Expression and functional analyses of Niemann–Pick C2 gene in Phytoseiulus persimilis Athias-Henriot

preprint OA: closed
Full text JSON View at publisher

Abstract

As a new protein class of semiochemical binding and transporting, Niemann-Pick proteins type C2 (NPC2) in arthropods has received more attentions in recent decade. However, the gene function has not been studied in phytoseiid mites for biocontrol potential. In current study, we identified and cloned a new NPC2 gene PpNPC2a from transcriptome of a predatory mite Phytoseiulus persimilis Athias-Henriot. PpNPC2a encoded 181 amino acids with a conserved ML domain. From phylogenetic analyses, PpNPC2a was found homologous to NPC2-1 of Galendromus occidentalis Nesbitt. We also measured gene expression in different stages and tissues in P. persimilis . PpNPC2a transcript was significantly higher in female adults than in male adults or other immature stages. Due to tiny body size of predatory mites, we only examined tissue expressions in two sections, posterior part of which was found higher gene transcription of PpNPC2a . To investigate the potential function of PpNPC2a in P. persimilis , we interfered gene expression in female adults by feeding dsRNA. The relative expression was found decreased by 59.1% and 78.2% in 24 h and 72 h after treatments, respectively. The dsNPC2a-treated females had less preference to spider mite infested plant, but we did not find their insensitiveness in response to four representative compounds of HIPVs, including 4,8,12-trimethyl-1,3,7,11-tridecatetraene (TMTT), Methyl salicylate (MeSA), β-Caryophyllene and Linalool. These results indicated PpNPC2a may play a role in P. persimilis in response to plant volatiles.
Full text 97,011 characters · extracted from preprint-html · click to expand
Expression and functional analyses of Niemann–Pick C2 gene in Phytoseiulus persimilis Athias-Henriot | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Expression and functional analyses of Niemann–Pick C2 gene in Phytoseiulus persimilis Athias-Henriot Hongxu Zhou, Hong Yan, Endong Wang, Bo Zhang, Xuenong Xu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2162814/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Mar, 2023 Read the published version in Experimental and Applied Acarology → Version 1 posted You are reading this latest preprint version Abstract As a new protein class of semiochemical binding and transporting, Niemann-Pick proteins type C2 (NPC2) in arthropods has received more attentions in recent decade. However, the gene function has not been studied in phytoseiid mites for biocontrol potential. In current study, we identified and cloned a new NPC2 gene PpNPC2a from transcriptome of a predatory mite Phytoseiulus persimilis Athias-Henriot. PpNPC2a encoded 181 amino acids with a conserved ML domain. From phylogenetic analyses, PpNPC2a was found homologous to NPC2-1 of Galendromus occidentalis Nesbitt. We also measured gene expression in different stages and tissues in P. persimilis . PpNPC2a transcript was significantly higher in female adults than in male adults or other immature stages. Due to tiny body size of predatory mites, we only examined tissue expressions in two sections, posterior part of which was found higher gene transcription of PpNPC2a . To investigate the potential function of PpNPC2a in P. persimilis , we interfered gene expression in female adults by feeding dsRNA. The relative expression was found decreased by 59.1% and 78.2% in 24 h and 72 h after treatments, respectively. The dsNPC2a-treated females had less preference to spider mite infested plant, but we did not find their insensitiveness in response to four representative compounds of HIPVs, including 4,8,12-trimethyl-1,3,7,11-tridecatetraene (TMTT), Methyl salicylate (MeSA), β-Caryophyllene and Linalool. These results indicated PpNPC2a may play a role in P. persimilis in response to plant volatiles. Phytoseiidae Olfaction RNA interference Behavioral response Predatory mite Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction As a finely tuned sense for survival, olfaction plays a crucial role in foraging, host-seeking, mating, oviposition and avoiding toxic substances for arthropods (Gong et al. 2009 ; Wolff and Riffell, 2018 ). Olfactory receptor neurons encased in sensilla on antenna of insects or forelegs of Acari are mostly involved in odor recognition (Leal, 2013 ; Carr and Roe, 2016 ). Besides two types of soluble proteins, odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), three membrane-bound receptors are also common in most insect olfactory receptor neurons, including olfactory receptors (ORs), gustatory receptors (GRs) and ionic receptors (IRs). Among these, OBPs or CSPs can bind, transport, and deliver exogenous odorant molecules across the lymph to ORs or IRs on the dendrite membrane of sensory neurons, which subsequently generates action potential (Vosshall et al. 1999 ; Leal, 2013 ; Pelosi et al. 2014 ). The mechanism of odor stimuli and behavioral response has been well studied in model insects, whereas the functions of these chemosensory-related proteins in Chelicerata is poorly understood. To our knowledge, only one CSP sequence and no OBP is found in Ixodes scapularis genome (Vieira and Rozas, 2011 ; Gulia-Nuss et al. 2016 ). Similarly, a potential CSP gene and zero OBP has been predicted in the genome of Neoseiulus cucumeris Oudemans (Zhang et al. 2019 ). By analyses of micromolar affinity, NPC2 protein can bind cholesterol which had been previously identified as HE1, a major secretory protein of human epididymis (Naureckiene and Lobel, 2000). NPC2 gene encodes a small soluble glycoprotein which was found in lysosomes and secretory fluids such as milk, epididymal fluid, bile, and plasma (Kirchhoff et al. 1996 ; Klein et al. 2010 ). Studies of chelicerate chemoreception have also reported Niemann–Pick C2 (NPC2) protein by the genomics and proteomic methods (Iovinella et al. 2016 ; Josek et al. 2018 ). These researches focus on NPC2 function as semiochemical carrier in invertebrates, as both solubilizers and transporters to fulfill the roles of OBPs and CSPs in chemical communication in chelicerates (Pelosi et al. 2014 ; Renthal et al. 2017 ). NPC2 proteins detected in olfactory organs (Haller's organ and palp sensilla) of tick Ixodes ricinus have showed good affinity to the fluorescent probe N-phenylnaphthylamine and some organic compounds, indicating as an odorant carrier in chemoreception (Iovinella et al. 2016 ). By chemosensory appendage proteome analysis, NPC2 protein products are solidly presented in three species of ticks I. scapularis , Amblyomma americium and Rhipicephalus appendiculatus for putative odorant binding (Renthal et al. 2017 ). In Phytoseiidae, three and two NPC2 genes have been identified in Neoseiulus barkeri Hughes and N. cucumeris , respectively (Li et al. 2020 ; Zhang et al. 2019 ). However, the function of this gene family has not been attempted in predatory mites for biocontrol potentials. As an important group of biological control agents, predatory mites (Acari: Phytoseiidae) are widely used in agricultural and horticultural crops to control various small pests and mites. In tritrophic systems, plants attacked by herbivorous mites can produce volatiles to transmit their infested signal to the predatory mites (Dicke et al. 1988 ; Sabelis et al. 2001 ). By detecting the chemical and tactile stimuli from plants, the olfactory systems thereafter enable predatory mites to successfully locate and prey (Takabayashi et al. 1992; Shimoda et al. 2005 ; Janssen et al. 1998 ). Among phytoseiid mites, the first mass-produced species P. persimilis is widely applied as a specialist predator of Tetranychus species. Chemoreceptors in P. persimilis are presumed to detect these chemical cues from plants for spider mite prey (Akkerhuis et al. 1985 ), since P. persimilis is found to select significantly more lima bean leaves infested by Tetranychus urticae than by thrips (Janssen et al. 1998 ). Whereas the odor binding or receptor proteins of P. persimilis are not clear in response to plant volatiles. In this study, we identified a NPC2 gene from the transcriptome of P. persimilis , and analyzed gene expressions at spatial and temporal levels using the real-time quantitative PCR. In addition, RNAi of PpNPC2 combined with behavioral bioassays were conducted to investigate PpNPC2 effect of P. persimilis in response to the infested leaves and specific compounds of herbivore-induced plant volatiles (HIPVs). The results aimed to provide a basis for better understanding of the chemosensory mechanisms in predatory mites. Materials And Methods Mite preparations P. persimilis colony has been reared by T. urticae for over ten years in the lab of Predatory Mites, Institute of Plant Protection, Chinese Academy of Agricultural Sciences (IPP-CAAS), Beijing, China. T. urticae were reared on 2-week-old bean seedlings ( Phaseolus vulgaris L.). They were maintained under the condition of 25 ± 1°C, 70% ± 5% RH and L : D = 16h : 8h. Bioinformatic analyses of PpNPC2a Primer Premier 5 software was used to design gene-specific primers for full-length cloning of NPC2 gene which contained complete coding sequence (CDS) based on the transcriptome of P. persimilis . Total RNA was extracted using MolPure Cell/Tissue Total RNA Kit (YEASEN, 19221ES50). RNA integrity was assessed by 1% agarose gel electrophoresis and RNA concentration was quantified using Nanodrop 1000 (Thermo Scientific, Lithuania). The cDNA was synthesized following the instruction of Super RT CDNA kit (UPTECH, China). After being confirmed by gel electrophoresis, the PCR products were sequenced by Sangon Biotech (Shanghai, China). All primers used in this study were synthesized by Sangon Biotech (Shanghai, China) (Table. 1). The open reading frame (ORF) and conserved domains of the PpNPC2a gene was analyzed by ORFFinder ( https://www.ncbi.nlm.nih.gov/orffinder/ ) and Pfam ( https://pfam.xfam.org/ncbiseq/ ). The iso-electric point (pI) and molecular weight (MW) were calculated by DNAMAN v.8.0. Nucleic acid sequences were translated in Expasy v.3.1 ( https://web.expasy.org/transate/ ). The SignalP 5.0 ( https://services.healthtech.dtu.dk/service.php?SignalP ) was used to predict the signal peptide. Serine, threonine or tyrosine phosphorylation sites and N-glycosylation sites were predicted by NetPhos v.3.1 servers ( http://www.cbs.dtu.dk/services/NetPhos/ ) and NetNglyc v.1.0 servers ( http://www.cbs.dtu.dk/services/NetNGlyc/ ). We screened NPC2 orthologs from several arachnoid and insect species that have relatively complete genomes in NCBI or Uniprot. In total, 21 NPC2 orthologs were downloaded from Uniprot. With sequences alignment, phylogenetic tree was built using MEGA-X with a bootstrap of 1000 replicates (Newman et al. 2016 ). Spatiotemporal expression patterns of PpNPC2a To estimate expression of PpNPC2a in several developmental stages and different tissues, we reared P. persimilis individually in small arenas from egg stage (Zhang et al. 2015 ). Each rearing unit contained four layers from bottom to top: a rectangular glass plate, a small bean leaf disc with prey, a central layer with a 1.5-cm-diameter hole in the center as the arena for mites, and a rectangular glass cover to seal the arena. The layers were tightly clipped together on both ends. To test the expression profile during the developmental processes, 80 eggs, 50 larvae, 30 nymphs and 20 newly emerged adults of each sex were collected for RNA extraction as one biological replicate, respectively. We then dissected 200 female adults of P. persimilis into two sections, anterior (gnathosoma and the first pair of legs) and posterior (idiosoma without the first pair of legs) part, to investigate gene spatial expression (Fig. 2 C). All the samples were embedded in RNA Stabilization Reagent (QIAGEN, Germany) before RNA extraction. Three biological replicates were prepared for each stage and tissue. All samples were immediately frozen in liquid nitrogen and stored at − 80°C. Real-time quantitative PCR (qPCR) using SYBR Mixture (UPTECH, China) (with ROX) in FQD-96A (ABI QuantStudio 4, China) followed the program: initial denaturation at 95 ℃ for 10 min, 40 cycles of 95 ℃ for 20 s, 60 ℃ for 20 s and 72 ℃ for 30 s. The expression quantity of PpNPC2a was calculated using 2 −ΔΔCT method (Livak and Schmittgen 2001 ). Each sample had three technical replicates and β-actin gene was used as an internal control (Bi et al. 2019 ). Effect of dsRNA treatment on P. persimilis behavior The fragments of PpNPC2a and EGFP were amplified using unique primers (Table. 1) that conjunct with T7 RNA polymerase promoter sequence, using a T7 RNAi Transcription Kit (Vazyme). The 200 µl of dsRNA solution (containing 500 ng/µl dsRNA of PpNPC2a or EGFP, 20% sucrose, and 10% blue food dye was added on the leaves with T. urticae ). We selected 200 1-day-old female adults to feed dsRNA solution for gene interference. Similarly, same number of female adults were fed with dsEGFP. The female adults only fed T. urticae were as control. Precisely 20 female adults were collected at 24 h and 72 h after dsRNA interference to measure the silencing efficiency of PpNPC2a by qPCR. Each treatment was set four biological replicates. To examine behavioral response of P. persimilis , we improved the “T” bridge method of Li et al. ( 2007 ) and used two experimental setups, including leaves in plastic box and intact plant in pot. In plastic box (Fig. 4 A), we placed the infested leaf with T. urticae on one side and clean leaf on the other side in a rectangular box (3×3×4 cm). For each round of test, 15 female adults of P. persimilis were released in the middle of a paper bridge with a length of 20 cm. The number of predatory mites was recorded at each side within 5 min. For the intact plants (Fig. 4 B), one side was the T. urticae infested plant and the other side was a pot of clean plant. Precise 15 female adults of P. persimilis were released in the middle of a cotton thread with a length of 60 cm. We recorded the number of female adults on each plant within 15 minutes. Our preliminary experiments suggested that the selection times for female adults in plastic box and plant pot was stable and consistent upon 5 minutes and 15minutes, respectively. According to previous studies (Shimoda et al. 2002 ; Shimoda et al. 2005 ; Silva et al. 2018 ), four representative compounds of HIPVs were selected to test predatory mite response, including TMTT, MeSA, β-caryophyllene and linalool. Each compound of 10µl at a concentration of 50 µg/µl was dropped on one side of the filter paper in the rectangular box, and its solvent n-hexane was dropped on the other side. Similarly, we recorded the number of predatory mites on either side within 5 minutes. Female adults that did not reach either side within the stipulated time were considered as no choice. Each treatment tested a total of 90 female adult mites. The positions of filter paper on left and right sides were swapped after each round test in clean rectangular box. Statistical analysis The relative expressions of PpNPC2a at developmental stages were compared using one-way ANOVA with LSD (α = 0.05) for multiple comparisons. We used independent-sample t test to compare the relative expression of PpNPC2a of two body parts as well as dsRNA interference after 24 h and 72 h. A chi-square test (χ 2 ) was performed to identify significant differences in behavioral responses of P. persimilis . All statistical tests were conducted with IBM-SPSS v.22.0 (IBM, Armonk, NY, USA). Results Bioinformatic analysis of PpNPC2a An ortholog of NPC2 gene termed as PpNPC2a was identified from the transcriptome of P. persimilis . The length of PpNPC2a was 546 bp encoding a total of 181 amino acids. It contained a highly conserved ML domain (MD-2-related lipid-recognition). The isoelectric point (pI) was predicted to be 8.71 and its molecular weight (Mw) was 20.04 kDa. The signal peptides were MKCIVLTCFLLGVATASG. PpNPC2a has 1 N-glycosylation site, 13 serine, 5 threonine and 2 tyrosine phosphorylation sites. Phylogenetic tree was built to compare PpNPC2a with other NPC2 genes in 17 species from Arachnida and Insecta (Fig. 1 A). PpNPC2a has the same evolutionary origin with NPC2s in Mesostigmata, Ixodida and Araneae. And it was highly homologous to NPC2-1 of G. occidentalis . NPC2 gene had one conserved domain in Arachnida and Insecta (Fig. 1 B). Although branches for Arachnida and Insecta were separated, NPC2 genes in three orders still shared conserved domains. Spatiotemporal expression patterns of PpNPC2a PpNPC2a was broadly expressed across all life stages of P. persimilis . Overall, the expression of PpNPC2a in adults was higher than that in immature stages. Especially, the expression levels of PpNPC2a showed a striking upregulation over 150-folds in female adults compared to eggs ( F (4,10) = 32.876, p < 0.001, Fig. 2 A). The tissue expression revealed that PpNPC2a was predominantly expressed in the posterior part, which was 5 times higher than that in the anterior part ( p = 0.002, Fig. 2 B). Effect of dsRNA interfering on P. persimilis behavior After treated by dsNPC2a, PpNPC2a expression in the whole body of P. persimilis was reduced by 59.1 and 78.2% at 24 h and 72 h, respectively (Fig. 3 ). In behavioral test, dsNPC2a-treated female adults reduced choice to infested leaves in box ( χ 2 = 15.520, df = 2, p < 0.001, Fig. 4 C), while selection trend of dsEGFP-treated female adults had no differences with the control. Furthermore, we found the same pattern on the intact plants ( χ 2 = 6.501, df = 2, p = 0.039, Fig. 4 D). The selection rate of dsNPC2a-treated adults to infested leaves and plants were reduced by 23.1% and 30.4%, respectively. Whereas, in comparison to the dsEGFP-treated or control mites, dsNPC2a-treated female adults did not exhibit any change in response to four compounds of TMTT, MeSA, β-Caryophyllene and linalool (Fig. 5 ). Discussion Recent studies have determined that NPC2 widely participates in chemical communication of arthropods (Pelosi et al. 2014 ). For example, NPC2 protein was accumulated in the basiconic sensillum of the worker Japanese carpenter ant Camponotus japonicus , acting as a semiochemical carrier (Ishida et al. 2014 ). Similar result was found in the spider Pardosa pseudoannulata that the NPC2 was identified as an olfactory related gene with putative role of the odorant carrier (Xiu et al. 2019 ). These researches provided effective information of NPC2 function for our work. In the current study, we found PpNPC2a gene from P. persimilis containing a typical ML domain which was highly homologous to G. occidentalis . The phylogenetic tree showed that NPC2 genes in Acari bifurcated prior to the divergence of Mesostigmata and Ixodida. In addition, the presence of signal peptides at the N-terminus of PpNPC2a were similar with insect OBPs, suggesting the potential function as secretory protein (Pelosi et al. 2018 ). In absence of OBP or CSP genes, ticks and mites were supposed to utilize other soluble proteins with similar roles. Thus, NPC2 family in Chelicerata might fulfil the role of semiochemical carriers, as performed by OBPs and CSPs in insects (Pelosi et al. 2014 ). The expression of PpNPC2a was significantly higher in posterior part than anterior part in P. persimilis . Several insect OBPs and CSPs have been reported not only in chemosensory organs, but also in other parts of the body such as pheromonal glands and reproductive organs (Pelosi et al. 2014 ). IscaNPC2-1 in I. scapularis appeared to be present both in the anterior part (gnathosoma and the first pair of legs) of the body, containing chemosensory organs, and in the posterior part (idiosoma without the first pair of legs) (Iovinella et al. 2016 ). This information indicates that PpNPC2a may play an important role in carrying semiochemical in P. persimilis , and the expression profiles at different developmental stages further confirm our speculation. Similar to studies in insects and Arachnoidea species, PpNPC2a in P. persimilis displayed the highest expression levels in female adults. In Macrocentrus cingulum , McinNPC2 expressed significantly higher in female than male, especially in female antennal tissue (Kyaw et al. 2021 ). PpNPC2-1 and PpNPC2-3 in P. pseudoannulata showed predominant expressions in female pedipalps and chelicerae (Xiu et al. 2019 ). The expression of our PpNPC2a was significantly higher in female adults than in male adults of P. persimilis , indicating that it may involve in chemical communications in the functional responsibilities of the female, such as oviposition, host-seeking and efficient foraging. By using this kind of semiochemical carrier, phytoseiid mites might utilize plant volatiles as olfactory cues for survival and reproduction (Dicke et al. 1988 ; Bruce-Oliver et al. 1996 ; Choh et al. 2010 ). The behavioral observations provided further evidence that PpNPC2a may play a role in the chemosensory pathway. In both test apparatuses of leaves and plants, dsNPC2a-treated female adults showed significant insensitiveness in response to infested leaves with T. urticae , suggesting successful gene interference in predatory mite to plant volatiles. NPC2 has been reported to be involved in a wide array of biochemical pathways beyond chemoreception, such as sterol homeostasis, ecdysteroid biosynthesis and triglyceride accumulation (Huang et al. 2007 ; Shi et al. 2012 ; Adachi et al. 2014 ; Pelosi et al. 2014 ; Iovinella et al. 2016 ; Zhu et al. 2018 ). Unfortunately, we did not find the insensitiveness of female adults treated with dsNPC2a in response to TMTT, MeSA, β-Caryophyllene and Linalool, four of which were considered as typical HIPVs. This may be none of these compounds was the ligands of PpNPC2a protein. NPC2-1 was found to bind to β-ionone in I. scapularis (Josek et al. 2018 ). Similarly, the best ligand for MminNPC2 was β-ionone rather than linalool in M. cingulum (Kyaw et al.2021). In Microplitis mediatore , MmedNPC2 can specifically bind β-ionone, linalool and other 6 volatiles, but not β-caryophyllene or MeSA (Zheng et al. 2018 ). It might suggest functional differentiations of NPC2 members in gene family among arthropods (Ishida et al. 2014 ; Iovinella et al. 2016 ). In short, our study identified the PpNPC2a gene from NPC2 family and revealed its potential role in chemoreception of host plant volatiles in P. persimilis . In future research, tissue localization of NPC2 gene can be examined by situ hybridization. The odor binding spectrum of this protein family in P. persimilis could also improve our knowledge to understand responsive stimuli from HIPVs for biocontrol potential in predatory mites. Declarations Acknowledgments This work was supported by National Natural Science Foundation of China (Grant No. 32070402), Beijing Natural Science Foundation (Grant No. 6222052), Beijing Agriculture Innovation Consortium (BAIC01-2022) and Agricultural Science and Technology Innovation Program, CAAS “Protection Application of Insect Natural Enemies”. Author Contribution s Hongxu Zhou : Investigation, Formal analysis, Writing- Original draft preparation, reviewing and editing. Hong Yan : reviewing and editing. Endong Wang: Supervision and Editing. Bo Zhang : Conceptualization, Formal analysis, Supervision, Writing- Original draft preparation, reviewing and editing. Xuenong Xu : Validation, Supervision and Editing. Conflict of interest The authors have declared that no competing interest exits. References Adachi T, Ishii K, Matsumoto Y, Hayashi Y, Hamamoto H, Sekimizu K (2014)Niemann-Pick disease type C2 protein induces triglyceride accumulation in silkworm and mammalian cell lines. Biochem J 459(1):137-147. https://doi.org/10.1042/BJ20130876. Akkerhuis GJO, Sabelis MW, Tjallingii WF (1985) Ultrastructure of chemoreceptors on the pedipalps and first tarsi of Phytoseiulus persimilis. Exp Appl Acarol 1:235-251. https://doi.org/10.1007/BF01198521 Bruce-Oliver SJ, Hoy MA, Yaninek JS (1996) Effect of some food sources associated with cassava in Africa on the development, fecundity and longevity of Euseius fustis (Pritchard and Baker) (Acari: Phytoseiidae). Exp Appl Acarol 20:73-85. https://doi.org/10.1007/BF00051154 Bi SJ, Lv JL, Xu J, Shi DY, Wang ED, Li GT, Xu XN (2019) RNAi mediated knockdown of RpL11, RpS2, and tra-2 led to reduced reproduction of Phytoseiulus persimilis. Exp Appl Acarol 78(4):505-520. https://doi.org/10.1007/s10493-019-00403-2 Carr AL, Roe M (2016) Acarine attractants: chemoreception, bioassay, chemistry and control. Pestic. Biochem. Physiol. 131: 60-79. https://doi.org/10.1016/j.pestbp.2015.12.009 Choh Y, Uefune M, Takabayashi J (2010) Predation-related odours reduce oviposition in a herbivorous mite. Exp Appl Acarol 50:1-8. https://doi.org/10.1007/s10493-009-9277-8 Dicke M, Sabelis MW, Dejong M (1988) Analysis of prey preference in phytoseiid mites by using an olfactometer, predation models and electrophoresis. Exp Appl Acarol 5:225-241. https://doi.org/10.1007/BF02366096 Gong DP, Zhang HJ, Zhao P, Xia QY, Xiang ZH (2009) The odorant binding protein gene family from the genome of silk worm Bombyx mori. BMC Genom 10:332. https://doi.org/10.1186/1471-2164-10-332. Gulia-Nuss M, Nuss AB, Meyer JM, Sonenshine DE, Roe RM, Waterhouse RM, Sattelle DB, de la Fuente J, Ribeiro JM, Megy K, Thimmapuram J, Miller JR, Walenz BP, Koren S, Hostetler JB, Thiagarajan M, Joardar VS, Hannick LI, Bidwell S, Hammond MP, Young S, Zeng Q, Abrudan JL, Almeida FC, Ayllon N, Bhide K, Bissinger BW, Bonzon-Kulichenko E, Buckingham SD, Caffrey DR, Caimano MJ, Croset V, Driscoll T, Gilbert D, Gillespie JJ, Giraldo-Calderon GI, Grabowski JM, Jiang D, Khalil SMS, Kim D, Kocan KM, Koci J, Kuhn RJ, Kurtti TJ, Lees K, Lang EG, Kennedy RC, Kwon H, Perera R, Qi Y, Radolf JD, Sakamoto JM, Sanchez-Gracia A, Severo MS, Silverman N, Simo L, Tojo M, Tornador C, Van Zee JP, Vazquez J, Vieira FG, Villar M, Wespiser AR, Yang Y, Zhu J, Arens-burger P, Pietrantonio PV, Barker SC, Shao R, Zdobnov EM, Hauser F, Grimmelikhuijzen CJP, Park Y, Rozas J, Benton R, Pedra JHF, Nelson DR, Unger MF, Tubio JMC, Tu Z, Robertson HM, Shumway M, Sutton G, Wortman JR, Lawson D, Wikel SK, Nene VM, Fraser CM, Collins FH, Birren B, Nelson KE, Caler E, Hill CA (2016) Genomic insights into the Ixodes scapularis tick vector of Lyme disease. Nat Commun 7:10507. https://doi.org/10.1038/ncomms10507 Huang X, Warren JT, Buchanan J, Gilbert LI, Scott MP (2007) Drosophila Niemann-Pick type C-2 genes control sterol homeostasis and steroid biosynthesis: a model of human neurodegenerative disease. Development 134(20):3733-3742. https://doi.org/10.1242/dev.004572 Iovinella I, Ban L, Song L, Pelosi P, Dani FR (2016) Proteomic analysis of castor bean tick Ixodes ricinus: a focus on chemosensory organs. Insect Biochem Mol Biol 78:58-68. https://doi.org/10.1016/j.ibmb.2016.09.004 Ishida Y, Tsuchiya W, Fujii T, Fujimoto Z, Miyazawa M, Ishibashi J, Matsuyama S, Ishikawa Y, Yamazaki T (2014) Niemann-Pick type C2 protein mediating chemical communication in the worker ant. Proc Natl Acad Sci USA 111:3847-3852. https://doi.org/10.1073/pnas.1323928111 Janssen A, Pallini A, Venzon M, Sabelis MW (1998) Behaviour and indirect interactions in food webs of plant-inhabiting arthropods. Exp Appl Acarol 22: 497-521. https://doi.org/10.1023/A:1006089924336 Josek T, Walden KKO, Allan BF, Alleyne M, Robertson HM (2018) A foreleg transcriptome for Ixodes scapularis ticks: candidates for chemoreceptors and binding proteins that might be expressed in the sensory Haller’s organ. Ticks Tick Borne Dis 9(5):1317-1327. https://doi.org/10.1016/j.ttbdis.2018.05.013. Kirchhoff C, Osterhoff C, Young L (1996) Molecular cloning and characterization of HE1, a major secretory protein of the human epididymis. Biol Reprod 54(4):847-856. https://doi.org/10.1095/biolreprod54.4.847 Klein A, Amigo L, Retamal MJ, Morales MG, Miquel JF, Rigotti A, Zanlungo S (2010) NPC2 is expressed in human and murine liver and secreted into bile: potential implications for body cholesterol homeostasis. Hepatology 43:126-133 https://doi.org/10.1002/hep.20985 Kyaw LM, Dapeng J, Zhang TT, Sivaprasath P, He KL, Bai SX, Wang ZY (2021) Molecular Identification and Functional Analysis of Niemann-Pick Type C2 Protein in Macrocentrus Cingulum Brischke (Hymenoptera: Braconidae). J Asia Pac Entomol 24(1): 7-14. https://doi.org/10.1016/j.aspen.2020.11.001 Leal WS (2013) Odorant reception in insects: roles of receptors, binding proteins, and degrading enzymes. Ann Rev Entomol. 58(1):373-391. https://doi.org/10.1146/annurev-ento-120811-153635 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25(4):402-408. https://doi. org/10.1006/meth. 2001.1262 Li YY, Ma RJ, Tian CB, Yuan JG, Xu YJ, Chen HQ, and Liu H (2020) Molecular Characterization of Three Niemann–Pick Type C2 Proteins in the Predatory Mite Neoseiulus Barkeri Hughes (Acari: Phytoseiidae). Syst Appl Acarol-UK 25(8): 1421-1432. https://doi.org/10.11158/saa.25.8.5 Li ZX, Sun XG, Liu XH. (2007) Determination on the selectibity of two kinds of spider mites to ginkgo biloba leaves and foliar volatiles. Scientia Silvae Sinicae. 43(11): 170-174. Naureckiene S, Sleat DE, Lackland H, Fensom A, Vanier MT, Wattiaux R, Jadot M, Lobel P (2000) Identification of HE1 as the second gene of Niemann-Pick C disease. Science 290(5500):2298-2301. https://doi.org/10.1126/ science.290.5500.2298. Newman L, Duffus ALJ, Lee C (2016) Using the Free Program MEGA to Build Phylogenetic Trees from Molecular Data. Am Biol Teach 78(7):608-612. https://doi.org/10.1525/abt.2016.78.7.608 Pelosi P, Iovinella I, Felicioli A, Dani FR (2014) Soluble proteins of chemical communication: an overview across arthropods. Front Physiol 5:320. https://doi.org/10.3389/fphys.2014.00320 Pelosi P, Iovinella, I, Zhu J, Wang G, Dani FR (2018) Beyond chemoreception: diverse tasks of soluble olfactory proteins in insects. Biol Rev 93:184-200. https://doi.org/10.1111/brv.12339 Renthal R, Maghnani L, Bernal S, Qu Y, Griffith WP, Lohmeyer K, Guerrero FD, Borges LMF, Pérez de León A (2017) The chemosensory appendage proteome of Amblyomma americanum (Acari: Ixodidae) reveals putative odorant-binding and other chemoreception-related proteins. Insect Sci 24(5):730-742. https://doi.org/10.1111/1744-7917.12368 Sabelis MW, Janssen A, Kant MR (2001) The enemy of my enemy is my ally. Science 291:2104-2105. https://doi.org/10.1126/science.1059939. Shimoda T, Ozawa R, Arimura GI, Takabayashi J, Nishioka T (2002) Olfactory responses of two specialist insect predators of spider mites toward plant volatiles from lima bean leaves induced by jasmonic acid and/or methyl salicylate. App Entomol Zool 37:535-541. https://doi.org/10.1303/aez.2002.535 Shimoda T, Ozawa R, Sano K, Yano E, Takabayashi J (2005) The involvement of volatile infochemicals from spider mites and from food–plants in prey location of the generalist predatory mite Neoseiulus californicus . J Chem Ecol 31:2019-2032. https://doi.org/10.1007/s10886-005-6075-6 Shi XZ, Zhong X, Yu XQ (2012) Drosophila melanogaster NPC2 proteins bind bacterial cell wall components and may function in immune signal pathways. Insect Biochem Mol Biol 42(8):545-556. https://doi.org/10.1016/j.ibmb.2012.04.002 Silva DB, Bueno VHP, Van Loon JJA, Peñaflor MFGV, Bento JMS, Van Lenteren JC (2018) Attraction of three mirid predators to tomato infested by both the tomato leaf mining moth Tuta absoluta and the whitefly Bemisia tabaci . J Chem Ecology 44:29-39. https://doi.org/10.1007/s10886-017-0909-x Takabayashi J, Dicke M (1992) Response of Predatory Mites with Different Rearing Histories to Volatiles of Uninfested Plants. Entomol Exp Appl 64(2):187-193. https://doi.org/10.1111/j.1570-7458.1992.tb01608.x Vosshall LB, Amrein H, Morozov PS, Rzhetsky A, Axel R (1999) A spatial map of olfactory receptor expression in the Drosophila antenna. Cell 96:725-736. https://doi.org/10.1016/S0092-8674(00)80582-6 Vieira FG, Rozas J (2011) Comparative genomics of the odorant-binding and chemosensory protein gene families across the arthropoda: origin and evolutionary history of the chemosensory system. Genome Biol Evol 3:476-490. https://doi.org/10.1093/gbe/evr033 Wolff GH, Riffell JA (2018) Olfaction experience and neural mechanisms underlying mosquito host preference. J of Exp Biol 221(Pt 4) jeb157131. https://doi.org/10.1242/jeb.157131. Xiu C, Xiao Y, Zhang S, Bao H, Liu Z, Zhang Y (2019) Niemann-Pick proteins type C2 are identified as olfactory related genes of Pardosa pseudoannulata by transcriptome and expression profile analysis. Comp Biochem Phys D 29:320-329. https://doi.org/10.1016/j.cbd.2019.01.004 Zhang XX, Lv JL, Hu Y, Wang BM, Chen X, Xu XN, Wang ED (2015) Prey preference and life table of Amblyseius orientalis on Bemisia tabaci and Tetranychus cinnabarinus . PLoS ONE 10(10):e0138820. https://doi.org/10.1371/journal.pone.0138820 Zhang YX, Chen X, Wang JP, Zhang ZQ, Wei H, Yu HY, Zheng HK, Chen Y, Zhang LS, Lin JZ, Sun L, Liu DY, Tang J, Lei Y, Li XM, Liu M (2019) Genomic insights into mite phylogeny, fitness, development, and reproduction. BMC Genomics 20(1):954. https://doi.org/10.1186/s12864-019-6281-1 Zheng Y, Wang SN, Peng Y, Lu ZY, Shan S, Yang YQ, Li RJ, Zhang YJ, Guo YY (2018) Functional characterization of a Niemann-Pick type C2 protein in the parasitoid wasp Microplitis mediator. Insect Sci 25(5):765-777. https://doi.org/10.1111/1744-7917.12473 Zhu J, Guo M, Ban L, Song LM, Liu Y, Pelosi P, Wang G (2018) Niemann-Pick C2 proteins: a new function for an old family. Front Physiol 9:52. https://doi.org/10.3389/fphys.2018.00052 Table 1 Table 1 Primers for PCR, Q-RT-PCR and synthesis of dsRNA in this study Group Gene Forward primer (5′–3′) Reverse primer (3′–5′) Length(bp) PCR Q-RT-PCR PpNPC2a PpNPC2a GTGCATAGTGCTAACGTGCT GCAGCTCGGATAAGGATGGAT TCAACCAAGAGTGGCCCTGA ACTTTGGCACCGTCTGGG 541 130 Actin TGGTCGGTATGGGTCAGA TGGCAGGAGTGTTGAAGGTC 264 dsRNA PpNPC2a CAGACGGTGCCAAAGTCAAG CTTCGCGATTCCGGACAAAG 243 EGFP TGAGCAAGGGCGAGGAG GCCGCCAGTGCTTGAGGT C 948 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 15 Mar, 2023 Read the published version in Experimental and Applied Acarology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2162814","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":144058540,"identity":"f6539b3e-7c34-4dfd-9c0c-27101b15c6a2","order_by":0,"name":"Hongxu Zhou","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hongxu","middleName":"","lastName":"Zhou","suffix":""},{"id":144058541,"identity":"25be6c7a-9f03-40fb-8384-eada409fffbc","order_by":1,"name":"Hong Yan","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Yan","suffix":""},{"id":144058542,"identity":"7252ce4e-467b-4bc0-a240-774214b0f653","order_by":2,"name":"Endong Wang","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Endong","middleName":"","lastName":"Wang","suffix":""},{"id":144058543,"identity":"32eb17ba-8aac-4d3e-a954-11f9b71b957a","order_by":3,"name":"Bo Zhang","email":"","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Zhang","suffix":""},{"id":144058544,"identity":"9b791575-7d8b-4586-866a-793eb7d66d25","order_by":4,"name":"Xuenong Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYFAD9gaStfAcIFmLRAKRCg1u5JhJfNxhkycf+fjhhx9/GOTNCWmRnJGWJjnzTFqx4e00Y8neNgbDnQ0EtPBLJB+T5m07nLhxdg6DBG8DQ4LBAQJa2CQS26T/grTMPMP8888fIrSAbWEEapkvwcMmzcNGhBbJnmfJlr1taYkbeNLMrGXbJAw3ENJicDzH8MbPNpvE+e2HH99888dGnqAtCL0QlRLEqgcC+QYSFI+CUTAKRsHIAgDS7z6pGjmVUQAAAABJRU5ErkJggg==","orcid":"","institution":"Chinese Academy of Agricultural Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Xuenong","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2022-10-13 13:59:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2162814/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2162814/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10493-023-00781-8","type":"published","date":"2023-03-15T20:02:07+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":27946907,"identity":"6ee851f0-2bed-433d-ba86-e5987fc98751","added_by":"auto","created_at":"2022-10-18 16:54:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":220084,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of NPC2 protein sequences among Arachnida and Insecta. (A) Phylogenetic tree constructed with Mega-X using neighbor-joining method with a bootstrap of 1000 replicates. (B) Conversed domains of NPC2 protein in \u003cem\u003ePhytoseiulus persimilis \u003c/em\u003e(\u003cem\u003eP.p NPC2a\u003c/em\u003e), \u003cem\u003eVarroa jacobsoni \u003c/em\u003e(\u003cem\u003eV.j\u003c/em\u003e), \u003cem\u003eVarroa destructor \u003c/em\u003e(\u003cem\u003eV.d\u003c/em\u003e), \u003cem\u003eGalendromus occidentalis \u003c/em\u003e(\u003cem\u003eG.o\u003c/em\u003e), \u003cem\u003eNeoseiulus barkeri \u003c/em\u003e(\u003cem\u003eN.b\u003c/em\u003e), \u003cem\u003eDermacentor silvarum \u003c/em\u003e(\u003cem\u003eD.s\u003c/em\u003e), \u003cem\u003eDermacentor andersoni \u003c/em\u003e(\u003cem\u003eD.a\u003c/em\u003e), \u003cem\u003eRhipicephalus sanguineus \u003c/em\u003e(\u003cem\u003eR.s\u003c/em\u003e), \u003cem\u003eRhipicephalus microplus \u003c/em\u003e(\u003cem\u003eR.m\u003c/em\u003e), \u003cem\u003eIxodes scapularis \u003c/em\u003e(\u003cem\u003eI.s\u003c/em\u003e), \u003cem\u003eIxodes ricinus \u003c/em\u003e(\u003cem\u003eI.r\u003c/em\u003e), \u003cem\u003ePardosa pseudoannulata \u003c/em\u003e(\u003cem\u003eP.p\u003c/em\u003e), \u003cem\u003eAraneus ventricosus \u003c/em\u003e(\u003cem\u003eA.v\u003c/em\u003e), \u003cem\u003eCaerostris darwini \u003c/em\u003e(\u003cem\u003eC.d\u003c/em\u003e), \u003cem\u003eTrichonephila clavate \u003c/em\u003e(\u003cem\u003eT.c\u003c/em\u003e). Colors of the boxes in B are consistent with the branch colors in A.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-2162814/v1/262d359bcc796325d531270d.png"},{"id":27946911,"identity":"d1d6914a-9214-447e-a1ca-61b3f48c2177","added_by":"auto","created_at":"2022-10-18 16:54:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":96299,"visible":true,"origin":"","legend":"\u003cp\u003eExpression patterns of \u003cem\u003ePpNPC2a\u003c/em\u003e in various developmental stages (A) and different tissues of adults (B). Data represents the mean values ± SE of three independent replicates. Different letters indicate significant statistics at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0. 05, and two asterisks indicate significant statistics at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0. 01.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-2162814/v1/ddb8d43e755106a1cf14e8ba.png"},{"id":27947348,"identity":"58296d98-742b-49c4-ad73-a1447faa42fa","added_by":"auto","created_at":"2022-10-18 16:59:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":28619,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of the relative expression levels of \u003cem\u003ePpNPC2a\u003c/em\u003e after dsRNA interference. (A) 24 h after interference; (B) 72 h after interference. Data represents the mean values ± SE of three independent replicates. Asterisks indicate significances at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0. 001.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-2162814/v1/6d4227b60b7c8124a0b1fa42.png"},{"id":27947350,"identity":"fa81190a-6e8c-4d3e-9872-5f198485a103","added_by":"auto","created_at":"2022-10-18 16:59:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":192775,"visible":true,"origin":"","legend":"\u003cp\u003eThe experimental setups (A \u0026amp; B) and responses of \u003cem\u003eP. persimilis\u003c/em\u003e female adults to infested leaves (C) and plants (D). NC (No choice) means the number of \u003cem\u003eP. persimilis\u003c/em\u003e that did not on either side. *:\u003cem\u003e p\u003c/em\u003e \u0026lt; 0.05; ***: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001; ns: not significant.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-2162814/v1/b2591b462c94e1d7af240990.png"},{"id":27947349,"identity":"c45fea38-e279-4c75-8422-c0e567becb18","added_by":"auto","created_at":"2022-10-18 16:59:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":105601,"visible":true,"origin":"","legend":"\u003cp\u003eResponses of \u003cem\u003eP. persimilis \u003c/em\u003efemale adults to four HIPV compounds. (A) TMTT, (B) MeSA, (C) β-Caryophyllene and (D) Linalool. NC (No choice) means the number of \u003cem\u003eP. persimilis\u003c/em\u003e that did not respond to volatiles. *: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ***: \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, NS: not significant.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-2162814/v1/2fb0564b1a64e9a1db8d684e.png"},{"id":44723267,"identity":"4362557f-e1fa-4325-95d4-518418e580ca","added_by":"auto","created_at":"2023-10-16 20:15:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1011408,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2162814/v1/85a43734-df76-4ca7-93a1-094d24690e93.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expression and functional analyses of Niemann–Pick C2 gene in Phytoseiulus persimilis Athias-Henriot","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAs a finely tuned sense for survival, olfaction plays a crucial role in foraging, host-seeking, mating, oviposition and avoiding toxic substances for arthropods (Gong et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Wolff and Riffell, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Olfactory receptor neurons encased in sensilla on antenna of insects or forelegs of Acari are mostly involved in odor recognition (Leal, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Carr and Roe, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Besides two types of soluble proteins, odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), three membrane-bound receptors are also common in most insect olfactory receptor neurons, including olfactory receptors (ORs), gustatory receptors (GRs) and ionic receptors (IRs). Among these, OBPs or CSPs can bind, transport, and deliver exogenous odorant molecules across the lymph to ORs or IRs on the dendrite membrane of sensory neurons, which subsequently generates action potential (Vosshall et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Leal, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Pelosi et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The mechanism of odor stimuli and behavioral response has been well studied in model insects, whereas the functions of these chemosensory-related proteins in Chelicerata is poorly understood. To our knowledge, only one CSP sequence and no OBP is found in \u003cem\u003eIxodes scapularis\u003c/em\u003e genome (Vieira and Rozas, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Gulia-Nuss et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Similarly, a potential CSP gene and zero OBP has been predicted in the genome of \u003cem\u003eNeoseiulus cucumeris\u003c/em\u003e Oudemans (Zhang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBy analyses of micromolar affinity, NPC2 protein can bind cholesterol which had been previously identified as HE1, a major secretory protein of human epididymis (Naureckiene and Lobel, 2000). NPC2 gene encodes a small soluble glycoprotein which was found in lysosomes and secretory fluids such as milk, epididymal fluid, bile, and plasma (Kirchhoff et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Klein et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Studies of chelicerate chemoreception have also reported Niemann\u0026ndash;Pick C2 (NPC2) protein by the genomics and proteomic methods (Iovinella et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Josek et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). These researches focus on NPC2 function as semiochemical carrier in invertebrates, as both solubilizers and transporters to fulfill the roles of OBPs and CSPs in chemical communication in chelicerates (Pelosi et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Renthal et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). NPC2 proteins detected in olfactory organs (Haller's organ and palp sensilla) of tick \u003cem\u003eIxodes ricinus\u003c/em\u003e have showed good affinity to the fluorescent probe N-phenylnaphthylamine and some organic compounds, indicating as an odorant carrier in chemoreception (Iovinella et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). By chemosensory appendage proteome analysis, NPC2 protein products are solidly presented in three species of ticks \u003cem\u003eI. scapularis\u003c/em\u003e, \u003cem\u003eAmblyomma americium\u003c/em\u003e and \u003cem\u003eRhipicephalus appendiculatus\u003c/em\u003e for putative odorant binding (Renthal et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In Phytoseiidae, three and two NPC2 genes have been identified in \u003cem\u003eNeoseiulus barkeri\u003c/em\u003e Hughes and \u003cem\u003eN. cucumeris\u003c/em\u003e, respectively (Li et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). However, the function of this gene family has not been attempted in predatory mites for biocontrol potentials.\u003c/p\u003e \u003cp\u003eAs an important group of biological control agents, predatory mites (Acari: Phytoseiidae) are widely used in agricultural and horticultural crops to control various small pests and mites. In tritrophic systems, plants attacked by herbivorous mites can produce volatiles to transmit their infested signal to the predatory mites (Dicke et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Sabelis et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). By detecting the chemical and tactile stimuli from plants, the olfactory systems thereafter enable predatory mites to successfully locate and prey (Takabayashi et al. 1992; Shimoda et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Janssen et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Among phytoseiid mites, the first mass-produced species \u003cem\u003eP. persimilis\u003c/em\u003e is widely applied as a specialist predator of \u003cem\u003eTetranychus\u003c/em\u003e species. Chemoreceptors in \u003cem\u003eP. persimilis\u003c/em\u003e are presumed to detect these chemical cues from plants for spider mite prey (Akkerhuis et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1985\u003c/span\u003e), since \u003cem\u003eP. persimilis\u003c/em\u003e is found to select significantly more lima bean leaves infested by \u003cem\u003eTetranychus urticae\u003c/em\u003e than by thrips (Janssen et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). Whereas the odor binding or receptor proteins of \u003cem\u003eP. persimilis\u003c/em\u003e are not clear in response to plant volatiles.\u003c/p\u003e \u003cp\u003eIn this study, we identified a NPC2 gene from the transcriptome of \u003cem\u003eP. persimilis\u003c/em\u003e, and analyzed gene expressions at spatial and temporal levels using the real-time quantitative PCR. In addition, RNAi of \u003cem\u003ePpNPC2\u003c/em\u003e combined with behavioral bioassays were conducted to investigate \u003cem\u003ePpNPC2\u003c/em\u003e effect of \u003cem\u003eP. persimilis\u003c/em\u003e in response to the infested leaves and specific compounds of herbivore-induced plant volatiles (HIPVs). The results aimed to provide a basis for better understanding of the chemosensory mechanisms in predatory mites.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMite preparations\u003c/h2\u003e \u003cp\u003e \u003cem\u003eP. persimilis\u003c/em\u003e colony has been reared by \u003cem\u003eT. urticae\u003c/em\u003e for over ten years in the lab of Predatory Mites, Institute of Plant Protection, Chinese Academy of Agricultural Sciences (IPP-CAAS), Beijing, China. \u003cem\u003eT. urticae\u003c/em\u003e were reared on 2-week-old bean seedlings (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.). They were maintained under the condition of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 70% \u0026plusmn; 5% RH and L : D\u0026thinsp;=\u0026thinsp;16h : 8h.\u003c/p\u003e \u003cp\u003e \u003cb\u003eBioinformatic analyses of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ePpNPC2a\u003c/span\u003e\u003c/p\u003e \u003cp\u003ePrimer Premier 5 software was used to design gene-specific primers for full-length cloning of NPC2 gene which contained complete coding sequence (CDS) based on the transcriptome of \u003cem\u003eP. persimilis\u003c/em\u003e. Total RNA was extracted using MolPure Cell/Tissue Total RNA Kit (YEASEN, 19221ES50). RNA integrity was assessed by 1% agarose gel electrophoresis and RNA concentration was quantified using Nanodrop 1000 (Thermo Scientific, Lithuania). The cDNA was synthesized following the instruction of Super RT CDNA kit (UPTECH, China). After being confirmed by gel electrophoresis, the PCR products were sequenced by Sangon Biotech (Shanghai, China). All primers used in this study were synthesized by Sangon Biotech (Shanghai, China) (Table. 1).\u003c/p\u003e \u003cp\u003eThe open reading frame (ORF) and conserved domains of the \u003cem\u003ePpNPC2a\u003c/em\u003e gene was analyzed by ORFFinder (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/orffinder/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/orffinder/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Pfam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pfam.xfam.org/ncbiseq/\u003c/span\u003e\u003cspan address=\"https://pfam.xfam.org/ncbiseq/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The iso-electric point (pI) and molecular weight (MW) were calculated by DNAMAN v.8.0. Nucleic acid sequences were translated in Expasy v.3.1 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/transate/\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/transate/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The SignalP 5.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://services.healthtech.dtu.dk/service.php?SignalP\u003c/span\u003e\u003cspan address=\"https://services.healthtech.dtu.dk/service.php?SignalP\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to predict the signal peptide. Serine, threonine or tyrosine phosphorylation sites and N-glycosylation sites were predicted by NetPhos v.3.1 servers (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbs.dtu.dk/services/NetPhos/\u003c/span\u003e\u003cspan address=\"http://www.cbs.dtu.dk/services/NetPhos/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and NetNglyc v.1.0 servers (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbs.dtu.dk/services/NetNGlyc/\u003c/span\u003e\u003cspan address=\"http://www.cbs.dtu.dk/services/NetNGlyc/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe screened NPC2 orthologs from several arachnoid and insect species that have relatively complete genomes in NCBI or Uniprot. In total, 21 NPC2 orthologs were downloaded from Uniprot. With sequences alignment, phylogenetic tree was built using MEGA-X with a bootstrap of 1000 replicates (Newman et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eSpatiotemporal expression patterns of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ePpNPC2a\u003c/span\u003e\u003c/p\u003e \u003cp\u003eTo estimate expression of \u003cem\u003ePpNPC2a\u003c/em\u003e in several developmental stages and different tissues, we reared \u003cem\u003eP. persimilis\u003c/em\u003e individually in small arenas from egg stage (Zhang et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Each rearing unit contained four layers from bottom to top: a rectangular glass plate, a small bean leaf disc with prey, a central layer with a 1.5-cm-diameter hole in the center as the arena for mites, and a rectangular glass cover to seal the arena. The layers were tightly clipped together on both ends. To test the expression profile during the developmental processes, 80 eggs, 50 larvae, 30 nymphs and 20 newly emerged adults of each sex were collected for RNA extraction as one biological replicate, respectively. We then dissected 200 female adults of \u003cem\u003eP. persimilis\u003c/em\u003e into two sections, anterior (gnathosoma and the first pair of legs) and posterior (idiosoma without the first pair of legs) part, to investigate gene spatial expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). All the samples were embedded in RNA Stabilization Reagent (QIAGEN, Germany) before RNA extraction. Three biological replicates were prepared for each stage and tissue. All samples were immediately frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eReal-time quantitative PCR (qPCR) using SYBR Mixture (UPTECH, China) (with ROX) in FQD-96A (ABI QuantStudio 4, China) followed the program: initial denaturation at 95 ℃ for 10 min, 40 cycles of 95 ℃ for 20 s, 60 ℃ for 20 s and 72 ℃ for 30 s. The expression quantity of \u003cem\u003ePpNPC2a\u003c/em\u003e was calculated using 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method (Livak and Schmittgen \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Each sample had three technical replicates and \u003cem\u003eβ-actin\u003c/em\u003e gene was used as an internal control (Bi et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of dsRNA treatment on\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP. persimilis\u003c/span\u003e \u003cb\u003ebehavior\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe fragments of \u003cem\u003ePpNPC2a\u003c/em\u003e and \u003cem\u003eEGFP\u003c/em\u003e were amplified using unique primers (Table. 1) that conjunct with T7 RNA polymerase promoter sequence, using a T7 RNAi Transcription Kit (Vazyme). The 200 \u0026micro;l of dsRNA solution (containing 500 ng/\u0026micro;l dsRNA of \u003cem\u003ePpNPC2a\u003c/em\u003e or EGFP, 20% sucrose, and 10% blue food dye was added on the leaves with \u003cem\u003eT. urticae\u003c/em\u003e). We selected 200 1-day-old female adults to feed dsRNA solution for gene interference. Similarly, same number of female adults were fed with \u003cem\u003edsEGFP.\u003c/em\u003e The female adults only fed \u003cem\u003eT. urticae\u003c/em\u003e were as control. Precisely 20 female adults were collected at 24 h and 72 h after dsRNA interference to measure the silencing efficiency of \u003cem\u003ePpNPC2a\u003c/em\u003e by qPCR. Each treatment was set four biological replicates.\u003c/p\u003e \u003cp\u003eTo examine behavioral response of \u003cem\u003eP. persimilis\u003c/em\u003e, we improved the \u0026ldquo;T\u0026rdquo; bridge method of Li et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) and used two experimental setups, including leaves in plastic box and intact plant in pot. In plastic box (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), we placed the infested leaf with \u003cem\u003eT. urticae\u003c/em\u003e on one side and clean leaf on the other side in a rectangular box (3\u0026times;3\u0026times;4 cm). For each round of test, 15 female adults of \u003cem\u003eP. persimilis\u003c/em\u003e were released in the middle of a paper bridge with a length of 20 cm. The number of predatory mites was recorded at each side within 5 min. For the intact plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), one side was the \u003cem\u003eT. urticae\u003c/em\u003e infested plant and the other side was a pot of clean plant. Precise 15 female adults of \u003cem\u003eP. persimilis\u003c/em\u003e were released in the middle of a cotton thread with a length of 60 cm. We recorded the number of female adults on each plant within 15 minutes. Our preliminary experiments suggested that the selection times for female adults in plastic box and plant pot was stable and consistent upon 5 minutes and 15minutes, respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAccording to previous studies (Shimoda et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Shimoda et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Silva et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), four representative compounds of HIPVs were selected to test predatory mite response, including TMTT, MeSA, β-caryophyllene and linalool. Each compound of 10\u0026micro;l at a concentration of 50 \u0026micro;g/\u0026micro;l was dropped on one side of the filter paper in the rectangular box, and its solvent n-hexane was dropped on the other side. Similarly, we recorded the number of predatory mites on either side within 5 minutes. Female adults that did not reach either side within the stipulated time were considered as no choice. Each treatment tested a total of 90 female adult mites. The positions of filter paper on left and right sides were swapped after each round test in clean rectangular box.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe relative expressions of \u003cem\u003ePpNPC2a\u003c/em\u003e at developmental stages were compared using one-way ANOVA with LSD (α\u0026thinsp;=\u0026thinsp;0.05) for multiple comparisons. We used independent-sample t test to compare the relative expression of \u003cem\u003ePpNPC2a\u003c/em\u003e of two body parts as well as dsRNA interference after 24 h and 72 h. A chi-square test (χ\u003csup\u003e2\u003c/sup\u003e) was performed to identify significant differences in behavioral responses of \u003cem\u003eP. persimilis\u003c/em\u003e. All statistical tests were conducted with IBM-SPSS v.22.0 (IBM, Armonk, NY, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eBioinformatic analysis of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ePpNPC2a\u003c/span\u003e\u003c/p\u003e \u003cp\u003eAn ortholog of NPC2 gene termed as \u003cem\u003ePpNPC2a\u003c/em\u003e was identified from the transcriptome of \u003cem\u003eP. persimilis\u003c/em\u003e. The length of \u003cem\u003ePpNPC2a\u003c/em\u003e was 546 bp encoding a total of 181 amino acids. It contained a highly conserved ML domain (MD-2-related lipid-recognition). The isoelectric point (pI) was predicted to be 8.71 and its molecular weight (Mw) was 20.04 kDa. The signal peptides were MKCIVLTCFLLGVATASG. \u003cem\u003ePpNPC2a\u003c/em\u003e has 1 N-glycosylation site, 13 serine, 5 threonine and 2 tyrosine phosphorylation sites.\u003c/p\u003e \u003cp\u003ePhylogenetic tree was built to compare \u003cem\u003ePpNPC2a\u003c/em\u003e with other \u003cem\u003eNPC2\u003c/em\u003e genes in 17 species from Arachnida and Insecta (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). \u003cem\u003ePpNPC2a\u003c/em\u003e has the same evolutionary origin with \u003cem\u003eNPC2s\u003c/em\u003e in Mesostigmata, Ixodida and Araneae. And it was highly homologous to \u003cem\u003eNPC2-1\u003c/em\u003e of \u003cem\u003eG. occidentalis\u003c/em\u003e. \u003cem\u003eNPC2\u003c/em\u003e gene had one conserved domain in Arachnida and Insecta (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Although branches for Arachnida and Insecta were separated, NPC2 genes in three orders still shared conserved domains.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSpatiotemporal expression patterns of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ePpNPC2a\u003c/span\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003ePpNPC2a\u003c/em\u003e was broadly expressed across all life stages of \u003cem\u003eP. persimilis\u003c/em\u003e. Overall, the expression of \u003cem\u003ePpNPC2a\u003c/em\u003e in adults was higher than that in immature stages. Especially, the expression levels of \u003cem\u003ePpNPC2a\u003c/em\u003e showed a striking upregulation over 150-folds in female adults compared to eggs (\u003cem\u003eF\u003c/em\u003e\u003csub\u003e(4,10)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;32.876, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The tissue expression revealed that \u003cem\u003ePpNPC2a\u003c/em\u003e was predominantly expressed in the posterior part, which was 5 times higher than that in the anterior part (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of dsRNA interfering on\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eP. persimilis\u003c/span\u003e \u003cb\u003ebehavior\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAfter treated by dsNPC2a, \u003cem\u003ePpNPC2a\u003c/em\u003e expression in the whole body of \u003cem\u003eP. persimilis\u003c/em\u003e was reduced by 59.1 and 78.2% at 24 h and 72 h, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In behavioral test, dsNPC2a-treated female adults reduced choice to infested leaves in box (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;15.520, df\u0026thinsp;=\u0026thinsp;2, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), while selection trend of dsEGFP-treated female adults had no differences with the control. Furthermore, we found the same pattern on the intact plants (\u003cem\u003eχ\u003c/em\u003e\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;6.501, df\u0026thinsp;=\u0026thinsp;2, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.039, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The selection rate of dsNPC2a-treated adults to infested leaves and plants were reduced by 23.1% and 30.4%, respectively. Whereas, in comparison to the dsEGFP-treated or control mites, dsNPC2a-treated female adults did not exhibit any change in response to four compounds of TMTT, MeSA, β-Caryophyllene and linalool (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eRecent studies have determined that NPC2 widely participates in chemical communication of arthropods (Pelosi et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). For example, NPC2 protein was accumulated in the basiconic sensillum of the worker Japanese carpenter ant \u003cem\u003eCamponotus japonicus\u003c/em\u003e, acting as a semiochemical carrier (Ishida et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Similar result was found in the spider \u003cem\u003ePardosa pseudoannulata\u003c/em\u003e that the NPC2 was identified as an olfactory related gene with putative role of the odorant carrier (Xiu et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These researches provided effective information of NPC2 function for our work. In the current study, we found \u003cem\u003ePpNPC2a\u003c/em\u003e gene from \u003cem\u003eP. persimilis\u003c/em\u003e containing a typical ML domain which was highly homologous to \u003cem\u003eG. occidentalis\u003c/em\u003e. The phylogenetic tree showed that NPC2 genes in Acari bifurcated prior to the divergence of Mesostigmata and Ixodida. In addition, the presence of signal peptides at the N-terminus of \u003cem\u003ePpNPC2a\u003c/em\u003e were similar with insect OBPs, suggesting the potential function as secretory protein (Pelosi et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In absence of OBP or CSP genes, ticks and mites were supposed to utilize other soluble proteins with similar roles. Thus, NPC2 family in Chelicerata might fulfil the role of semiochemical carriers, as performed by OBPs and CSPs in insects (Pelosi et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe expression of \u003cem\u003ePpNPC2a\u003c/em\u003e was significantly higher in posterior part than anterior part in \u003cem\u003eP. persimilis\u003c/em\u003e. Several insect OBPs and CSPs have been reported not only in chemosensory organs, but also in other parts of the body such as pheromonal glands and reproductive organs (Pelosi et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). IscaNPC2-1 in \u003cem\u003eI. scapularis\u003c/em\u003e appeared to be present both in the anterior part (gnathosoma and the first pair of legs) of the body, containing chemosensory organs, and in the posterior part (idiosoma without the first pair of legs) (Iovinella et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This information indicates that \u003cem\u003ePpNPC2a\u003c/em\u003e may play an important role in carrying semiochemical in \u003cem\u003eP. persimilis\u003c/em\u003e, and the expression profiles at different developmental stages further confirm our speculation. Similar to studies in insects and Arachnoidea species, \u003cem\u003ePpNPC2a\u003c/em\u003e in \u003cem\u003eP. persimilis\u003c/em\u003e displayed the highest expression levels in female adults. In \u003cem\u003eMacrocentrus cingulum\u003c/em\u003e, \u003cem\u003eMcinNPC2\u003c/em\u003e expressed significantly higher in female than male, especially in female antennal tissue (Kyaw et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). \u003cem\u003ePpNPC2-1\u003c/em\u003e and \u003cem\u003ePpNPC2-3\u003c/em\u003e in \u003cem\u003eP. pseudoannulata\u003c/em\u003e showed predominant expressions in female pedipalps and chelicerae (Xiu et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The expression of our \u003cem\u003ePpNPC2a\u003c/em\u003e was significantly higher in female adults than in male adults of \u003cem\u003eP. persimilis\u003c/em\u003e, indicating that it may involve in chemical communications in the functional responsibilities of the female, such as oviposition, host-seeking and efficient foraging. By using this kind of semiochemical carrier, phytoseiid mites might utilize plant volatiles as olfactory cues for survival and reproduction (Dicke et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1988\u003c/span\u003e; Bruce-Oliver et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Choh et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe behavioral observations provided further evidence that \u003cem\u003ePpNPC2a\u003c/em\u003e may play a role in the chemosensory pathway. In both test apparatuses of leaves and plants, dsNPC2a-treated female adults showed significant insensitiveness in response to infested leaves with \u003cem\u003eT. urticae\u003c/em\u003e, suggesting successful gene interference in predatory mite to plant volatiles. NPC2 has been reported to be involved in a wide array of biochemical pathways beyond chemoreception, such as sterol homeostasis, ecdysteroid biosynthesis and triglyceride accumulation (Huang et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Shi et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Adachi et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Pelosi et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Iovinella et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Zhu et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Unfortunately, we did not find the insensitiveness of female adults treated with dsNPC2a in response to TMTT, MeSA, β-Caryophyllene and Linalool, four of which were considered as typical HIPVs. This may be none of these compounds was the ligands of \u003cem\u003ePpNPC2a\u003c/em\u003e protein. NPC2-1 was found to bind to β-ionone in \u003cem\u003eI. scapularis\u003c/em\u003e (Josek et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Similarly, the best ligand for \u003cem\u003eMminNPC2\u003c/em\u003e was β-ionone rather than linalool in \u003cem\u003eM. cingulum\u003c/em\u003e (Kyaw et al.2021). In \u003cem\u003eMicroplitis mediatore\u003c/em\u003e, \u003cem\u003eMmedNPC2\u003c/em\u003e can specifically bind β-ionone, linalool and other 6 volatiles, but not β-caryophyllene or MeSA (Zheng et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). It might suggest functional differentiations of NPC2 members in gene family among arthropods (Ishida et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Iovinella et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn short, our study identified the \u003cem\u003ePpNPC2a\u003c/em\u003e gene from NPC2 family and revealed its potential role in chemoreception of host plant volatiles in \u003cem\u003eP. persimilis\u003c/em\u003e. In future research, tissue localization of NPC2 gene can be examined by situ hybridization. The odor binding spectrum of this protein family in \u003cem\u003eP. persimilis\u003c/em\u003e could also improve our knowledge to understand responsive stimuli from HIPVs for biocontrol potential in predatory mites.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by National Natural Science Foundation of China (Grant No. 32070402), Beijing Natural Science Foundation (Grant No. 6222052), Beijing Agriculture Innovation Consortium (BAIC01-2022) and Agricultural Science and Technology Innovation Program, CAAS \u0026ldquo;Protection Application of Insect Natural Enemies\u0026rdquo;.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eContribution\u003c/strong\u003e\u003cstrong\u003es\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHongxu Zhou\u003c/strong\u003e:\u0026nbsp;Investigation,\u0026nbsp;Formal analysis,\u0026nbsp;Writing-\u0026nbsp;Original draft preparation, reviewing and editing. \u003cstrong\u003eHong Yan\u003c/strong\u003e: reviewing and editing. Endong Wang: Supervision and Editing. \u003cstrong\u003eBo Zhang\u003c/strong\u003e: Conceptualization, Formal analysis, Supervision, Writing- Original draft preparation, reviewing and editing. \u003cstrong\u003eXuenong Xu\u003c/strong\u003e:\u0026nbsp;Validation, Supervision and Editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no competing interest exits.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAdachi T, Ishii K, Matsumoto Y, Hayashi Y, Hamamoto H, Sekimizu K (2014)Niemann-Pick disease type C2 protein induces triglyceride accumulation in silkworm and mammalian cell lines. Biochem J 459(1):137-147. https://doi.org/10.1042/BJ20130876.\u003c/li\u003e\n\u003cli\u003eAkkerhuis GJO, Sabelis MW, Tjallingii WF (1985) Ultrastructure of chemoreceptors on the pedipalps and first tarsi of Phytoseiulus persimilis. Exp Appl Acarol 1:235-251. https://doi.org/10.1007/BF01198521\u003c/li\u003e\n\u003cli\u003eBruce-Oliver SJ, Hoy MA, Yaninek JS (1996) Effect of some food sources associated with cassava in Africa on the development, fecundity and longevity of \u003cem\u003eEuseius fustis\u003c/em\u003e (Pritchard and Baker) (Acari: Phytoseiidae). Exp Appl Acarol 20:73-85. https://doi.org/10.1007/BF00051154\u003c/li\u003e\n\u003cli\u003eBi SJ, Lv JL, Xu J, Shi DY, Wang ED, Li GT, Xu XN (2019) RNAi mediated knockdown of RpL11, RpS2, and tra-2 led to reduced reproduction of Phytoseiulus persimilis. Exp Appl Acarol 78(4):505-520. https://doi.org/10.1007/s10493-019-00403-2\u003c/li\u003e\n\u003cli\u003eCarr AL, Roe M (2016) Acarine attractants: chemoreception, bioassay, chemistry and control. Pestic. Biochem. Physiol. 131: 60-79. https://doi.org/10.1016/j.pestbp.2015.12.009\u003c/li\u003e\n\u003cli\u003eChoh Y, Uefune M, Takabayashi J (2010) Predation-related odours reduce oviposition in a herbivorous mite. Exp Appl Acarol 50:1-8. https://doi.org/10.1007/s10493-009-9277-8\u003c/li\u003e\n\u003cli\u003eDicke M, Sabelis MW, Dejong M (1988) Analysis of prey preference in phytoseiid mites by using an olfactometer, predation models and electrophoresis. Exp Appl Acarol 5:225-241. https://doi.org/10.1007/BF02366096\u003c/li\u003e\n\u003cli\u003eGong DP, Zhang HJ, Zhao P, Xia QY, Xiang ZH (2009) The odorant binding protein gene family from the genome of silk worm Bombyx mori. BMC Genom 10:332. https://doi.org/10.1186/1471-2164-10-332.\u003c/li\u003e\n\u003cli\u003eGulia-Nuss M, Nuss AB, Meyer JM, Sonenshine DE, Roe RM, Waterhouse RM, Sattelle DB, de la Fuente J, Ribeiro JM, Megy K, Thimmapuram J, Miller JR, Walenz BP, Koren S, Hostetler JB, Thiagarajan M, Joardar VS, Hannick LI, Bidwell S, Hammond MP, Young S, Zeng Q, Abrudan JL, Almeida FC, Ayllon N, Bhide K, Bissinger BW, Bonzon-Kulichenko E, Buckingham SD, Caffrey DR, Caimano MJ, Croset V, Driscoll T, Gilbert D, Gillespie JJ, Giraldo-Calderon GI, Grabowski JM, Jiang D, Khalil SMS, Kim D, Kocan KM, Koci J, Kuhn RJ, Kurtti TJ, Lees K, Lang EG, Kennedy RC, Kwon H, Perera R, Qi Y, Radolf JD, Sakamoto JM, Sanchez-Gracia A, Severo MS, Silverman N, Simo L, Tojo M, Tornador C, Van Zee JP, Vazquez J, Vieira FG, Villar M, Wespiser AR, Yang Y, Zhu J, Arens-burger P, Pietrantonio PV, Barker SC, Shao R, Zdobnov EM, Hauser F, Grimmelikhuijzen CJP, Park Y, Rozas J, Benton R, Pedra JHF, Nelson DR, Unger MF, Tubio JMC, Tu Z, Robertson HM, Shumway M, Sutton G, Wortman JR, Lawson D, Wikel SK, Nene VM, Fraser CM, Collins FH, Birren B, Nelson KE, Caler E, Hill CA (2016) Genomic insights into the Ixodes scapularis tick vector of Lyme disease. Nat Commun 7:10507. https://doi.org/10.1038/ncomms10507\u003c/li\u003e\n\u003cli\u003eHuang X, Warren JT, Buchanan J, Gilbert LI, Scott MP (2007) Drosophila Niemann-Pick type C-2 genes control sterol homeostasis and steroid biosynthesis: a model of human neurodegenerative disease. Development 134(20):3733-3742. https://doi.org/10.1242/dev.004572\u003c/li\u003e\n\u003cli\u003eIovinella I, Ban L, Song L, Pelosi P, Dani FR (2016) Proteomic analysis of castor bean tick Ixodes ricinus: a focus on chemosensory organs. Insect Biochem Mol Biol 78:58-68. https://doi.org/10.1016/j.ibmb.2016.09.004\u003c/li\u003e\n\u003cli\u003eIshida Y, Tsuchiya W, Fujii T, Fujimoto Z, Miyazawa M, Ishibashi J, Matsuyama S, Ishikawa Y, Yamazaki T (2014) Niemann-Pick type C2 protein mediating chemical communication in the worker ant. Proc Natl Acad Sci USA 111:3847-3852. https://doi.org/10.1073/pnas.1323928111\u003c/li\u003e\n\u003cli\u003eJanssen A, Pallini A, Venzon M, Sabelis MW (1998) Behaviour and indirect interactions in food webs of plant-inhabiting arthropods. Exp Appl Acarol 22: 497-521. https://doi.org/10.1023/A:1006089924336\u003c/li\u003e\n\u003cli\u003eJosek T, Walden KKO, Allan BF, Alleyne M, Robertson HM (2018) A foreleg transcriptome for Ixodes scapularis ticks: candidates for chemoreceptors and binding proteins that might be expressed in the sensory Haller\u0026rsquo;s organ. Ticks Tick Borne Dis 9(5):1317-1327. https://doi.org/10.1016/j.ttbdis.2018.05.013.\u003c/li\u003e\n\u003cli\u003eKirchhoff C, Osterhoff C, Young L (1996) Molecular cloning and characterization of HE1, a major secretory protein of the human epididymis. Biol Reprod 54(4):847-856. https://doi.org/10.1095/biolreprod54.4.847\u003c/li\u003e\n\u003cli\u003eKlein A, Amigo L, Retamal MJ, Morales MG, Miquel JF, Rigotti A, Zanlungo S (2010) NPC2 is expressed in human and murine liver and secreted into bile: potential implications for body cholesterol homeostasis. Hepatology 43:126-133 https://doi.org/10.1002/hep.20985\u003c/li\u003e\n\u003cli\u003eKyaw LM, Dapeng J, Zhang TT, Sivaprasath P, He KL, Bai SX, Wang ZY (2021) Molecular Identification and Functional Analysis of Niemann-Pick Type C2 Protein in \u003cem\u003eMacrocentrus Cingulum\u003c/em\u003e Brischke (Hymenoptera: Braconidae). J Asia Pac Entomol 24(1): 7-14. https://doi.org/10.1016/j.aspen.2020.11.001\u003c/li\u003e\n\u003cli\u003eLeal WS (2013) Odorant reception in insects: roles of receptors, binding proteins, and degrading enzymes. Ann Rev Entomol. 58(1):373-391. https://doi.org/10.1146/annurev-ento-120811-153635\u003c/li\u003e\n\u003cli\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25(4):402-408. https://doi. org/10.1006/meth. 2001.1262\u003c/li\u003e\n\u003cli\u003eLi YY, Ma RJ, Tian CB, Yuan JG, Xu YJ, Chen HQ, and Liu H (2020) Molecular Characterization of Three Niemann\u0026ndash;Pick Type C2 Proteins in the Predatory Mite Neoseiulus Barkeri Hughes (Acari: Phytoseiidae). Syst Appl Acarol-UK 25(8): 1421-1432. https://doi.org/10.11158/saa.25.8.5\u003c/li\u003e\n\u003cli\u003eLi ZX, Sun XG, Liu XH. (2007) Determination on the selectibity of two kinds of spider mites to ginkgo biloba leaves and foliar volatiles. Scientia Silvae Sinicae. 43(11): 170-174.\u003c/li\u003e\n\u003cli\u003eNaureckiene S, Sleat DE, Lackland H, Fensom A, Vanier MT, Wattiaux R, Jadot M, Lobel P (2000) Identification of HE1 as the second gene of Niemann-Pick C disease. Science 290(5500):2298-2301. https://doi.org/10.1126/ science.290.5500.2298.\u003c/li\u003e\n\u003cli\u003eNewman L, Duffus ALJ, Lee C (2016) Using the Free Program MEGA to Build Phylogenetic Trees from Molecular Data. Am Biol Teach 78(7):608-612. https://doi.org/10.1525/abt.2016.78.7.608\u003c/li\u003e\n\u003cli\u003ePelosi P, Iovinella I, Felicioli A, Dani FR (2014) Soluble proteins of chemical communication: an overview across arthropods. Front Physiol 5:320. https://doi.org/10.3389/fphys.2014.00320\u003c/li\u003e\n\u003cli\u003ePelosi P, Iovinella, I, Zhu J, Wang G, Dani FR (2018) Beyond chemoreception: diverse tasks of soluble olfactory proteins in insects. Biol Rev 93:184-200. https://doi.org/10.1111/brv.12339\u003c/li\u003e\n\u003cli\u003eRenthal R, Maghnani L, Bernal S, Qu Y, Griffith WP, Lohmeyer K, Guerrero FD, Borges LMF, P\u0026eacute;rez de Le\u0026oacute;n A (2017) The chemosensory appendage proteome of \u003cem\u003eAmblyomma americanum\u003c/em\u003e (Acari: Ixodidae) reveals putative odorant-binding and other chemoreception-related proteins. Insect Sci 24(5):730-742. https://doi.org/10.1111/1744-7917.12368\u003c/li\u003e\n\u003cli\u003eSabelis MW, Janssen A, Kant MR (2001) The enemy of my enemy is my ally. Science 291:2104-2105. https://doi.org/10.1126/science.1059939.\u003c/li\u003e\n\u003cli\u003eShimoda T, Ozawa R, Arimura GI, Takabayashi J, Nishioka T (2002) Olfactory responses of two specialist insect predators of spider mites toward plant volatiles from lima bean leaves induced by jasmonic acid and/or methyl salicylate. App Entomol Zool 37:535-541. https://doi.org/10.1303/aez.2002.535\u003c/li\u003e\n\u003cli\u003eShimoda T, Ozawa R, Sano K, Yano E, Takabayashi J (2005) The involvement of volatile infochemicals from spider mites and from food\u0026ndash;plants in prey location of the generalist predatory mite \u003cem\u003eNeoseiulus californicus\u003c/em\u003e. J Chem Ecol 31:2019-2032. https://doi.org/10.1007/s10886-005-6075-6\u003c/li\u003e\n\u003cli\u003eShi XZ, Zhong X, Yu XQ (2012) Drosophila melanogaster NPC2 proteins bind bacterial cell wall components and may function in immune signal pathways. Insect Biochem Mol Biol 42(8):545-556. https://doi.org/10.1016/j.ibmb.2012.04.002\u003c/li\u003e\n\u003cli\u003eSilva DB, Bueno VHP, Van Loon JJA, Pe\u0026ntilde;aflor MFGV, Bento JMS, Van Lenteren JC (2018) Attraction of three mirid predators to tomato infested by both the tomato leaf mining moth \u003cem\u003eTuta absoluta\u003c/em\u003e and the whitefly \u003cem\u003eBemisia tabaci\u003c/em\u003e. J Chem Ecology 44:29-39. https://doi.org/10.1007/s10886-017-0909-x\u003c/li\u003e\n\u003cli\u003eTakabayashi J, Dicke M (1992) Response of Predatory Mites with Different Rearing Histories to Volatiles of Uninfested Plants. Entomol Exp Appl 64(2):187-193. https://doi.org/10.1111/j.1570-7458.1992.tb01608.x\u003c/li\u003e\n\u003cli\u003eVosshall LB, Amrein H, Morozov PS, Rzhetsky A, Axel R (1999) A spatial map of olfactory receptor expression in the Drosophila antenna. Cell 96:725-736. https://doi.org/10.1016/S0092-8674(00)80582-6\u003c/li\u003e\n\u003cli\u003eVieira FG, Rozas J (2011) Comparative genomics of the odorant-binding and chemosensory protein gene families across the arthropoda: origin and evolutionary history of the chemosensory system. Genome Biol Evol 3:476-490. https://doi.org/10.1093/gbe/evr033\u003c/li\u003e\n\u003cli\u003eWolff GH, Riffell JA (2018) Olfaction experience and neural mechanisms underlying mosquito host preference. J of Exp Biol 221(Pt 4) jeb157131. https://doi.org/10.1242/jeb.157131.\u003c/li\u003e\n\u003cli\u003eXiu C, Xiao Y, Zhang S, Bao H, Liu Z, Zhang Y (2019) Niemann-Pick proteins type C2 are identified as olfactory related genes of Pardosa pseudoannulata by transcriptome and expression profile analysis. Comp Biochem Phys D 29:320-329. https://doi.org/10.1016/j.cbd.2019.01.004\u003c/li\u003e\n\u003cli\u003eZhang XX, Lv JL, Hu Y, Wang BM, Chen X, Xu XN, Wang ED (2015) Prey preference and life table of \u003cem\u003eAmblyseius orientalis\u003c/em\u003e on \u003cem\u003eBemisia tabaci\u003c/em\u003e and \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e. PLoS ONE 10(10):e0138820. https://doi.org/10.1371/journal.pone.0138820\u003c/li\u003e\n\u003cli\u003eZhang YX, Chen X, Wang JP, Zhang ZQ, Wei H, Yu HY, Zheng HK, Chen Y, Zhang LS, Lin JZ, Sun L, Liu DY, Tang J, Lei Y, Li XM, Liu M (2019) Genomic insights into mite phylogeny, fitness, development, and reproduction. BMC Genomics 20(1):954. https://doi.org/10.1186/s12864-019-6281-1\u003c/li\u003e\n\u003cli\u003eZheng Y, Wang SN, Peng Y, Lu ZY, Shan S, Yang YQ, Li RJ, Zhang YJ, Guo YY (2018) Functional characterization of a Niemann-Pick type C2 protein in the parasitoid wasp Microplitis mediator. Insect Sci 25(5):765-777. https://doi.org/10.1111/1744-7917.12473\u003c/li\u003e\n\u003cli\u003eZhu J, Guo M, Ban L, Song LM, Liu Y, Pelosi P, Wang G (2018) Niemann-Pick C2 proteins: a new function for an old family. Front Physiol 9:52. https://doi.org/10.3389/fphys.2018.00052\u003c/li\u003e\n\u003c/ol\u003e"},{"header":" Table 1","content":" \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003ePrimers for PCR, Q-RT-PCR and synthesis of dsRNA in this study\u003c/div\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eGroup\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eGene\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eForward primer (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eReverse primer (3\u0026prime;\u0026ndash;5\u0026prime;)\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eLength(bp)\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePCR\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003eQ-RT-PCR\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePpNPC2a\u003c/span\u003e\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePpNPC2a\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eGTGCATAGTGCTAACGTGCT\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003eGCAGCTCGGATAAGGATGGAT\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eTCAACCAAGAGTGGCCCTGA\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003eACTTTGGCACCGTCTGGG\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e541\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e130\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eActin\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eTGGTCGGTATGGGTCAGA\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eTGGCAGGAGTGTTGAAGGTC\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e264\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003edsRNA\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003ePpNPC2a\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eCAGACGGTGCCAAAGTCAAG\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eCTTCGCGATTCCGGACAAAG\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e243\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eEGFP\u003c/span\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eTGAGCAAGGGCGAGGAG\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eGCCGCCAGTGCTTGAGGT C\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e948\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003cbr/\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Phytoseiidae, Olfaction, RNA interference, Behavioral response, Predatory mite","lastPublishedDoi":"10.21203/rs.3.rs-2162814/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2162814/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAs a new protein class of semiochemical binding and transporting, Niemann-Pick proteins type C2 (NPC2) in arthropods has received more attentions in recent decade. However, the gene function has not been studied in phytoseiid mites for biocontrol potential. In current study, we identified and cloned a new NPC2 gene \u003cem\u003ePpNPC2a\u003c/em\u003e from transcriptome of a predatory mite \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e Athias-Henriot. \u003cem\u003ePpNPC2a\u003c/em\u003e encoded 181 amino acids with a conserved ML domain. From phylogenetic analyses, \u003cem\u003ePpNPC2a\u003c/em\u003e was found homologous to \u003cem\u003eNPC2-1\u003c/em\u003e of \u003cem\u003eGalendromus occidentalis\u003c/em\u003e Nesbitt. We also measured gene expression in different stages and tissues in \u003cem\u003eP. persimilis\u003c/em\u003e. \u003cem\u003ePpNPC2a\u003c/em\u003e transcript was significantly higher in female adults than in male adults or other immature stages. Due to tiny body size of predatory mites, we only examined tissue expressions in two sections, posterior part of which was found higher gene transcription of \u003cem\u003ePpNPC2a\u003c/em\u003e. To investigate the potential function of \u003cem\u003ePpNPC2a\u003c/em\u003e in \u003cem\u003eP. persimilis\u003c/em\u003e, we interfered gene expression in female adults by feeding dsRNA. The relative expression was found decreased by 59.1% and 78.2% in 24 h and 72 h after treatments, respectively. The dsNPC2a-treated females had less preference to spider mite infested plant, but we did not find their insensitiveness in response to four representative compounds of HIPVs, including 4,8,12-trimethyl-1,3,7,11-tridecatetraene (TMTT), Methyl salicylate (MeSA), β-Caryophyllene and Linalool. These results indicated \u003cem\u003ePpNPC2a\u003c/em\u003e may play a role in \u003cem\u003eP. persimilis\u003c/em\u003e in response to plant volatiles.\u003c/p\u003e","manuscriptTitle":"Expression and functional analyses of Niemann–Pick C2 gene in Phytoseiulus persimilis Athias-Henriot","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-10-18 16:54:09","doi":"10.21203/rs.3.rs-2162814/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3c8ceced-dea0-47b9-817e-9101040b59b4","owner":[],"postedDate":"October 18th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T20:12:12+00:00","versionOfRecord":{"articleIdentity":"rs-2162814","link":"https://doi.org/10.1007/s10493-023-00781-8","journal":{"identity":"experimental-and-applied-acarology","isVorOnly":false,"title":"Experimental and Applied Acarology"},"publishedOn":"2023-03-15 20:02:07","publishedOnDateReadable":"March 15th, 2023"},"versionCreatedAt":"2022-10-18 16:54:09","video":"","vorDoi":"10.1007/s10493-023-00781-8","vorDoiUrl":"https://doi.org/10.1007/s10493-023-00781-8","workflowStages":[]},"version":"v1","identity":"rs-2162814","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2162814","identity":"rs-2162814","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00