Pervasive homeobox gene function in the male-specific nervous system of Caenorhabditis elegans

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 99,809 characters · extracted from preprint-html · click to expand
Pervasive homeobox gene function in the male-specific nervous system of Caenorhabditis elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Pervasive homeobox gene function in the male-specific nervous system of Caenorhabditis elegans Robert W. Fernandez , Angelo J. Digirolamo III , View ORCID Profile Giulio Valperga , View ORCID Profile G. Robert Aguilar , Laura Molina-García , Rinn M. Kersh , Chen Wang , Karinna Pe , View ORCID Profile Yasmin H. Ramadan , Curtis Loer , Arantza Barrios , View ORCID Profile Oliver Hobert doi: https://doi.org/10.1101/2025.05.13.653874 Robert W. Fernandez 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Angelo J. Digirolamo III 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Giulio Valperga 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Giulio Valperga G. Robert Aguilar 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for G. Robert Aguilar Laura Molina-García 2 Department of Cell and Developmental Biology, University College London , London WC1E 6BT, UK 4 Microbial Biotechnology Department, National Centre for Biotechnology (CNB-CSIC) , 28049 Madrid, Spain Find this author on Google Scholar Find this author on PubMed Search for this author on this site Rinn M. Kersh 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Chen Wang 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Karinna Pe 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yasmin H. Ramadan 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Yasmin H. Ramadan Curtis Loer 3 University of San Diego, Department of Biology , San Diego, CA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Arantza Barrios 2 Department of Cell and Developmental Biology, University College London , London WC1E 6BT, UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Oliver Hobert 1 Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute , 1212 Amsterdam Avenue, New York, NY 10025, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Oliver Hobert For correspondence: or38{at}columbia.edu Abstract Full Text Info/History Metrics Preview PDF ABSTRACT We explore here how neuronal cell type diversity is genetically delineated in the context of the large, but poorly studied male-specific nervous system of the nematode Caenorhabditis elegans. Mostly during postembryonic development, the C. elegans male adds 93 male-specific neurons, falling into 25 cardinal classes, to the predominantly embryonically generated, sex-shared nervous system, comprised of 294 neurons (116 cardinal classes). Using engineered reporter alleles, we investigate here the expression pattern of 40 phylogenetically conserved homeodomain proteins within the male-specific nervous system of C. elegans, demonstrating that in aggregate, the expression of these homeodomain proteins covers each individual male-specific neuron. We show that the male-specific nervous system can be subdivided along the anterior/posterior axis in HOX cluster expression domains. The extent of our expression analysis predicts that each individual neuron class is likely defined by unique combinations of homeodomain proteins. Using a collection of newly available molecular markers, we undertake a mutant analysis of five of these genes ( unc-30, unc-42, lim-6, lin-11, ttx-1) and identified defects in cell fate specification and/or male copulatory defects in each of these mutant strains. Our analysis expands our understanding of the importance of homeobox genes in nervous system development and function. INTRODUCTION The generation of molecular maps of animal brains has tremendously advanced over the past few years, with whole brain atlases now existing for several bilaterian model system species (e.g.[ 1 – 3 ]). Molecular brain maps raise a host of questions: Can the multidimensional complexity of individual neuron types be reduced to simpler molecular descriptors? Are there common themes in the mechanisms that generate the enormous diversity of cell types which define each animal nervous system? A tentative answer to both questions has recently emerged in the brain of the nematode Caenorhabditis elegans : first, the analysis of expression of the entire family of homeodomain transcription factors (encoded by a total of 102 homeobox genes) has shown that each of the 118 distinct neuron classes of the nervous system of the hermaphrodite can be described by unique combinatorial codes of homeodomain expression [ 4 , 5 ]; and, second, mutant analyses of homeobox genes over the past few decades have revealed that homeobox genes indeed regulate the acquisition of specific neuronal identities – not just in C. elegans , but in many other animal species as well (reviewed in [ 6 ]). To further investigate how extensively homeobox genes define distinct neuronal cell types, we turned to the little explored nervous system of the C. elegans male. Based on sex-specific patterns of blast cell proliferation, sex-specific execution of cell death programs and sex-specific transdifferentiation, male animals generate an additional set of 93 neurons compared to the hermaphrodite [ 7 – 11 ]. Owing to lineage history, overall morphology and synaptic connectivity, these 93 neurons can be subdivided into 25 “cardinal classes” [ 7 – 11 ]( Table 1 ). Two cardinal classes are located in the head (CEM and MCM neuron classes), two are located in the ventral nerve cord (CA and CP), and all others are located in several distinct ganglia in the tail of the animal, where they form a closely intertwined set of circuits that control various aspects of the complex male copulatory behavior [ 12 – 14 ]. While many of the 25 cardinal classes are composed only of either unilateral neurons or bilateral neuron pairs, four cardinal classes – the CA and CP ventral cord neurons, and the tail ray sensory classes RnA and RnB - are subdividable into a multitude of different subclasses that are clearly distinguishable by connectivity and molecular markers [ 15 – 17 ]. View this table: View inline View popup Download powerpoint Table 1: Summary of expression of the homeobox genes across the male C. elegans nervous system. This table summarizes the imaging data from Fig 1 . Sites of expression were identified by crossing homeobox reporter alleles into the NeuroPAL ( otIs669 or otIs696 ) landmark strain. Panneuronally expressed ceh-44 and ceh-48 are not shown here. Numbers on the right show how many homeodomain proteins are expressed in a given neuron class. In contrast to the mostly embryonically generated, sex-shared nervous system of C. elegans , where neurons are generated after a series of rapid cell divisions, most male-specific neurons are generated from quiescent neuroblasts, generated initially as specialized epithelial cells in the embryo. In early larval stages, these neuroblasts lose their specialized epithelial features, re-enter the cell cycle and generate the vast majority of male-specific neurons, as well as other male-specific cell types [ 7 , 18 ]. These distinctive patterning mechanisms could trigger terminal differentiation programs that are distinct from those that generate sex-shared neurons during embryogenesis. In the most extreme version of such scenario, these differentiation program may even rely less on the homeobox gene family that is so important in patterning the embryonic, sex-shared nervous system. Only some very limited hints towards the involvement of homeobox genes in male-specific neurons exist. Male-specific CEM neurons were previously described to require the unc-86/Brn3 POU homeobox gene for their proper differentiation [ 19 – 22 ]. In the ventral cord, HOX cluster genes lin-39 and mab-5 control the differentiation of two classes of male-specific motor and interneurons, the CA and the CP neurons, while the HOX cluster gene egl-5 controls the proper differentiation of a subset of ray sensory neurons [ 23 – 27 ]. Beyond these hints of homeobox gene function in certain male-specific neurons, very little is known about the expression or function of homeobox genes in the many remaining male-specific neurons. We have set out here to address this gap in knowledge by making use of a large toolbox of strains that express gfp- tagged homeobox genes, a resource that we previously used to investigate homeodomain protein expression throughout the entire nervous system of the hermaphrodite [ 4 , 5 ]. Cellular sites of gene expression patterns in the male-specific nervous system have been notoriously difficult to identify based on the occasionally variable position of neuronal cell bodies in the male tail and the absence of reporter landmarks. This problem was recently overcome by the introduction of NeuroPAL, a multicolor fluorescent transgene in which each individual male-specific neuron class can be reliably identified through non-GFP-based fluorescent landmarks, which can be overlaid with a GFP-tagged reporter strain [ 28 ]. NeuroPAL color maps have been established for both the hermaphrodite and the male nervous system [ 28 , 29 ]. The paucity of well-described fluorescent reporter-based marker genes has hampered the study of neuronal differentiation programs for which such markers are often of critical importance. Compounding this lack of markers is also the current absence of a complete scRNA-seq atlas of the male-specific nervous system. However, the recent systematic mapping of neurotransmitter identities in the male-specific nervous system has begun to mitigate this problem [ 15 ]. In addition, our recent reporter-based analysis of neuropeptide-encoding genes in the hermaphrodite nervous system [ 30 ] has provided additional tools, in the form of neuropeptide reporter alleles, to identity more cell fate markers in the male-specific nervous system. We exploit these tools here to generate a collection of cell fate markers of male-specific neuron identities and to assess the impact of homeobox gene function on the differentiation programs of several male-specific neuron types. The analysis conducted here in this paper leads us to conclude that despite the distinctive patterning mechanisms of male-specific neurons, homeobox genes play a role in male-specific neuron differentiation that appears to be as predominant as in the sex-shared nervous system. MATERIAL AND METHODS Strains A list of strains used in this study is provided in S2 Table . C . elegans genome-engineered strains Many reporter alleles generated in this study were engineered using the CRISPR/Cas9 system, by SunyBiotech, using an SL2::GFP::H2B reporter cassette (indicated by the syb allele name in S2 Table ). Some of these strains have been recently described [ 4 , 5 , 30 , 31 ], other have been generated specifically for this study ( S2 Table ). All gene deletion alleles were designed to remove the entire coding region of the gene, and include the following: A null allele for unc-42 , ot1187 , was generated injecting the following crRNAs and repair template to completely remove the coding region of unc-42 : crRNA (GCTCATtgtgtgagtgaaag), crRNA (tctcactgatagactaatgt), ssODN (ATCCCTTCAGAGCCATACTTCTCACTACTACCACCATCATAGAATCAAGACCTGAAATCG ACCTAAAAAA). Due to issue with their mating efficiency, multiple molecularly identical null alleles of lin-11 and lim- 6 have been generated by injecting separate strains carrying reporter alleles for terminal identity markers, using the following crRNAs and repair templates: lin-11(ot1026, ot1497, ot1444, ot1521, ot1472, ot1483) , crRNAs (attgagaagggagtaaaagg and CGTGGAATACTCCTGTATGT), ssODN (TTCGTGGTCGttcttcttcttcttctcctcctcctTACAGGAGTATTCCACGTTCGTGTAGTTTTTCTTC) lim-6 (ot1699, ot1700, ot1701, ot1702) , crRNAs (TGTGTTTTGTAGAAGACCGG and GAAAAGCAAAATAAAGCGGG), ssODN (gctcctgctctctctctctgtgttttgtagaagacgctttattttgcttttcacctcatattatttattt) Neuronal identification using NeuroPAL Sites of reporter gene expression were determined using the NeuroPAL landmark strain ( otIs669 and otIs696 alleles) and male tail atlases previously described [ 28 , 29 ]. The identity of each neuronal type was identified by comparing the color, size, and location of each neuron relative to one another. A detailed protocol to neuronal identification using NeuroPAL can be found at: https://www.hobertlab.org/neuropal/ Microscopy and mutant analysis To prepare animals for imaging, a small agarose pad (5%) was cast on a standard imaging slide and worms were mounted and immobilized using a solution of 100 mM of sodium azide (NaN3). Images were acquired either using confocal laser scanning microscopes (Zeiss LSM880 and LSM980) or wide-field microscopy (Axio Imager Z2). Images were processed and analysed using the Zen (Zeiss) or Fiji [ 32 ] imaging software. All reporter reagents and mutants were imaged at 40x using fosmid or CRISPR reagents, unless otherwise specified. For determining the expression pattern of homeobox genes or terminal identity markers, representative maximum intensity projections are displayed in grey scale, with gamma and histogram adjustments for visibility. For mutant functional analysis, representative maximum intensity projections are shown in inverted grey scale. In case of all-or-nothing changes, a qualitative analysis using three qualifiers was used to score mutants; ON - the signal was still present in the mutant, OFF – the signal was lost, DIM – the signal was still present but drastically reduced. When changes were not all-or-nothing, a qualitative approach was used and the signal intensity was extracted using either Zen or Fiji. To assay homeobox gene expression pattern at different larval and adult stages, animals were picked from a plate containing a mixed population of different stages. Different larval stages were differentiated according to size and well-known anatomical markers. Furthermore, animals were sexed under a high magnification microscope and only male larvae were included in the analysis. The NeuroPAL images provided in supplementary figures are pseudo-colored according to [ 28 , 29 ]. Serotonin antibody staining Anti-serotonin immunofluorescence was performed as previously described [ 33 ]. Briefly, worms were fixed overnight (ON) in 1.5 ml microfuge tubes at 4C in 4% paraformaldehyde in PBS; rinsed 3x in PBSTx (0.5% Triton X-100 / PBS), then incubated ON at 37C with gentle mixing in 5% beta-mercaptoethanol in TrisTx (1% TX-100 / 0.1 M Tris, pH 7.4). Rinsed twice in TrisTx, then once in collagenase buffer (CB: 1mM CaCl 2 / TrisTx), then digested with 2000 Units/ml Collagenase type IV (Sigma C5138) in CB until a few adult worms fragmented (typically 30-45 min). Rinsed three times PBSTx, incubated in 1% BSA in PBSTx for 1-2 hrs at room temp (RT). Then incubated ON at RT in 1:100 anti-serotonin (Rabbit antiserum, Sigma S5545) in 1% BSA/ PBSTx. Rinsed three to four times in 0.1% BSA/ PBSTx over 1-2 hr at RT. Then incubated ON at RT (in the dark) in 1:100 secondary antibody (Goat anti-Rabbit IgG, TRITC-conjugated). Rinsed 3-4x in 0.1% BSA/ PBSTx over 1-2 hr at RT. Viewed and photographed with an Olympus BX60 upright fluorescence microscope equipped with a Magnafire CCD camera. Mating assays Mating assays were performed on 9 cm NGM plates in which a bacterial lawn of 15 uL of OP50 was placed in the middle containing 30 unc-51(e369) hermaphrodites. Males were tested at one day of adulthood with 1-day-old unc-51(e369) hermaphrodites picked the night before as L4s. Each male was tested for 15 minutes. During this time, all steps of mating were scored in one or more hermaphrodites. Assays were replicated at least twice on different days and with different sets of males. Videos of mating events were recorded at 2fps using LoopBio and visualized with QMPlay 2 to analyze the following steps of mating: Response: A male was scored as responding to mate contact if it placed its tail ventral side down on the hermaphrodite’s body and initiated the mating sequence by backing along the hermaphrodite’s body to make a turn. The response efficiency was calculated by dividing 1 (response) by the total number of contacts made with the mate before responding. As a more sensitive measure of the quality of response, we scored hesitation during response. Hesitation is a switch in direction between forward and backward locomotion from the time the male establishes contact with the mate to the first turn (or to location of vulva if this occurs without the need of a turn). Scanning: A single scan was scored as the journey around the hermaphrodite’s body away from and returning to the vulva position. The first scan was counted as the journey from the point of first contact to the hermaphrodite vulva position. A scan was considered continuous if locomotion was maintained in the backward direction without switching direction or pausing (regardless of pause duration). Turning: Measured as proportion of good turns (number of good turns divided by total number of turns performed by the male) until location of vulva. A turn was considered good if it happened continuously while the worm was scanning backwards the tip of the hermaphrodite body to continue scanning the other side of the hermaphrodite without losing contact, switching direction or pausing before the turn. Location of vulva (LOV): A male was considered successful in locating the vulva when they stop scanning at the vulva position to try to insert the spicules. The LOV efficiency was calculated by dividing 1 (LOV) by the total number of times the male passes by the vulva without stopping there. Molina maneuvers: A continuous single maneuver was scored as the journey away from the vulva in forward locomotion, to a distance bigger than two tail-tip lengths, and return to the vulva in backward locomotion. Any visible pause during forward or backward locomotion was considered a STOP regardless of its duration. The category of discontinuous maneuver ‘switching’ was scored as a change in direction of locomotion while travelling away or towards the vulva without reaching it. Tail contact loss: Number of contact loss was scored as previously described [ 34 ]; i.e. the number of times that a male lost tail contact with the hermaphrodite during the mating trial (without counting male detachment after ejaculation). RESULTS Homeodomain protein expression analysis The C. elegans genome codes for 102 homeobox genes, 80 of them conserved throughout the animal kingdom ( S1 Table ). Since no complete scRNA-seq dataset exists so far for the male-specific nervous system of C. elegans , we examined homeobox gene expression using a reporter gene approach, making use of a resource of gfp- tagged homeobox gene loci whose expression we previously analyzed in the context of the hermaphrodite [ 4 , 5 ]. This approach has the advantage over scRNA-seq analysis that the direct fusion of gfp to the respective homeobox gene visualizes protein, rather than mRNA expression, thereby capturing posttranscriptional (e.g. translational) gene regulatory events. We analyzed the expression of half (40) of the 80 conserved homeodomain proteins, covering all main homeodomain subclasses (Antp-like, Prd-like, POU, LIM, SIX etc. ). We assessed expression of all male-specific neurons in the head, ventral nerve cord and tail ( Fig 1 ; Table 1 , S1 Table ). For the identification of the neuronal sites of expression, we used the NeuroPAL transgene which differentially labels all neuron classes in the male-specific nervous system [ 29 ]( S1 Fig ). Download figure Open in new tab Fig 1: Representative images of homeobox reporter alleles Representative images of homeobox reporters examined in this paper, which are either fosmid-based or CRISPR/Cas9-engineered alleles. Neuronal sites of expression were identified through overlap with NeuroPAL [ 28 , 29 ]. The corresponding images showing overlap with NeuroPAL colors are in S1 Fig, with the exception of the pan-neuronal ceh-44 and ceh-48 . Expression patterns are summarized in Table 1 . For 12 of the examined 40 homeodomain proteins, we observed no expression in male-specific neurons (summarized in S1 Table ). As expected from their pan-neuronal expression in the hermaphrodite [ 35 ], two genes, the CUT homeobox genes ceh-44 and ceh-48 are panneuronally expressed ( Fig 1 ). All other 26 homeodomain proteins show restricted expression in male-specific neurons ( Fig 1 , Table 1 ). We found that each male-specific neuron class expresses at least one homeodomain protein, therefore matching the complete coverage of all neuron classes in the hermaphrodite by homeobox genes. Most homeobox genes are expressed in small subsets of male-specific neuron classes, sometimes exclusively in single neuron classes ( unc-42/Prop1 in MCM, unc-30/Pitx in PGA). Exceptions to very restricted homeodomain proteins patterns are the six HOX cluster proteins, as well as their frequent co-factor UNC-62/Meis, each of which are broadly, yet still highly cell type-specifically expressed throughout the male-specific nervous system. Other than the two of the AbdB-type HOX cluster genes, php-3 and nob-1 [ 36 ], which recently duplicated specifically in Caenorhabditiae, no two homeobox genes show the exact same expression pattern ( Fig 1 , Table 1 ). Each individual male-specific neuron co-expresses, on average, three homeobox genes (range: 1 to 7, excluding the panneuronal CUT homeobox genes). There appear to be no preferential partnership of any two homeodomain proteins, with the exception of the expected, frequent association of UNC-62/Meis expression with a HOX cluster gene. This is expected because of the evolutionary ancient biochemical partnership of HOX and Meis proteins [ 37 ]. However, there are also clear cases where either HOX or Meis are expressed independently of one another, as also observed in other organisms [ 38 ]. We describe HOX protein expression patterns in more detail in a separate section below. Strikingly, of the cardinal 25 male-specific neuron classes, there are only two sets of neuron classes that cannot be distinguished by unique combinations of the homeobox genes we examined (even though they can be distinguished by neuropeptides, Table 2 ): The lineally related PCA and PCC share the same homeobox code ( ceh-43 and vab-3) as do the lineally related PVX and PVY ( lin-11 and ttx-1, plus 3 HOX cluster genes)( Table 1 ). As reflected by their shared name (and their shared lineage), the PCA and PCC neuron class, as well as the PVX and PVY neuron classes are also anatomically similar to one another. Nevertheless, since we only analyzed half of all conserved C. elegans homeobox genes, we anticipate that a complete examination may attach unique codes to all neuron classes. View this table: View inline View popup Download powerpoint Table 2: Summary of molecular markers for male-specific neurons. This table summarizes the imaging data from Fig 4 . Sites of expression were identified by crossing homeobox reporter alleles into the NeuroPAL ( otIs669 or otIs696 ) landmark strain. Within each cardinal class that can be clearly subdivided into subtypes (RnA, RnB, CAn and CPn neurons), we also find homeobox codes for several, but not all molecularly previously defined subtypes ( Fig 1 , Table 1 ). Specifically, within the ventral nerve cord, we observe that homeobox genes subdivide male-specific CA and CP neuron classes into subclasses, in accordance with earlier studies using cell fate markers [ 23 ] and recent neurotransmitter mapping studies [ 15 ]. Similarly, in the male tail, the A- and B-type ray neuron classes, each composed of 9 class members, can be subdivided into various subclasses based on homeobox gene expression ( Fig 1 , Table 1 ), again in accordance with earlier studies using other markers [ 15 , 16 ]. We discovered novel subtypes with the DX and EF neuron class, each of which is composed of up to 4 class members ( lim-7/Islet: EF1/2, not EF3/4; unc-4: DX1/2, not DX3/4). Conversely, neuron classes with previously much appreciated subclass diversity are “unified” by the expression of particular homeobox genes: all CA neurons express the Eve/Evx-type homeobox gene vab-7, all CP neurons express the lin-11 LIM homeobox genes and all A-type ray neurons express Dlx-type homeobox gene ceh-43 ( Fig 1 , Table 1 ). HOX cluster genes show anteriorly/posteriorly patterned expression in the male-specific nervous system One set of homeobox genes that warrant a separate consideration are the C. elegans HOX cluster genes ( Fig 2A and 2B ). In the context of animal nervous systems, the analysis of HOX gene expression and function has largely focused on the ventral nerve cord of invertebrates and spinal cord of vertebrates where HOX cluster genes are differentially expressed along the anterior/posterior axis, showing a remarkable match to their chromosomal localization (“co-linearity”)(reviewed in [ 39 – 42 ]). In the C. elegans hermaphrodite, HOX gene expression extends posteriorly beyond the ventral nerve cord into various tail ganglia, which express the AbdB-homologs egl-5, php-3 and nob-1 (reviewed in [ 39 ]). In the male, the expression of a subset of HOX cluster had already been examined in some restricted regions of the male tail (e.g. [ 43 ]; reviewed in [ 39 ]), but no comprehensive and comparative analysis was yet available. Using reporter alleles for all HOX cluster genes, we note the following themes of HOX genes in the adult male nervous system ( Fig 2B and S2; Table 1 ): The vast majority of mature, male-specific neurons in the ventral cord and tail ganglia express at least one HOX cluster gene. This is in striking contrast to neurons in the anterior head ganglia, which express very few HOX cluster genes ( Fig 2B ). Along the male ventral nerve cord, the postembryonically added, male-specific CA and CP neurons show similar patterns as the sex-shared neurons: Concordant with their chromosomal location, lin-39/Scr and mab-5/Antp show an ordered expression with lin-39/Scr being expressed in more anterior CA and CP class members, and mab-5/Antp in more posterior CA and CP class members. In male all tail ganglia, which contain a manifold increase in neuron number of all different types (sensory, inter-and motor neurons) compared to hermaphrodites, domains of HOX gene expression show a notable co-linearity with their genomic arrangement: there is no expression of the anterior HOX cluster gene lin-39/Scr , while mab-5/Antp expression is observed in more anterior parts of the ganglia but then peters out. egl-5/AbdB expression predominates, with the most posterior AbdB paralogs nob-1 and php-3 being more enriched in the most posterior neurons ( Fig 2B ; Table 1 ). Colinearity of HOX gene expression is recapitulated, albeit imperfectly, in the “microcosm” of the ray neurons, which innervate the sensory ray structure of the worm that are aligned in an anterior-to-posterior manner along the male bursa (inset in Fig 2A ). The ceh-13/Lab homeobox gene represent a curious case in the C. elegans HOX cluster. ceh-13 is the C. elegans homolog of the most anterior HOX cluster gene of other metazoans, Labial in flies and HoxA/B/C/D1 in vertebrates, but it has switched its chromosomal order with lin-39, the C. elegans Dfd/Scr homolog ( Fig 2A and 2B )[ 36 , 44 ]. Nevertheless, in the embryo, ceh-13 expression pattern is indeed enriched in the anterior part [ 45 , 46 ]. However, unlike with the other HOX cluster genes, an anterior/posterior gradient is not evident in the context of the hermaphrodite ventral nerve cord [ 4 ]. We rather find that in males, ceh-13/Lab is expressed in several ray neurons in the tail. Download figure Open in new tab Fig 2: Expression of HOX cluster genes A: Cartoon representation of the expression pattern of HOX genes in male C. elegans . Genomic position of HOX genes from C. elegans , Drosophila and chordates is also represented. HOX cluster gene similarities are from [ 68 ]. B: Expression of CRISPR/Cas9 engineered reporter alleles and fosmid shows the spatially controlled expression of HOX proteins. Panels show representative images of each protein expression pattern. Circles indicate the HOX protein signal, whilst arrows are used to match the signal to the specific Neural ID. Gut autofluorescence is visible in images for ceh-13 ( syb2307 ) and lin-39 ( kas9 ). Autofluorescence from the male tail is visible in reporters for lin-39 ( kas9 ), mab-5 ( syb6730 ), egl-5 (reporter array wgIs54) and php-3 ( syb1549 ). White dotted lines are used to trace the contours of the animal. To obtain a definitive Neural ID, multiple images acquired with the NeuroPAL landmark ( otIs669 or otIs696 ) are used to obtain a Neuronal ID that is overlaid on representative images. The corresponding images showing overlap with NeuroPAL colors are in S2 Fig. Temporal dynamics of homeodomain protein expression in the male-specific nervous system Our expression analysis of all homeodomain proteins has focused on the fully mature nervous system. While we have not examined the onset of expression of homeodomain proteins during developmental specification, we note the presence of widely divergent onsets of expression. Previous work has revealed expression of the AbdB-type EGL-5 HOX already in the epithelial neuroblast precursor of many male-specific neurons at the first larval stage [ 43 ], mirrored by neuroblast division defects observed in egl-5 mutants [ 47 ]. On the extreme other end of the spectrum, we find that TTX-1 homeodomain protein only becomes visible in the P12-derived PVX neuron by the third larval stage ( Fig 3A ), even though this neuron is already generated after a few divisions of the P12 neuroblast in the first larval stage [ 7 ]. Download figure Open in new tab Fig 3: Temporal dynamics of homeobox gene expression in male neurons relative to neuronal transdifferentiation A: Temporal dynamics of ttx-1(syb1679) expression in the neurons of the male tail. While PVX is generated in the first larval stage [ 7 ], expression of TTX-1 homeodomain protein in PVX is only detectable by the third larval stage. B: Temporal dynamics of homeobox genes expressed in MCM. dve-1(syb6673 syb6847) and ttx-1(syb1679) are expressed in the glial precursors of MCM (AMso) and continue to be expressed in both AMso and MCM after the transdifferentiation event at sexual maturation. unc-42(ot986) is expressed only in MCM and not its glial precursor AMso. C: Temporal dynamics of homeobox genes expressed in PHD. dve-1(syb6673 syb6847), ttx-1(syb1679), and the fosmid-based ceh-43 reporter wgIs699 are expressed in the glial precursors of PHD (PHso1) and continue to be expressed in PHD after the transdifferentiation event at sexual maturation. PHso1 to PHD transdifferentiation is direct and does not involve cell division. lin-11(ot958) is expressed only in PHD and not in its glial precursor PHso1. We observed two distinct types of onsets of homeodomain expression in two male-specific neuron classes generated by transdifferentiation. The two male-specific neuron classes, the head interneuron MCM and tail sensory neuron PHD, are generated during sexual maturation through a transdifferentiation process from glial cell types, the AMso glia in the case of MCM and the PHso glia in the case of PHD [ 10 , 11 ]. We found that a subset of the homeodomain proteins is already expressed in the socket glia from which these neurons are generated: MCM-expressed dve-1 and ttx-1 are expressed already in the AMso glia precursor ( Fig 3B ), while PHD-expressed ceh-43 is expressed already in PHso1 ( Fig 3C ). Two other homeodomain proteins, unc-42 and lin-11 , are, however, only expressed in the respective neuron upon trans-differentiation from glia to neuron: unc-42 is expressed in MCM, but not AMso ( Fig 3B ) and lin-11 is expressed in PHD, but not PHso1 ( Fig 3C ). A toolbox of terminal differentiation markers for male-specific neurons One reason why so few previous studies have examined the regulation of differentiation programs in the male-specific nervous system has been the paucity of molecular markers for most male-specific neurons. The construction of the NeuroPAL transgene, which combines a multitude of differentiation markers for the male-specific nervous system [ 29 ], as well as our recent mapping of neurotransmitter identities of male-specific neurons [ 15 ], has improved the situation, but for many neuron classes still only a limited number of differentiation markers are available [ 16 , 23 ]. To generate more markers for an analysis of homeobox gene function in the male-specific nervous system, we turned to an analysis of expression of neuropeptide-encoding genes, which display strong and highly neuron type-selective expression throughout the hermaphrodite nervous system, as revealed by previous reporter gene and scRNA analysis [ 1 , 30 , 48 ]. We utilized several previously published neuropeptide reporter alleles, engineered using the CRISPR/Cas9 system and engineered novel, SL2::GFP::H2B-based reporter alleles for a total of 17 neuropeptide-encoding genes, including seven FLP, six NLP and five insulin-like peptides. We analyzed their expression in the male-specific nervous system using the NeuroPAL transgene and discovered highly cell type-specific patterns for each of them, covering in aggregate a large majority of the male-specific nervous system ( Fig 4 and S3 , Table 2 ). Of particular note is the selective co-expression of four insulin-like genes exclusively in the MCM neuron in the head of adult males (with no expression elsewhere in the male-specific nervous system)( Fig 4D and Table 2 ). Download figure Open in new tab Fig 4: Terminal differentiation markers for male-specific neurons A: CRISPR/Cas9-engineered SL2::GFP::H2B-based reporter alleles reveal previously undescribed expression of several neuropeptides in male-specific neurons. Additional reporter allele data that is not shown here is summarized in Table 2 . B: Expression of CRISPR/Cas9-engineered SL2::GFP::H2B-based reporter alleles of insulin-like peptides in the male nervous system. Four of these, ins-2(syb6543), ins-3(syb5421), ins-5(syb6245), ins-6(syb5463) , show expression in MCM but not in other neurons in the male nervous system. ins-18(syb5462) is expressed in several neuron types in the male tail. C: Stable unc-6/Netrin expression in several male tail neurons. CRISPR/Cas9-engineered unc-6(syb5064) reporter allele is stably expressed in DVE, DVF, PHD, PGA neurons belonging to distinct ganglia (preanal, lumbar, dorsorectal), suggesting potential function of unc-6/Netrin in maintaining neuronal and circuit features. For all panels, the corresponding images showing overlap with NeuroPAL ( otIs669 or otIs696 ) colors are in S3 Fig. In addition to these 17 neuropeptide-encoding genes, we also identified the male-specific sites of expression of unc-6/Netrin , whose neuron type-specific expression in select neuron types of the hermaphrodite has served as a valuable cell fate marker for several sex-shared head neuron classes [ 49 ]( Fig 4C , Table 2 ). We found that UNC-6/Netrin is selectively expressed in four male-specific neuron classes (DVE, DVF, PHD, PGA), covering three different tail ganglia (preanal, lumbar, dorsorectal). Expression is observed not just transiently, as one would perhaps expect from a gene so prominently involved in axon pathfinding [ 50 ], but is rather stably observed after males have reached maturity. Such maintained expression is suggestive of UNC-6/Netrin function in maintaining neuronal features, such as proper synaptic connectivity. The Pitx-homolog unc-30 is required for PGA interneuron differentiation Armed with these molecular markers, we set out to examine whether homeobox genes affect neuronal differentiation to an extent similar to what has been observed in other neuronal contexts in the hermaphrodite. We first examined one of the two most sparsely expressed homeobox genes, the C. elegans homolog of the vertebrate Pitx genes, unc-30, which, in the context of the male-specific nervous system, is exclusively expressed in a single male-specific neuron class, the PGA interneuron in the preanal ganglion. PGA is one of a total of 4 pre-anal ganglion interneurons generated by the P11 epidermal blast cells in response to Wnt and EGF signaling [ 51 ]. The terminally differentiated state of PGA is one of the few neurons in the C. elegans nervous system that expresses multiple neurotransmitter systems: Based on unc-17/VAChT expression, PGA is cholinergic but also uses an additional, unknown neurotransmitter, based on the expression of the GABA/Glycine vesicular transporter unc-47/VGAT and the concomitant absence of unc-25/GAD [ 15 ]. Moreover, PGA re-uptakes and re-utilizes serotonin, as inferred from absence of tph-1/TPH expression, 5HT antibody staining, cat-1/VMAT expression and mod-5/SERT expression [ 15 ]. In addition, our marker analysis described above identified two neuropeptides ( flp-27 and nlp-50) expressed in PGA, as well as the axon guidance/synaptogenic UNC-6/Netrin protein ( Fig 4A,C ). PGA is also marked by a specific color-code in NeuroPAL [ 29 ]. To assess unc-30 function, we engineered a molecular null allele (ot1186) using CRISPR/Cas9 genome engineering [ 35 ]. We find that the entire cohort of neurotransmitter and neuropeptide reporters fails to be properly expressed in the PGA neuron of these unc-30 null mutants ( Fig 5A and 5B ). Moreover, 5HT antibody staining, which we find to be mod-5/SERT- dependent, as expected from absence of 5HT biosynthesis pathway genes, is absent in unc-30 null mutants ( Fig 5C ). unc-6/Netrin reporter allele expression is also affected and so is the normal color code of NeuroPAL ( Fig 5A ). However, since the panneuronal marker of the NeuroPAL transgene is not affected in PGA, we can conclude that PGA is generated in unc-30(ot1186) mutant animals but fails to adopt its proper identity. unc-30 therefore classifies as a terminal selector of PGA identity, mirroring its terminal selector function in several sex-shared neuron classes previously examined in the hermaphrodite, namely, the D-type motorneuron, the PVP and the AVJ neuron classes [ 5 , 22 , 52 , 53 ]. Intriguingly, the NeuroPAL transgene generates a novel TagBFP signal in PGA in unc-30(ot1186) ( Fig 5A ), indicating that PGA may have undergone an identity transformation to another neuron class. We cannot presently tell what this alternative neuronal identity may be since the NeuroPAL transgene expresses TagBFP from 12 different promoters, expressed in 10 different neuron classes [ 29 ]. Download figure Open in new tab Fig 5: The unc-30 Pitx-type homeobox gene affects differentiation of the PGA neuron. A : In unc-30(ot1186) null mutant animals, the NeuroPAL ( otIs669 ) color code of PGA is changed from orange to blue. Expression of unc-6(syb5064) and nlp-50(syb2704) in PGA is abolished in unc-30(ot1186) null mutants. Number of animals scored are shown within each bar. B: unc-30(ot1186) null mutants show decreased expression of several PGA markers, including unc-47(syb7566), unc-17(syb4491), flp-27(syb4413), cat-1(syb6486), and mod-5(vlc47) . Statistical analyses for panel A were performed using Fischer’s exact test. For panel B, the Mann-Whitney test was used. Error bars indicate SEM. ****p ≤ 0.0001, ***p ≤ 0.001, **p ≤ 0.01. C: Loss of anti-serotonin antibody staining in unc-30(ot1186) null mutant animals. 0/52 male tails had strong PGA staining; 3/15 had a weakly staining PGA (bottom panel). The Prop1-homolog unc-42 and the Otx-homolog ttx-1 control different aspects of MCM neuron differentiation We discovered a similar terminal selector role for the Prop1 homolog unc-42 homeobox gene, which, like unc-30 , is expressed in a single male-specific neuron class, the peptidergic MCM neuron in the head of the worm, after it has transdifferentiated from the AMso cell ( Fig 3B ). Our analysis of neuropeptide reporter alleles defined four markers for MCM, including reporter alleles for pdf-1, ins-2, ins-5 and ins-6. We found that all four markers fail to be properly expressed in the MCM neurons of unc-42 null mutant animals, containing an entire deletion of the unc-42 coding region, generated by CRISPR/Cas9 genome engineering ( Fig 6A and Methods ). Expression of the panneuronal rab-3 marker is unaffected in unc-42 null mutant animals, suggesting that MCM neurons are properly generated (i.e. transdifferentiated from the AMso amphid socket glia), but fail to adopt their unique identity ( Fig 6A ). We conclude that unc-42/Prop1 acts as a terminal selector of MCM identity. Download figure Open in new tab Fig 6: Effect of the Otx-type ttx-1 and Prop-type unc-42 homeobox gene on MCM neuron differentiation A: MCM terminal identity markers, but not a pan-neural marker, are lost in unc-42(ot1187) null mutants. Gray-scale images are representative of expression of 4 terminal identity markers [ ins-2(syb6543), ins-5(syb6245), ins-6(syb5463) and pdf-1(syb3330) ] and one pan-neuronal marker ( rab-3 array otIs355) in a wild type (control) and unc-42(ot1187) null mutant background. Dotted lines are used to trace the contours of the animal and its pharynx. Bar graphs show the percentage of animals that retained or lost expression in MCM. B: A gfp- tagged, cis- regulatory allele of ttx-1, syb1679 ot1264, results in loss of expression in male-specific neurons MCM and PHD. Cartoon representation of the ttx-1 locus showing the extent of the ot1264 deletion (red bar) and the syb1679 edit which inserts a gfp in frame with ttx-1 for visualizing the protein expression. Representative images show that in a ot1264 deletion background, ttx-1 is not expressed in MCM and PHD. Dotted lines are used to trace the contours of the animal. C: MCM terminal identity markers and a pan-neural marker, are lost in ttx-1(syb1679 ot1264) cis- regulatory mutants. Gray-scale images are representative of expression of 3 terminal identity markers ( ins-2(syb6543), ins-5(syb6245) and pdf-1(syb3330) reporter alleles) and one pan-neuronal marker ( rab-3 reporter array otIs355 ) in a wild type (control) and ttx-1(syb1679 ot1264) mutant background. Dotted lines are used to trace the contours of the animal and its pharynx. Bright extra signal between the first and second bulb of the pharynx in ttx-1 ( syb1679 ot1264 ) mutant animals is likely TTX-1::GFP (See Fig 6B , syb1679) signal coming from AFD. The ot1264 regulatory allele does not disrupt ttx-1 expression in a number of cells, including AFD [ 5 ]. Bar graphs show the percentage of animals that retained or lost expression in MCM. D: ttx-1(syb1679 ot1264) animals show impaired MCM differentiation from AMso glia. Gray-scale images are representative of expression of grl-2 (reporter array sEx12853 ), an AMso terminal identity marker in a wild type (Control) and ttx-1(syb1679 ot1264) mutant background. Dotted lines are used to trace the contours of the animal and its pharynx. Left bar graph shows the percentage of animals that retained or lost grl-2 ( reporter array sEx12853) expression in AMso. Right bar graph shows the percentage of AMso that gave rise to MCM. During AMso to MCM transdifferentiation in wild type animals, the GFP protein from grl-2 expressing AMso perdures into MCM as it divides [ 10 ]. In ttx-1(syb1679 ot1264) mutants, no perdurance is seen. Statistics: **p value ≤0.01, ****p value ≤0.0001, ns, not significant. Testing was performed using the Fisher’s Exact test. Since homeodomain proteins are known to act in combinations, we also tested the role of another homeobox gene that we found to be expressed in MCM from their initial differentiation throughout adulthood, the Otx-type homeobox gene ttx-1 ( Fig 3B ). To analyze ttx-1 function, we could not utilize a molecular null allele of the entire locus since such a deletion results in embryonic lethality [ 5 ]. In a previous study on ttx-1 function in the hermaphrodite nervous system, we had circumvented this problem by generating a cis- regulatory allele, ot1264 , a 9 kb deletion of an enhancer region that resulted in loss of ttx-1 expression in several sex-shared neurons, but not in other tissues in which ttx-1 function is required for embryonic viability [ 5 ]. Using a gfp- tagged ttx-1 reporter allele, we examined whether this cis -regulatory allele also eliminates expression of ttx-1 from the male-specific neuron classes in which ttx-1 is normally expressed in. We found this to indeed be the case ( Fig 6B ). Using this cis -regulatory allele, we found that elimination of ttx-1 displays the same phenotype as unc-42 null mutant animals: expression of pdf-1, ins-2 and ins-5 is lost ( Fig 6C ). In this case, however, we also failed to detect expression of the rab-3 panneuronal marker, indicating that the MCM neurons may not be properly generated at all ( Fig 6C ). Since ttx-1 is, in contrast to unc-42 , already expressed in the AMso glia cell from which the MCM neuron transdifferentiated ( Fig 3B ), we assessed AMso glia (as well as PHso) differentiation defects in ttx-1(syb1679 ot1264) mutants. We found no effect on the expression of the grl-2 glia marker in juvenile AMso glia ( Fig 6D ). However, we noted that after the cell division of the embryonically generated AMso during sexual maturation in larval stage animals, which generates the adult AMso and the MCM neurons, the expression of grl-2 from embryonically generated AMso perdures in the MCM neurons [ 10 ]. We fail to detect such perdurance in ttx-1(syb1679 ot1264) mutants ( Fig 6D ). Taken together with the lack of rab-3 expression where we expect MCM to be, we conclude that in the absence of ttx-1 , the MCM neuron fails to be generated, possibly due to a failure of embryonically generated AMso to divide upon sexual maturation. The LIM homeobox gene lim-6 affects DVE and DVF differentiation The LIM homeobox gene lim-6, the C. elegans ortholog of vertebrate Lmx1/2, is known to control the differentiation program of the sex-shared DVB neuron, located in the dorsorectal ganglion [ 54 , 55 ]. The expression of lim-6 in two other, male-specific neurons of the dorsorectal ganglion, DVE and DVF, as well as the existence of cell markers for these two neurons, prompted us to assess the effect of lim-6 on the differentiation of these neurons. We found that the characteristic color code of the NeuroPAL transgene in the DVE and DVF neurons of lim-6 null mutants is defective ( Fig 7A ). DVE and DVF do not synthesize a currently known fast neurotransmitter system, but express the vesicular neurotransmitter transporter unc-47/VGAT [ 15 ] and this expression is significantly affected upon loss of lim-6 ( Fig 7B ). Our neuropeptide expression analysis identified three neuropeptides expressed in these neurons, flp-23 and nlp-50 (expressed in both DVE and DVF) and nlp-18 (expressed only in DVE)( Fig 4 ). We found that expression of nlp-18 in DVE is affected in lim-6 null mutants ( Fig 7B ), while there is a reduction in the expression levels of flp-23 in DVE but not DVF. However, expression of nlp-50 in both neurons is not affected in lim-6 null mutants ( Fig 7C ). We conclude that lim-6 is required for the proper differentiation of DVE and DVF. Download figure Open in new tab Fig 7: The Lmx-type lim-6 homeobox gene affects differentiation of DVE and DVF neurons A: In nearly half of lim-6(ot1701) null mutant animals, the NeuroPAL ( otIs696 ) colors of DVE and DVF are changed from turquoise to green, suggesting loss of blue-expressing reporters. lim-6 null mutants exhibit low mating efficiency. In lieu of crosses, molecularly identical null deletions were generated in the background of the markers in panels B and C by CRISPR/Cas9-engineering using the same guide RNAs and repair templates (see Methods). These alleles are lim-6(ot1699) , lim-6(ot1700), lim-6(ot1701) and lim-6(ot1702) . B: lim-6(ot1701) and lim-6(ot1700) null mutants display defects in the expression of DVE and DVF markers nlp-18(ot1421) and unc-47(syb7566) . C: lim-6(ot1699) and lim-6(ot1702) null mutants do not show defects in the expression of the DVE and DVF markers nlp-50(syb2704) and flp-23(syb3242) . Statistical analyses for panels A and B were performed using Fischer’s exact test. For panel C, the Mann-Whitney test was used. Error bars indicate SEM. **p ≤ 0.01, *p ≤ 0.05, ns not significant. The DVE and DVF neurons also co-express the Eve-homolog vab-7 . We found that in vab-7 mutants, marker gene expression in neurons of the dorsorectal ganglion do not appear to be affected, but we noted an increased number of neurons in the ganglion, indicating lineage division defects, which we did not pursue further. The LIM homeobox gene lin-11 has a range of effects on several neuron classes We extended our homeobox mutant analysis to additional neuron types and found that removal of the LIM homeobox gene lin-11, the C. elegans ortholog of vertebrate LHX1/5, has complex, differential effects on the differentiation of several different male-specific neuron classes. The PHD neurons, generated during sexual maturation by transdifferentiation from PHso1 glia, are normally generated in lin-11 null mutants and still express both their cholinergic identity ( unc-17/VAChT), as well as the single Ig domain protein oig-8 ( Fig 8A ), a previously described marker of PHD identity [ 11 , 56 ]. However, the NeuroPAL color code, as well as expression of the nlp-51 neuropeptide and unc-6/ Netrin are defective ( Fig 8A and S4A ). The Otx-type homeobox gene ttx-1, which is also expressed in PHD, also affects unc-6/Netrin expression and the NeuroPAL color code, but does not affect nlp-51 , oig-8 or PHD’s cholinergic identity ( unc-17/VAChT ) ( Fig 8B and S4B ). lin-11; ttx-1 double mutants do not show more severe defects in PHD differentiation than each single mutant, i.e. neither oig-8 nor unc-17/VAChT markers are affected ( Fig 8C ). Download figure Open in new tab Fig 8: Effect of the LIM-type homeobox gene lin-11 and the Otx-type ttx-1 homeobox gene on PVX, PVY, PHD differentiation A: Bar graphs show the percentage of animals that retained or lost signal for 6 terminal identity markers ( unc-6(syb5064), cat-1(syb6486), oig-8 array (drpIs4), nlp-51(syb3936), unc-17(syb4491), unc-47(syb7566) ) as well as quantifying the NeuroPAL( otIs669 ) color in the male-specific neurons (PVX, PVY and PHD) of wild type and ttx-1(syb1679 ot1264) regulatory mutants B: Bar graphs show the percentage of animals that retained or lost signal for 6 terminal identity markers ( unc-6(syb5064), cat-1(syb6486), oig-8 array (drpIs4), nlp-51(syb3936), unc-17(syb4491), unc-47(syb7566) ) as well as quantifying the NeuroPAL( otIs669 ) color in the male-specific neuron (PVX, PVY and PHD) of wild type and lin-11 null mutants (lin-11(ot1483);unc-6(syb5064), lin-11(ot1472);cat-1(syb6486), lin-11(ot1521);oig-8 array (drpIs4), lin-11(ot1444);nlp-51(syb3936), lin-11(ot1026);unc-17(syb4491), lin-11(ot1497);unc-47(syb7566)) . Using CRISPR/Cas9 and HDR multiple but genetically identical null alleles of lin-11 were obtained (See Methods). C: Bar graphs show the percentage of animals that retained or lost signal for 6 terminal identity markers ( unc-6(syb5064), cat-1(syb6486), oig-8 array (drpIs4), nlp-51(syb3936), unc-17(syb4491), unc-47(syb7566) ) in the male-specific neurons (PVX, PVY and PHD) of wild type and ttx-1(syb1679 ot1264);lin-11 double mutants (ttx-1(syb1679 ot1264);lin-11(ot1483);unc-6(syb5064), ttx-1(syb1679 ot1264);lin-11(ot1472);cat-1(syb6486), ttx-1(syb1679 ot1264);lin-11(ot1521);oig-8 array (drpIs4), ttx-1(syb1679 ot1264);lin-11(ot1444);nlp-51(syb3936), ttx-1(syb1679 ot1264);lin-11(ot1026);unc-17(syb4491), ttx-1(syb1679 ot1264);lin-11(ot1497);unc-47(syb7566)) . Using CRISPR/Cas9 and HDR multiple but genetically identical null alleles of lin-11 were obtained (See Methods). Statistics: *p value ≤0.05, **p value ≤0.01, ***p value ≤0.001, ****p value ≤0.0001, ns, not significant. Testing was performed using the Fisher Exact test. Besides PHD, the lin-11 and ttx-1 homeobox genes are also co-expressed in the PVX and PVY neurons. We did not observe any differentiation defects in PVX or PVY in lin-11, ttx-1 or lin-11; ttx-1 double mutants based on intact unc-6/Netrin and oig-8 expression, aminergic identity ( cat-1/VMAT ), cholinergic identity ( unc-17/VAChT ) and other terminal identity features ( unc-47/VGAT ) ( Fig 8A-C ). However, we found that in lin-11 null mutant animals, but not in ttx-1 mutants, the expression of nlp-51 was affected in PVX neurons ( Fig 8A and S4A ). ttx-1 may nevertheless have a partial impact on PVX differentiation since we observed a change in the NeuroPAL color code ( Fig 8B and S4B ). In the ventral nerve cord, lin-11 is expressed in a subset of CA and all CP neurons. Each of these neuron classes falls into distinct subtypes based on neurotransmitter expression [ 15 ], neuropeptide expression ( Table 2 ) and color codes of NeuroPAL transgene [ 29 ]. We found that cholinergic identity ( unc-17/VAChT expression) of the CA1-4 neurons, which normally express lin-11, is unaffected in lin-11 null mutants (13/14 animals show normal expression of an unc-17/VAChT reporter allele). Instead, several of the CP neurons (CP0, CP5, CP6, CP7, CP8), as well as CA7, which are either not cholinergic or express unc-17 only very weakly, express unc-17/VAChT either ectopically or much more strongly in lin-11 null mutants ( Fig 9A and B). Ectopic expression in lin-11 mutants was not limited to unc-17/VAChT since we observed ectopic expression of cat-1/VMAT in CP8 as well ( Fig 9C ). Moreover, there is a concomitant novel NeuroPAL color code (gain of blue color) observed in the CP1-6 neurons of lin-11 mutants ( Fig 9D ). Since the CA neurons, which are sisters of the CP neurons, are cholinergic [ 15 ], a CP to CA identity switch could be envisioned. However, such transformation is unlikely since first, the change in NeuroPAL color code is not consistent with such a switch (NeuroPAL does not mark the CA neurons with any signal beyond the panneuronal signal, yet there is a gain in orange signal in lin-11 mutants) and, second, we find 5HT antibody staining of CP neurons to be unaffected in lin-11 mutants (52/55 animals show normal 5HT staining), indicating the CPs do retain aspects of their original identity. At this point, we can only infer that in lin-11 mutants, the CP neurons are not properly specified. Download figure Open in new tab Fig 9: Effect of the LIM homeobox gene lin-11 on CP neuron differentiation A: Extra unc-17 positive CP neurons are found in lin-11(ot1026) null mutants. Representative images show the expression of unc-17(syb4491) , NeuroPAL (otIs669) landmark and their merge in wild type and lin-11(ot1026) mutants. Bar graphs show the percentage of animals expressing ectopic unc-17 . B: Absence of lin-11 increases the expression of unc-17 in several CP neurons. Bar graphs show the percentage of animals expressing unc-17 as well as intensity values in wild type and lin-11(ot1026) null mutants. C: lin-11(ot1026) mutants show alter NeuroPAL colors in CP neurons. Representative images show an overlay of the NeuroPAL (otIs669) pseudocolors in wild type and lin-11(ot1026) null mutants. CP neurons have a stronger blue fluorophore signal in lin-11(ot1026) null mutants compared to wild type. Bar graphs show the percentage of animals with no color change (Correct Color), a color change (Color Change), absence of the orange color (Absence of CyOFP1 color) and a dim orange color (Weak CyOFP1 color). D: lin-11 null mutants show ectopic cat-1 expression in CP8 male-specific neurons. Representative images show the expression of cat-1(syb6486) , NeuroPAL (otIs669) landmark and their merge in wild type and lin-11(ot1450) mutants. Bar graphs show the percentage of animals expressing ectopic cat-1 . Statistics: *p value ≤0.05, **p value ≤0.01, ***p value ≤0.001, ****p value ≤0.0001, ns, not significant. Testing was performed using the Fisher Exact test and Student t-test for quantification of Relative Intensity Values Behavioral deficits of lin-11 and ttx-1 mutants Due to their strong locomotory defects, we were not able to assess the behavioral consequences of loss of MCM differentiation in unc-42/Prop1 null mutants or loss of PGA differentiation in unc-30/Pitx null mutants. However, superficially normal locomotion of lin-11(n389) animals and ttx-1(syb1679 ot1264) animals did allow us to assess possible effects on PHD, PVX and/or PVY function. These three neurons are among the very few male-specific neurons to which functions were previously assigned. Specifically, the PVX and PVY interneurons have been shown to be involved in the male’s contact-based scanning of the hermaphrodite’s surface for the vulva [ 34 ]. This scanning behavior also requires the PHD neuron, which is presynaptic to both PVX and PVY [ 11 ]. The expression of lin-11 and ttx-1 in PHD, PVX and PVY, combined with the observed effect of these transcription factors on a subset of differentiation markers in at least two of these neurons, prompted us to examine male mating behavior in lin-11 and ttx-1 mutant males. We found that both tail contact and scanning behavior of ttx-1 mutant males is indeed defective, as predicted by ttx-1’s expression in PVX, PVY and PHD ( Fig 10A ). Scanning behavior, but not tail contact, is also defective in lin-11 mutant males ( Fig 10B ). PHD is also involved in another aspect of the mating behavior, the Molina maneuver, a re-engagement process of males with a mate after an unsuccessful mating attempt [ 11 ]. Molina maneuvers are defective in lin-11 mutant males, but not in ttx-1 mutants, consistent with lin-11 mutant males appearing to have a more severe PHD differentiation defect than ttx-1 mutant males ( Fig 8A and B ). Download figure Open in new tab Fig 10: lin-11 and ttx-1 mutants display male mating defects A: Male mating steps in ttx-1(syb1679 ot1264); him-8(e1489) IV mutant males, mated with unc-51 mutant hermaphrodites. See Methods for details on scored behavior. Mann-Whitney tests were used to compare efficiencies of response, turning, location of vulva and tail contact of control and mutant males; ξ 2 was used to compare the proportion of responses with hesitation and proportion of continuous scans and Molina Maneuvers. n.s = not significantly different, p≥0.05, ** p≤ 0.01, **** p≤0.0001, n= number of events; 23 ttx-1 and 28 him-8 males were scored. B: Male mating steps in lin-11(n389) I; him-5(e1467) mutant males, mated with unc-51 mutant hermaphrodites. See Methods for details on scored behavior. Mann-Whitney test was used to compare efficiencies of response, turning, location of vulva and tail contact of control and mutant males; ξ 2 was used to compare the proportion of responses with hesitation and proportion of continuous scans and Molina Maneuvers. n.s = not significantly different, p≥0.05, * p≤ 0.05, *** p≤0.001, n= number of events; 18 lin-11 and 20 him-5 were scored. While other aspects of male mating behavior are intact in ttx-1 and lin-11 mutants, we also noted two defects that are not predicted by their expression pattern ( Fig 10A and B ): lin-11 mutants display defects in vulval stop behavior and ttx-1 mutant display defects in turning behavior. Whether these defects are also the result of PVX, PVY or PHD differentiation defects is currently unknown. DISCUSSION The male-specific nervous system of C. elegans The nervous system of male nematodes is substantially larger than the nervous system of hermaphrodites, owing largely to sex-specific neuroblast proliferation that generate a wide spectrum of distinct neuron types only in males [ 7 ]. While brain size differences are also apparent in different areas of human male and female brains [ 57 ], the underlying cellular basis of such differences remains unclear in mammals. While the number, lineage and morphology of male-specific neurons in C. elegans have been precisely delineated [ 7 , 9 ], mechanisms that specify the unique identities of these male-specific neurons have mostly been explored in the context of developmental patterning, namely of (a) the ray sensory neuron classes, a prominent subgroup of male-specific neurons [ 16 , 25 , 58 , 59 ], (b) two male-specific neuron classes that are generated via transdifferentiation (MCM, PHD)[ 10 , 11 ], (c) one male-specific neuron class whose sex-specificity is the result of sex-specific cell death (CEM) [ 20 , 21 , 60 ] and (d) several male-specific motor and interneurons in the ventral cord (CA,CP)[ 23 , 24 ]. Earlier patterning information is available for the developmental specification programs of other male-specific neurons [ 61 ], yet information about terminal differentiation programs had been limited. We have begun here to rectify these limitations, by (a) establishing a protein expression atlas of a family of transcription factors, homeodomain proteins, and (b) defining the role of these proteins in cell fate specification using a new set of reagents that allowed us to define cell identity. Homeobox gene expression In the hermaphrodite, an analysis of homeodomain protein expression has shown that each individual terminally differentiated neuron class can be defined by a unique combination of homeodomain proteins [ 4 ]. Even though we analyzed only half of all conserved C. elegans homeodomain proteins in this study, homeodomain proteins again clearly emerge as accurate descriptors of neuronal identity in the male-specific nervous system. The expression of homeobox genes also delineates neuronal subclasses within the previously known cardinal 23 male neuron classes. Such subclassification has been evident already based on terminal markers (e.g. among CA, CP or ray neurons), but for other classes, such subclassification was not previously appreciated (e.g. EF, DX neurons, class members distinguished by LIM-7 and UNC-4, respectively). We assigned at least one homeodomain protein to all 25 cardinal neuron classes of the male-specific nervous system of C. elegans , and, except for two closely related groups of neuron classes, we observed neuron specific combination of homeodomain proteins in each of these classes. The broad coverage of neuron classes with a limited number of examined homeodomain proteins predicts that a complete map of all homeodomain proteins will result in neuron type-specific combination of homeodomain proteins for each individual male-specific neuron class, as observed in the hermaphrodite nervous system. As in the sex-shared nervous system, there is no obvious match of a specific neurotransmitter system with a specific homeobox signature, at least as far as the most commonly deployed neurotransmitter systems (ACh, Glu, GABA) are concerned, thereby corroborating the theme that neurotransmitter identity of distinct neuron classes is controlled in a “piece-meal” manner through distinct regulatory factors. This notion is further supported by the dissection of the cis -regulatory architecture of the eat-4/VGluT locus which identified distinct cis-regulatory elements driving gene expression in distinct male-specific neuron classes [ 62 ]. The HOX cluster homeodomain proteins, which constitute only 6 of the 102 homeodomain proteins in C. elegans, stand out in several regards. First, unlike in head ganglia, HOX gene expression very densely covers almost all neuron classes in male tail ganglia, oftentimes in an overlapping manner (summarized in Fig 2 ). This is a mirror image of many non-cluster homeobox genes that are expressed in multiple sex-shared head neuron classes but not at all in tail ganglia ( S1 Table ). Second, HOX cluster genes show clear anterior-posterior (a/p) patterns of collinearity within tail ganglia. Such co-linearity had already been observed in ventral cord neurons in C. elegans of sex-shared and sex-specific neurons [ 23 , 63 , 64 ]. Our systematic analysis of all HOX cluster genes extends such a/p-patterned expression throughout all neurons within male tail ganglia (i.e. the much-expanded lumbar ganglion in males, as well as the male-specific cloacal ganglion). This neuronal expression is – like all homeodomain protein expression patterns that we describe here – maintained throughout mature, adult stages. Homeobox gene function Previous work has defined functions of HOX cluster genes in the male nervous system [ 16 , 25 , 29 ]. We have leveraged here the power of the NeuroPAL cell fate tool, in combination with additional cell fate markers that we developed, to describe the impact of removal of non-HOX cluster homeobox gene on the differentiation program of individual male-specific neurons. In two cases, notably PGA and MCM, we have shown that of the many neuron type-specific identity features that we tested, every single feature is affected in the respective homeobox gene mutant ( unc-30 for PGA; unc-42 for MCM), arguing for a strict co-regulation of distinct identity markers, the key defining feature of a terminal selector-type regulatory logic [ 65 ]. In the case of MCM, we have also identified a homeobox gene, ttx-1 which appears to act at an earlier step in the differentiation program by apparently priming the AMso glia cell to transdifferentiate into MCM. We had previously noted that a subset of terminal selector demarcates neurons that are more highly interconnected with each other compared to other neurons and suggested that such terminal selectors may act as “circuit organizers” [ 49 ]. The best described of these cases is the unc-42 homeobox gene which acts as a terminal selector in all 15 interconnected neurons in a nociceptive repulsive reflex circuit [ 49 ]. The function of unc-42 as a terminal selector in the male-specific MCM neuron, the only sex-specific neuron in which unc-42 is expressed in, fits into this theme since MCM is extensively connected to this unc-42(+) reflex circuit [ 9 ]. We therefore predict that in unc-42 mutants, MCM may not only lose features of its molecular identity but may also fail to wire into the “ unc-42 circuit”. It is conceivable that UNC-42 may regulate the expression of cell surface molecules that allow for selective fasciculation of these neurons. We have also described cases here in which it is either not clear whether a homeobox gene acts as a master-regulatory terminal selector or whether it rather regulates only individual aspects of a neuron function. In the DVE and DVF neurons, lim-6 appears to control some, but clearly not all identity features. The effect of lin-11 and ttx-1 in the synaptically interconnected PVX, PVY and PHD neurons is also restricted to only a small number of identity features. However, these effects may have significant functional consequences, as evidenced by behavioral defects observed in ttx-1 and lin-11 mutants. lin-11 and ttx-1 may either act redundantly with other homeobox genes to specify PVX, PVY and PHD differentiation and/or other PVX/PVY/PHD-expressed factors may fulfill a master regulatory terminal selector role. Akin to the mating defects that we describe here in lin-11 and ttx-1 mutants, mating defects have also been observed in another homeobox gene, mec-3 [ 66 , 67 ]. The sites of expression of mec-3 that we described here match the function of the neurons and the specific behavioral defects in mec-3 mutants (HOB neuron for vulva stopping; ray neurons for turning behavior)[ 67 ]. Yet, as in the case of lin-11 and ttx-1 mutants, cell type-specific rescue experiments are needed to confirm that these genes indeed act in these respective neurons to control animal behavior. Due to pleiotropies of other homeobox gene mutants (e.g. Unc phenotype of unc-42 and unc-30 , Let phenotype of ceh-43, Clr phenotype of ceh-10 etc.), more cell type-specific knock-out approaches will be needed to assess their impact on the function in the male-specific neurons that these genes are expressed in. Limitations and conclusions There are several limitations of the studies described here. The expression of half of all conserved homeodomain proteins still awaits investigation in the male-specific nervous system. Cell type-specific rescue experiments and/or cell type-specific knock-out experiments are currently lacking and are particularly needed to link the behavioral defects of lin-11 and ttx-1 mutants to their specific cellular focus of action. Such approaches will require the development of drivers with required cellular specificity. Also, while our cell fate marker analysis has clearly assigned function to several homeobox genes in identity specification, the analysis of more markers would be useful. Despite these limitations, we can conclude that homeobox gene expression and function appears to be as pervasive in the sex-specific nervous system as it is in the sex-shared nervous system. These observations are in further support of the hypothesis that homeobox genes may have fulfilled an evolutionarily ancient function in neuronal differentiation [ 6 ]. SUPPLEMENTARY FIGURES AND TABLES Download figure Open in new tab S1 Fig: NeuroPAL ID data for homeobox reporter alleles Homeobox reporter alleles from Fig 1 merged with NeuroPAL colors. Panels show representative images of NeuroPAL ( otIs669 or otIs696 ) landmark allele where all pseudocolors, as described [ 28 , 29 ], are merged together with the GFP signal of homeobox reporters. Circles indicate the nuclear signal, whilst arrows are used to match the signal to the specific Neural ID. White dotted lines are used to trace the contours of the animal and its pharynx. Multiple images acquired with the NeuroPAL landmark are used to obtain a neuronal ID that is overlaid on representative images. Download figure Open in new tab S2 Fig: NeuroPAL ID data for HOX cluster alleles HOX cluster reporter alleles from Fig 2 merged with NeuroPAL colors. Panels show representative images of NeuroPAL ( otIs669 or otIs696 ) landmark allele where all pseudocolors, as described [ 28 , 29 ], are merged together with the GFP signal of HOX reporters. Circles indicate the nuclear signal, whilst arrows are used to match the signal to the specific Neural ID. White dotted lines are used to trace the contours of the animal and its pharynx. Multiple images acquired with the NeuroPAL landmark are used to obtain a neuronal ID that is overlaid on representative images. Download figure Open in new tab S3 Fig: NeuroPAL ID data for new terminal identity markers for male-specific neurons A,B : New terminal identity markers for male-specific neurons shown in Fig 4 merged with NeuroPAL colors. Panels show representative images of NeuroPAL ( otIs669 or otIs696 ) landmark allele where all pseudocolors, as described [ 28 , 29 ], are merged together. Circles indicate the nuclear signal, whilst arrows are used to match the signal to the specific Neural ID. White dotted lines are used to trace the contours of the animal and its pharynx. Multiple images acquired with the NeuroPAL landmark are used to obtain a neuronal ID that is overlaid on representative images. Download figure Open in new tab S4 Fig: ttx-1 and lin-11 mutant analysis A: lin-11 full deletion mutants affect the expression of unc-6/Netrin in PHD. Representative images show the expression of unc-6(syb5064) , nlp-51(syb3936) , NeuroPAL colors( otIs669 ) and a merge of both in wild type and lin-11(ot1448) null mutants. Bar graph quantifies the decrease in Relative Intensity Value of unc-6( syb5064) and nlp-51(syb3936) expression in PHD and PVX, PHD respectively. B: ttx-1 mutants affect the expression of unc-6/Netrin in PHD. Representative images show the expression of unc-6(syb5064)) , NeuroPAL colors( otIs669 ) and a merge of both in wild type and ttx-1(syb1679 ot1264) mutants. Bar graph quantifies the decrease in Relative Intensity Value of unc-6(syb5064) expression in PHD. Statistics: *p value ≤0.05, ***p value ≤0.001, ****p value ≤0.0001, ns, not significant. Testing was performed using the Student t-test. View this table: View inline View popup Download powerpoint S1 Table: List of all C. elegans homeodomain proteins. The table indicates which of the 102 C. elegans homeodomain proteins were analyzed for expression in the male-specific nervous system. View this table: View inline View popup Download powerpoint S2 Table: Strain list. List of all strains used in the manuscript. ACKNOWLEDGEMENTS We thank Chi Chen for generating C. elegans mutant and transgenic strains and members of the Hobert lab for comments on this manuscript. G.V was supported by an EMBO Postdoctoral fellowship. This work was funded by the NIH (R01NS039996, R01NS137594) and the Howard Hughes Medical Institute. Funder Information Declared National Institutes of Health , R01NS039996 , R01NS137594 European Molecular Biology Organization, https://ror.org/04wfr2810 , ALTF 195-2022 REFERENCES 1. ↵ Taylor SR , Santpere G , Weinreb A , Barrett A , Reilly MB , Xu C , et al. Molecular topography of an entire nervous system . Cell . 2021 ; 184 ( 16 ): 4329 – 47 e23. Epub 2021/07/09. doi: 10.1016/j.cell.2021.06.023 . PubMed PMID: 34237253 . OpenUrl CrossRef PubMed 2. Li H , Janssens J , De Waegeneer M , Kolluru SS , Davie K , Gardeux V , et al. Fly Cell Atlas: A single-nucleus transcriptomic atlas of the adult fruit fly . Science . 2022 ; 375 ( 6584 ): eabk2432 . Epub 20220304. doi: 10.1126/science.abk2432 . PubMed PMID: 35239393 ; PubMed Central PMCID: PMCPMC8944923 . OpenUrl CrossRef PubMed 3. ↵ Yao Z , van Velthoven CTJ , Kunst M , Zhang M , McMillen D , Lee C , et al. A high-resolution transcriptomic and spatial atlas of cell types in the whole mouse brain . Nature . 2023 ; 624 ( 7991 ): 317 ߝ 32 . Epub 20231213. doi: 10.1038/s41586-023-06812-z . PubMed PMID: 38092916 ; PubMed Central PMCID: PMCPMC10719114 . OpenUrl CrossRef PubMed 4. ↵ Reilly MB , Cros C , Varol E , Yemini E , Hobert O . Unique homeobox codes delineate all the neuron classes of C. elegans . Nature . 2020 ; 584 ( 7822 ): 595 – 601 . Epub 2020/08/21. doi: 10.1038/s41586-020-2618-9 . PubMed PMID: 32814896 . OpenUrl CrossRef PubMed 5. ↵ Reilly MB , Tekieli T , Cros C , Aguilar GR , Lao J , Toker IA , et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification . PLoS Genet . 2022 ; 18 ( 9 ): e1010372 . Epub 2022/10/01. doi: 10.1371/journal.pgen.1010372 . PubMed PMID: 36178933 ; PubMed Central PMCID: PMCPMC9524666 . OpenUrl CrossRef PubMed 6. ↵ Hobert O . Homeobox genes and the specification of neuronal identity . Nat Rev Neurosci . 2021 ; 22 ( 10 ): 627 – 36 . Epub 2021/08/28. doi: 10.1038/s41583-021-00497-x . PubMed PMID: 34446866 . OpenUrl CrossRef PubMed 7. ↵ Sulston JE , Albertson DG , Thomson JN . The Caenorhabditis elegans male: postembryonic development of nongonadal structures . Dev Biol . 1980 ; 78 ( 2 ): 542 – 76 . PubMed PMID: 7409314 . OpenUrl CrossRef PubMed Web of Science 8. Emmons SW . The development of sexual dimorphism: studies of the Caenorhabditis elegans male . Wiley interdisciplinary reviews Developmental biology . 2014 ; 3 ( 4 ): 239 – 62 . doi: 10.1002/wdev.136 . PubMed PMID: 25262817 ; PubMed Central PMCID: PMC4181595 . OpenUrl CrossRef PubMed 9. ↵ Cook SJ , Jarrell TA , Brittin CA , Wang Y , Bloniarz AE , Yakovlev MA , et al. Whole-animal connectomes of both Caenorhabditis elegans sexes . Nature . 2019 ; 571 ( 7763 ): 63 – 71 . doi: 10.1038/s41586-019-1352-7 . PubMed PMID: 31270481 . OpenUrl CrossRef PubMed 10. ↵ Sammut M , Cook SJ , Nguyen KC , Felton T , Hall DH , Emmons SW , et al. Glia-derived neurons are required for sex-specific learning in C. elegans . Nature . 2015 ; 526 ( 7573 ): 385 – 90 . doi: 10.1038/nature15700 . PubMed PMID: 26469050 ; PubMed Central PMCID: PMC4650210 . OpenUrl CrossRef PubMed 11. ↵ Molina-Garcia L , Lloret-Fernandez C , Cook SJ , Kim B , Bonnington RC , Sammut M , et al. Direct glia-to-neuron transdifferentiation gives rise to a pair of male-specific neurons that ensure nimble male mating . eLife . 2020 ; 9 . Epub 2020/11/04. doi: 10.7554/eLife.48361 . PubMed PMID: 33138916 ; PubMed Central PMCID: PMCPMC7609048 . OpenUrl CrossRef PubMed 12. ↵ Emmons SW . Neural Circuits of Sexual Behavior in Caenorhabditis elegans . Annu Rev Neurosci . 2018 ; 41 : 349 – 69 . doi: 10.1146/annurev-neuro-070815-014056 . PubMed PMID: 29709211 . OpenUrl CrossRef PubMed 13. Liu KS , Sternberg PW . Sensory regulation of male mating behavior in Caenorhabditis elegans . Neuron . 1995 ; 14 ( 1 ): 79 – 89 . PubMed PMID: 7826644 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Garcia LR , Portman DS . Neural circuits for sexually dimorphic and sexually divergent behaviors in Caenorhabditis elegans . Curr Opin Neurobiol . 2016 ; 38 : 46 – 52 . doi: 10.1016/j.conb.2016.02.002 . PubMed PMID: 26929998 ; PubMed Central PMCID: PMCPMC4921283 . OpenUrl CrossRef PubMed 15. ↵ Wang C , Vidal B , Sural S , Loer C , Aguilar GR , Merritt DM , et al. A neurotransmitter atlas of C. elegans males and hermaphrodites . eLife . 2024 ; 13 . Epub 20241018. doi: 10.7554/eLife.95402 . PubMed PMID: 39422452 ; PubMed Central PMCID: PMCPMC11488851 . OpenUrl CrossRef PubMed 16. ↵ Lints R , Jia L , Kim K , Li C , Emmons SW . Axial patterning of C. elegans male sensilla identities by selector genes . Dev Biol . 2004 ; 269 ( 1 ): 137 – 51 . PubMed PMID: 15081363 . OpenUrl CrossRef PubMed Web of Science 17. ↵ Lints R , Emmons SW . Regulation of sex-specific differentiation and mating behavior in C. elegans by a new member of the DM domain transcription factor family . Genes Dev . 2002 ; 16 ( 18 ): 2390 – 402 . doi: 10.1101/gad.1012602 . PubMed PMID: 12231628 ; PubMed Central PMCID: PMC187445 . OpenUrl Abstract / FREE Full Text 18. ↵ Sulston JE , Schierenberg E , White JG , Thomson JN . The embryonic cell lineage of the nematode Caenorhabditis elegans . Dev Biol . 1983 ; 100 ( 1 ): 64 – 119 . OpenUrl CrossRef PubMed Web of Science 19. ↵ Nehme R , Grote P , Tomasi T , Loser S , Holzkamp H , Schnabel R , et al. Transcriptional upregulation of both egl-1 BH3-only and ced-3 caspase is required for the death of the male-specific CEM neurons . Cell Death Differ . 2010 ; 17 ( 8 ): 1266 – 76 . Epub 20100212. doi: 10.1038/cdd.2010.3 . PubMed PMID: 20150917 ; PubMed Central PMCID: PMCPMC2902690 . OpenUrl CrossRef PubMed Web of Science 20. ↵ Peden E , Kimberly E , Gengyo-Ando K , Mitani S , Xue D . Control of sex-specific apoptosis in C. elegans by the BarH homeodomain protein CEH-30 and the transcriptional repressor UNC-37/Groucho . Genes Dev . 2007 ; 21 ( 23 ): 3195 – 207 . doi: 10.1101/gad.1607807 . PubMed PMID: 18056429 ; PubMed Central PMCID: PMC2081983 . OpenUrl Abstract / FREE Full Text 21. ↵ Shaham S , Bargmann CI . Control of neuronal subtype identity by the C. elegans ARID protein CFI-1 . Genes Dev . 2002 ; 16 ( 8 ): 972 – 83 . PubMed PMID: 11959845 . OpenUrl Abstract / FREE Full Text 22. ↵ Pereira L , Kratsios P , Serrano-Saiz E , Sheftel H , Mayo AE , Hall DH , et al. A cellular and regulatory map of the cholinergic nervous system of C. elegans . eLife . 2015 ; 4 . doi: 10.7554/eLife.12432 . PubMed PMID: 26705699 ; PubMed Central PMCID: PMCPMC4769160 . OpenUrl CrossRef PubMed 23. ↵ Kalis AK , Kissiov DU , Kolenbrander ES , Palchick Z , Raghavan S , Tetreault BJ , et al. Patterning of sexually dimorphic neurogenesis in the caenorhabditis elegans ventral cord by Hox and TALE homeodomain transcription factors . Dev Dyn . 2014 ; 243 ( 1 ): 159 – 71 . doi: 10.1002/dvdy.24064 . PubMed PMID: 24115648 . OpenUrl CrossRef PubMed 24. ↵ Kalis AK , Sterrett MC , Armstrong C , Ballmer A , Burkstrand K , Chilson E , et al. Hox proteins interact to pattern neuronal subtypes in Caenorhabditis elegans males . Genetics . 2022 ; 220 ( 4 ). doi: 10.1093/genetics/iyac010 . PubMed PMID: 35137058 ; PubMed Central PMCID: PMCPMC8982040 . OpenUrl CrossRef PubMed 25. ↵ Lints R , Emmons SW . Patterning of dopaminergic neurotransmitter identity among Caenorhabditis elegans ray sensory neurons by a TGFbeta family signaling pathway and a Hox gene . Development . 1999 ; 126 ( 24 ): 5819 – 31 . PubMed PMID: 10572056 . OpenUrl Abstract 26. Salser SJ , Loer CM , Kenyon C . Multiple HOM-C gene interactions specify cell fates in the nematode central nervous system . Genes Dev . 1993 ; 7 ( 9 ): 1714 – 24 . PubMed PMID: 8103754 . OpenUrl Abstract / FREE Full Text 27. ↵ Clark SG , Chisholm AD , Horvitz HR . Control of cell fates in the central body region of C. elegans by the homeobox gene lin-39 . Cell . 1993 ; 74 ( 1 ): 43 – 55 . PubMed PMID: 8101475 . OpenUrl CrossRef PubMed Web of Science 28. ↵ Yemini E , Lin A , Nejatbakhsh A , Varol E , Sun R , Mena GE , et al. NeuroPAL: A Multicolor Atlas for Whole-Brain Neuronal Identification in C. elegans . Cell . 2021 ; 184 ( 1 ): 272 – 88 e11. Epub 2020/12/31. doi: 10.1016/j.cell.2020.12.012 . PubMed PMID: 33378642 . OpenUrl CrossRef PubMed 29. ↵ Tekieli T , Yemini E , Nejatbakhsh A , Wang C , Varol E , Fernandez RW , et al. Visualizing the organization and differentiation of the male-specific nervous system of C. elegans . Development . 2021 ; 148 ( 18 ). Epub 20210916. doi: 10.1242/dev.199687 . PubMed PMID: 34415309 ; PubMed Central PMCID: PMCPMC8489020 . OpenUrl CrossRef PubMed 30. ↵ Ripoll-Sanchez L , Watteyne J , Sun H , Fernandez R , Taylor SR , Weinreb A , et al. The neuropeptidergic connectome of C. elegans . Neuron . 2023 ; 111 ( 22 ): 3570 – 89 e5. Epub 20231106. doi: 10.1016/j.neuron.2023.09.043 . PubMed PMID: 37935195 . OpenUrl CrossRef PubMed 31. ↵ Ma X , Zhao Z , Xiao L , Xu W , Kou Y , Zhang Y , et al. A 4D single-cell protein atlas of transcription factors delineates spatiotemporal patterning during embryogenesis . Nat Methods . 2021 ; 18 ( 8 ): 893 – 902 . Epub 2021/07/28. doi: 10.1038/s41592-021-01216-1 . PubMed PMID: 34312566 . OpenUrl CrossRef PubMed 32. ↵ Schindelin J , Arganda-Carreras I , Frise E , Kaynig V , Longair M , Pietzsch T , et al. Fiji: an open-source platform for biological-image analysis . Nat Methods . 2012 ; 9 ( 7 ): 676 – 82 . doi: 10.1038/nmeth.2019 . PubMed PMID: 22743772 ; PubMed Central PMCID: PMCPMC3855844 . OpenUrl CrossRef PubMed Web of Science 33. ↵ Loer CM , Kenyon CJ . Serotonin-deficient mutants and male mating behavior in the nematode Caenorhabditis elegans . J Neurosci . 1993 ; 13 ( 12 ): 5407 – 17 . PubMed PMID: 8254383 . OpenUrl Abstract / FREE Full Text 34. ↵ Sherlekar AL , Janssen A , Siehr MS , Koo PK , Caflisch L , Boggess M , et al. The C. elegans male exercises directional control during mating through cholinergic regulation of sex-shared command interneurons . PLoS One . 2013 ; 8 ( 4 ): e60597 . doi: 10.1371/journal.pone.0060597 . PubMed PMID: 23577128 ; PubMed Central PMCID: PMC3618225 . OpenUrl CrossRef PubMed 35. ↵ Leyva-Diaz E , Hobert O . Robust regulatory architecture of pan-neuronal gene expression . Curr Biol . 2022 ; 32 : 1715 – 27 . Epub 2022/03/09. doi: 10.1016/j.cub.2022.02.040 . PubMed PMID: 35259341 . OpenUrl CrossRef PubMed 36. ↵ Kirangwa J , Laetsch DR , King E , Stevens L , Blaxter M , Holovachov O , et al. Evolutionary plasticity in nematode Hox gene complements and genomic loci arrangement . Scientific reports . 2024 ; 14 ( 1 ): 29513 . Epub 20241127. doi: 10.1038/s41598-024-79962-3 . PubMed PMID: 39604390 ; PubMed Central PMCID: PMCPMC11603191 . OpenUrl CrossRef PubMed 37. ↵ Merabet S , Galliot B . The TALE face of Hox proteins in animal evolution . Front Genet . 2015 ; 6 : 267 . Epub 20150818. doi: 10.3389/fgene.2015.00267 . PubMed PMID: 26347770 ; PubMed Central PMCID: PMCPMC4539518 . OpenUrl CrossRef PubMed 38. ↵ Moens CB , Selleri L . Hox cofactors in vertebrate development . Dev Biol . 2006 ; 291 ( 2 ): 193 – 206 . Epub 2006/03/07. doi: S0012-1606(05)00760-8 [pii] 10.1016/j.ydbio.2005.10.032 . PubMed PMID: 16515781 . OpenUrl CrossRef PubMed Web of Science 39. ↵ Smith JJ , Kratsios P . Hox gene functions in the C. elegans nervous system: From early patterning to maintenance of neuronal identity . Semin Cell Dev Biol . 2024 ; 152 – 153 :58-69. Epub 20221207. doi: 10.1016/j.semcdb.2022.11.012 . PubMed PMID: 36496326 ; PubMed Central PMCID: PMCPMC10244487 . OpenUrl CrossRef PubMed 40. Dasen JS , Jessell TM . Hox networks and the origins of motor neuron diversity . Curr Top Dev Biol . 2009 ; 88 : 169 – 200 . Epub 2009/08/05. doi: S0070-2153(09)88006-X [pii] 10.1016/S0070-2153(09)88006-X . PubMed PMID: 19651305 . OpenUrl CrossRef PubMed Web of Science 41. Alexander T , Nolte C , Krumlauf R . Hox genes and segmentation of the hindbrain and axial skeleton . Annu Rev Cell Dev Biol . 2009 ; 25 : 431 – 56 . doi: 10.1146/annurev.cellbio.042308.113423 . PubMed PMID: 19575673 . OpenUrl CrossRef PubMed Web of Science 42. ↵ Krumlauf R . Hox genes, clusters and collinearity . Int J Dev Biol . 2018 ; 62 (11-12): 659 – 63 . doi: 10.1387/ijdb.180330rr . PubMed PMID: 30604835 . OpenUrl CrossRef PubMed 43. ↵ Ferreira HB , Zhang Y , Zhao C , Emmons SW . Patterning of Caenorhabditis elegans posterior structures by the Abdominal-B homolog, egl-5 . Dev Biol . 1999 ; 207 ( 1 ): 215 – 28 . Epub 1999/03/02. doi: S0012-1606(98)99124-2 [pii] 10.1006/dbio.1998.9124 . PubMed PMID: 10049576 . OpenUrl CrossRef PubMed Web of Science 44. ↵ Burglin TR , Ruvkun G . The Caenorhabditis elegans homeobox gene cluster . Curr Opin Genet Dev . 1993 ; 3 ( 4 ): 615 – 20 . doi: 10.1016/0959-437x(93)90097-9 . PubMed PMID: 7902148 . OpenUrl CrossRef PubMed 45. ↵ Wittmann C , Bossinger O , Goldstein B , Fleischmann M , Kohler R , Brunschwig K , et al. The expression of the C. elegans labial-like Hox gene ceh-13 during early embryogenesis relies on cell fate and on anteroposterior cell polarity . Development . 1997 ; 124 ( 21 ): 4193 – 200 . PubMed PMID: 9334268 . OpenUrl Abstract 46. ↵ Brunschwig K , Wittmann C , Schnabel R , Burglin TR , Tobler H , Muller F . Anterior organization of the Caenorhabditis elegans embryo by the labial-like Hox gene ceh-13 . Development . 1999 ; 126 ( 7 ): 1537 – 46 . PubMed PMID: 10068646 . OpenUrl Abstract 47. ↵ Chisholm A . Control of cell fate in the tail region of C. elegans by the gene egl-5 . Development . 1991 ; 111 ( 4 ): 921 – 32 . PubMed PMID: 1879361 . OpenUrl Abstract / FREE Full Text 48. ↵ Kim K , Li C . Expression and regulation of an FMRFamide-related neuropeptide gene family in Caenorhabditis elegans . The Journal of comparative neurology . 2004 ; 475 ( 4 ): 540 – 50 . doi: 10.1002/cne.20189 . PubMed PMID: 15236235 . OpenUrl CrossRef PubMed Web of Science 49. ↵ Berghoff EG , Glenwinkel L , Bhattacharya A , Sun H , Varol E , Mohammadi N , et al. The Prop1-like homeobox gene unc-42 specifies the identity of synaptically connected neurons . eLife . 2021 ; 10 . Epub 2021/06/25. doi: 10.7554/eLife.64903 . PubMed PMID: 34165428 . OpenUrl CrossRef PubMed 50. ↵ Chisholm AD , Hutter H , Jin Y , Wadsworth WG . The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans . Genetics . 2016 ; 204 ( 3 ): 849 – 82 . doi: 10.1534/genetics.115.186262 . PubMed PMID: 28114100 ; PubMed Central PMCID: PMC5105865 . OpenUrl Abstract / FREE Full Text 51. ↵ Yu H , Seah A , Herman MA , Ferguson EL , Horvitz HR , Sternberg PW . Wnt and EGF pathways act together to induce C. elegans male hook development . Dev Biol . 2009 ; 327 ( 2 ): 419 – 32 . doi: 10.1016/j.ydbio.2008.12.023 . PubMed PMID: 19154732 ; PubMed Central PMCID: PMCPMC2695933 . OpenUrl CrossRef PubMed 52. ↵ Cinar H , Keles S , Jin Y . Expression profiling of GABAergic motor neurons in Caenorhabditis elegans . Curr Biol . 2005 ; 15 ( 4 ): 340 – 6 . PubMed PMID: 15723795 . OpenUrl CrossRef PubMed Web of Science 53. ↵ Jin Y , Hoskins R , Horvitz HR . Control of type-D GABAergic neuron differentiation by C. elegans UNC-30 homeodomain protein . Nature . 1994 ; 372 ( 6508 ): 780 – 3 . OpenUrl CrossRef PubMed Web of Science 54. ↵ Hobert O , Tessmar K , Ruvkun G . The Caenorhabditis elegans lim-6 LIM homeobox gene regulates neurite outgrowth and function of particular GABAergic neurons . Development . 1999 ; 126 ( 7 ): 1547 – 62 . OpenUrl Abstract 55. ↵ Gendrel M , Atlas EG , Hobert O . A cellular and regulatory map of the GABAergic nervous system of C. elegans . eLife . 2016 ; 5 . doi: 10.7554/eLife.17686 . PubMed PMID: 27740909 ; PubMed Central PMCID: PMC5065314 . OpenUrl CrossRef PubMed 56. ↵ Howell K , Hobert O . Morphological Diversity of C. elegans Sensory Cilia Instructed by the Differential Expression of an Immunoglobulin Domain Protein . Curr Biol . 2017 ; 27 ( 12 ): 1782 – 90 e5. Epub 20170601. doi: 10.1016/j.cub.2017.05.006 . PubMed PMID: 28578929 . OpenUrl CrossRef PubMed 57. ↵ DeCasien AR , Guma E , Liu S , Raznahan A . Sex differences in the human brain: a roadmap for more careful analysis and interpretation of a biological reality . Biol Sex Differ . 2022 ; 13 ( 1 ): 43 . Epub 20220726. doi: 10.1186/s13293-022-00448-w . PubMed PMID: 35883159 ; PubMed Central PMCID: PMCPMC9327177 . OpenUrl CrossRef PubMed 58. ↵ Siehr MS , Koo PK , Sherlekar AL , Bian X , Bunkers MR , Miller RM , et al. Multiple doublesex-related genes specify critical cell fates in a C. elegans male neural circuit . PLoS One . 2011 ; 6 ( 11 ): e26811 . doi: 10.1371/journal.pone.0026811 . PubMed PMID: 22069471 ; PubMed Central PMCID: PMC3206049 . OpenUrl CrossRef PubMed 59. ↵ Yang Y , Sun Y , Luo X , Zhang Y , Chen Y , Tian E , et al. Polycomb-like genes are necessary for specification of dopaminergic and serotonergic neurons in Caenorhabditis elegans . Proc Natl Acad Sci U S A . 2007 ; 104 ( 3 ): 852 – 7 . Epub 2007/01/12. doi: 0610261104 [pii] 10.1073/pnas.0610261104 . PubMed PMID: 17215367 . OpenUrl Abstract / FREE Full Text 60. ↵ Schwartz HT , Horvitz HR . The C. elegans protein CEH-30 protects male-specific neurons from apoptosis independently of the Bcl-2 homolog CED-9 . Genes Dev . 2007 ; 21 ( 23 ): 3181 – 94 . doi: 10.1101/gad.1607007 . PubMed PMID: 18056428 ; PubMed Central PMCID: PMC2081982 . OpenUrl Abstract / FREE Full Text 61. ↵ Yu H , Pretot RF , Burglin TR , Sternberg PW . Distinct roles of transcription factors EGL-46 and DAF-19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior . Development . 2003 ; 130 ( 21 ): 5217 – 27 . Epub 20030903. doi: 10.1242/dev.00678 . PubMed PMID: 12954713 . OpenUrl Abstract / FREE Full Text 62. ↵ Serrano-Saiz E , Gulez B , Pereira L , Gendrel M , Kerk SY , Vidal B , et al. Modular Organization of Cis-regulatory Control Information of Neurotransmitter Pathway Genes in Caenorhabditis elegans . Genetics . 2020 ; 215 ( 3 ): 665 – 81 . Epub 2020/05/24. doi: 10.1534/genetics.120.303206 . PubMed PMID: 32444379 ; PubMed Central PMCID: PMCPMC7337081 . OpenUrl Abstract / FREE Full Text 63. ↵ Smith JJ , Taylor SR , Blum JA , Feng W , Collings R , Gitler AD , et al. A molecular atlas of adult C. elegans motor neurons reveals ancient diversity delineated by conserved transcription factor codes . Cell Rep . 2024 ; 43 ( 3 ): 113857 . Epub 20240229. doi: 10.1016/j.celrep.2024.113857 . PubMed PMID: 38421866 ; PubMed Central PMCID: PMCPMC11091551 . OpenUrl CrossRef PubMed 64. ↵ Kratsios P , Kerk SY , Catela C , Liang J , Vidal B , Bayer EA , et al. An intersectional gene regulatory strategy defines subclass diversity of C. elegans motor neurons . eLife . 2017 ; 6 . doi: 10.7554/eLife.25751 . PubMed PMID: 28677525 ; PubMed Central PMCID: PMC5498135 . OpenUrl CrossRef PubMed 65. ↵ Hobert O . Terminal Selectors of Neuronal Identity . Curr Top Dev Biol . 2016 ; 116 : 455 – 75 . doi: 10.1016/bs.ctdb.2015.12.007 . PubMed PMID: 26970634 . OpenUrl CrossRef PubMed 66. ↵ Hodgkin J . Male Phenotypes and Mating Efficiency in CAENORHABDITIS ELEGANS . Genetics . 1983 ; 103 ( 1 ): 43 – 64 . doi: 10.1093/genetics/103.1.43 . PubMed PMID: 17246100 ; PubMed Central PMCID: PMCPMC1202023 . OpenUrl Abstract / FREE Full Text 67. ↵ Iosilevskii Y , Hall DH , Katz M , Podbilewicz B . The PVD neuron has male-specific structure and mating function in Caenorhabditis elegans . Proc Natl Acad Sci U S A . 2025 ; 122 ( 13 ): e2421376122 . Epub 20250326. doi: 10.1073/pnas.2421376122 . PubMed PMID: 40138342 . OpenUrl CrossRef PubMed 68. ↵ Hueber SD , Weiller GF , Djordjevic MA , Frickey T . Improving Hox protein classification across the major model organisms . PLoS One . 2010 ; 5 ( 5 ): e10820 . Epub 20100525. doi: 10.1371/journal.pone.0010820 . PubMed PMID: 20520839 ; PubMed Central PMCID: PMCPMC2876039 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted May 17, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Pervasive homeobox gene function in the male-specific nervous system of Caenorhabditis elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Pervasive homeobox gene function in the male-specific nervous system of Caenorhabditis elegans Robert W. Fernandez , Angelo J. Digirolamo III , Giulio Valperga , G. Robert Aguilar , Laura Molina-García , Rinn M. Kersh , Chen Wang , Karinna Pe , Yasmin H. Ramadan , Curtis Loer , Arantza Barrios , Oliver Hobert bioRxiv 2025.05.13.653874; doi: https://doi.org/10.1101/2025.05.13.653874 Share This Article: Copy Citation Tools Pervasive homeobox gene function in the male-specific nervous system of Caenorhabditis elegans Robert W. Fernandez , Angelo J. Digirolamo III , Giulio Valperga , G. Robert Aguilar , Laura Molina-García , Rinn M. Kersh , Chen Wang , Karinna Pe , Yasmin H. Ramadan , Curtis Loer , Arantza Barrios , Oliver Hobert bioRxiv 2025.05.13.653874; doi: https://doi.org/10.1101/2025.05.13.653874 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7635) Biochemistry (17697) Bioengineering (13895) Bioinformatics (41953) Biophysics (21456) Cancer Biology (18595) Cell Biology (25521) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22511) Immunology (17738) Microbiology (40401) Molecular Biology (17184) Neuroscience (88623) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00