Exploring the potent antimicrobial activity of manuka honey as against clinically isolated multi-drug resistant and ceftriaxone-resistant Salmonella Typhi in septicemia patients: a promising therapeutic option | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exploring the potent antimicrobial activity of manuka honey as against clinically isolated multi-drug resistant and ceftriaxone-resistant Salmonella Typhi in septicemia patients: a promising therapeutic option Iqra Bashir, Muhammad Hidayat Rasool, Muhammad Shafique, Kokab Jabeen, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3881301/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background : The rise of extensively drug-resistant Salmonella Typhi is a significant concern in clinical settings, particularly among patients with septicemia. These pathogenic eggs were resistant to first and second-line drugs, including ceftriaxone, except azithromycin. Mauka honey serves as a viable alternative treatment choice in combating these diseases. Hence, our main objective is to ascertain the antimicrobial efficacy of manuka honey against multidrug-resistant (MDR) and extensively drug-resistant (XDR) clinical strains of S . Typhi. Methods : A combined total of 50 MDR and 50 XDR S . Typhi clinical isolates were obtained from patients with septicemia. Following the Bactec blood culture system, the isolates were sub-cultured on blood and MacConkey agar and their biochemical confirmation and susceptibility to different antibiotics was done using the Vitek 2 compact system. The PCR technique was used to amplify the antibiotic-resistance genes. The antibacterial activity of Manuka honey was assessed using the agar well diffusion assay and micro broth dilution assay. Results : All 100 isolates were verified to be S. Typh. Out of the total, 50% of the S . Typhi bacteria were MDR and 50% were XDR. These bacteria were only susceptible to azithromycin and carbapenems. These strains exhibited amplification of H58, gyrA, and gyrB genes, blaCTX-M-15 and blaTEM genes. The zone of inhibition for MDR and XDR- S . typhi was shown to range from 15-24mm and 15-23mm, respectively, while using 100% manuka honey. The MDR- S . Typhi 18/50 (36%) strain and XDR- S . Typhi 14/50 (28%) strain was inhibited at a concentration of 3.125 v/v%. Conclusion : Manuka honey could be an alternative option against MDR and XDR S. Typhi. MDR S. Typhi XDR S. Typhi Septicemia Antimicrobial resistant genes Manuka honey Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The World Health Organization (WHO) has estimated that out of 48.9 million recorded cases of sepsis globally, around 20 million cases were found in children (Fleischmann-Struzek and Rudd 2023 ). Unfortunately, 1.27 million people died related to AMR and around 5 million deaths were attributed to AMR infections in 2019 (Murray et al. 2022 ). Infections produced by Salmonella serovar Typhi become more complicated due to the emergence of multi-drug-resistant (MDR) and extensively drug-resistant (XDR) strains globally (Shahid et al. 2021 ). The outbreak of XDR- S . Typhi was reported first time in Hyderabad, Pakistan in 2016 (Yousafzai et al. 2019 ). The MDR-S. Typhi produced resistance to first-line drugs (ampicillin, cotrimoxazole, and fluoroquinolones) (Shaikh et al. 2023 ), while XDR-S. Typhi was resistant to first-line drugs along with ceftriaxone antibiotics and treated with only azithromycin and carbapenem (Qureshi et al. 2020 ). However, recently azithromycin resistance has also been reported in Pakistan (Iqbal et al. 2020 ). The XDR-S. Typhi bacteria contained highly evolving plasmid-mediated resistance, transposons, and mutations in chromosomal genes that confer resistance to various classes of antibiotics. These include cat A1 (resistance to chloramphenicol), blaTEM-1 (resistance to ampicillin), dhfR7 and sul 1 (resistance to co-trimoxazole), and qnr S (resistance to fluoroquinolones). The QRDR regions were found to contain gyr A and gyr B, par C and pare, and blaCTX-M-15 (resistance to ceftriaxone) in the IncY region of the plasmid (Kim et al. 2021 ) To combat these superbugs, the World Health Organisation is calling on researchers to develop novel treatments. One essential commodity that can be utilised to reduce the strain of resistance on the health sector is medical-grade honey, commonly known as Manuka honey. This honey is not only used as a natural food but it is also used to cure a variety of illnesses, such as burns and wounds (Combarros-Fuertes et al. 2020 ). Manuka Honey is derived from the Leptospermum scoparium tree by bees in New Zealand and coastal regions of Australia. Bees gather the pollen from the blossoms of a Manuka tree (Qamar et al. 2018 ). Manuka honey possesses several antibacterial properties including low pH, high osmolarity, and stimulus to the immune system that are crucial in combating the development of antibiotic resistance in diverse microbes (Hewett et al. 2022 ). The antimicrobial effects of Manuka honey primarily stem from its significant levels of Methylglyoxal (MGO) and phenolic compounds. Consequently, it can serve as a substitute for conventional antibiotics to treat the prevalence of highly resistant (Nolan et al. 2020 ). There is a scarcity of studies that have documented the antibacterial efficacy of Manuka honey against MDR and XDR strains of S. Typhi. Hence, our objective was to conduct a comprehensive investigation into the bacterial isolates, antimicrobial profile, genetic characterisation, and antibacterial activity of Manuka honey against these highly resistant bacteria. Methods Ethical permission and patient’s consent Before starting the study, we obtained ethical approval from the Ethical Review Committee at Government College University Faisalabad. As required by the legal guardians of the study population, we obtained consent in the national language, which was also provided in writing when necessary. We assured the participants that their confidential information would be kept secure and used only for research purposes. After that, we transferred the materials to the researcher for further processing. Throughout the study, we processed the samples as anonymous data and analyzed them, ensuring the confidentiality of individuals' personal information. Collection of bacterial isolates from clinical wards Using aseptic techniques, we collected 100 blood culture isolates of S . Typhi from patients suspected of having septicemia. These isolates were collected from various public and private sector Hospitals in Lahore and Faisalabad, Pakistan. The study participants comprised patients of all age groups from various hospital wards, including the intensive care unit (ICU), emergency, outdoor patient (OPD), and medical and surgery wards. The study included patients ranging from infants to adolescents, without any consideration for gender discrimination. The study included patients who exhibited two or more of the following signs and symptoms: body temperature exceeding 38°C or falling below 35°C, pulse rate surpassing 90 beats per minute, and respiration rate exceeding 20 breaths per minute. Blood culture processing and isolate confirmation 5–10 ml blood from adults and 3-5ml blood from children were drawn aseptically following the standard operating procedure. The isolates underwent processing in the Bactec/Alert BD 9120 system (bioMeriux, France). This technique utilises fluorescence technology to quickly identify the presence of blood-borne pathogens in a patient's blood. The basic principle is to monitor the production of CO 2 by the microbes resulting in the emission of light. The light detector identified an elevated level of CO2, which served as an indication of the existence of viable microorganisms in the blood-grown bottles. All the bottles were monitored for up to five days. Positive isolates were further processed for identification based on colony morphology and cultural characteristics. Blood culture isolates were sub-cultured on blood agar, Salmonella-Shigella agar and MacConkey agar for further demonstration at 37 o C following overnight incubation. Colony morphology and cultural characteristics indicated the type of the organism. The isolates were further confirmed through an automated Vitek 2 compact system (bioMeriux, France) by utilizing 64 different biochemical tests. Determination of minimum inhibitory concentration of antibiotics against S. Typhi All 100 isolates of S. Typhi were analyzed to determine their resistance profile against different antimicrobials using the Vitek® 2 compact system. Antibiogram to determine the susceptibility pattern of identified strains by using ampicillin, co-trimoxazole, ciprofloxacin, chloramphenicol, ceftriaxone, azithromycin, meropenem, imipenem was performed using CLSI guidelines, 2021. Molecular Characterization of S. Typhi Isolates DNA extraction of the 100 blood culture isolates of S. Typhi was done using a DNA extraction kit (Seongam, South Korea) as per the manufacturer’s instructions (Bahari et. Al, 2021). This is based on silica membrane spin column-based technology for purifying genomic DNA. This technology comprises of lysis step, Binding Step, wash step and final Elution steps with the use of GT1 buffer, GT2 buffer, W1 Buffer, W2 Buffer, Elution Buffer and Proteinase K enzyme for performing various steps of genomic DNA extraction. Molecular detection of ARGs in S . Typhi Molecular detection of antimicrobial-resistant genes in S. Typhi was carried through Monoplex and Multiplex PCR Assays were conducted to clone resistant genes of different antimicrobials using a Thermal cycler machine (Bio-Rad T100™ Thermal cycler, USA) as per manufacturer’s guidelines. The PCR was a 25ųl of the PCR reaction mixture prepared in a PCR reaction tube containing 4ng of DNA, 12 ųl of 2X PCR Green Tag MasterMix (Thermo Fischer Scientific, UK), 1.5 ųM of each forward and reverse primer and 6ųl of nuclease-free water to attain a final volume of 25ųl. All the tubes containing the PCR reactions mixture were run in a thermal cycler machine ( BioRad Laboratories Inc., USA) with the following conditions; Initial denaturation at 95 o C for about 120 sec, final denaturation at 95 o C for 30 sec, annealing at 68 o C for 60 sec and final extension at 68 o C for 10 mins. Each step was repeated for 30 times (Khokhar et. al., 2022). The PCR product from the thermal cycler was put onto 1.1% agarose gel (Thermo Fischer Scientific, UK) to separate resistant gene bands based on charge and size. Ethidium bromide dye was added to visualize bands under UV light as the gel gets stained with this fluorescent dye. DNA bands are visualized on an ultraviolet transilluminator. Amplicon size was compared to the 100bp DNA ladder (Zokeyo, UK). The list of primers used in this study is given in Table 1 . Table 1 Primers sequences and PCR conditions Target genes Primer Sequence (5’-3’) Amplicon size (bp) Annealing temp ( O C) pltB TAAACCATGATAGACTGG 657 55 GAAAGTTACGGTTATACC catA1 GAAGATCACTTCGCAGAATAA 1003 45 CAGCAATAGACATAAGCG dhfR7 GCAACGTCAGAAAATGGC 405 60 AAACTGCTCAAAAAGGAAATTGA sul1 GTATTGCGCCGCTCTTAGAC 500 60 AGGGTTTCCGAGAAGGTGAT qnrS TATAATGGTAGTCTAGCCC 722 52 GATGTGTGATTTTAAACG S . Typhi GGCAGATATACTTTCGCAGGCA 227 60 CCCAGAACCAAATTTGCTTACA XDR-S . Typhi TGAATGGTTCTGGTCTGGCG 425 60 CTAAACCACGACGGCTCAGT H58 GGGCTTGATGGCTTCATTAGT 509 60 ACAGGTTGTACGCCTTTCCA gyr A TACCGTCATAGTTATCCACA 313 53 GTACTTTACGCCATGAACGT gyr B GCGCTGTCCGAACTGTACCT 345 53 GATCAGCGTCGCCACTTCC parC ATAGGGTATTATCTGCGGC 2473 55 GAATAAACAACGGTTTTACG parE TGCACAGTTGCTGACAATC 1990 55 TCGGATTCTCTTATCCGGCCTG macA CTGTAAGCTGTGTCATGATCG 1308 52 CTCACATTGCACAGTTCAAGC acrB (N-term) GGTTAAAGTGCAGGAAATTACCG 1695 50 CTACGCTATCGGTGTAGTGAT acrB (C-term) GACGATGCTCAAACCCGT 1815 50 GCCAACTTTCCTAAGAAAAAGCC acrR CACCGACATATGGCACGAA 633 52 CAGCGTCGGACACAATTGATA bla CTX−M−15 CAATGTGCAGCACCAGTAA 540 50 CGCAATATCATTGGTGGTG bla TEM-1 CAGCGGTAAGATCCTTGAA 643 55 ACTCGCCGTCGTGTAGATAA blaIMP GGAATAGAGTGGCTTAATTCTC 510 52 CCAAACCAC TACGTTATC blaVIM GATGGTGTTTGGTCGCATA 450 52 CGAATGCGCAGCACCAG In vitro activity of Manuka Honey against S . Typhi The manuka honey (Watson & Son, New Zealand) (250g) with + 24 UMF (unique manuka factor) with MGO was commercially purchased. The honey was serially diluted at the concentrations of 10%, 20%, 30%, 40%, 50%, and 100% as described previously (Ejaz et al. 2023 ). In short, the bacterial suspension (0.5McFarland) was evenly spread onto Muller Hinton Agar (MHA) plates. Agar wells were created on the plates using a sterile cork borer with a diameter of 6mm, and each dilution was poured into its corresponding well. The plates were then incubated at a temperature of 37°C for 24 hours. The zone of inhibition (mm) of manuka honey against MDR, and XDR S. Typhi strains was calculated using a vernier callipe. The minimum inhibitory concentration of Manuka Honey against S . Typhi Fresh 2–3 colonies of S. Typhi bacterial culture were emulsified into 2-3ml of concentrated lysogeny broth solution in 50 falcon tubes. The mixture was then incubated at 37 o C to achieve 0.5 McFarland turbidity standard at an optical density of 0.07 and wavelength of 600nm. Further dilutions were made by adding 1:100th double-strength LB to achieve a concentration of 1-10 5 CFU/ml. Each well of a microtiter plate (Thermo Scientific, UK) was filled with 100ml of each dilution except for the negative control that contained only 100ųl of lysogeny broth (Kim et. al., 2021 ). 100ųl of + 24 UMF concentrated manuka honey was added to the first well and then further dilutions were added to the next wells, respectively except for the positive control well. Both bacterial suspension and lysogeny broth were added into the positive control wells of the microtitration plate. Following overnight incubation at 37 o C in a shaking incubator (MaxQTM Mini 4450, Thermo Fisher Scientific) at 3g, MIC (v/v %) was read comparing the wells with positive and negative controls (Ejaz et al. 2023 ). Minimum bactericidal concentration MBC is defined as the first dilution with no visible growth on agar plates. A 10µl of the sample from no visible growth wells of the microtiter plates was inoculated onto nutrient agar plates (Oxoid, UK) followed by overnight incubation at 37 o C, aerobically. Viable cells and colonies formed on the agar plates were examined for further scoring as visible or no visible growth. Results Clinical information and confirmation of S. Typhi The clinical characterization of patients was included in this study. The 60% were male 40% were female were reported and the male to female ratio was ?????. the age range was 1 year to 31 years with the majority of the isolates recovered from children less than 5 years followed by 24 from > 10 - ≤15 years and 16 from > 5 - ≤10 years. Further, most of the samples were recovered from the emergency department (62%) followed by OPD (26%) and ICU (5%) (Table 1 ). Table 1 Comprehensive representation of the blood culture isolates of MDR and XDR S. Typhi Clinical information Number Percentage Gender Male 60 60% Female 40 40% Male to female ratio Age (1 year to 31 years) 0 - ≤5 45 45% > 5 - ≤10 16 16% > 10 - ≤15 24 24% > 15 - ≤20 10 10% > 20 5 5% Clinical wards Emergency room 62 62% ICU 7 7% OPD 26 26% Surgical wards 5 5% ICU: intensive care unit, OPD: outdoor patients Antibiogram profiling of S. Typhi clinical isolates The minimum inhibitory concentration of clinical isolates of S. Typhi was performed against the WHO class of antibiotics including “Access”, “Watch” and “Reserve” (AWaRe) as per CLSI 2021 guidelines. Of the 100 isolates, 50 were MDR- S . Typhi and 50 were XDR- S . Typhi. The antibiogram revealed that 100% of the isolates were resistant to ampicillin (≥ 32µg/ml), co-trimoxazole (≥ 4/76 µg/ml), chloramphenicol (≥ 32 µg/ml), and ciprofloxacin (≥ 1 µg/ml). However, 50% of the isolates were resistant to ceftriaxone. Further, all the isolates were sensitive to carbapenem and azithromycin (Table 2 ). Table 2 Antimicrobial susceptibility testing of S . Typhi clinical isolates WHO classes Antibiotics MIC Breakpoints Resistant Sensitive Access AMP ≥ 32 100 0 Access SXT ≥ 4/76 100 0 Access CHL ≥ 32 100 0 Watch CIP ≥ 1 100 0 Watch CRO ≥ 4 50 50 Watch AZM ≥ 32 0 100 Watch IMP ≥ 4 0 100 Watch MEM ≥ 4 0 100 AMP: ampicillin, SXT: co-trimoxazole, CHL: Chlorophenicol, CIP: ciprofloxacin, CRO: ceftriaxone, AZM: azithromycin, IMP: imipenem, MEM: meropenem Molecular detection of ARGs in S . Typhi The molecular detection of the ARGs of the S . Tsyphi gene was determined by PCR. All the S. Typhi were detected with geneus species-specific primers (Fig. 1 A). MDR-S. Typhi (n = 50) were co-honoured with H58 and gyrA and gyrB gene (Fig. 1 C). Further, the XDR-S. Typhi (n = 50) were harboured by the gyrA , gyrB , bla CTX−M−15 , bla TEM−1 , and XDR-S. Typhi-specific primer (Fig. 1 B, 2 A, 2 B, 3 A, and 3 B) and Table 3 . Table 3 Phenotypic and genotypic detection of MDR and XDR genes in S. Typhi No of isolates AMP SXT C CIP CRO Antimicrobial-resistant genes MDR S. Typhi (n = 50) ≥ 32 ≥ 4/76 ≥ 32 ≥ 1 ≤ 4 S. Typhi gene, g yr A , gyrB, H58 XDR S. Typhi (n = 50) ≥ 32 ≥ 4/76 ≥ 32 ≥ 1 ≥ 4 S. Typhi gene, g yr A, gyr B, bla CTX−M−15 bla TEM−1. H58, XDR-S. Typhi gene , Antibacterial efficacy of Manuka honey against MDR and XDR S. Typhi The effectiveness of Manuka honey against MDR and XDR- S . Typhi clinical isolates were tested using the agar well diffusion method. Sterile water was used to dilute the honey from 100–10%. MDR- S . Typhi bacteria exposed to 100% concentration of Manuka honey showed a range of 15-24mm zone of inhibition, with an average of 20.3mm and an SD of 2.18. At a 50% concentration, the zone of inhibition ranged from 13-19mm, with an average of 15.8mm. At a concentration of 14.3mm, the zone of inhibition ranged from 11-18mm, with an SD of 1.60 ( P-value : 0.001). The XDR-S. Typhi showed a range of 15-23mm zone of inhibition when exposed to 100% Manuka honey, with an average of 19.2mm and an SD of 1.95. At 50% concentration, the zone of inhibition ranged from 12-18mm, with an average of 15.5mm and a standard deviation of 1.43. At a concentration of 40%, the zone of inhibition ranged from 10-17mm, with an average of 13.7mm and an SD of 1.48 ( P-value : 0.000) (Table 1 and Fig. 4 ). Table 4 Agar wal diffusion assay of Mauka honey against MDR and XDR- S . Typhi 100% 50% 40% 30% 20% 10% P-value MDR- S . Typhi Range (mm) 15–24 13–19 11–18 9–17 8–16 7–14 0.001* Mean 20.3 15.8 14.3 12.9 11.6 10.0 SD 2.18 1.38 1.60 1.88 2.0 1.91 XDR- S . Typhi Range (mm) 15–23 12–18 10–17 9–16 7–14 5–11 0.000* Mean 19.24 15.5 13.7 11.9 10.3 8.0 SD 1.95 1.43 1.48 1.80 1.64 1.67 * P-value < 0.05 is considered statistically significant. SD: standard deviation MIC and MBC of manuka honey against MDR and XDR-S. Typhi The MIC and MBC of manuka honey were evaluated using the micro broth dilution assay on microtiter plates. The MDR-S. Typhi strain, with a prevalence of 5/50 (10%), was effectively inhibited at a MIC of 1.56 v/v%. Furthermore, it was completely eradicated at a MBC of 3.125 v/v%. In contrast, the 18/50 (36%) strain showed susceptibility at 3.125 v/v%, the 12/50 (24%) strain at 6.25 v/v%, the 10/50 (20%) strain at 12.5 v/v%, and the 5/50 (10%) strain at 25 v/v% (Fig. 5 ). Furthermore, the XDR-S. Typhi strain inhibited 1/50 (2%) of the strains at a concentration of 1.56v/v%. This was followed by inhibition in 14/50 (28%) of the strains at a concentration of 3.125 v/v%, 10/50 (20%) at 6.25 v/v%, 16/50 (32%) at 12.5v/v%, and 9/50 (18%) at 25v/v% concentration of manuka honey (Fig. 6 and Fig. 7 ). Discussion In poor and middle-income nations, the recent appearance of S . Typhi has become a serious issue because of the spread of bloodstream infections that can cause sepsis, especially in those with impaired immune systems (Masuet-Aumatell and Atouguia 2021 ). According to the World Health Organization (WHO), in 2019, over 9 million individuals contracted typhoid fever and 110,000 individuals succumbed to the disease annually (Hancuh et al. 2023 ). AMR progressively emerged as MDR and XDR in S. Typhi leading to the failure of treatment (Qamar et al. 2020 ). The MIC values of all the MDR S. Typhi isolates showed resistance to ampicillin, chloramphenicol and co-trimoxazole while XDR strains that harboured resistance against all first lines, second-line fluoroquinolones and third-generation cephalosporins leaving macrolides and carbapenems as alternative options (Jabeen et al. 2023 ). The study focused on isolating MDR and XDR S . Typhi bacteria from patients with septicemia who were admitted to various wards. A comparable extensive investigation carried out on patients with septicemia in Pakistan unveiled the existence of 50.1% MDR and 33% XDR S . Typhi. (Qamar et al. 2021 ). Similarly, a study conducted in Pakistan has documented the existence of 45 strains of XDR S. Typhi isolated from cases of septicemia in paediatric patients (Kim et al. 2021 ). After the first outbreak of XDR. S. typhi strains its now been reported across the border from China (Wang et al. 2022 ), USA (Walker et al. 2023 ), UK (Benjamin et al. 2021 ), and India (Samajpati et al. 2021 ), and Bangladesh (Djeghout et al. 2018 ). However, reports on the emergence of azithromycin-resistant S . Typhi (Iqbal et al. 2020 ) and carbapenem-resistant S . Typhi from Pakistan (Nizamuddin et al. 2023 ). The emergence of these resistant strains is mostly attributed to the acquisition of genes that confer resistance to antimicrobial agents. In the present study, the MDR-S. Typhi strains were simultaneously present with H58, as well as the gyrA and gyrB genes. Additionally, the H58 strain co-existed with XDR-S. Typhi, along with the gyrA, gyrB, blaCTX-M-15 , and blaTEM-1 genes. A study conducted in Hong Kong found that 30 strains originating from southeast Asia displayed the H58 haplotype in XDR-S. Typhi isolates (Li et al. 2023 ). Additionally, a study conducted in Italy has detected the blaCTX-M-15 gene in XDR-S. Typhi. (Procaccianti et al. 2020 ). A separate study conducted in Pakistan also observed the existence of blaCTX-M-15, blaTEM, gyrA, gyrB , and H58. (Kim et al. 2021 ). In addition, a study conducted in Lahore, Pakistan identified the presence of the gyrA, gyrB, blaCTX-M-15, blaTEM , and sul1 genes at the molecular level (Jabeen et al. 2023 ). We investigated the antibacterial activity of manuka honey (+ 24UMF) imported from New Zealand against several MDR and XDR strains of S . Typhi. The strains were inhibited at low MIC and MBC. So far, there have been no documented studies investigating the efficacy of Manuka honey against XDR S . Typhi strains. A study conducted in Pakistan investigated the antibacterial properties of Pakistani honeys against MDR-S. Typhi. The findings revealed that 30% of the strains were inhibited by 11–16% phenol. Additionally, it was observed that manuka honey exhibited higher activity compared to other types of honey (Hussain et al. 2015 ). In addition, a study was conducted on the indigenous honey against XDR-S. Typhi strains in Pakistan revealed that Beri honey exhibited the greatest zone of inhibition, measuring between 7 and 15 mm, while Neem honey had a zone of inhibition ranging from 7 to 12 mm. The MIC and MBC of beri honey against 15% of XDR- S . Typhi isolates were determined to be 3.125% and 6.25%, respectively (Ejaz et al. 2023 ). Conclusion This investigation identified a substantial occurrence of MDR and XDR strains of S . Typhi in patients with septicemia, specifically in children, in clinical settings in Pakistan. Furthermore, we have identified the presence of H58 haplotypes in S. Typhi strains that are resistant, along with the blaCTX-M-15, gyrA, gyrB , and blaTEM genes. Furthermore, Manuka honey, which has antibacterial properties, shows promising effectiveness against these bacteria that are resistant to antibiotics. In addition, manuka honey can be utilized alongside antibiotics to efficiently address infections caused by extremely resistant strains of S. Typhi, which exhibit resistance to many medicines and are widely drug-resistant. This therapy technique has been substantiated by multiple rigorous clinical trials. Declarations Conflict of interest: All authors declare no conflict of interest. Author Contribution Conceptualization, writing the original draft, formal analysis, investigations: IB, MHR, MS, MUQ, Formal analysis, investigations, funding acquisition, resources, project administration, reviewing and editing. MUQ, IB, KJ. Reviewing and editing, data validation, and data curation: MUQ, IB, KJ. All authors reviewed the manuscript. Acknowledgement: We express our gratitude to the Institute of Microbiology, Faculty of Life Sciences, Government College University Faisalabad for their invaluable cooperation. References Benjamin A, Olley L, Troise O, Hughes S, Donaldson H, Sadighi A (2021) A case of Extensively Drug Resistant (XDR) Extended Spectrum Beta-Lactamase (ESBL) typhoid fever in the Ambulatory Emergency Care (AEC) unit. Clinical Infection in Practice 10:100068 doi: https://doi.org/10.1016/j.clinpr.2021.100068 Combarros-Fuertes P, Fresno JM, Estevinho MM, Sousa-Pimenta M, Tornadijo ME, Estevinho LM (2020) Honey: Another Alternative in the Fight against Antibiotic-Resistant Bacteria? Antibiotics (Basel) 9 doi: 10.3390/antibiotics9110774 Djeghout B et al. (2018) Ceftriaxone-resistant Salmonella Typhi carries an IncI1-ST31 plasmid encoding CTX-M-15. J Med Microbiol 67:620-627 doi: 10.1099/jmm.0.000727 Ejaz H et al. (2023) Antibacterial efficacy of indigenous Pakistani honey against extensively drug-resistant clinical isolates of Salmonella enterica serovar Typhi: an alternative option to combat antimicrobial resistance. BMC Complementary Medicine and Therapies 23:42 doi: 10.1186/s12906-023-03870-8 Fleischmann-Struzek C, Rudd K (2023) Challenges of assessing the burden of sepsis. Medizinische Klinik - Intensivmedizin und Notfallmedizin 118:68-74 doi: 10.1007/s00063-023-01088-7 Hancuh M et al. (2023) Typhoid Fever Surveillance, Incidence Estimates, and Progress Toward Typhoid Conjugate Vaccine Introduction - Worldwide, 2018-2022. MMWR Morb Mortal Wkly Rep 72:171-176 doi: 10.15585/mmwr.mm7207a2 Hewett SR, Crabtrey SD, Dodson EE, Rieth CA, Tarkka RM, Naylor K (2022) Both Manuka and Non-Manuka Honey Types Inhibit Antibiotic Resistant Wound-Infecting Bacteria. Antibiotics 11:1132 Hussain MB et al. (2015) Evaluation of the antibacterial activity of selected Pakistani honeys against multi-drug resistant Salmonella typhi. BMC Complement Altern Med 15:32 doi: 10.1186/s12906-015-0549-z Iqbal J et al. (2020) A Race against Time: Reduced Azithromycin Susceptibility in Salmonella enterica Serovar Typhi in Pakistan. mSphere 5:10.1128/msphere.00215-00220 doi: doi:10.1128/msphere.00215-20 Jabeen K et al. (2023) Molecular Characterization of Extensively Drug Resistant Salmonella Enterica Serovar Typhi Clinical Isolates from Lahore, Pakistan. Infect Drug Resist 16:2987-3001 doi: 10.2147/idr.s406253 Kim C et al. (2021) The molecular basis of extensively drug-resistant Salmonella Typhi isolates from pediatric septicemia patients. PLoS One 16:e0257744 doi: 10.1371/journal.pone.0257744 Li X et al. (2023) Genomic Investigation of Salmonella Typhi in Hong Kong Revealing the Predominance of Genotype 3.2.2 and the First Case of an Extensively Drug-Resistant H58 Genotype. Microorganisms 11:667 Masuet-Aumatell C, Atouguia J (2021) Typhoid fever infection – Antibiotic resistance and vaccination strategies: A narrative review. Travel Medicine and Infectious Disease 40:101946 doi: https://doi.org/10.1016/j.tmaid.2020.101946 Murray CJL et al. (2022) Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 399:629-655 doi: 10.1016/s0140-6736(21)02724-0 Nizamuddin S, Khan EA, Chattaway MA, Godbole G (2023) Case of Carbapenem-Resistant Salmonella Typhi Infection, Pakistan, 2022. Emerg Infect Dis 29:2395-2397 doi: 10.3201/eid2911.230499 Nolan VC, Harrison J, Wright JEE, Cox JAG (2020) Clinical Significance of Manuka and Medical-Grade Honey for Antibiotic-Resistant Infections: A Systematic Review. Antibiotics (Basel) 9 doi: 10.3390/antibiotics9110766 Procaccianti M et al. (2020) First Case of Typhoid Fever due to Extensively Drug-resistant Salmonella enterica serovar Typhi in Italy. Pathogens 9:151 Qamar FN et al. (2020) Antimicrobial Resistance in Typhoidal Salmonella: Surveillance for Enteric Fever in Asia Project, 2016-2019. Clin Infect Dis 71:S276-s284 doi: 10.1093/cid/ciaa1323 Qamar MU et al. (2021) Molecular detection of extensively drug-resistant Salmonella Typhi and carbapenem-resistant pathogens in pediatric septicemia patients in Pakistan - a public health concern. Future Microbiol 16:731-739 doi: 10.2217/fmb-2021-0036 Qamar MU et al. (2018) In vitro and in vivo activity of Manuka honey against NDM-1-producing Klebsiella pneumoniae ST11. Future Microbiol 13:13-26 doi: 10.2217/fmb-2017-0119 Qureshi S et al. (2020) Response of extensively drug resistant Salmonella Typhi to treatment with meropenem and azithromycin, in Pakistan. PLoS Negl Trop Dis 14:e0008682 doi: 10.1371/journal.pntd.0008682 Samajpati S, Pragasam AK, Mandal S, Balaji V, Dutta S (2021) Emergence of ceftriaxone resistant Salmonella enterica serovar Typhi in Eastern India. Infect Genet Evol 96:105093 doi: 10.1016/j.meegid.2021.105093 Shahid S, Mahesar M, Ghouri N, Noreen S (2021) A review of clinical profile, complications and antibiotic susceptibility pattern of extensively drug-resistant (XDR) Salmonella Typhi isolates in children in Karachi. BMC Infectious Diseases 21:900 doi: 10.1186/s12879-021-06599-2 Shaikh OA, Asghar Z, Aftab RM, Amin S, Shaikh G, Nashwan AJ (2023) Antimicrobial resistant strains of Salmonella typhi: The role of illicit antibiotics sales, misuse, and self-medication practices in Pakistan. Journal of Infection and Public Health 16:1591-1597 doi: https://doi.org/10.1016/j.jiph.2023.08.003 Walker J et al. (2023) Assessing the global risk of typhoid outbreaks caused by extensively drug resistant Salmonella Typhi. Nature Communications 14:6502 doi: 10.1038/s41467-023-42353-9 Wang Y et al. (2022) Extensively Drug-Resistant (XDR) Salmonella Typhi Outbreak by Waterborne Infection - Beijing Municipality, China, January-February 2022. China CDC Wkly 4:254-258 doi: 10.46234/ccdcw2022.062 Yousafzai MT et al. (2019) Ceftriaxone-resistant Salmonella Typhi Outbreak in Hyderabad City of Sindh, Pakistan: High Time for the Introduction of Typhoid Conjugate Vaccine. Clin Infect Dis 68:S16-s21 doi: 10.1093/cid/ciy877 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3881301","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":268521154,"identity":"45b10bb2-fe9f-4c3e-b243-bafa3b33a331","order_by":0,"name":"Iqra Bashir","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Iqra","middleName":"","lastName":"Bashir","suffix":""},{"id":268521155,"identity":"147a5b4e-aeb1-4627-a1e3-07ac7323bf81","order_by":1,"name":"Muhammad Hidayat Rasool","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Hidayat","lastName":"Rasool","suffix":""},{"id":268521156,"identity":"41e22c3d-9095-4977-a3b6-87ac7ffc4d64","order_by":2,"name":"Muhammad Shafique","email":"","orcid":"","institution":"Government College University","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"","lastName":"Shafique","suffix":""},{"id":268521157,"identity":"01f74777-c953-4cec-8f8f-9f4895696859","order_by":3,"name":"Kokab Jabeen","email":"","orcid":"","institution":"General Hospital Lahore","correspondingAuthor":false,"prefix":"","firstName":"Kokab","middleName":"","lastName":"Jabeen","suffix":""},{"id":268521158,"identity":"5cf10c14-9aa1-4fe2-bb1f-a4a66ba175cd","order_by":4,"name":"Muhammad Usman Qamar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYJADxgdAgh+IDYA4gSgtzCClkg2kaGGTIEqL7oz0pxt+7rCW120/+6zyS81hCQb25m0SjDvScGoxu5FjdrP3TLrhtjPpZrdljgG18Bwrk2A8k4NPC9sN3rbDjNsOpLHdlmw4XMcgkWMmwdhWgUdL+rObf9sO2287/4ytGKhFgkH+DSEtCWa3gbYkbruRxsb4EaRFggekBY/Dzrwxuy3blp687cYzZmmGY+kSbDxpxRaJZ/B4/zjQYW/brG23nU9j/PijxlqCn/3wxhsfdyTj1AIFzBCSB0iwgViJDYR0QLUw/oDxGQlrGQWjYBSMgpEDAPQ3WE0lVrE9AAAAAElFTkSuQmCC","orcid":"","institution":"Government College University","correspondingAuthor":true,"prefix":"","firstName":"Muhammad","middleName":"Usman","lastName":"Qamar","suffix":""}],"badges":[],"createdAt":"2024-01-20 10:44:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3881301/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3881301/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50119800,"identity":"58e98905-28ab-4a88-9b2c-390b5f107c78","added_by":"auto","created_at":"2024-01-24 19:29:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":212089,"visible":true,"origin":"","legend":"\u003cp\u003eA is the molecular detection of S. Typhi (species-specific gene) with 227bp. B is XDR S. Typhi-specific gene with 425bp. C is the H58 gene with 509bp. 100bp ladder was used to compare the genes.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/c9e5452bb7d35098a083ae66.png"},{"id":50120621,"identity":"e9470771-4445-43bf-b117-894b5525a7aa","added_by":"auto","created_at":"2024-01-24 19:37:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":110724,"visible":true,"origin":"","legend":"\u003cp\u003eA the molecular detection of \u003cem\u003egyrA\u003c/em\u003e\u003csub\u003e \u003c/sub\u003ewith 313bp and B shows the \u003cem\u003egyrB \u003c/em\u003egene with 345bp against a 100bp ladder.\u0026nbsp;\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/1b5a027a0500e7c70494d512.png"},{"id":50119798,"identity":"ae011172-38df-47f6-8ec7-9af59b5177f1","added_by":"auto","created_at":"2024-01-24 19:29:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":147901,"visible":true,"origin":"","legend":"\u003cp\u003eA is the molecular detection of \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM \u003c/sub\u003ewith 643bp and B is the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M-15\u003c/sub\u003e gene with 540bp against 100bp ladder.\u0026nbsp;\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/3716883d3bdcc92ee8383caa.png"},{"id":50120620,"identity":"2b69063f-1e12-45a4-bb1b-5003cdee25e8","added_by":"auto","created_at":"2024-01-24 19:37:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":854778,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eagar well diffusion assay of manuka honey against MDR-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. Typhi (left) and XDR-\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. Typhi (right)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/e97098bf4218f95fda0c5c2e.png"},{"id":50119799,"identity":"8bd3e304-e603-4889-b617-893f4e76d4cf","added_by":"auto","created_at":"2024-01-24 19:29:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":32392,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMIC and MBC of Manuka honey against MDR-S. Typhi\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/241ddcdfc913c4683c2cd338.png"},{"id":50119804,"identity":"d687ba1f-38bc-43e7-98ca-880b1ea6c225","added_by":"auto","created_at":"2024-01-24 19:29:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":41193,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMIC and MBC of Manuka honey against XDR-S. Typhi\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/1124a428e12c10c310169bb2.png"},{"id":50119802,"identity":"10a42b53-e0af-45ff-8d2a-729d154973e5","added_by":"auto","created_at":"2024-01-24 19:29:41","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1210669,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMicro broth dilution of manuka honey against S. Typhi strains\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/a2d41e9379c6cba69492fc49.png"},{"id":50121797,"identity":"b20ffd4f-d33f-44a1-9317-fa104d59f625","added_by":"auto","created_at":"2024-01-24 19:53:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2955154,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3881301/v1/b0a1c614-dfa1-4f82-9479-586847c51311.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Exploring the potent antimicrobial activity of manuka honey as against clinically isolated multi-drug resistant and ceftriaxone-resistant Salmonella Typhi in septicemia patients: a promising therapeutic option","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe World Health Organization (WHO) has estimated that out of 48.9\u0026nbsp;million recorded cases of sepsis globally, around 20\u0026nbsp;million cases were found in children (Fleischmann-Struzek and Rudd \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Unfortunately, 1.27\u0026nbsp;million people died related to AMR and around 5\u0026nbsp;million deaths were attributed to AMR infections in 2019 (Murray et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Infections produced by \u003cem\u003eSalmonella\u003c/em\u003e serovar Typhi become more complicated due to the emergence of multi-drug-resistant (MDR) and extensively drug-resistant (XDR) strains globally (Shahid et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The outbreak of XDR-\u003cem\u003eS\u003c/em\u003e. Typhi was reported first time in Hyderabad, Pakistan in 2016 (Yousafzai et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The MDR-S. Typhi produced resistance to first-line drugs (ampicillin, cotrimoxazole, and fluoroquinolones) (Shaikh et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), while XDR-S. Typhi was resistant to first-line drugs along with ceftriaxone antibiotics and treated with only azithromycin and carbapenem (Qureshi et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, recently azithromycin resistance has also been reported in Pakistan (Iqbal et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The XDR-S. Typhi bacteria contained highly evolving plasmid-mediated resistance, transposons, and mutations in chromosomal genes that confer resistance to various classes of antibiotics. These include \u003cem\u003ecat\u003c/em\u003eA1 (resistance to chloramphenicol), \u003cem\u003eblaTEM-1\u003c/em\u003e (resistance to ampicillin), \u003cem\u003edhfR7\u003c/em\u003e and \u003cem\u003esul\u003c/em\u003e1 (resistance to co-trimoxazole), and \u003cem\u003eqnr\u003c/em\u003eS (resistance to fluoroquinolones). The QRDR regions were found to contain \u003cem\u003egyr\u003c/em\u003eA and \u003cem\u003egyr\u003c/em\u003eB, \u003cem\u003epar\u003c/em\u003eC and pare, and \u003cem\u003eblaCTX-M-15\u003c/em\u003e (resistance to ceftriaxone) in the IncY region of the plasmid (Kim et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) To combat these superbugs, the World Health Organisation is calling on researchers to develop novel treatments. One essential commodity that can be utilised to reduce the strain of resistance on the health sector is medical-grade honey, commonly known as Manuka honey. This honey is not only used as a natural food but it is also used to cure a variety of illnesses, such as burns and wounds (Combarros-Fuertes et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Manuka Honey is derived from the \u003cem\u003eLeptospermum scoparium\u003c/em\u003e tree by bees in New Zealand and coastal regions of Australia. Bees gather the pollen from the blossoms of a Manuka tree (Qamar et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Manuka honey possesses several antibacterial properties including low pH, high osmolarity, and stimulus to the immune system that are crucial in combating the development of antibiotic resistance in diverse microbes (Hewett et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The antimicrobial effects of Manuka honey primarily stem from its significant levels of Methylglyoxal (MGO) and phenolic compounds. Consequently, it can serve as a substitute for conventional antibiotics to treat the prevalence of highly resistant (Nolan et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). There is a scarcity of studies that have documented the antibacterial efficacy of Manuka honey against MDR and XDR strains of \u003cem\u003eS.\u003c/em\u003e Typhi. Hence, our objective was to conduct a comprehensive investigation into the bacterial isolates, antimicrobial profile, genetic characterisation, and antibacterial activity of Manuka honey against these highly resistant bacteria.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthical permission and patient\u0026rsquo;s consent\u003c/h2\u003e \u003cp\u003e Before starting the study, we obtained ethical approval from the Ethical Review Committee at Government College University Faisalabad. As required by the legal guardians of the study population, we obtained consent in the national language, which was also provided in writing when necessary. We assured the participants that their confidential information would be kept secure and used only for research purposes. After that, we transferred the materials to the researcher for further processing. Throughout the study, we processed the samples as anonymous data and analyzed them, ensuring the confidentiality of individuals' personal information. \u003cb\u003eCollection of bacterial isolates from clinical wards\u003c/b\u003e\u003c/p\u003e \u003cp\u003eUsing aseptic techniques, we collected 100 blood culture isolates of \u003cem\u003eS\u003c/em\u003e. Typhi from patients suspected of having septicemia. These isolates were collected from various public and private sector Hospitals in Lahore and Faisalabad, Pakistan. The study participants comprised patients of all age groups from various hospital wards, including the intensive care unit (ICU), emergency, outdoor patient (OPD), and medical and surgery wards. The study included patients ranging from infants to adolescents, without any consideration for gender discrimination. The study included patients who exhibited two or more of the following signs and symptoms: body temperature exceeding 38\u0026deg;C or falling below 35\u0026deg;C, pulse rate surpassing 90 beats per minute, and respiration rate exceeding 20 breaths per minute.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eBlood culture processing and isolate confirmation\u003c/h2\u003e \u003cp\u003e5\u0026ndash;10 ml blood from adults and 3-5ml blood from children were drawn aseptically following the standard operating procedure. The isolates underwent processing in the Bactec/Alert BD 9120 system (bioMeriux, France). This technique utilises fluorescence technology to quickly identify the presence of blood-borne pathogens in a patient's blood. The basic principle is to monitor the production of CO\u003csub\u003e2\u003c/sub\u003e by the microbes resulting in the emission of light. The light detector identified an elevated level of CO2, which served as an indication of the existence of viable microorganisms in the blood-grown bottles. All the bottles were monitored for up to five days. Positive isolates were further processed for identification based on colony morphology and cultural characteristics. Blood culture isolates were sub-cultured on blood agar, Salmonella-Shigella agar and MacConkey agar for further demonstration at 37\u003csup\u003eo\u003c/sup\u003eC following overnight incubation. Colony morphology and cultural characteristics indicated the type of the organism. The isolates were further confirmed through an automated Vitek 2 compact system (bioMeriux, France) by utilizing 64 different biochemical tests.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDetermination of minimum inhibitory concentration of antibiotics against S. Typhi\u003c/h2\u003e \u003cp\u003eAll 100 isolates of \u003cem\u003eS.\u003c/em\u003e Typhi were analyzed to determine their resistance profile against different antimicrobials using the Vitek\u0026reg; 2 compact system. Antibiogram to determine the susceptibility pattern of identified strains by using ampicillin, co-trimoxazole, ciprofloxacin, chloramphenicol, ceftriaxone, azithromycin, meropenem, imipenem was performed using CLSI guidelines, 2021.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular Characterization of\u003c/b\u003e \u003cb\u003eS.\u003c/b\u003e \u003cb\u003eTyphi Isolates\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDNA extraction of the 100 blood culture isolates of \u003cem\u003eS.\u003c/em\u003e Typhi was done using a DNA extraction kit (Seongam, South Korea) as per the manufacturer\u0026rsquo;s instructions (Bahari et. Al, 2021). This is based on silica membrane spin column-based technology for purifying genomic DNA. This technology comprises of lysis step, Binding Step, wash step and final Elution steps with the use of GT1 buffer, GT2 buffer, W1 Buffer, W2 Buffer, Elution Buffer and Proteinase K enzyme for performing various steps of genomic DNA extraction.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular detection of ARGs in\u003c/b\u003e \u003cb\u003eS\u003c/b\u003e. \u003cb\u003eTyphi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMolecular detection of antimicrobial-resistant genes in \u003cem\u003eS.\u003c/em\u003e Typhi was carried through Monoplex and Multiplex PCR Assays were conducted to clone resistant genes of different antimicrobials using a Thermal cycler machine (Bio-Rad T100\u0026trade; Thermal cycler, USA) as per manufacturer\u0026rsquo;s guidelines. The PCR was a 25ųl of the PCR reaction mixture prepared in a PCR reaction tube containing 4ng of DNA, 12 ųl of 2X PCR Green Tag MasterMix (Thermo Fischer Scientific, UK), 1.5 ųM of each forward and reverse primer and 6ųl of nuclease-free water to attain a final volume of 25ųl. All the tubes containing the PCR reactions mixture were run in a thermal cycler machine ( BioRad Laboratories Inc., USA) with the following conditions; Initial denaturation at 95\u003csup\u003eo\u003c/sup\u003eC for about 120 sec, final denaturation at 95\u003csup\u003eo\u003c/sup\u003eC for 30 sec, annealing at 68\u003csup\u003eo\u003c/sup\u003eC for 60 sec and final extension at 68\u003csup\u003eo\u003c/sup\u003eC for 10 mins. Each step was repeated for 30 times (Khokhar et. al., 2022).\u003c/p\u003e \u003cp\u003eThe PCR product from the thermal cycler was put onto 1.1% agarose gel (Thermo Fischer Scientific, UK) to separate resistant gene bands based on charge and size. Ethidium bromide dye was added to visualize bands under UV light as the gel gets stained with this fluorescent dye. DNA bands are visualized on an ultraviolet transilluminator. Amplicon size was compared to the 100bp DNA ladder (Zokeyo, UK). The list of primers used in this study is given in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers sequences and PCR conditions\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget genes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmplicon size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAnnealing temp (\u003csup\u003eO\u003c/sup\u003eC)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003epltB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAAACCATGATAGACTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e657\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAAGTTACGGTTATACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ecatA1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAAGATCACTTCGCAGAATAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCAATAGACATAAGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003edhfR7\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAACGTCAGAAAATGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e405\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAACTGCTCAAAAAGGAAATTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003esul1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTATTGCGCCGCTCTTAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGTTTCCGAGAAGGTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eqnrS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTATAATGGTAGTCTAGCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e722\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATGTGTGATTTTAAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eS\u003c/em\u003e. Typhi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCAGATATACTTTCGCAGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e227\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCAGAACCAAATTTGCTTACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eXDR-S\u003c/em\u003e. Typhi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAATGGTTCTGGTCTGGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e425\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTAAACCACGACGGCTCAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eH58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCTTGATGGCTTCATTAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e509\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAGGTTGTACGCCTTTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003egyr A\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACCGTCATAGTTATCCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e313\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTACTTTACGCCATGAACGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003egyr B\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGCTGTCCGAACTGTACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e345\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCAGCGTCGCCACTTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eparC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATAGGGTATTATCTGCGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAATAAACAACGGTTTTACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eparE\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCACAGTTGCTGACAATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1990\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGGATTCTCTTATCCGGCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003emacA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTAAGCTGTGTCATGATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1308\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCACATTGCACAGTTCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eacrB (N-term)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTTAAAGTGCAGGAAATTACCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1695\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTACGCTATCGGTGTAGTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eacrB (C-term)\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACGATGCTCAAACCCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1815\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAACTTTCCTAAGAAAAAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eacrR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCGACATATGGCACGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e633\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCGTCGGACACAATTGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eCTX\u0026minus;M\u0026minus;15\u003c/em\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAATGTGCAGCACCAGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e540\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCAATATCATTGGTGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003ebla TEM-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGCGGTAAGATCCTTGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e643\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTCGCCGTCGTGTAGATAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eblaIMP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAATAGAGTGGCTTAATTCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAAACCAC TACGTTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eblaVIM\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATGGTGTTTGGTCGCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e450\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGAATGCGCAGCACCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003eactivity of Manuka Honey against\u003c/b\u003e \u003cb\u003eS\u003c/b\u003e. \u003cb\u003eTyphi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe manuka honey (Watson \u0026amp; Son, New Zealand) (250g) with +\u0026thinsp;24 UMF (unique manuka factor) with MGO was commercially purchased. The honey was serially diluted at the concentrations of 10%, 20%, 30%, 40%, 50%, and 100% as described previously (Ejaz et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In short, the bacterial suspension (0.5McFarland) was evenly spread onto Muller Hinton Agar (MHA) plates. Agar wells were created on the plates using a sterile cork borer with a diameter of 6mm, and each dilution was poured into its corresponding well. The plates were then incubated at a temperature of 37\u0026deg;C for 24 hours. The zone of inhibition (mm) of manuka honey against MDR, and XDR S. Typhi strains was calculated using a vernier callipe.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe minimum inhibitory concentration of Manuka Honey against\u003c/b\u003e \u003cb\u003eS\u003c/b\u003e. \u003cb\u003eTyphi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFresh 2\u0026ndash;3 colonies of \u003cem\u003eS.\u003c/em\u003e Typhi bacterial culture were emulsified into 2-3ml of concentrated lysogeny broth solution in 50 falcon tubes. The mixture was then incubated at 37\u003csup\u003eo\u003c/sup\u003eC to achieve 0.5 McFarland turbidity standard at an optical density of 0.07 and wavelength of 600nm. Further dilutions were made by adding 1:100th double-strength LB to achieve a concentration of 1-10\u003csup\u003e5\u003c/sup\u003e CFU/ml. Each well of a microtiter plate (Thermo Scientific, UK) was filled with 100ml of each dilution except for the negative control that contained only 100ųl of lysogeny broth (Kim et. al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). 100ųl of +\u0026thinsp;24 UMF concentrated manuka honey was added to the first well and then further dilutions were added to the next wells, respectively except for the positive control well. Both bacterial suspension and lysogeny broth were added into the positive control wells of the microtitration plate. Following overnight incubation at 37\u003csup\u003eo\u003c/sup\u003eC in a shaking incubator (MaxQTM Mini 4450, Thermo Fisher Scientific) at 3g, MIC (v/v %) was read comparing the wells with positive and negative controls (Ejaz et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMinimum bactericidal concentration\u003c/h2\u003e \u003cp\u003eMBC is defined as the first dilution with no visible growth on agar plates. A 10\u0026micro;l of the sample from no visible growth wells of the microtiter plates was inoculated onto nutrient agar plates (Oxoid, UK) followed by overnight incubation at 37\u003csup\u003eo\u003c/sup\u003eC, aerobically. Viable cells and colonies formed on the agar plates were examined for further scoring as visible or no visible growth.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eClinical information and confirmation of\u003c/b\u003e \u003cb\u003eS.\u003c/b\u003e \u003cb\u003eTyphi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe clinical characterization of patients was included in this study. The 60% were male 40% were female were reported and the male to female ratio was ?????. the age range was 1 year to 31 years with the majority of the isolates recovered from children less than 5 years followed by 24 from \u0026gt;\u0026thinsp;10 - \u0026le;15 years and 16 from \u0026gt;\u0026thinsp;5 - \u0026le;10 years. Further, most of the samples were recovered from the emergency department (62%) followed by OPD (26%) and ICU (5%) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComprehensive representation of the blood culture isolates of MDR and XDR \u003cem\u003eS.\u003c/em\u003e Typhi\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClinical information\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePercentage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eGender\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale to female ratio\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eAge (1 year to 31 years)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0 - \u0026le;5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;5 - \u0026le;10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;10 - \u0026le;15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e24%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;15 - \u0026le;20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eClinical wards\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEmergency room\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e62%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eICU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOPD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e26%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSurgical wards\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c4\" namest=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eICU: intensive care unit, OPD: outdoor patients\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \n\u003cp\u003e\u003cb\u003eAntibiogram profiling of\u003c/b\u003e \u003cb\u003eS.\u003c/b\u003e \u003cb\u003eTyphi clinical isolates\u003c/b\u003e\u003c/p\u003e \n\u003cp\u003e The minimum inhibitory concentration of clinical isolates of S. Typhi was performed against the WHO class of antibiotics including \u0026ldquo;Access\u0026rdquo;, \u0026ldquo;Watch\u0026rdquo; and \u0026ldquo;Reserve\u0026rdquo; (AWaRe) as per CLSI 2021 guidelines. Of the 100 isolates, 50 were MDR-\u003cem\u003eS\u003c/em\u003e. Typhi and 50 were XDR-\u003cem\u003eS\u003c/em\u003e. Typhi. The antibiogram revealed that 100% of the isolates were resistant to ampicillin (\u0026ge;\u0026thinsp;32\u0026micro;g/ml), co-trimoxazole (\u0026ge;\u0026thinsp;4/76 \u0026micro;g/ml), chloramphenicol (\u0026ge;\u0026thinsp;32 \u0026micro;g/ml), and ciprofloxacin (\u0026ge;\u0026thinsp;1 \u0026micro;g/ml). However, 50% of the isolates were resistant to ceftriaxone. Further, all the isolates were sensitive to carbapenem and azithromycin (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAntimicrobial susceptibility testing of \u003cem\u003eS\u003c/em\u003e. Typhi clinical isolates\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWHO classes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAntibiotics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMIC Breakpoints\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eResistant\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSensitive\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAccess\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAMP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAccess\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSXT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4/76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAccess\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCHL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWatch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCIP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWatch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWatch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAZM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWatch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIMP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWatch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMEM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"5\"\u003eAMP: ampicillin, SXT: co-trimoxazole, CHL: Chlorophenicol, CIP: ciprofloxacin, CRO: ceftriaxone, AZM: azithromycin, IMP: imipenem, MEM: meropenem\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003cp\u003e\u003cb\u003eMolecular detection of ARGs in\u003c/b\u003e \u003cb\u003eS\u003c/b\u003e.\u003cb\u003eTyphi\u003c/b\u003e\u003c/p\u003e\n \u003cp\u003eThe molecular detection of the ARGs of the \u003cem\u003eS\u003c/em\u003e. Tsyphi gene was determined by PCR. All the S. Typhi were detected with geneus species-specific primers (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). MDR-S. Typhi (n\u0026thinsp;=\u0026thinsp;50) were co-honoured with H58 and \u003cem\u003egyrA\u003c/em\u003e and \u003cem\u003egyrB\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Further, the XDR-S. Typhi (n\u0026thinsp;=\u0026thinsp;50) were harboured by the \u003cem\u003egyrA\u003c/em\u003e, \u003cem\u003egyrB\u003c/em\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u0026minus;15\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eTEM\u0026minus;1\u003c/sub\u003e, and XDR-S. Typhi-specific primer (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) and Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePhenotypic and genotypic detection of MDR and XDR genes in S. Typhi\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo of isolates\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAMP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSXT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCIP\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCRO\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAntimicrobial-resistant genes\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMDR \u003cem\u003eS.\u003c/em\u003e Typhi (n\u0026thinsp;=\u0026thinsp;50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4/76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eS. Typhi gene, g\u003c/em\u003eyr\u003cem\u003eA\u003c/em\u003e, \u003cem\u003egyrB, H58\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXDR \u003cem\u003eS.\u003c/em\u003e Typhi (n\u0026thinsp;=\u0026thinsp;50)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4/76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eS. Typhi gene, g\u003c/em\u003eyr A, \u003cem\u003egyr B, bla\u003c/em\u003e\u003csub\u003e\u003cem\u003eCTX\u0026minus;M\u0026minus;15\u003c/em\u003e\u003c/sub\u003e \u003cem\u003ebla\u003c/em\u003e\u003csub\u003e\u003cem\u003eTEM\u0026minus;1.\u003c/em\u003e\u003c/sub\u003e \u003cem\u003eH58, XDR-S.\u003c/em\u003e Typhi \u003cem\u003egene\u003c/em\u003e,\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAntibacterial efficacy of Manuka honey against MDR and XDR S. Typhi\u003c/h2\u003e \u003cp\u003eThe effectiveness of Manuka honey against MDR and XDR-\u003cem\u003eS\u003c/em\u003e. Typhi clinical isolates were tested using the agar well diffusion method. Sterile water was used to dilute the honey from 100\u0026ndash;10%. MDR-\u003cem\u003eS\u003c/em\u003e. Typhi bacteria exposed to 100% concentration of Manuka honey showed a range of 15-24mm zone of inhibition, with an average of 20.3mm and an SD of 2.18. At a 50% concentration, the zone of inhibition ranged from 13-19mm, with an average of 15.8mm. At a concentration of 14.3mm, the zone of inhibition ranged from 11-18mm, with an SD of 1.60 (\u003cem\u003eP-value\u003c/em\u003e: 0.001). The XDR-S. Typhi showed a range of 15-23mm zone of inhibition when exposed to 100% Manuka honey, with an average of 19.2mm and an SD of 1.95. At 50% concentration, the zone of inhibition ranged from 12-18mm, with an average of 15.5mm and a standard deviation of 1.43. At a concentration of 40%, the zone of inhibition ranged from 10-17mm, with an average of 13.7mm and an SD of 1.48 (\u003cem\u003eP-value\u003c/em\u003e: 0.000) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAgar wal diffusion assay of Mauka honey against MDR and XDR-\u003cem\u003eS\u003c/em\u003e. Typhi\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e50%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eP-value\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"1\" nameend=\"c9\" namest=\"c9\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"9\" nameend=\"c9\" namest=\"c1\"\u003e \u003cp\u003eMDR-\u003cem\u003eS\u003c/em\u003e. Typhi\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRange (mm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u0026ndash;24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u0026ndash;19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e11\u0026ndash;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u0026ndash;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8\u0026ndash;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u0026ndash;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0.001*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c9\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMean\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e11.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e10.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c9\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c9\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"9\" nameend=\"c9\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eXDR-\u003c/b\u003e\u003cb\u003eS\u003c/b\u003e. \u003cb\u003eTyphi\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRange (mm)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15\u0026ndash;23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u0026ndash;18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u0026ndash;17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9\u0026ndash;16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7\u0026ndash;14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5\u0026ndash;11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0.000*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c9\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMean\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e19.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e10.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c9\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c9\" namest=\"c9\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003e* P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 is considered statistically significant. SD: standard deviation\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMIC and MBC of manuka honey against MDR and XDR-S. Typhi\u003c/h2\u003e \u003cp\u003eThe MIC and MBC of manuka honey were evaluated using the micro broth dilution assay on microtiter plates. The MDR-S. Typhi strain, with a prevalence of 5/50 (10%), was effectively inhibited at a MIC of 1.56 v/v%. Furthermore, it was completely eradicated at a MBC of 3.125 v/v%. In contrast, the 18/50 (36%) strain showed susceptibility at 3.125 v/v%, the 12/50 (24%) strain at 6.25 v/v%, the 10/50 (20%) strain at 12.5 v/v%, and the 5/50 (10%) strain at 25 v/v% (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Furthermore, the XDR-S. Typhi strain inhibited 1/50 (2%) of the strains at a concentration of 1.56v/v%. This was followed by inhibition in 14/50 (28%) of the strains at a concentration of 3.125 v/v%, 10/50 (20%) at 6.25 v/v%, 16/50 (32%) at 12.5v/v%, and 9/50 (18%) at 25v/v% concentration of manuka honey (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn poor and middle-income nations, the recent appearance of \u003cem\u003eS\u003c/em\u003e. Typhi has become a serious issue because of the spread of bloodstream infections that can cause sepsis, especially in those with impaired immune systems (Masuet-Aumatell and Atouguia \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). According to the World Health Organization (WHO), in 2019, over 9\u0026nbsp;million individuals contracted typhoid fever and 110,000 individuals succumbed to the disease annually (Hancuh et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). AMR progressively emerged as MDR and XDR in \u003cem\u003eS.\u003c/em\u003e Typhi leading to the failure of treatment (Qamar et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The MIC values of all the MDR \u003cem\u003eS.\u003c/em\u003e Typhi isolates showed resistance to ampicillin, chloramphenicol and co-trimoxazole while XDR strains that harboured resistance against all first lines, second-line fluoroquinolones and third-generation cephalosporins leaving macrolides and carbapenems as alternative options (Jabeen et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The study focused on isolating MDR and XDR \u003cem\u003eS\u003c/em\u003e. Typhi bacteria from patients with septicemia who were admitted to various wards. A comparable extensive investigation carried out on patients with septicemia in Pakistan unveiled the existence of 50.1% MDR and 33% XDR \u003cem\u003eS\u003c/em\u003e. Typhi. (Qamar et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Similarly, a study conducted in Pakistan has documented the existence of 45 strains of XDR S. Typhi isolated from cases of septicemia in paediatric patients (Kim et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). After the first outbreak of XDR. S. typhi strains its now been reported across the border from China (Wang et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), USA (Walker et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), UK (Benjamin et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and India (Samajpati et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and Bangladesh (Djeghout et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, reports on the emergence of azithromycin-resistant \u003cem\u003eS\u003c/em\u003e. Typhi (Iqbal et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) and carbapenem-resistant \u003cem\u003eS\u003c/em\u003e. Typhi from Pakistan (Nizamuddin et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe emergence of these resistant strains is mostly attributed to the acquisition of genes that confer resistance to antimicrobial agents. In the present study, the MDR-S. Typhi strains were simultaneously present with H58, as well as the \u003cem\u003egyrA\u003c/em\u003e and \u003cem\u003egyrB\u003c/em\u003e genes. Additionally, the H58 strain co-existed with XDR-S. Typhi, along with the \u003cem\u003egyrA, gyrB, blaCTX-M-15\u003c/em\u003e, and \u003cem\u003eblaTEM-1\u003c/em\u003e genes. A study conducted in Hong Kong found that 30 strains originating from southeast Asia displayed the H58 haplotype in XDR-S. Typhi isolates (Li et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Additionally, a study conducted in Italy has detected the blaCTX-M-15 gene in XDR-S. Typhi. (Procaccianti et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). A separate study conducted in Pakistan also observed the existence of \u003cem\u003eblaCTX-M-15, blaTEM, gyrA, gyrB\u003c/em\u003e, and H58. (Kim et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In addition, a study conducted in Lahore, Pakistan identified the presence of the \u003cem\u003egyrA, gyrB, blaCTX-M-15, blaTEM\u003c/em\u003e, and \u003cem\u003esul1\u003c/em\u003e genes at the molecular level (Jabeen et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). We investigated the antibacterial activity of manuka honey (+\u0026thinsp;24UMF) imported from New Zealand against several MDR and XDR strains of \u003cem\u003eS\u003c/em\u003e. Typhi. The strains were inhibited at low MIC and MBC. So far, there have been no documented studies investigating the efficacy of Manuka honey against XDR \u003cem\u003eS\u003c/em\u003e. Typhi strains. A study conducted in Pakistan investigated the antibacterial properties of Pakistani honeys against MDR-S. Typhi. The findings revealed that 30% of the strains were inhibited by 11\u0026ndash;16% phenol. Additionally, it was observed that manuka honey exhibited higher activity compared to other types of honey (Hussain et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In addition, a study was conducted on the indigenous honey against XDR-S. Typhi strains in Pakistan revealed that Beri honey exhibited the greatest zone of inhibition, measuring between 7 and 15 mm, while Neem honey had a zone of inhibition ranging from 7 to 12 mm. The MIC and MBC of beri honey against 15% of XDR-\u003cem\u003eS\u003c/em\u003e. Typhi isolates were determined to be 3.125% and 6.25%, respectively (Ejaz et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis investigation identified a substantial occurrence of MDR and XDR strains of \u003cem\u003eS\u003c/em\u003e. Typhi in patients with septicemia, specifically in children, in clinical settings in Pakistan. Furthermore, we have identified the presence of H58 haplotypes in S. Typhi strains that are resistant, along with the \u003cem\u003eblaCTX-M-15, gyrA, gyrB\u003c/em\u003e, and \u003cem\u003eblaTEM\u003c/em\u003e genes. Furthermore, Manuka honey, which has antibacterial properties, shows promising effectiveness against these bacteria that are resistant to antibiotics. In addition, manuka honey can be utilized alongside antibiotics to efficiently address infections caused by extremely resistant strains of S. Typhi, which exhibit resistance to many medicines and are widely drug-resistant. This therapy technique has been substantiated by multiple rigorous clinical trials.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest:\u003c/h2\u003e \u003cp\u003eAll authors declare no conflict of interest.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization, writing the original draft, formal analysis, investigations: IB, MHR, MS, MUQ, Formal analysis, investigations, funding acquisition, resources, project administration, reviewing and editing. MUQ, IB, KJ. Reviewing and editing, data validation, and data curation: MUQ, IB, KJ. All authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement:\u003c/h2\u003e \u003cp\u003eWe express our gratitude to the Institute of Microbiology, Faculty of Life Sciences, Government College University Faisalabad for their invaluable cooperation.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBenjamin A, Olley L, Troise O, Hughes S, Donaldson H, Sadighi A (2021) A case of Extensively Drug Resistant (XDR) Extended Spectrum Beta-Lactamase (ESBL) typhoid fever in the Ambulatory Emergency Care (AEC) unit. Clinical Infection in Practice 10:100068 doi: https://doi.org/10.1016/j.clinpr.2021.100068\u003c/li\u003e\n\u003cli\u003eCombarros-Fuertes P, Fresno JM, Estevinho MM, Sousa-Pimenta M, Tornadijo ME, Estevinho LM (2020) Honey: Another Alternative in the Fight against Antibiotic-Resistant Bacteria? Antibiotics (Basel) 9 doi: 10.3390/antibiotics9110774\u003c/li\u003e\n\u003cli\u003eDjeghout B et al. (2018) Ceftriaxone-resistant Salmonella Typhi carries an IncI1-ST31 plasmid encoding CTX-M-15. J Med Microbiol 67:620-627 doi: 10.1099/jmm.0.000727\u003c/li\u003e\n\u003cli\u003eEjaz H et al. (2023) Antibacterial efficacy of indigenous Pakistani honey against extensively drug-resistant clinical isolates of Salmonella enterica serovar Typhi: an alternative option to combat antimicrobial resistance. BMC Complementary Medicine and Therapies 23:42 doi: 10.1186/s12906-023-03870-8\u003c/li\u003e\n\u003cli\u003eFleischmann-Struzek C, Rudd K (2023) Challenges of assessing the burden of sepsis. Medizinische Klinik - Intensivmedizin und Notfallmedizin 118:68-74 doi: 10.1007/s00063-023-01088-7\u003c/li\u003e\n\u003cli\u003eHancuh M et al. (2023) Typhoid Fever Surveillance, Incidence Estimates, and Progress Toward Typhoid Conjugate Vaccine Introduction - Worldwide, 2018-2022. MMWR Morb Mortal Wkly Rep 72:171-176 doi: 10.15585/mmwr.mm7207a2\u003c/li\u003e\n\u003cli\u003eHewett SR, Crabtrey SD, Dodson EE, Rieth CA, Tarkka RM, Naylor K (2022) Both Manuka and Non-Manuka Honey Types Inhibit Antibiotic Resistant Wound-Infecting Bacteria. Antibiotics 11:1132\u003c/li\u003e\n\u003cli\u003eHussain MB et al. (2015) Evaluation of the antibacterial activity of selected Pakistani honeys against multi-drug resistant Salmonella typhi. BMC Complement Altern Med 15:32 doi: 10.1186/s12906-015-0549-z\u003c/li\u003e\n\u003cli\u003eIqbal J et al. (2020) A Race against Time: Reduced Azithromycin Susceptibility in \u0026lt;i\u0026gt;Salmonella enterica\u0026lt;/i\u0026gt; Serovar Typhi in Pakistan. mSphere 5:10.1128/msphere.00215-00220 doi: doi:10.1128/msphere.00215-20\u003c/li\u003e\n\u003cli\u003eJabeen K et al. (2023) Molecular Characterization of Extensively Drug Resistant Salmonella Enterica Serovar Typhi Clinical Isolates from Lahore, Pakistan. Infect Drug Resist 16:2987-3001 doi: 10.2147/idr.s406253\u003c/li\u003e\n\u003cli\u003eKim C et al. (2021) The molecular basis of extensively drug-resistant Salmonella Typhi isolates from pediatric septicemia patients. PLoS One 16:e0257744 doi: 10.1371/journal.pone.0257744\u003c/li\u003e\n\u003cli\u003eLi X et al. (2023) Genomic Investigation of Salmonella Typhi in Hong Kong Revealing the Predominance of Genotype 3.2.2 and the First Case of an Extensively Drug-Resistant H58 Genotype. Microorganisms 11:667\u003c/li\u003e\n\u003cli\u003eMasuet-Aumatell C, Atouguia J (2021) Typhoid fever infection \u0026ndash; Antibiotic resistance and vaccination strategies: A narrative review. Travel Medicine and Infectious Disease 40:101946 doi: https://doi.org/10.1016/j.tmaid.2020.101946\u003c/li\u003e\n\u003cli\u003eMurray CJL et al. (2022) Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 399:629-655 doi: 10.1016/s0140-6736(21)02724-0\u003c/li\u003e\n\u003cli\u003eNizamuddin S, Khan EA, Chattaway MA, Godbole G (2023) Case of Carbapenem-Resistant Salmonella Typhi Infection, Pakistan, 2022. Emerg Infect Dis 29:2395-2397 doi: 10.3201/eid2911.230499\u003c/li\u003e\n\u003cli\u003eNolan VC, Harrison J, Wright JEE, Cox JAG (2020) Clinical Significance of Manuka and Medical-Grade Honey for Antibiotic-Resistant Infections: A Systematic Review. Antibiotics (Basel) 9 doi: 10.3390/antibiotics9110766\u003c/li\u003e\n\u003cli\u003eProcaccianti M et al. (2020) First Case of Typhoid Fever due to Extensively Drug-resistant Salmonella enterica serovar Typhi in Italy. Pathogens 9:151\u003c/li\u003e\n\u003cli\u003eQamar FN et al. (2020) Antimicrobial Resistance in Typhoidal Salmonella: Surveillance for Enteric Fever in Asia Project, 2016-2019. Clin Infect Dis 71:S276-s284 doi: 10.1093/cid/ciaa1323\u003c/li\u003e\n\u003cli\u003eQamar MU et al. (2021) Molecular detection of extensively drug-resistant Salmonella Typhi and carbapenem-resistant pathogens in pediatric septicemia patients in Pakistan - a public health concern. Future Microbiol 16:731-739 doi: 10.2217/fmb-2021-0036\u003c/li\u003e\n\u003cli\u003eQamar MU et al. (2018) In vitro and in vivo activity of Manuka honey against NDM-1-producing Klebsiella pneumoniae ST11. Future Microbiol 13:13-26 doi: 10.2217/fmb-2017-0119\u003c/li\u003e\n\u003cli\u003eQureshi S et al. (2020) Response of extensively drug resistant Salmonella Typhi to treatment with meropenem and azithromycin, in Pakistan. PLoS Negl Trop Dis 14:e0008682 doi: 10.1371/journal.pntd.0008682\u003c/li\u003e\n\u003cli\u003eSamajpati S, Pragasam AK, Mandal S, Balaji V, Dutta S (2021) Emergence of ceftriaxone resistant Salmonella enterica serovar Typhi in Eastern India. Infect Genet Evol 96:105093 doi: 10.1016/j.meegid.2021.105093\u003c/li\u003e\n\u003cli\u003eShahid S, Mahesar M, Ghouri N, Noreen S (2021) A review of clinical profile, complications and antibiotic susceptibility pattern of extensively drug-resistant (XDR) Salmonella Typhi isolates in children in Karachi. BMC Infectious Diseases 21:900 doi: 10.1186/s12879-021-06599-2\u003c/li\u003e\n\u003cli\u003eShaikh OA, Asghar Z, Aftab RM, Amin S, Shaikh G, Nashwan AJ (2023) Antimicrobial resistant strains of Salmonella typhi: The role of illicit antibiotics sales, misuse, and self-medication practices in Pakistan. Journal of Infection and Public Health 16:1591-1597 doi: https://doi.org/10.1016/j.jiph.2023.08.003\u003c/li\u003e\n\u003cli\u003eWalker J et al. (2023) Assessing the global risk of typhoid outbreaks caused by extensively drug resistant Salmonella Typhi. Nature Communications 14:6502 doi: 10.1038/s41467-023-42353-9\u003c/li\u003e\n\u003cli\u003eWang Y et al. (2022) Extensively Drug-Resistant (XDR) Salmonella Typhi Outbreak by Waterborne Infection - Beijing Municipality, China, January-February 2022. China CDC Wkly 4:254-258 doi: 10.46234/ccdcw2022.062\u003c/li\u003e\n\u003cli\u003eYousafzai MT et al. (2019) Ceftriaxone-resistant Salmonella Typhi Outbreak in Hyderabad City of Sindh, Pakistan: High Time for the Introduction of Typhoid Conjugate Vaccine. Clin Infect Dis 68:S16-s21 doi: 10.1093/cid/ciy877\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"MDR S. Typhi, XDR S. Typhi, Septicemia, Antimicrobial resistant genes, Manuka honey","lastPublishedDoi":"10.21203/rs.3.rs-3881301/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3881301/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e: The rise of extensively drug-resistant \u003cem\u003eSalmonella\u003c/em\u003eTyphi is a significant concern in clinical settings, particularly among patients with septicemia. These pathogenic eggs were resistant to first and second-line drugs, including ceftriaxone, except azithromycin. Mauka honey serves as a viable alternative treatment choice in combating these diseases. Hence, our main objective is to ascertain the antimicrobial efficacy of manuka honey against multidrug-resistant (MDR) and extensively drug-resistant (XDR) clinical strains of \u003cem\u003eS\u003c/em\u003e. Typhi.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e: A combined total of 50 MDR and 50 XDR \u003cem\u003eS\u003c/em\u003e. Typhi clinical isolates were obtained from patients with septicemia. Following the Bactec blood culture system, the isolates were sub-cultured on blood and MacConkey agar and their biochemical confirmation and susceptibility to different antibiotics was done using the Vitek 2 compact system. The PCR technique was used to amplify the antibiotic-resistance genes. The antibacterial activity of Manuka honey was assessed using the agar well diffusion assay and micro broth dilution assay.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: All 100 isolates were verified to be S. Typh. Out of the total, 50% of the \u003cem\u003eS\u003c/em\u003e. Typhi bacteria were MDR and 50% were XDR. These bacteria were only susceptible to azithromycin and carbapenems. These strains exhibited amplification of \u003cem\u003eH58, gyrA, \u003c/em\u003eand\u003cem\u003egyrB\u003c/em\u003e genes, \u003cem\u003eblaCTX-M-15\u003c/em\u003e and \u003cem\u003eblaTEM\u003c/em\u003e genes. The zone of inhibition for MDR and XDR-\u003cem\u003eS\u003c/em\u003e. typhi was shown to range from 15-24mm and 15-23mm, respectively, while using 100% manuka honey. The MDR-\u003cem\u003eS\u003c/em\u003e. Typhi 18/50 (36%) strain and XDR-\u003cem\u003eS\u003c/em\u003e. Typhi 14/50 (28%) strain was inhibited at a concentration of 3.125 v/v%.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e: Manuka honey could be an alternative option against MDR and XDR S. Typhi.\u003c/p\u003e","manuscriptTitle":"Exploring the potent antimicrobial activity of manuka honey as against clinically isolated multi-drug resistant and ceftriaxone-resistant Salmonella Typhi in septicemia patients: a promising therapeutic option","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-24 19:29:36","doi":"10.21203/rs.3.rs-3881301/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ef4c26de-1588-4e7c-9215-ee6ac927cb93","owner":[],"postedDate":"January 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-01-24T19:29:38+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-24 19:29:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3881301","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3881301","identity":"rs-3881301","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.