Malik, S. Use of Azathioprine in Ulcerative Colitis: A Comprehensive Review. Cureus 14, 24874. (2022). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7759/cureus.24874\u003c/span\u003e\u003cspan address=\"10.7759/cureus.24874\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHelmy, A. M., Elsabahy, M., Soliman, G. M., Mahmoud, M. A. \u0026amp; Ibrahim, E. A. Development and in vivo evaluation of chitosan beads for the colonic delivery of azathioprine for treatment of inflammatory bowel disease. \u003cem\u003eEur. J. Pharm. Sci.\u003c/em\u003e \u003cb\u003e109\u003c/b\u003e, 269\u0026ndash;279. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejps.2017.08.025\u003c/span\u003e\u003cspan address=\"10.1016/j.ejps.2017.08.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao, D., Qin, D., Yin, L. \u0026amp; Yang, Q. Integrated bioinformatics analysis and experimental verification of immune cell infiltration and the related core genes in ulcerative colitis. \u003cem\u003ePharmgenomics Pers. Med.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 629\u0026ndash;643. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/PGPM.S406644\u003c/span\u003e\u003cspan address=\"10.2147/PGPM.S406644\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, Y. P. et al. Association between thiopurine S-methyltransferase polymorphisms and thiopurine-induced adverse drug reactions in patients with inflammatory bowel disease: a meta-analysis. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, e0121745. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0121745\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0121745\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePestana-Bauer, V. R., Zambiazi, R. C., Mendon\u0026ccedil;a, C. R., Beneito-Cambra, M. \u0026amp; Ramis-Ramos, G. γ-Oryzanol and tocopherol contents in residues of rice bran oil refining. \u003cem\u003eFood Chem.\u003c/em\u003e \u003cb\u003e134\u003c/b\u003e, 1479\u0026ndash;1483. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.foodchem.2012.03.059\u003c/span\u003e\u003cspan address=\"10.1016/j.foodchem.2012.03.059\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRao, Y. P. C., Sugasini, D. \u0026amp; Lokesh, B. R. Dietary gamma oryzanol plays a significant role in the anti-inflammatory activity of rice bran oil by decreasing pro-inflammatory mediators secreted by peritoneal macrophages of rats. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e479\u003c/b\u003e, 747\u0026ndash;752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2016.09.140\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2016.09.140\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIslam, M. S. et al. Anti-inflammatory effects of phytosterylferulates in colitis induced by dextran sulphate sodium in mice. \u003cem\u003eBr. J. Pharmacol.\u003c/em\u003e \u003cb\u003e154\u003c/b\u003e, 812\u0026ndash;824. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/bjp.2008.137\u003c/span\u003e\u003cspan address=\"10.1038/bjp.2008.137\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIslam, M. S., Ushio, H., Hori, M. \u0026amp; Ozaki, H. Cycloartenyl ferulate downregulates lipopolysaccharide-stimulated iNOS mRNA via NF-κβ suppression in RAW 264.7 macrophages. \u003cem\u003eAsian J. Med. Biol. Res.\u003c/em\u003e \u003cb\u003e2\u003c/b\u003e, 523\u0026ndash;531. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3329/ajmbr.v2i4.30992\u003c/span\u003e\u003cspan address=\"10.3329/ajmbr.v2i4.30992\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee, S. et al. Rice bran oil ameliorates inflammatory responses by enhancing mitochondrial respiration in murine macrophages. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e14\u003c/b\u003e, e0222857. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0222857\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0222857\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReddy, K. V., Maheswaraiah, A. \u0026amp; Naidu, K. A. Rice bran oil and n-3 fatty acid-rich garden cress (Lepidium sativum) seed oil attenuate murine model of ulcerative colitis. \u003cem\u003eInt. J. Colorectal Dis.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 267\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00384-013-1785-7\u003c/span\u003e\u003cspan address=\"10.1007/s00384-013-1785-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePark, H., Yu, S. \u0026amp; Kim, W. Rice bran oil attenuates chronic inflammation by inducing M2 macrophage switching in high-fat diet-fed obese mice. \u003cem\u003eFoods\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 359. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/foods10020359\u003c/span\u003e\u003cspan address=\"10.3390/foods10020359\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKettawan, A. et al. Rice bran oil improves emphysema in cigarette smoke extract-induced mice through anti-inflammatory and antioxidative effects. \u003cem\u003eNutrients\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 433. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu16030433\u003c/span\u003e\u003cspan address=\"10.3390/nu16030433\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMahdavi-Roshan, M. et al. The effects of rice bran oil on left ventricular systolic function, cardiometabolic risk factors and inflammatory mediators in men with coronary artery disease: a randomized clinical trial. \u003cem\u003eFood Funct.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 4446\u0026ndash;4457. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/d1fo00094b\u003c/span\u003e\u003cspan address=\"10.1039/d1fo00094b\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYadav, N. V. et al. Sesame oil and rice bran oil ameliorate adjuvant-induced arthritis in rats: distinguishing the role of minor components and fatty acids. \u003cem\u003eLipids\u003c/em\u003e \u003cb\u003e51\u003c/b\u003e, 1385\u0026ndash;1395. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11745-016-4203-4\u003c/span\u003e\u003cspan address=\"10.1007/s11745-016-4203-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbdel-Rahman, R. F. et al. The involvement of TGF-β1/FAK/α-SMA pathway in the antifibrotic impact of rice bran oil on thioacetamide-induced liver fibrosis in rats. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e, e0260130. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0260130\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0260130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKawai, T. \u0026amp; Akira, S. The role of pattern-recognition receptors in innate immunity: update on toll-like receptors. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 373\u0026ndash;384. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ni.1863\u003c/span\u003e\u003cspan address=\"10.1038/ni.1863\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeutler, B., Du, X. \u0026amp; Poltorak, A. Identification of toll-like receptor 4 (Tlr4) as the sole conduit for LPS signal transduction: genetic and evolutionary studies. \u003cem\u003eJ. Endotoxin Res.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 277\u0026ndash;280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1177/09680519010070040901\u003c/span\u003e\u003cspan address=\"10.1177/09680519010070040901\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQu, Y. et al. Kaempferol alleviates murine experimental colitis by restoring gut microbiota and inhibiting the LPS-TLR4-NF-κβ axis. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 679897. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2021.679897\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.679897\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang, S. et al. Effects of folate-chicory acid liposome on macrophage polarization and TLR4/NF-κβ signaling pathway in ulcerative colitis mouse. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cb\u003e128\u003c/b\u003e, 155415. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phymed.2024.155415\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2024.155415\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang, X. et al. Resatorvid (TAK-242) ameliorates ulcerative colitis by modulating macrophage polarization and T helper cell balance via TLR4/JAK2/STAT3 signaling pathway. \u003cem\u003eInflammation\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e, 2108\u0026ndash;2128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phymed.2024.155415\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2024.155415\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng, J. et al. Taurine alleviates experimental colitis by enhancing intestinal barrier function and inhibiting inflammatory response through TLR4/NF-κB signaling. \u003cem\u003eJ. Agric. Food Chem.\u003c/em\u003e \u003cb\u003e72\u003c/b\u003e, 12119\u0026ndash;12129. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jafc.4c00662\u003c/span\u003e\u003cspan address=\"10.1021/acs.jafc.4c00662\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo, H. et al. Oyster peptides ameliorate dextran sulfate sodium-induced ulcerative colitis via modulating the gut microbiota and inhibiting the TLR4/NF-κB pathway. \u003cem\u003eNutrients\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 1591. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu16111591\u003c/span\u003e\u003cspan address=\"10.3390/nu16111591\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang, S., Chen, C., Li, R., Jiang, G. \u0026amp; Du, L. Costunolide and dehydrocostus lactone alleviate ulcerative colitis via regulating TLR4, NF-κB and PI3K expression. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 29777 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWaldner, M. J. \u0026amp; Neurath, M. F. Master regulator of intestinal disease: IL-6 in chronic inflammation and cancer development. \u003cem\u003eSemin Immunol.\u003c/em\u003e \u003cb\u003e26\u003c/b\u003e, 75\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-024-77021-5\u003c/span\u003e\u003cspan address=\"10.1038/s41598-024-77021-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, K. et al. Expression of interleukin 6 in brain and colon of rats with TNBS-induced colitis. \u003cem\u003eWorld J. Gastroenterol.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 2252\u0026ndash;2259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3748/wjg.v16.i18.2252\u003c/span\u003e\u003cspan address=\"10.3748/wjg.v16.i18.2252\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEl-Mahdy, N. A., El-Sayad, M. E., El-Kadem, A. H. \u0026amp; Abu-Risha, S. E. Targeting IL-10, ZO-1 gene expression and IL-6/STAT-3 trans-signaling by a combination of atorvastatin and mesalazine to enhance anti-inflammatory effects and attenuate progression of oxazolone-induced colitis. \u003cem\u003eFundam Clin. Pharmacol.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 143\u0026ndash;155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/fcp.12563\u003c/span\u003e\u003cspan address=\"10.1111/fcp.12563\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng, Z. et al. Traditional herbal pair Portulacae Herba and Granati Pericarpium alleviates DSS-induced colitis in mice through IL-6/STAT3/SOCS3 pathway. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cb\u003e126\u003c/b\u003e, 155283. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.phymed.2023.155283\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2023.155283\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eElhefnawy, E. A., Zaki, H. F., El Maraghy, N. N., Ahmed, K. A. \u0026amp; Abd El-Haleim, E. A. Genistein and/or sulfasalazine ameliorate acetic acid-induced ulcerative colitis in rats via modulating INF-γ/JAK1/STAT1/IRF-1, TLR-4/NF-κB/IL-6, and JAK2/STAT3/COX-2 crosstalk. \u003cem\u003eBiochem. Pharmacol.\u003c/em\u003e \u003cb\u003e214\u003c/b\u003e, 115673. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bcp.2023.115673\u003c/span\u003e\u003cspan address=\"10.1016/j.bcp.2023.115673\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAhmadi, A. et al. Investigating the expression of anti/pro-inflammatory cytokines in the pathogenesis and treatment of ulcerative colitis and its association with serum level of vitamin D. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 7569. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-025-87551-1\u003c/span\u003e\u003cspan address=\"10.1038/s41598-025-87551-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAghamohamadi, E. et al. Gene expression analysis of intestinal IL-8, IL-17A and IL-10 in patients with celiac and inflammatory bowel diseases. \u003cem\u003eMol. Biol. Rep.\u003c/em\u003e \u003cb\u003e49\u003c/b\u003e, 6085\u0026ndash;6091. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11033-022-07397-y\u003c/span\u003e\u003cspan address=\"10.1007/s11033-022-07397-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorshedzadeh, N. et al. The effects of flaxseed supplementation on gene expression and inflammation in ulcerative colitis patients: an open-labelled randomised controlled trial. \u003cem\u003eInt. J. Clin. Pract.\u003c/em\u003e \u003cb\u003e75\u003c/b\u003e, e14035. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/ijcp.14035\u003c/span\u003e\u003cspan address=\"10.1111/ijcp.14035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, Z. et al. A polyphenol-assisted IL-10 mRNA delivery system for ulcerative colitis. \u003cem\u003eActa Pharm. Sin B\u003c/em\u003e. \u003cb\u003e12\u003c/b\u003e, 3367\u0026ndash;3382. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.apsb.2022.03.025\u003c/span\u003e\u003cspan address=\"10.1016/j.apsb.2022.03.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTao, Y. et al. Chitosan-coated artesunate protects against ulcerative colitis via STAT6-mediated macrophage M2 polarization and intestinal barrier protection. \u003cem\u003eInt. J. Biol. Macromol.\u003c/em\u003e \u003cb\u003e254\u003c/b\u003e, 127680. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ijbiomac.2023.127680\u003c/span\u003e\u003cspan address=\"10.1016/j.ijbiomac.2023.127680\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, X. et al. SIRT3 activator honokiol inhibits Th17 cell differentiation and alleviates colitis. \u003cem\u003eInflamm. Bowel Dis.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 1929\u0026ndash;1940. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/ibd/izad099\u003c/span\u003e\u003cspan address=\"10.1093/ibd/izad099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, D., Saikam, V., Skrada, K. A., Merlin, D. \u0026amp; Iyer, S. S. Inflammatory bowel disease biomarkers. \u003cem\u003eMed. Res. Rev.\u003c/em\u003e \u003cb\u003e42\u003c/b\u003e, 1856\u0026ndash;1887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/med.21893\u003c/span\u003e\u003cspan address=\"10.1002/med.21893\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu, F. et al. MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cb\u003e135\u003c/b\u003e, 1624\u0026ndash;1635. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/j.gastro.2008.07.068\u003c/span\u003e\u003cspan address=\"10.1053/j.gastro.2008.07.068\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFasseu, M. et al. Identification of restricted subsets of mature microRNA abnormally expressed in inactive colonic mucosa of patients with inflammatory bowel disease. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e5\u003c/b\u003e, e13160. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0013160\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0013160\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang, Y. et al. Overexpression of miR-21 in patients with ulcerative colitis impairs intestinal epithelial barrier function through targeting the Rho GTPase RhoB. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e434\u003c/b\u003e, 746\u0026ndash;752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2013.03.122\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2013.03.122\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQuaglio, A. E. V., Santaella, F. J., Rodrigues, M. A. M., Sassaki, L. Y. \u0026amp; Di Stasi, L. C. MicroRNAs expression influence in ulcerative colitis and Crohn's disease: a pilot study for the identification of diagnostic biomarkers. \u003cem\u003eWorld J. Gastroenterol.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 7801\u0026ndash;7812. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3748/wjg.v27.i45.7801\u003c/span\u003e\u003cspan address=\"10.3748/wjg.v27.i45.7801\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchaefer, J. S. et al. MicroRNA signatures differentiate Crohn's disease from ulcerative colitis. \u003cem\u003eBMC Immunol.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12865-015-0069-0\u003c/span\u003e\u003cspan address=\"10.1186/s12865-015-0069-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015). 5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchaefer, J. S., Montufar-Solis, D., Vigneswaran, N. \u0026amp; Klein, J. R. Selective upregulation of microRNA expression in peripheral blood leukocytes in IL-10-/- mice precedes expression in the colon. \u003cem\u003eJ. Immunol.\u003c/em\u003e \u003cb\u003e187\u003c/b\u003e, 5834\u0026ndash;5841. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.1100922\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.1100922\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCalabrese, J. M., Seila, A. C., Yeo, G. W. \u0026amp; Sharp, P. A. RNA sequence analysis defines Dicer's role in mouse embryonic stem cells. \u003cem\u003eProc. Natl. Acad. Sci. U S A\u003c/em\u003e. \u003cb\u003e104\u003c/b\u003e, 18097\u0026ndash;18102. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.0709193104\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0709193104\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa, F. et al. MicroRNA-466l upregulates IL-10 expression in TLR-triggered macrophages by antagonizing RNA-binding protein tristetraprolin-mediated IL-10 mRNA degradation. \u003cem\u003eJ. Immunol.\u003c/em\u003e \u003cb\u003e184\u003c/b\u003e, 6053\u0026ndash;6059. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4049/jimmunol.0902308\u003c/span\u003e\u003cspan address=\"10.4049/jimmunol.0902308\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi, M. M. et al. Role of miR-466 in mesenchymal stromal cell-derived extracellular vesicles treating inoculation pneumonia caused by multidrug-resistant Pseudomonas aeruginosa. \u003cem\u003eClin. Transl Med.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, e287. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ctm2.287\u003c/span\u003e\u003cspan address=\"10.1002/ctm2.287\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTanideh, N. et al. Protection by pure and genistein-fortified extra virgin olive oil, canola oil, and rice bran oil against acetic acid-induced ulcerative colitis in rats. \u003cem\u003eFood Funct.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 860\u0026ndash;870. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/c9fo01951k\u003c/span\u003e\u003cspan address=\"10.1039/c9fo01951k\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh, R. et al. miR-10b-5p rescues diabetes and gastrointestinal dysmotility. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cb\u003e160\u003c/b\u003e, 1662\u0026ndash;1678e18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/j.gastro.2020.12.062\u003c/span\u003e\u003cspan address=\"10.1053/j.gastro.2020.12.062\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWirtz, S. et al. Chemically induced mouse models of acute and chronic intestinal inflammation. \u003cem\u003eNat. Protoc.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 1295\u0026ndash;1309. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nprot.2017.044\u003c/span\u003e\u003cspan address=\"10.1038/nprot.2017.044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWen, S. et al. Stigmasterol restores the balance of Treg/Th17 cells by activating the butyrate-PPARγ axis in colitis. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 741934. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2021.741934\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.741934\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrunau, A., Escher, U., K\u0026uuml;hl, A. A., Bereswill, S. \u0026amp; Heimesaat, M. M. Toll-like receptor-4 differentially mediates intestinal and extra-intestinal immune responses upon multi-drug resistant Pseudomonas aeruginosa association of IL10-/- mice with chronic colitis. \u003cem\u003eGut Pathog\u003c/em\u003e. \u003cb\u003e9\u003c/b\u003e, 61. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13099-017-0211-z\u003c/span\u003e\u003cspan address=\"10.1186/s13099-017-0211-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGolusda, L. et al. Visualization of inflammation in experimental colitis by magnetic resonance imaging using very small superparamagnetic iron oxide particles. \u003cem\u003eFront. Physiol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 862212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fphys.2022.862212\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2022.862212\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePfaffl, M. W., Horgan, G. W. \u0026amp; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e30\u003c/b\u003e, e36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/30.9.e36\u003c/span\u003e\u003cspan address=\"10.1093/nar/30.9.e36\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKonac, E. et al. Endometrial mRNA expression of matrix metalloproteinases, their tissue inhibitors and cell adhesion molecules in unexplained infertility and implantation failure patients. \u003cem\u003eReprod. Biomed. Online\u003c/em\u003e. \u003cb\u003e19\u003c/b\u003e, 391\u0026ndash;397. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s1472-6483(10)60174-5\u003c/span\u003e\u003cspan address=\"10.1016/s1472-6483(10)60174-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun, Q. et al. WKB ameliorates DSS-induced colitis through inhibiting enteric glial cells activation and altering the intestinal microbiota. \u003cem\u003eJ. Transl Med.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12967-025-06085-2\u003c/span\u003e\u003cspan address=\"10.1186/s12967-025-06085-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMao, N. et al. Matrine ameliorates DSS-induced colitis by suppressing inflammation, modulating oxidative stress and remodeling the gut microbiota. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 6613. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25126613\u003c/span\u003e\u003cspan address=\"10.3390/ijms25126613\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNiu, Z., Li, X., Yang, X. \u0026amp; Sun, Z. Protective effects of sinomenine against dextran sulfate sodium-induced ulcerative colitis in rats via alteration of HO-1/Nrf2 and inflammatory pathway. \u003cem\u003eInflammopharmacology\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e, 2007\u0026ndash;2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10787-024-01455-6\u003c/span\u003e\u003cspan address=\"10.1007/s10787-024-01455-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShao, X. X., Xu, Y., Xiao, H. Y., Hu, Y. \u0026amp; Jiang, Y. Higenamine improves DSS-induced ulcerative colitis in mice through the Galectin-3/TLR4/NF-κB pathway. \u003cem\u003eTissue Cell.\u003c/em\u003e \u003cb\u003e82\u003c/b\u003e, 102111. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tice.2023.102111\u003c/span\u003e\u003cspan address=\"10.1016/j.tice.2023.102111\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eErben, U. et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models. \u003cem\u003eInt. J. Clin. Exp. Pathol.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 4557\u0026ndash;4576 (2014). ISSN:1936\u0026ndash;2625/IJCEP0001236.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMorgan, S. et al. Azathioprine has a deleterious effect on the bone health of mice with DSS-induced inflammatory bowel disease. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e, 6085. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms20236085\u003c/span\u003e\u003cspan address=\"10.3390/ijms20236085\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang, Z. et al. Amomum tsaoko flavonoids attenuate ulcerative colitis by inhibiting TLR4/NF-κB/NLRP3 signaling pathway and modulating gut microbiota in mice. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 1557778. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2025.1557778\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2025.1557778\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKajimura, Y. et al. E4BP4 in macrophages induces an anti-inflammatory phenotype that ameliorates the severity of colitis. \u003cem\u003eCommun. Biol.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 527. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s42003-024-06099-4\u003c/span\u003e\u003cspan address=\"10.1038/s42003-024-06099-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThangavel, J. et al. Epigenetic modifiers reduce inflammation and modulate macrophage phenotype during endotoxemia-induced acute lung injury. \u003cem\u003eJ. Cell. Sci.\u003c/em\u003e \u003cb\u003e128\u003c/b\u003e, 3094\u0026ndash;3105. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/jcs.170258\u003c/span\u003e\u003cspan address=\"10.1242/jcs.170258\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, Z., Dong, W. H., Wu, Q. \u0026amp; Wang, J. Two-layer regulation of TRAF6 mediated by both TLR4/NF-κβ signaling and miR-589-5p increases proinflammatory cytokines in the pathology of severe acute pancreatitis. \u003cem\u003eAm. J. Transl Res.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 2379\u0026ndash;2395 (2020). ISSN:1943\u0026ndash;8141/AJTR0107576.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFeng, Z., Meng, R., Li, Q., Li, D. \u0026amp; Xu, Q. 5-aza-2'-deoxycytidine may regulate the inflammatory response of human odontoblast-like cells through the NF-κB pathway. \u003cem\u003eInt. Endod J.\u003c/em\u003e \u003cb\u003e54\u003c/b\u003e, 1105\u0026ndash;1117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/iej.13488\u003c/span\u003e\u003cspan address=\"10.1111/iej.13488\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXia, X. et al. Oryzanol ameliorates DSS-stimulated gut barrier damage via targeting the gut microbiota accompanied by the TLR4/NF-κB/NLRP3 cascade response in vivo. \u003cem\u003eJ. Agric. Food Chem.\u003c/em\u003e \u003cb\u003e70\u003c/b\u003e, 15747\u0026ndash;15762. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jafc.2c04354\u003c/span\u003e\u003cspan address=\"10.1021/acs.jafc.2c04354\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTajasuwan, L., Kettawan, A., Rungruang, T., Wunjuntuk, K. \u0026amp; Prombutara, P. Role of dietary defatted rice bran in the modulation of gut microbiota in AOM/DSS-induced colitis-associated colorectal cancer rat model. \u003cem\u003eNutrients\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 1528. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu15061528\u003c/span\u003e\u003cspan address=\"10.3390/nu15061528\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMastinu, A. et al. Gamma-oryzanol prevents LPS-induced brain inflammation and cognitive impairment in adult mice. \u003cem\u003eNutrients\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 728. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu11040728\u003c/span\u003e\u003cspan address=\"10.3390/nu11040728\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLo, H. C., Chen, Y. H. \u0026amp; Wu, W. T. Ethanol extracts of rice bran and whole grain adlay seeds mitigate colonic inflammation and damage in mice with colitis. \u003cem\u003eNutrients\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 3877. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu14183877\u003c/span\u003e\u003cspan address=\"10.3390/nu14183877\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHenderson, A. J., Kumar, A., Barnett, B., Dow, S. W. \u0026amp; Ryan, E. P. Consumption of rice bran increases mucosal immunoglobulin A concentrations and numbers of intestinal Lactobacillus spp. \u003cem\u003eJ. Med. Food\u003c/em\u003e. \u003cb\u003e15\u003c/b\u003e, 469\u0026ndash;475. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1089/jmf.2011.0213\u003c/span\u003e\u003cspan address=\"10.1089/jmf.2011.0213\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTajasuwan, L. et al. Inhibitory effect of dietary defatted rice bran in an AOM/DSS-induced colitis-associated colorectal cancer experimental animal model. \u003cem\u003eFoods\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 3488. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/foods11213488\u003c/span\u003e\u003cspan address=\"10.3390/foods11213488\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLazcano-Silveira, R. et al. Carbon 60 dissolved in grapeseed oil inhibits dextran sodium sulfate-induced experimental colitis. \u003cem\u003eJ. Inflamm. Res.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 4185\u0026ndash;4198. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/JIR.S366886\u003c/span\u003e\u003cspan address=\"10.2147/JIR.S366886\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumar, D. et al. A randomized double-blind, placebo-controlled trial of artesunate and curcumin in patients with Crohn\u0026rsquo;s disease: a pilot study. \u003cem\u003eJGH Open.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, e70211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jgh3.70211\u003c/span\u003e\u003cspan address=\"10.1002/jgh3.70211\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe, X., Jing, Z. \u0026amp; Cheng, G. MicroRNAs: new regulators of Toll-like receptor signalling pathways. Biomed Res Int 945169. (2014). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2014/945169\u003c/span\u003e\u003cspan address=\"10.1155/2014/945169\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, Y. et al. Plasticity of leukocytic exudates in resolving acute inflammation is regulated by microRNA and proresolving mediators. \u003cem\u003eImmunity\u003c/em\u003e \u003cb\u003e39\u003c/b\u003e, 885\u0026ndash;898. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.immuni.2013.10.011\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2013.10.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEl-Gowelli, H. M., Saad, E. I., Abdel-Galil, A. G. \u0026amp; Ibrahim, E. R. Co-administration of α-lipoic acid and cyclosporine aggravates colon ulceration of acetic acid-induced ulcerative colitis via facilitation of NO/COX-2/miR-210 cascade. \u003cem\u003eToxicol. Appl. Pharmacol.\u003c/em\u003e \u003cb\u003e288\u003c/b\u003e, 300\u0026ndash;312. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.taap.2015.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.taap.2015.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarthikeyan, A. et al. Curcumin and its modified formulations on inflammatory bowel disease (IBD): the story so far and future outlook. \u003cem\u003ePharmaceutics\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 484. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/pharmaceutics13040484\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics13040484\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMirbagheri, S. A., Nezami, B. G., Assa, S. \u0026amp; Hajimahmoodi, M. Rectal administration of d-alpha tocopherol for active ulcerative colitis: a preliminary report. \u003cem\u003eWorld J. Gastroenterol.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 5990\u0026ndash;5995. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3748/wjg.14.5990\u003c/span\u003e\u003cspan address=\"10.3748/wjg.14.5990\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrown, P. N. \u0026amp; Yin, H. PNA-based microRNA inhibitors elicit anti-inflammatory effects in microglia cells. \u003cem\u003eChem. Commun. (Camb)\u003c/em\u003e. \u003cb\u003e49\u003c/b\u003e, 4415\u0026ndash;4417. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1039/c2cc36540e\u003c/span\u003e\u003cspan address=\"10.1039/c2cc36540e\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, J. P., Dong, L. N., Wang, M., Guo, J. \u0026amp; Zhao, Y. Q. miR-146a regulates the development of ulcerative colitis via mediating the TLR4/MyD88/NF-κB signaling pathway. \u003cem\u003eEur. Rev. Med. Pharmacol. Sci.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 2151\u0026ndash;2157. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.26355/eurrev_201903_17260\u003c/span\u003e\u003cspan address=\"10.26355/eurrev_201903_17260\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiao, X. et al. miRNAs can affect intestinal epithelial barrier in inflammatory bowel disease. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 868229. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2022.868229\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2022.868229\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMasi, L. et al. MicroRNAs as innovative biomarkers for inflammatory bowel disease and prediction of colorectal cancer. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 7991. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms23147991\u003c/span\u003e\u003cspan address=\"10.3390/ijms23147991\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMi, S., Zhang, J., Zhang, W. \u0026amp; Huang, R. S. Circulating microRNAs as biomarkers for inflammatory diseases. \u003cem\u003eMicrorna\u003c/em\u003e \u003cb\u003e2\u003c/b\u003e, 63\u0026ndash;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2174/2211536611302010007\u003c/span\u003e\u003cspan address=\"10.2174/2211536611302010007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu, P. D. \u0026amp; Zhao, Y. H. Targeting NF-κB pathway for treating ulcerative colitis: comprehensive regulatory characteristics of Chinese medicines. \u003cem\u003eChin. Med.\u003c/em\u003e \u003cb\u003e15\u003c/b\u003e, 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13020-020-0296-z\u003c/span\u003e\u003cspan address=\"10.1186/s13020-020-0296-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2020).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Ulcerative colitis, Rice bran oil, Anti-miR-466l, TLR4/NF-ĸβ Signaling, IL-6/10","lastPublishedDoi":"10.21203/rs.3.rs-7845870/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7845870/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study aimed to evaluate the anti-inflammatory effects of azathioprine (AZA), rice bran oil (RBO), and antisense miR-466l in a dextran sulfate sodium (DSS)-induced ulcerative colitis (UC) model. The synergistic effect of AZA with RBO and the therapeutic potential of miR-466l inhibition were investigated. Forty male C57BL/6 mice were assigned to six groups: control, UC, UC\u0026thinsp;+\u0026thinsp;AZA, UC\u0026thinsp;+\u0026thinsp;RBO, UC\u0026thinsp;+\u0026thinsp;AZA\u0026thinsp;+\u0026thinsp;RBO, and UC\u0026thinsp;+\u0026thinsp;anti-miR-466l. Disease severity was evaluated by colon length, Disease Activity Index (DAI), and histopathological scoring. Expression levels of IL-6/IL-10/NF-κβ/TLR4 and miR-466l were analyzed using qRT-PCR. DSS exposure resulted in severe inflammation, colon shortening, and increased DAI scores, along with upregulation of IL-6/TLR4/NF-κβ, and miR-466l, and a marked reduction in IL-10. AZA and RBO treatments attenuated these effects, improving mucosal architecture and restoring cytokine balance. The combined AZA\u0026thinsp;+\u0026thinsp;RBO therapy exhibited the strongest anti-inflammatory response, significantly suppressing pro-inflammatory markers and enhancing IL-10 expression. Anti-miR-466l treatment improved both molecular and histological parameters, highlighting its role in inflammation regulation. The combination therapy provided superior outcomes compared to monotherapies, suggesting a synergistic modulation of immune and oxidative pathways. Overall, integrating AZA, RBO, and miR-466l inhibition may offer a promising and synergistic therapeutic strategy for ulcerative colitis management.\u003c/p\u003e","manuscriptTitle":"Synergistic Suppression of Inflammation by AZA, Rice Bran Oil, and AntimiR-466l through IL-6/NF-κβ/TLR4 Pathways in Mice Model of Ulcerative Colitis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-13 11:20:19","doi":"10.21203/rs.3.rs-7845870/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"87b131e1-6e32-4a40-93ad-da8eaabd4c39","owner":[],"postedDate":"November 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":57822837,"name":"Health sciences/Diseases"},{"id":57822838,"name":"Health sciences/Gastroenterology"},{"id":57822839,"name":"Biological sciences/Immunology"}],"tags":[],"updatedAt":"2026-05-13T09:02:12+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-13 11:20:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7845870","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7845870","identity":"rs-7845870","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}