Characterization of Multidrug-Resistant Acinetobacter baumannii isolates and inhibition of biofilm

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background: Multidrug-resistant (MDR) Acinetobacter baumannii poses a significant therapeutic challenge due to its resistance to multiple antibiotics and biofilm formation capabilities. This study characterized MDR A. baumannii strains for the possession of genes related to biofilm formation and their ability to form biofilms. Additionally, it evaluated compounds, particularly essential oils, for their antibiofilm activity. Method: This was a cross-sectional study conducted at the 750-bed Tribhuvan University Teaching Hospital in Nepal. Identification and antibiotic sensitivity of A. baumannii isolates from clinical specimens were performed following the guidelines of the American Society for Microbiology. Strains were screened for their motility profiles, ability to form biofilms in a microtiter plate assay, and for possession of biofilm-related gene(s) by conventional polymerase chain reaction. The ability of cinnamaldehyde, ethylenediaminetetraacetic acid (EDTA), Tween 80, the amino acids glycine and glutamic acid, and natural plant extracts to inhibit biofilm formation also used the microtitre plate system. Result: Out of the total 200 A. baumannii isolates, 195 were MDR, with 192 able to produce biofilms. Among them, 83.1% were strong biofilm producers. In this study, 42.0% and 66.2% of the isolates showed twitching motility and surface-associated motility, respectively. Thirty MDR A. baumannii isolates from medical devices contained the biofilm-associated genes csuE, ompA, bap and blaPER-1, present in 90.0%, 53.3%, 46.6%, and 26.6% of strains. respectively. Cinnamaldehyde was the most effective compound, inhibiting biofilm formation by 77.3%, followed by the ethanolic extract of onion (77.2%) , 0.5% Tween 80 (76.8%), essential oils of ginger (70.8% ) and garlic (68.6%), the ethanolic extract of chili pepper (68.1%), the essential oil of Ageratina adenophora (67.6%), EDTA (54.8%) and the essential oil of turmeric (51.9%). The amino acids glutamic acid and glycine reduced biofilm formation by 66.6% and 33.7% of the isolates, respectively. Conclusion: A. baumannii isolates were commonly strong biofilm producers and often possessed the biofilm-associated genes csuE and ompA. Essential oils, along with Tween 80, were the most effective (≥67%) at reducing the amount of biofilms. These findings help to understand the biofilm production and provide valuable insights into MDR A. baumannii isolates in this clinical setting.
Full text 179,089 characters · extracted from preprint-html · click to expand
Characterization of Multidrug-Resistant Acinetobacter baumannii isolates and inhibition of biofilm | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Characterization of Multidrug-Resistant Acinetobacter baumannii isolates and inhibition of biofilm Poonam Yadav, Sreska Shrestha, Deepak Basyal, Ananda Tiwari, Ranjit Sah, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4343442/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Multidrug-resistant (MDR) Acinetobacter baumannii poses a significant therapeutic challenge due to its resistance to multiple antibiotics and biofilm formation capabilities. This study characterized MDR A. baumannii strains for the possession of genes related to biofilm formation and their ability to form biofilms. Additionally, it evaluated compounds, particularly essential oils, for their antibiofilm activity. Method: This was a cross-sectional study conducted at the 750-bed Tribhuvan University Teaching Hospital in Nepal. Identification and antibiotic sensitivity of A. baumannii isolates from clinical specimens were performed following the guidelines of the American Society for Microbiology. Strains were screened for their motility profiles, ability to form biofilms in a microtiter plate assay, and for possession of biofilm-related gene(s) by conventional polymerase chain reaction. The ability of cinnamaldehyde, ethylenediaminetetraacetic acid (EDTA), Tween 80, the amino acids glycine and glutamic acid, and natural plant extracts to inhibit biofilm formation also used the microtitre plate system. Result: Out of the total 200 A. baumannii isolates, 195 were MDR, with 192 able to produce biofilms. Among them, 83.1% were strong biofilm producers. In this study, 42.0% and 66.2% of the isolates showed twitching motility and surface-associated motility, respectively. Thirty MDR A. baumannii isolates from medical devices contained the biofilm-associated genes csuE, ompA, bap and bla PER-1, present in 90.0%, 53.3%, 46.6%, and 26.6% of strains. respectively. Cinnamaldehyde was the most effective compound, inhibiting biofilm formation by 77.3%, followed by the ethanolic extract of onion (77.2%) , 0.5% Tween 80 (76.8%), essential oils of ginger (70.8% ) and garlic (68.6%), the ethanolic extract of chili pepper (68.1%), the essential oil of Ageratina adenophora (67.6%), EDTA (54.8%) and the essential oil of turmeric (51.9%). The amino acids glutamic acid and glycine reduced biofilm formation by 66.6% and 33.7% of the isolates, respectively. Conclusion: A. baumannii isolates were commonly strong biofilm producers and often possessed the biofilm-associated genes csuE and ompA . Essential oils, along with Tween 80, were the most effective (≥67%) at reducing the amount of biofilms. These findings help to understand the biofilm production and provide valuable insights into MDR A. baumannii isolates in this clinical setting. A. baumannii multidrug-resistant (MDR) biofilm production biofilm inhibition essential oils biofilm-related gene(s) Figures Figure 1 Figure 2 Figure 3 Figure 4 Background The World Health Organization has categorized carbapenem-resistant Acinetobacter baumannii as the foremost critical priority pathogen, urgently requiring new therapeutics ( 1 ). A. baumannii is often associated with device-associated infections, e.g., ventilator-associated pneumonia (VAP), central-line associated bloodstream infection (CLABSI), catheter-associated urinary tract infection (CAUTI), as well as traumatic wound injury ( 2 ). Crude mortality rates associated with multi-drug resistant (MDR) A. baumannii range from 26–68% ( 3 ). Apart from acquiring antibiotic resistance, A. baumannii can develop antibiotic tolerance through biofilm formation which is mediated by autoinducers called acyl homoserine lactones (AHLs). These AHLs are also involved in the induction of virulence factors and antibiotic resistance via plasmid transfer ( 4 ). Biofilm-encased cells can persist on hospital surfaces, posing a risk of outbreaks and device-associated MDR infections among susceptible patients ( 5 ). Several factors contribute to biofilm formation. Bacterial motility helps cells spread across surfaces and from specific infection sites ( 6 – 10 ). Proteins involved in biofilm formation include outer membrane protein A (OmpA), biofilm-associated protein (Bap), a beta-lactamase PER-1, and the CsuA/BABCDE chaperone-usher pili assembly system ( 11 ). Plant extracts from leaves, stems, and roots are rich in a wide variety of secondary metabolites such as tannins, alkaloids, phenolic compounds, and flavonoids, known for their in vitro anti-biofilm properties ( 12 ). The anti-biofilm effects of natural products include suppression of cell adhesion and attachment, the inhibition of formation of the polymer matrix that encases cells, and decreasing virulence factor production ( 13 ). Cinnamaldehyde, for instance, can reduce quorum sensing, inhibiting polymer matrix formation around cells ( 14 , 15 ). Additionally, non-antibiotic agents such as ethylenediaminetetraacetic acid (EDTA) and Tween 80 can increase the permeability of the outer membrane of Gram-negative bacteria, and may destabilize their biofilms ( 16 – 19 ). This study aimed to assess the biofilm-forming ability of MDR A. baumannii , to identify biofilm-related genes and to test whether plant extracts from the local surroundings could inhibit biofilm formation. Materials and Methods Study design, setting, isolation and identification of A. baumannii This hospital-based cross-sectional study was conducted in the Department of Microbiology, among the inpatients of Tribhuvan University Teaching Hospital (TUTH), Kathmandu, a tertiary care referral center with 750 beds, from March to December 2021. Different clinical specimens (blood, urine, pus, cerebrospinal fluid, endotracheal tube, tracheal aspirate, fluids, lesion swab, genital swab, catheter tips, and sputum) were processed according to the American Society for Microbiology (ASM) guidelines ( 20 ). The specimens were inoculated onto suitable culture media (5% Human blood agar, MacConkey agar, Chocolate agar, Brain Heart Infusion (BHI); HiMedia, Laboratories Pvt. Ltd India) according to their specific requirements. Identification of isolates was performed following standard microbiological techniques. The purity of the culture inoculum was ensured by employing a purity plate in conjunction with biochemical tests. Antimicrobial susceptibility testing After identifying A. baumannii isolates, their susceptibility to different antibiotics was determined by the Kirby–Bauer disk diffusion method on Mueller-Hinton agar, following standard procedures recommended by the Clinical and Laboratory Standards Institute (CLSI), USA ( 21 ). The CLSI-recommended battery of antibiotics (HiMedia, Laboratories Pvt. Ltd, India) was used. The control strains included Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853, with known susceptibilities. Isolates resistant to at least one antibiotic from three different groups of first line drugs tested were regarded as multidrug-resistant (MDR). Extensively drug resistance (XDR) was defined as resistant to at least one agent in all antimicrobial categories ( 22 ). Motility detection Luria-Bertani (LB) broth containing 0.4% or 0.8% agar was used for motility assays ( 23 , 24 ). For swarming motility, bacteria from overnight grown colonies were stabbed on the surface of the 0.4% semisolid medium using a sterile wooden stick to enable spread of bacteria. For twitching motility, colonies were stabbed at interphase between the bottom of the Petri dish and medium (0.8% semisolid). The agar plates were then incubated at 37°C for 48 hours. For each isolate, assays were performed at least three times. Swarming motility was considered positive (Fig. 1 ) if isolates showed a zone of > 10 mm around the site of inoculation. For twitching motility, after incubation the agar bacteria were visualized by staining with 0.2% crystal violet. Bacteria (Fig. 2 ) were classified as non-motile ( 20 mm spread). Biofilm Formation assay Biofilm formation was detected as previously described (25). Briefly, 200µL of a 1/100 times dilution (in BHI broth with 1% glucose) of 0.5 McFarland adjusted bacterial suspension was placed into wells of polystyrene microtiter plates and incubated in static conditions for 24 hours at 37°C. Negative controls were wells containing sterile BHI broth only. The test was run in triplicate. After incubation, the microtiter plates were vigorously washed in physiological saline three times to remove planktonic and loosely adhered cells. The remaining adherent bacteria were fixed with 200 µL of 99% (v/v) methanol for 15 minutes then left to dry. Plates were stained with a 2% Hucker’s crystal violet for 5 minutes and rinsed with tap water. After complete drying, 200 µL of 33% glacial acetic acid was added to dissolve the crystal violet and the OD of the resulting solution was measured at 550 nm using an automated ELISA reader. The cut-off optical density (ODc) was defined as three standard deviations above the mean OD of the negative control (culture medium). Strains were classified as non-biofilm producers (OD ≤ Odc), weak biofilm producers (Odc < OD ≤ 2 × Odc), moderate biofilm producers (2 × Odc < OD ≤ 4 × Odc) or strong biofilm producers (4 × Odc < OD). Detection of gene(s) involved in biofilm formation of MDR A. baumannii isolates These tests were performed at the molecular laboratory of Annapurna Research Centre, Kathmandu, Nepal. Three to four isolated colonies of biofilm producing MDR A. baumannii isolates were inoculated in 3 mL of Trypticase Soy Broth. After overnight incubation at 37⁰C, genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) method ( 26 ). The presence of the biofilm related genes bap (biofilm-associated protein), ompA (outer membrane protein A), csuE (chaperone-usher pili assembly system), and bla PER−1 (beta-lactamase PER-1) was assessed using PCR ( 11 ). The primers sequences are listed in Table 1 . The PCR was performed by using DreamTaq PCR Master Mix (Thermo Fisher Scientific), which contains Taq polymerase, dNTPs, MgCl 2 and the appropriate buffer. Each PCR tube contained 15 µL reaction mixture composed of 10.4 µL of master mix, 0.6 µl of each forward and reverse primer solution (Macrogen, South Korea), 4 µL of extracted DNA template. The PCR was conducted in a ProFlex PCR system and performed according to the following conditions: initial denaturation at 94°C for 5 min, then, 30 cycles of denaturation (94°C, 1 min), annealing (the annealing temperatures for each gene are listed in Table 1 ) for 1 min, extension at 72°C for 1 min, followed by a final extension at 72°C for 5 min. PCR products were analyzed by electrophoresis in 1% agarose gel containing 2 µl ethidium bromide. DNA bands were observed under UV transilluminator (UVITEC Cambridge) (Fig. 3 ). Previously isolated in-house strains of A. baumannii known to contain the respective genes were used as positive controls, and PCR buffer with no extracted DNA was used as the negative control. Table 1 Primers sequences and annealing temperature for the detection of biofilm-related genes. Targeted genes (Primers) Primer Sequence (5’-3’) Annealing Temperature(°c) DNA amplicon Size (bp) csuE FW = CATCTTCTATTTCGGTCCC RV = CGGTCTGAGCATTGGTAA 59 ° C 184 ompA FW = GTTAAAGGCGACGTAGACG RV = CCAGTGTTATCTGTGTGACC 49 ° C 578 bap FW = TGCTGACAGTGACGTAGAACCACA RV = TGCAACTAGTGGAATAGCAGCCCA 49 ° C 168 bla PER−1 FW = GCAACTGCTGCAATACTCGG RV = ATGTGCGACCACAGTACCAG 55 ° C 340 Biofilm inhibition assays Several experiments were conducted in which different natural and chemical agents were used to examine their ability to inhibit biofilm formation. Ethylenediaminetetraacetic acid (EDTA) (125 mg /L), cinnamaldehyde (0.875 mg/ml), glycine (100 mM), glutamic acid (100mM) and Tween 80 were purchased from HiMedia, India. The rhizomes of turmeric and ginger, bulbs of garlic and onion, and chilli peppers were purchased from the local market of Kathmandu, Nepal and the leaves of Ageratina adenophora (identified as Ageratina denophora in the Department of Pharmacy, Institute of Medicine using standard techniques (27, 28) were collected from the garden of TUTH. Before extraction, plants were washed with clean tap water. The extraction of essential oils (EOs) from turmeric, ginger, garlic and Ageratina adenophora used a Clevenger apparatus. Fifty grams of each of the rhizomes of turmeric, ginger, the bulb of garlic and leaves of Ageratina adenophora were ground and heated in a one- liter round-bottom flask containing 500 ml water for 45 minutes in a Clevenger apparatus using steam distillation. Subsequently, the EO was separated from the water phase using a separatory funnel and the resulting oils were kept in Eppendorf tubes wrapped with aluminum foil and stored at 4 ºC prior to further analysis ( 29 ). The extraction of onion and chilli peppers was performed using the reflux condensation extraction method. Fifty grams each of onion and chilli pepper were ground, then added to a one litre capacity round-bottom flask containing 200 ml of aqueous ethanol, and refluxed for 2.5 hours ( 30 ). Any remaining ethanol was evaporated in a water bath and the remaining extracted residues were kept in an airtight container at 4 ºC until use. Tween 80 (0.1%) and dimethyl sulfoxide (DMSO) (5%) were used as solvents for the preparation of stock solutions of these different plant extracts. The stock solutions were further diluted to make 200 mg/L which was used as the working solution for biofilm inhibition method. The chemical constituents in the EOs of turmeric, ginger, garlic and Ageratina adenophora were analyzed by gas chromatography-mass spectrometry (GC-MS). The GC-MS analysis was performed on a Shimadzu GC-MS-QP2010 Plus available at the Instrument Section of the Department of Plant Resources, Kathmandu. The capillary column used for the analysis was RTX-5MS (60 m × 0.32 mm × 0.25 µm) with a crossbond of 5% diphenyl/95% dimethyl polysiloxane as the stationary phase. The GC analysis was performed under the following conditions: column oven temperature, 50ºC; injection temperature, 250ºC; ion source temperature, 250ºC; interface temperature, 200ºC; split injection mode with a split ratio of 80; helium with a pressure of 53.8 kPa; total gas flow, 112.3 mL/min; column flow, 1.35 mL/min. The GC-MS system started with an initial oven temperature of 50ºC for 1 min, then this was increased to 230ºC at a rate of 3ºC per 9 mins. Mass spectral detection was carried out in electron ionization mode by scanning at 40 to 350 m/z. The total time required for analyzing a single sample was 60 min. The chemical components of the EOs were identified by comparing their mass spectral fragmentation patterns with those in the National Institute of Standard Technology Library (NIST) 2017 and Flavor and Fragrance Natural and Synthetic Compounds (FFNSC) 4.0 library, and also by comparing the retention times of the components with those of the reference compounds. The percentage of each component (Area %) was reported as raw percentages based on the total ion chromatogram (TIC) without standardization. After extraction of EOs and collection of the other samples, the biofilm inhibition assay was performed on strong biofilm producing MDR A. baumannii isolates. The bacterial inocula were prepared as described for biofilm formation assay ( 16 , 17 ). A total of 100 µL of bacterial growth were added to wells of polystyrene, U-bottom 96-well microplates (TARSONS, Catalog No. 941296) and incubated for one hour at 37°C to allow cell adhesion. After incubation, 100 µL of each plant extract or the chemical compounds were added at their previously prepared concentrations to the wells. The growth control wells contained standardized amounts of bacteria in BHI (100 µL) plus an additional aliquot of sterile BHI (100 µL) to bring the final volume to 200 µL without any antibiofilm agent. Each isolate was tested in duplicate and incubated at a temperature of 37⁰C for 24 hours. After incubation, biofilm staining and quantification procedure was performed as previously described ( 31 – 33 ). The anti-biofilm activity was calculated as the percentage of reduction ([(OD growth control – OD experimental sample)/OD growth control] × 100%) ( 32 ) The final results were reported as the mean value of percentage inhibition of each corresponding anti-biofilm agents using against MDR A. baumannii isolates. Statistical analysis The data was finally entered in MS Excel 10 version as well as recorded manually. The data were analyzed using SPSS 20 (Armonk, NY:IBM Corp.). Chi-square test was applied to test the significance of the relation between categorical values; P value ˂ 0.05 was considered statistically significant. Figure 4 was made with OriginPro (OriginLab Corporation 2017). Results Characteristics of isolates Of a total of 18,343 specimens, 4,249 (23.1%) showed bacterial growth among which 200 (4.7%) were A. baumannii . Out of the 200 A. baumannii isolates, 195 (97.5%) were classified as being MDR. Among the total of 195 MDR A. baumannii , 84.6% were isolated from clinical specimens (non-medical devices) whereas 15.4% were recovered from medical devices (Table 2 ). Almost all (98.5%) of the MDR A. baumannii isolates were biofilm producers. The majority of biofilm producers were recovered from general intensive care unit (ICU) (n = 65) followed by COVID ICU (n = 18), medical ICU (n = 12). Table 2 Distribution of MDR A. baumannii growth in different clinical specimens Source of specimens Frequency % Non-medical devices 164 84.1 Sputum 75 38.5 Pus 40 20.5 Blood 17 8.7 Body fluid 14 7.2 Urine 9 4.6 Bronchoalveolar lavage (BAL) 9 4.6 Medical devices 30 15.9 Endotracheal aspirate 17 8.7 Central venous line 8 4.1 Urinary catheter 5 2.6 CSF shunt 1 0.5 Total 195 100 Distribution of biofilm producing capacity and motility of MDR A. baumannii isolated from medical devices and non- medical devices specimens As shown in Table 3 , among the 195 MDR A. baumannii isolates, 192 (98.5%) could produce biofilms, with 83% (162 isolates) identified as strong biofilm producers. Regardless of the source of isolation (tissue or medical devices), most isolates (n = 113, 57%) did not produce twitching motility, whereas the majority (n = 129, 69%) demonstrated swarming motility (Table 3 ). Similarly, irrespective of their resistance to any particular antibiotic, twitching motility was not seen in the majority of the isolates whereas swarming motility was observed most often (Table 4 ). Table 3 Biofilm production and motility of MDR A. baumannii from medical and non- medical device-associated infections. Source of isolate Biofilm production Twitching motility Swarming motility n (%) n (%) n (%) None Weak Mod-erate Strong None Inter-mediate High Negative Positive Tissues (n = 165) 3 ( 2 ) 2 ( 1 ) 28 ( 17 ) 132 (80) 93 ( 56 ) 66 ( 40 ) 6 ( 4 ) 57 ( 35 ) 108 (65) Medical devices (n = 30) 0 (0) 0 (0) 0 (0) 30 (100) 20 (67) 8 (27) 2 ( 7 ) 9 ( 30 ) 21 (70) Total = 195 3 2 28 162 113 74 8 66 129 Table 4 Motility pattern of MDR A. baumannii showing resistance to different antibiotics % of resistant isolates Antibiotics Number of MDR isolates showing resistance Twitching motility Swarming motility None Intermediate High Negative Positive Cotrimoxazole 187 58.3 37.4 4.3 33.2 66.8 Gentamicin 190 57.4 38.4 4.2 33.7 66.3 Amikacin 184 56.0 39.7 4.3 34.2 65.8 Ciprofloxacin 193 58.0 37.8 4.2 34.2 65.8 Levofloxacin 181 56.4 39.2 4.4 34.8 65.2 Ceftazidime 195 58.0 38.0 4.0 33.8 66.2 Meropenem 195 58.0 38.0 4.0 33.8 66.2 Imipenem 195 58.0 38.0 4.0 33.8 66.2 Cefepime 195 58.0 38.0 4.0 33.8 66.2 Piperacillin-tazobactam 195 58.0 38.0 4.0 33.8 66.2 Cefoperazone-sulbactam 138 52.2 45.7 2.1 34.0 66.0 Ampicillin-sulbactam 165 57.0 40.6 2.4 35.8 64.2 Doxycycline 195 58.0 38.0 4.0 33.8 66.2 Distribution of biofilm formation in MDR A. baumannii with respect to twitching and surface-associated motility Swarming motility was primarily seen in strong biofilm producers (119/162), whereas the majority (100/162) did not exhibit twitching motility (100/162) as shown in Table 5 . Table 5 Distribution of biofilm formation with motility in MDR A. baumannii isolates Biofilm types Number Twitching motility Swarming motility None Intermediate High Negative Positive Non-producer 3 0 3 0 2 1 Weak producer 2 0 2 0 1 1 Moderate producer 28 13 15 0 20 8 Strong producer 162 100 54 8 43 119 Genes involved in biofilm formation in MDR A. baumannii isolates from medical devices Thirty A. baumannii isolates from medical devices, all showing strong biofilm production, possessed at least one biofilm-associated gene. Among these, the prevalence decreased in the following order: csuE (90.0%), ompA (53.3%), bap (46.6%) and bla PER−1 (26.6%). Notably, the MDR A. baumannii isolates from endotracheal tubes showed the highest number of biofilm-related genes (Table 6 ). Table 6 Distribution of biofilm related genes among 30 MDR A. baumannii isolates from medical devices Medical devices csuE gene ompA gene bap gene bla PER-1 gene Endotracheal aspirate 15 (50.0%) 6 (20.0%) 6 (20.0%) 3 (10.0%) Central venous line 7 (23.3%) 6 (20.0%) 5 (16.6%) 4 (13.3%) Urinary catheter 5 (16.6%) 3 (10.0%) 3 (10.0%) 1 (3.3%) CSF shunt 0.0% 1 (3.3%) 0.0% 0.0% Distribution of biofilm-related genes among antibiotic resistant A. baumannii isolates The majority of antibiotic resistant isolates carried several biofilm related genes (Table 7 ). Table 7 Distribution of biofilm-related genes among A. baumannii isolates resistant to different antibiotics (n = 30) Antibiotics csuE (n = 27) ompA (n = 16) bap (n = 14) bla PER-1 (n = 8) Cotrimoxazole 27 16 14 8 Gentamicin 27 16 14 8 Amikacin 27 16 14 8 Ciprofloxacin 27 16 14 8 Levofloxacin 27 16 14 8 Ceftazidime 27 16 14 8 Cefepime 27 16 14 8 Piperacillin-tazobactam 27 16 14 8 Meropenem 27 16 14 8 Imipenem 27 16 14 8 Doxycycline 27 16 14 8 Cefoperazone-sulbactam 24 13 13 8 Ampicillin-sulbactam 25 14 13 8 Phytochemical constituents of the Essential Oils of plant extract The major compounds identified in EO of ginger were β-curcumene (14.9%), β-sesquiphellandrene (10.3%), geranial (9.0%), camphene (6.8%), neral (5.7%). allitridin (35.8%), trisulfide allyl methyl (18.6%), allyl disulfide (16.3%) and disulfide methyl allyl (4.4%) were major constituents found in EO of garlic. Similarly, the major compounds identified by GC-MS in EO of turmeric were Z-γ-atlantone (29.0%), ar-tumerone (19.9%), E-γ-atlantone (18.0%), Likewise, α-muurolol (12.0%), α-bisabolol (8.3%), cyperotundone (6.4%), bornyl acetate (5.8%) and p -cymene (4.8%) were main constituents found in EO of Ageratina adenophora. Biofilm inhibition by different compounds Biofilm inhibition assay was performed on strong biofilm-producing MDR A. baumannii isolates (n = 162). Cinnamaldehyde (0.875 mg/mL) and EDTA (125 mg/L) inhibited the biofilm biomass by 77.3% and 54.8% respectively. Different concentrations of Tween 80 (0.01%, 0.1% and 0.5%) showed concentration dependent inhibition of biofilm. The concentration of EOs (200 mg/L) of ginger, garlic, turmeric, Ageratina adenophora prevented biofilm formation by 70.8%, 68.6%, 51.9% and 67.6% respectively. Ethanolic extract of onion (200 mg/L) prevented biofilm formation by 77.2% which was more as compared to that by ethanolic extract of chili pepper (68.1%). Glutamic acid and glycine inhibited biofilm by 66.6% and 33.7% respectively. (Fig. 4 ). Discussion This study reveals a high prevalence of MDR and XDR clinical isolates of A. baumannii at the study site over the last decade ( 34 , 35 ). The high rates of MDR A. baumannii observed may be attributed to factors such as emergence of bacteria with different resistance mechanisms, increased likelihood of resistance dissemination in hospital environments, absence of a robust nosocomial infection surveillance system, and suboptimal infection control practices ( 36 ). In the present study, biofilm production was observed in nearly all isolates of MDR A. baumannii , with 83.1% exhibiting strong biofilm production. This finding aligns with a study conducted in a tertiary care hospital in Nepal, where 99.6% of Acinetobacter isolates were identified as biofilm producers, and 89% of them were characterized as strong biofilm producers ( 37 ). Strong biofilm producers are significantly associated with recurrent infections and antimicrobial resistance ( 38 , 39 ). Our study revealed that among the 195 MDR A. baumannii isolates, twitching motility was observed in 42.0%, while surface-associated motility was observed in 66.2%. These findings are consistent with another study where 50.0% of isolates exhibited twitching motility, and 62.5% displayed surface-associated motility phenotypes ( 40 ). Approximately 4.1% and 61.0% of MDR A. baumannii isolates exhibited strong twitching motility and surface-associated motility, respectively, along with a robust capacity for strong biofilm production. Notably, this study marks the first from Nepal to establish a correlation between biofilm formation and the motility traits of MDR A. baumannii isolates. Our findings also revealed a significant difference in resistance to ampicillin-sulbactam and cefoperazone-sulbactam, specifically in relation to twitching motility among the isolates. Twitching motility was more commonly seen among the isolates from sputum (data not shown). We speculate that the greater degree of motility observed in sputum isolates may be attributed to the overexpression of type IV pili-related genes compared to isolates from other specimens. Motility, as a trait, relies on the presence of type IV pili, and it has been demonstrated in other bacteria that biofilm-forming cells often downregulate genes associated with motility ( 41 ). Due to the escalating resistance of A. baumannii to various antibiotics, often attributed to biofilm formation, there is an urgent need to identify therapeutic strategies aimed at inhibiting biofilm formation and effectively treating established biofilms ( 42 , 43 ). In our study, treatment with EDTA (125 mg/L) resulted in a notable 54.8% inhibition in biofilm formation, consistent with findings in other studies ( 44 , 45 ). The ability of EDTA to chelate and potentiate bacterial cell walls, along with its capacity to destabilize biofilms by sequestering calcium, magnesium, zinc, and iron, positions it as a suitable agent for biofilm inhibition ( 46 ). Similarly, cinnamaldehyde demonstrated a promising inhibition of 77.3% in average biofilm formation, surpassing the findings by Mohamed et al. ( 17 ). In our study, Tween 80 exhibited a concentration-dependent reduction in biofilm formation, ranging from 61.8–76.8% as concentrations increased. Moreover, at a concentration of 100 mM, glutamic acid and glycine showed average reductions of 66.6% and 33.7%, respectively in biofilm formation. A study from Iraq also reported significant anti-biofilm activity of these compounds.( 16 ) Additionally, inhibitory effects observed against Staphylococcus aureus , Pseudomonas aeruginosa , and Bacillus subtilis suggest that D-amino acids may serve as a general strategy for inhibiting biofilm formation in opportunistic pathogens ( 47 – 49 ). D-amino acids play a role in regulating bacterial cell wall remodeling during the stationary phase, contributing to biofilm dispersal in aging bacterial communities ( 50 ). The use of anti-biofilm agents, capable of either inhibiting or eliminating biofilm without inducing resistance, is essential for a potential therapeutic approach to managing MDR biofilm-associated infections. As our study primarily focused on identifying alternative technologies for controlling A. baumannii biofilms, we turned to EOs derived from edible plants, which have been consumed by humanity since ancient times and are known for their diverse benefits. In our investigation, we employed EOs from ginger, garlic, turmeric, and Ageratina adenophora , along with ethanolic extracts of onion and chili, as anti-biofilm agents. Notably, to our knowledge, this study represents the first exploration in Nepal of bacterial biofilm inhibition using natural plant extracts. The Gas Chromatography-Mass Spectrometry (GC-MS) analysis of the ginger EO revealed the presence of phenolic compounds (geraniol, citronellol), volatile sesquiterpenes (bisabolene), and monoterpenoids (curcumene, β-sesquiphellandrene), aligning with another study ( 51 ). In our study, the EO of ginger demonstrated an average 70.8% reduction in biofilm in A. baumannii isolates which is comparable to another study ( 52 ). The EO of turmeric was found to contain secondary metabolites such as zingiberene, tumerone, ar-tumerone, curlone, and the phenolic compound curcumin, which is recognized as the most essential bioactive component among curcuminoids. Tumerone, in particular, exhibited anti-biofilm properties against bacterial isolates. Our study demonstrated an average 51.9% reduction in A. baumannii biofilm. Similarly, Ahamad et al. showed a reduction of A. baumannii biofilm from 2.0170 ± 0.14863 (mean ± SD) to 0.2470 ± 0.11314 by 200 mg/L turmeric extract. Additionally, Suwal et al. assessed the anti-biofilm activity of Curcuma longa (turmeric) rhizome extracts against, reporting inhibition ranging from 26.7–77.7% for Staphylococcus aureus and Pseudomonas aeruginosa ( 53 ). The EO of garlic revealed major compounds such as allyl disulfide and allitridine, known for their biofilm inhibiting properties. In our study, we observed a substantial 68.6% inhibition of biofilm in A. baumannii at a concentration of 200 mg/L, aligning with findings by Somrani et al., who reported a 68.0% inhibition of biofilm when garlic EO was exposed to bacteria for one hour at its Minimum Inhibitory Concentration (MIC) ( 32 ). Garlic has also been recommended in different studies as an agent to prevent wound pathogen biofilm formation when formulated as garlic ointment ( 54 ). Additionally, it can be applied on catheters to prevent catheter-associated biofilm infections ( 55 ). Furthermore, the GCMS analysis of the EO of Ageratina adenophora identified major chemical constituents such as α-phellandrene, camphene, bornyl acetate, p-cymene, γ-curcumene, germacrene, and α-bisabolol, consistent with previous reports ( 56 – 58 ) These compounds have demonstrated antibacterial activity against both Gram-positive and Gram-negative bacteria ( 56 ). In our study, 200 mg/L of Ageratina adenophora inhibited 67.6% of biofilm formation in A. baumannii . Chili pepper, another focus of our study, contained secondary metabolites such as dihydrocapsaicin and luteolin, which exhibit antimicrobial and anti-quorum sensing activities against bacterial pathogens ( 59 , 60 ). Another compound investigated in our study was the ethanolic extract of onion, which exhibited a notable 77.2% inhibition against A. baumannii biofilm. This efficacy aligns with findings demonstrating its effectiveness against Listeria monocytogenes biofilms as well ( 32 ). The anti-biofilm property of onion is attributed to its sulfur compounds. These compounds interact with the sulfhydryl (SH) groups of cellular proteins, forming mixed disulfides that have the potential to inflict damage upon microbial cells ( 61 ). Numerous studies have elucidated the role of biofilm-related genes ( csuE, ompA, bap , and bla PER−1 ) in A. baumannii in biofilm development and antibiotic resistance ( 62 , 63 ). In our study, these genes were identified in 30 strong biofilm-producing isolates of MDR A. baumannii obtained from medical devices. The results revealed the most prevalent gene was csuE (89.9%), followed by ompA (53.3%), bap (46.7%), and bla PER−1 (26.6%). Similar result was reported by Thummeepak et al., who showed a prevalence of 48% and 30.2% for bap and bla PER−1 genes, respectively ( 39 ). The highest frequency of biofilm-related genes was observed in isolates from endotracheal aspirate samples. The csuE gene, a member of the usher-chaperone assembly system, plays a crucial role in mediating attachment and biofilm formation. The high prevalence of csuE in A. baumannii is consistent with findings from other studies ( 5 , 62 – 64 ). OmpA , another biofilm-related gene in A. baumannii , is likely essential for attachment to human epithelial cells, biofilm development, and antimicrobial resistance. Conclusion Cinnamaldehyde, Tween 80, ethanolic extract of onion and essential oil of ginger showed good antibiofilm activity. CsuE, ompA, bap and bla PER−1 genes were associated for biofilm formation in MDR A. baumannii isolates from medical devices. Further research is warranted to elucidate the mechanism of action of anti-biofilm activities of these natural and chemical agents. Detailed phenotypic and genotypic characterization of MDR A. baumannii isolates should be conducted to understand their pathobiology and pathophysiology. Limitation of Study The cytotoxicity assay and MIC of different antibiotics and antibiofilm agents were not performed. Biofilm related genes were only studied in isolates from medical devices. Abbreviations Acinetobacter baumannii ( A. baumannii ); Acyl homoserine lactones (AHLs); American Society for Microbiology (ASM); American Type Culture Collection (ATCC); Biofilm-associated protein (Bap); Brain heart infusion ( BHI ); Catheter-associated urinary tract infection (CAUTI); Central-line associated bloodstream infection (CLABSI); Cetyltrimethylammonium bromide (CTAB); Clinical and Laboratory Standards Institute (CLSI); Coronavirus disease 2019 (COVID-19); Dimethyl sulfoxide (DMSO); Essential oil (EO); Ethylenediaminetetraacetic acid (EDTA); Extensively drug-resistant (XDR); Forward primer (FW); Gas Chromatography- Mass Spectrophotometer (GC-MS); Intensive care unit (ICU); Luria-Bertani (LB); Minimum inhibitory concentration (MIC); Multidrug-resistant (MDR); Nepal Health Research Council (NHRC); Optical density (OD); Outer membrane protein A (OmpA); Polymerase chain reaction (PCR); ); Reverse primer (RV); Tribhuvan University Teaching Hospital (TUTH); Ventilator-associated pneumonia (VAP). Declarations Ethics approval and consent to participate The study was approved by Institutional Review Committee of Institute of Medicine (Ref: 338(6-11)E 2 /077/078) and written consent was taken from patient's local guardian for participation in the study before enrolment. Consent for publication Not applicable. Availability of data and materials All data generated or analyzed during this study are included in this article. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the postgraduate research grant of Nepal Health Research Council (NHRC), Kathmandu, Nepal. (Grant number: 17/2078-079) and faculty research grant by Rector’s Office, Tribhuvan University, Nepal (2078). Acknowledgements We would like to thank laboratory staff, faculty members of Microbiology department of TUTH, patients who are the source for our bacterial strains. SKM is grateful to UNSW Sydney for Scientia PhD scholarship. Authors' contributions SKM, PY and MW conceived and designed the research. SKM, PY and DB developed the methodology. SKM and PY were responsible for the acquisition of research funds. PY conducted experiments, analyzed data and wrote the original draft of the manuscript. PY, SS, AT, AS and BY helped in the interpretation of data. SKM, RS and MW supervised the project. All authors read, contributed significantly by reviewing and editing the manuscript, and approved the final draft for publication. Authors' information 1 Department of Microbiology, Chitwan Medical College, Tribhuvan University, Nepal PY: (Orcid - https://orcid.org/0000-0002-7113-3690) 2 National Public Health Laboratory, Ministry of Health and Population, Kathmandu, Nepal 3 Department of Pharmacy, Maharajgunj Medical Campus, Institute of Medicine, Tribhuvan University, Kathmandu, Nepal 4 Department of Pharmacognosy, Keimyung University, Daegu, South Korea 5Department of Health Security, Expert Microbiology Research Unit, Finnish Institute for Health and Welfare. 6 Department of Microbiology, Tribhuvan University Teaching Hospital, Kathmandu, Nepal 7. Annapurna Research Center, Maitighar, Kathmandu 8 Department of General Practice and Emergency Medicine, Chitwan Medical College, Tribhuvan University, Nepal 9 School of Optometry and Vision Science, Faculty of Medicine and Health, University of New South Wales, Sydney, Australia MW: (Orcid - https://orcid.org/0000-0003-3842-7563) SKM: (Orcid - https://orcid.org/0000-0002-3888-7319) References Shlaes DM, Bradford PA. Antibiotics—From There to Where?: How the antibiotic miracle is threatened by resistance and a broken market and what we can do about it. Pathogens & Immunity. 2018;3(1):19. (DOI: 10.20411/pai.v3i1.231) Wong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B, Spellberg BJCmr. Clinical and pathophysiological overview of Acinetobacter infections: a century of challenges. Clinical Microbiology Reviews. 2017;30(1):409-47. (https://doi.org/10.1128/cmr.00058-16) Sunenshine RH, Wright M-O, Maragakis LL, Harris AD, Song X, Hebden J, et al. Multidrug-resistant Acinetobacter infection mortality rate and length of hospitalization. Emerging infectious diseases. 2007;13(1):97. (DOI: 10.3201/eid1301.060716) Bhargava N, Sharma P, Capalash N. Quorum sensing in Acinetobacter: an emerging pathogen. Critical reviews in microbiology. 2010;36(4):349-60. (https://doi.org/10.3109/1040841X.2010.512269) Zeighami H, Valadkhani F, Shapouri R, Samadi E, Haghi F. Virulence characteristics of multidrug resistant biofilm forming Acinetobacter baumannii isolated from intensive care unit patients. BMC infectious diseases. 2019;19(1):1-9. (https://doi.org/10.1186/s12879-019-4272-0) Erhardt M. Strategies to block bacterial pathogenesis by interference with motility and chemotaxis. How to overcome the antibiotic crisis: facts, challenges, technologies and future perspectives. 2016:185-205. Clemmer KM, Bonomo RA, Rather PN. Genetic analysis of surface motility in Acinetobacter baumannii. Microbiology. 2011;157(Pt 9):2534. (https://doi.org/10.1099/mic.0.049791-0) Eijkelkamp BA, Stroeher UH, Hassan KA, Papadimitrious MS, Paulsen IT, Brown MH, et al. Adherence and motility characteristics of clinical Acinetobacter baumannii isolates. FEMS microbiology letters. 2011;323(1):44-51. (https://doi.org/10.1111/j.1574-6968.2011.02362.x) Skiebe E, de Berardinis V, Morczinek P, Kerrinnes T, Faber F, Lepka D, et al. Surface-associated motility, a common trait of clinical isolates of Acinetobacter baumannii, depends on 1, 3-diaminopropane. International Journal of Medical Microbiology. 2012;302(3):117-28. (https://doi.org/10.1016/j.ijmm.2012.03.003) Tomaras AP, Dorsey CW, Edelmann RE, Actis LA. Attachment to and biofilm formation on abiotic surfaces by Acinetobacter baumannii: involvement of a novel chaperone-usher pili assembly system. Microbiology. 2003;149(12):3473-84. (https://doi.org/10.1099/mic.0.26541-0) Monfared AM, Rezaei A, Poursina F, Faghri J. Detection of genes involved in biofilm formation in MDR and XDR Acinetobacter baumannii isolated from human clinical specimens in Isfahan, Iran. Archives of Clinical Infectious Diseases. 2019;14(2). Yong YY, Dykes GA, Choo WS. Biofilm formation by staphylococci in health-related environments and recent reports on their control using natural compounds. Critical reviews in microbiology. 2019;45(2):201-22. (https://doi.org/10.1080/1040841X.2019.1573802) Lu L, Hu W, Tian Z, Yuan D, Yi G, Zhou Y, et al. Developing natural products as potential anti-biofilm agents. Chinese medicine. 2019;14(1):1-17. (https://doi.org/10.1186/s13020-019-0232-2) Niu C, Afre S, Gilbert ES. Subinhibitory concentrations of cinnamaldehyde interfere with quorum sensing. Letters in applied microbiology. 2006;43(5):489-94. (https://doi.org/10.1111/j.1472-765X.2006.02001.x) Bai A J, Vittal RR. Quorum sensing inhibitory and anti-biofilm activity of essential oils and their in vivo efficacy in food systems. Food Biotechnology. 2014;28(3):269-92. (https://doi.org/10.1080/08905436.2014.932287) Ahmad NH, Mohammad GA. Evaluation of Some Material to inhibit Biofilm Formed by Acinetobacter baumannii Isolates. Tikrit Journal of Pure Science. 2019;24(4):19-24. (http://dx.doi.org/10.25130/tjps.24.2019.066) Mohamed SH, Salem D, Azmy M, Fam NS. Antibacterial and antibiofilm activity of cinnamaldehyde against carbapenem-resistant Acinetobacter baumannii in Egypt: In vitro study. Journal of Applied Pharmaceutical Science. 2018;8(11):151-6. (http://dx.doi.org/10.7324/JAPS.2018.81121) Zegans ME, Wozniak D, Griffin E, Toutain-Kidd CM, Hammond JH, Garfoot A, et al. Pseudomonas aeruginosa exopolysaccharide Psl promotes resistance to the biofilm inhibitor polysorbate 80. Antimicrobial agents and chemotherapy. 2012;56(8):4112-22. (https://doi.org/10.1128/aac.00373-12) Brown M, Geaton E, Gilbert P. Additivity of action between polysorbate 80 and polymyxin B towards spheroplasts of Pseudomonas aeruginosa NCTC 6750. Journal of Pharmacy and Pharmacology. 1979;31(1):168-70. (https://doi.org/10.1111/j.2042-7158.1979.tb13463.x) Garcia LS. Clinical microbiology procedures handbook: American Society for Microbiology Press; 2010. Abbey TC, Deak E. What's new from the CLSI subcommittee on antimicrobial susceptibility testing M100. Clinical Microbiology Newsletter. 2019;41(23):203-9. (DOI: 10.1016/j.clinmicnews.2019.11.002) Magiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas M, Giske C, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical microbiology and infection. 2012;18(3):268-81. (DOI: 10.1111/j.1469-0691.2011.03570.x) Vijayakumar S, Rajenderan S, Laishram S, Anandan S, Balaji V, Biswas I. Biofilm formation and motility depend on the nature of the Acinetobacter baumannii clinical isolates. Frontiers in public health. 2016;4:105. (https://doi.org/10.3389/fpubh.2016.00105) Loraine J, Heinz E, Soontarach R, Blackwell GA, Stabler RA, Voravuthikunchai SP, et al. Genomic and phenotypic analyses of Acinetobacter baumannii isolates from three tertiary care hospitals in Thailand. Frontiers in Microbiology. 2020;11:548. (https://doi.org/10.3389/fmicb.2020.00548) )25. Stephanovic S, Cirkovic I, Ranin L, Svabic-Vlahovic M. Biofilm formation by Salmonella spp. and Listeria monocytognes on plastic surfaces. Lett Appl Microbiol. 2004;38:428-32. (DOI: 10.1111/j.1472-765X.2004.01513.x) Tiwari K, Jadhav S, Gupta S. Modified CTAB technique for isolation of DNA from some medicinal plants. Research Journal of Medicinal Plant. 2012;6(1):65-73. ( DOI: 10.3923/rjmp.2012.65.73) Poudel R, Neupane NP, Mukeri IH, Alok S, Verma A. An updated review on invasive nature, phytochemical evaluation, & pharmacological activity of Ageratina adenophora. Int J Pharm Sci Res. 2020;11:2510-20. (http://dx.doi.org/10.13040/IJPSR.0975-8232.11(6).2510-20) Poudel AS, Shrestha BB, Joshi MD, Muniappan R, Adiga A, Venkatramanan S, et al. Predicting the current and future distribution of the invasive weed Ageratina adenophora in the Chitwan–Annapurna Landscape, Nepal. Mountain Research and Development. 2020;40(2):R61. (https://doi.org/10.1659/MRD-JOURNAL-D-19-00069.1) Didar Z, Mohamadisani A. Comparison of the Effects of Hydrosol Extracted from Turmeric (Curcuma longa) and Cinnamon (Cinnamomum verum) on staphylococcal biofilm. Journal of Babol University of Medical Sciences. 2019;21(1):293-8. (http://dx.doi.org/10.22088/jbums.21.1.293) Laghari AQ, Memon S, Nelofar A, Laghari AH. Extraction, identification and antioxidative properties of the flavonoid-rich fractions from leaves and flowers of Cassia angustifolia. American Journal of Analytical Chemistry. 2011;2(08):871. (DOI:10.4236/ajac.2011.28100) Farrag HA, Hosny AE-DM, Hawas AM, Hagras SA, Helmy OM. Potential efficacy of garlic lock therapy in combating biofilm and catheter-associated infections; experimental studies on an animal model with focus on toxicological aspects. Saudi Pharmaceutical Journal. 2019;27(6):830-40. (https://doi.org/10.1016/j.jsps.2019.05.004) Somrani M, Inglés M-C, Debbabi H, Abidi F, Palop A. Garlic, onion, and cinnamon essential oil anti-biofilms’ effect against Listeria monocytogenes. Foods. 2020;9(5):567. (https://doi.org/10.3390/foods9050567) Rossi MW, Heuertz RM. Cinnamaldehyde inhibits MRSA biofilm formation and reduces cell viability. American Society for Clinical Laboratory Science. 2017;30(4):214-8. (DOI: https://doi.org/10.29074/ascls.30.4.214) Yadav SK, Bhujel R, Hamal P, Mishra SK, Sharma S, Sherchand JB. Burden of multidrug-resistant Acinetobacter baumannii infection in hospitalized patients in a tertiary care hospital of Nepal. Infection and drug resistance. 2020:725-32. (DOI: 10.2147/IDR.S239514) Mishra SK, Rijal BP, Pokhrel BM. Emerging threat of multidrug resistant bugs–Acinetobacter calcoaceticus baumannii complex and methicillin resistant Staphylococcus aureus. BMC research notes. 2013;6:1-6. (DOI: 10.1186/1756-0500-6-98) Shrestha SK, Trotter A, Shrestha PK. Epidemiology and risk factors of healthcare-associated infections in critically ill patients in a tertiary care teaching hospital in Nepal: a prospective cohort study. Infectious Diseases: Research and Treatment. 2022;15:11786337211071120. (https://doi.org/10.1177/11786337211071120) Khanal BR, Wagle S, TiWaRi BR. Biofilm formation and colistin susceptibility of clinical isolates of Acinetobacter species in a tertiary care hospital of Nepal. National J Lab Med. 2019;8(1):12-5. Malchau KS, Tillander J, Zaborowska M, Hoffman M, Lasa I, Thomsen P, et al. Biofilm properties in relation to treatment outcome in patients with first-time periprosthetic hip or knee joint infection. Journal of Orthopaedic Translation. 2021;30:31-40. (https://doi.org/10.1016/j.jot.2021.05.008) Thummeepak R, Kongthai P, Leungtongkam U, Sitthisak S. Distribution of virulence genes involved in biofilm formation in multi-drug resistant Acinetobacter baumannii clinical isolates. Int Microbiol. 2016;19(2):121-9. (DOI:10.2436/20.1501.01.270) Jain AL, Harding CM, Assani K, Shrestha CL, Haga M, Leber A, et al. Characteristics of invasive Acinetobacter species isolates recovered in a pediatric academic center. BMC Infectious Diseases. 2016;1(16):1-9. (DOI: 10.1186/s12879-016-1678-9) Pesavento C, Becker G, Sommerfeldt N, Possling A, Tschowri N, Mehlis A, et al. Inverse regulatory coordination of motility and curli-mediated adhesion in Escherichia coli. Genes & development. 2008;22(17):2434-46. (http://www.genesdev.org/cgi/doi/10.1101/gad.475808) Kuppusamy R, Yasir M, Yee E, Willcox M, Black DS, Kumar N. Guanidine functionalized anthranilamides as effective antibacterials with biofilm disruption activity. Organic & Biomolecular Chemistry. 2018;16(32):5871-88. (https://doi.org/10.1039/C8OB01699B) Mishra SK, Baidya S, Bhattarai A, Shrestha S, Homagain S, Rayamajhee B, et al. Bacteriology of Endotracheal Tube Biofilms and Antibiotic Resistance: A Systematic Review. Journal of Hospital Infection. 2024. (https://doi.org/10.1016/j.jhin.2024.03.004) Lee H-W, Koh Y, Kim J, Lee J-C, Lee Y-C, Seol S-Y, et al. Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces. Clinical microbiology and infection. 2008;14(1):49-54. (https://doi.org/10.1111/j.1469-0691.2007.01842.x) Anish C, Abhisek R, Radha M. Evaluation of biofilm production in Acinetobacter baumanii with reference to imipenem resistance. Inter J Sci Res Pub. 2017;7:732-7. Finnegan S, Percival SL. EDTA: an antimicrobial and antibiofilm agent for use in wound care. Advances in wound care. 2015;4(7):415-21. (https://doi.org/10.1089/wound.2014.0577) Sanchez Z, Tani A, Kimbara K. Extensive reduction of cell viability and enhanced matrix production in Pseudomonas aeruginosa PAO1 flow biofilms treated with a D-amino acid mixture. Applied and environmental microbiology. 2013;79(4):1396-9. (https://doi.org/10.1128/AEM.02911-12) Leiman SA, May JM, Lebar MD, Kahne D, Kolter R, Losick R. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis. Journal of bacteriology. 2013;195(23):5391-5. Hochbaum AI, Kolodkin-Gal I, Foulston L, Kolter R, Aizenberg J, Losick R. Inhibitory effects of D-amino acids on Staphylococcus aureus biofilm development. Journal of bacteriology. 2011;193(20):5616-22. (https://doi.org/10.1128/jb.05534-11) Cava F, Lam H, de Pedro MA, Waldor MK. Emerging knowledge of regulatory roles of d-amino acids in bacteria. Cellular and Molecular Life Sciences. 2011;68(5):817. (DOI: 10.1007/s00018-010-0571-8) Ali BH, Blunden G, Tanira MO, Nemmar A. Some phytochemical, pharmacological and toxicological properties of ginger (Zingiber officinale Roscoe): a review of recent research. Food and chemical Toxicology. 2008;46(2):409-20. (https://doi.org/10.1016/j.fct.2007.09.085) Nikolić M, Vasić S, Đurđević J, Stefanović O, Čomić L. Antibacterial and anti-biofilm activity of ginger (Zingiber officinale (Roscoe)) ethanolic extract. Kragujevac Journal of Science. 2014(36):129-36. (https://doi.org/10.5937/KgJSci1436129N) Suwal N, Subba RK, Paudyal P, Khanal DP, Panthi M, Suwal N, Nassan MA, Alqarni M, Batiha GE, Koirala N. Antimicrobial and antibiofilm potential of Curcuma longa Linn. Rhizome extract against biofilm producing Staphylococcus aureus and Pseudomonas aeruginosa isolates. Cellular and Molecular Biology. 2021 Jan 31;67(1):17-23. (doi: 10.14715/cmb/2021.67.1.3) Nidadavolu P, Amor W, Tran PL, Dertien J, Colmer-Hamood JA, Hamood AN. Garlic ointment inhibits biofilm formation by bacterial pathogens from burn wounds. Journal of medical microbiology. 2012;61(5):662-71. (https://doi.org/10.1099/jmm.0.038638-0) Ratthawongjirakul P, Thongkerd V. Fresh garlic extract inhibits Staphylococcus aureus biofilm formation under chemopreventive and chemotherapeutic conditions. Songklanakarin Journal of Science & Technology. 2016;38(4). Subba B, Kandel RC. Chemical composition and bioactivity of essential oil of Ageratina adenophora from Bhaktapur District of Nepal. Journal of Nepal Chemical Society. 2012;30:78-86. Kurade NP, Jaitak V, Kaul VK, Sharma OP. Chemical composition and antibacterial activity of essential oils of Lantana camara, Ageratum houstonianum and Eupatorium adenophorum. Pharmaceutical Biology. 2010;48(5):539-44. (https://doi.org/10.3109/13880200903193336) Pala-Paul J, Perez-Alonso M, Velasco-Negueruela A, Sanz J. Analysis by gas chromatography–mass spectrometry of the volatile components of Ageratina adenophora Spreng., growing in the Canary Islands. Journal of Chromatography A. 2002;947(2):327-31. (https://doi.org/10.1016/S0021-9673(02)00016-X) Rivera MLC, Hassimotto NMA, Bueris V, Sircili MP, de Almeida FA, Pinto UM. Effect of Capsicum frutescens extract, capsaicin, and luteolin on quorum sensing regulated phenotypes. Journal of food science. 2019;84(6):1477-86. (https://doi.org/10.1111/1750-3841.14648) Qais FA, Ahmad I, Altaf M, Alotaibi SH. Biofabrication of Gold Nanoparticles Using Capsicum annuum Extract and Its Antiquorum Sensing and Antibiofilm Activity against Bacterial Pathogens. ACS Omega. 2021. (https://doi.org/10.1021/acsomega.1c02297) El-Sayed HS, Chizzola R, Ramadan AA, Edris AE. Chemical composition and antimicrobial activity of garlic essential oils evaluated in organic solvent, emulsifying, and self-microemulsifying water based delivery systems. Food Chemistry. 2017;221:196-204. (https://doi.org/10.1016/j.foodchem.2016.10.052) Ghasemi E, Ghalavand Z, Goudarzi H, Yeganeh F, Hashemi A, Dabiri H, et al. Phenotypic and Genotypic Investigation of Biofilm Formation in Clinical and Environmental Isolates of Acinetobacter baumannii. 2018. (https://doi.org/10.5812/archcid.12914) Sung JY. Molecular characterization and antimicrobial susceptibility of biofilm-forming Acinetobacter baumannii clinical isolates from Daejeon, Korea. Korean Journal of Clinical Laboratory Science. 2018;50(2):100-9. (https://doi.org/10.15324/kjcls.2018.50.2.100) Yang C-H, Su P-W, Moi S-H, Chuang L-Y. Biofilm formation in Acinetobacter Baumannii: genotype-phenotype correlation. Molecules. 2019;24(10):1849. (https://doi.org/10.3390/molecules24101849) Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4343442","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":299661597,"identity":"6b89f841-5d4e-474c-bfee-2936bc078a2b","order_by":0,"name":"Poonam Yadav","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYHACAwTzA4YIIS2MM0jWwsxDjBaD44c3fuZhuCPHL938dLNNzTZ5BvbmbRKMO+7g1nImrViah+GZseScY2a3c47dNmzgOVYmwXjmGW4tB3IMJGcwHE7ccCPB7HZuw+0EBokcMwnGtsO4tZx/Y/wToiX9221LkBb5NwS03ACa+QGsJcfsNiPYFh78WiRvPCuz+GAA9MuMnLKbPUC/tPGkFVsktuH2C9/55M03EiqAISaRvu3Gj5rb8vzshzfe+NiGO8QUDkACASHCBiISGA5gUQwB8g1gClMBbi2jYBSMglEw4gAAQMRbUszWnaMAAAAASUVORK5CYII=","orcid":"","institution":"Tribhuvan University","correspondingAuthor":true,"prefix":"","firstName":"Poonam","middleName":"","lastName":"Yadav","suffix":""},{"id":299661599,"identity":"f9f1eb65-c1e6-4ffa-916f-5a2aae5e7894","order_by":1,"name":"Sreska Shrestha","email":"","orcid":"","institution":"National Public Health Laboratory, Ministry of Health and Population","correspondingAuthor":false,"prefix":"","firstName":"Sreska","middleName":"","lastName":"Shrestha","suffix":""},{"id":299661601,"identity":"39c1ab13-94ba-483b-ac58-3ed10078f510","order_by":2,"name":"Deepak Basyal","email":"","orcid":"","institution":"Tribhuvan University","correspondingAuthor":false,"prefix":"","firstName":"Deepak","middleName":"","lastName":"Basyal","suffix":""},{"id":299661603,"identity":"31156a02-48c1-4694-99a5-120aa6b76f03","order_by":3,"name":"Ananda Tiwari","email":"","orcid":"","institution":"Finnish Institute for Health and Welfare","correspondingAuthor":false,"prefix":"","firstName":"Ananda","middleName":"","lastName":"Tiwari","suffix":""},{"id":299661606,"identity":"19559851-7711-49c3-ac8d-33a338c772f0","order_by":4,"name":"Ranjit Sah","email":"","orcid":"","institution":"Tribhuvan University Teaching Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ranjit","middleName":"","lastName":"Sah","suffix":""},{"id":299661609,"identity":"7fc244fb-767e-4ef1-82be-703b830370fc","order_by":5,"name":"Anil Shah","email":"","orcid":"","institution":"Annapurna Neurological Institute and Allied Sciences","correspondingAuthor":false,"prefix":"","firstName":"Anil","middleName":"","lastName":"Shah","suffix":""},{"id":299661612,"identity":"b0bc3e83-eb5b-4686-91ae-ab54e2de5263","order_by":6,"name":"Bishal Yadav","email":"","orcid":"","institution":"Tribhuvan University","correspondingAuthor":false,"prefix":"","firstName":"Bishal","middleName":"","lastName":"Yadav","suffix":""},{"id":299661614,"identity":"224d2968-2e8b-40d6-9e8e-2788faab3383","order_by":7,"name":"Mark Willcox","email":"","orcid":"","institution":"University of New South Wales","correspondingAuthor":false,"prefix":"","firstName":"Mark","middleName":"","lastName":"Willcox","suffix":""},{"id":299661616,"identity":"cf953017-a386-46c9-84de-56a7537cf8ca","order_by":8,"name":"Shyam Kumar Mishra","email":"","orcid":"","institution":"Tribhuvan University Teaching Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shyam","middleName":"Kumar","lastName":"Mishra","suffix":""}],"badges":[],"createdAt":"2024-04-29 14:12:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4343442/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4343442/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56375073,"identity":"fa156fbd-e5b7-4b74-887e-789734c7cd22","added_by":"auto","created_at":"2024-05-13 11:02:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":154637,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eA. baumannii\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e colonies showing Swarming motility or being non-motile on 0.4% agar plates.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4343442/v1/ab4c7f7186785ab252c196ba.png"},{"id":56375080,"identity":"d3ddb27c-602c-4fdb-8064-a1ca88ffbbcd","added_by":"auto","created_at":"2024-05-13 11:02:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":111982,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eA. baumannii\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e showing twitching motility or being non-motile.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4343442/v1/cfca4924cfd90bcfaa139a62.png"},{"id":56375075,"identity":"d65463fe-aaa9-476a-a056-69e49a42b403","added_by":"auto","created_at":"2024-05-13 11:02:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":90579,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExamples of PCR products of the four biofilm-related genes in strains of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. baumannii\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. L = DNA ladder, NC= negative control, PC = positive control, numbers refer to different isolates of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. baumannii\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4343442/v1/8ce5aa7e5fac306691974076.png"},{"id":56375074,"identity":"c3b89086-3ea7-4d24-89a4-701c9b634d0c","added_by":"auto","created_at":"2024-05-13 11:02:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":56093,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBiofilm inhibition percentage of MDR \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. baumannii \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eisolates by different compounds\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4343442/v1/a6f6e19958f1a2698055638b.png"},{"id":57670234,"identity":"88c3d64c-e6f2-4d94-8eb2-695931300e9a","added_by":"auto","created_at":"2024-06-04 06:16:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1721552,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4343442/v1/d3b4d7d9-aad0-440f-9db1-763818f14a7b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Characterization of Multidrug-Resistant Acinetobacter baumannii isolates and inhibition of biofilm","fulltext":[{"header":"Background","content":"\u003cp\u003eThe World Health Organization has categorized carbapenem-resistant \u003cem\u003eAcinetobacter baumannii\u003c/em\u003e as the foremost critical priority pathogen, urgently requiring new therapeutics (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). \u003cem\u003eA. baumannii\u003c/em\u003e is often associated with device-associated infections, e.g., ventilator-associated pneumonia (VAP), central-line associated bloodstream infection (CLABSI), catheter-associated urinary tract infection (CAUTI), as well as traumatic wound injury (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Crude mortality rates associated with multi-drug resistant (MDR) \u003cem\u003eA. baumannii\u003c/em\u003e range from 26\u0026ndash;68% (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Apart from acquiring antibiotic resistance, \u003cem\u003eA. baumannii\u003c/em\u003e can develop antibiotic tolerance through biofilm formation which is mediated by autoinducers called acyl homoserine lactones (AHLs). These AHLs are also involved in the induction of virulence factors and antibiotic resistance \u003cem\u003evia\u003c/em\u003e plasmid transfer (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Biofilm-encased cells can persist on hospital surfaces, posing a risk of outbreaks and device-associated MDR infections among susceptible patients (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeveral factors contribute to biofilm formation. Bacterial motility helps cells spread across surfaces and from specific infection sites (\u003cspan additionalcitationids=\"CR7 CR8 CR9\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Proteins involved in biofilm formation include outer membrane protein A (OmpA), biofilm-associated protein (Bap), a beta-lactamase PER-1, and the CsuA/BABCDE chaperone-usher pili assembly system (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePlant extracts from leaves, stems, and roots are rich in a wide variety of secondary metabolites such as tannins, alkaloids, phenolic compounds, and flavonoids, known for their in vitro anti-biofilm properties (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). The anti-biofilm effects of natural products include suppression of cell adhesion and attachment, the inhibition of formation of the polymer matrix that encases cells, and decreasing virulence factor production (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Cinnamaldehyde, for instance, can reduce quorum sensing, inhibiting polymer matrix formation around cells (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Additionally, non-antibiotic agents such as ethylenediaminetetraacetic acid (EDTA) and Tween 80 can increase the permeability of the outer membrane of Gram-negative bacteria, and may destabilize their biofilms (\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThis study aimed to assess the biofilm-forming ability of MDR \u003cem\u003eA. baumannii\u003c/em\u003e, to identify biofilm-related genes and to test whether plant extracts from the local surroundings could inhibit biofilm formation.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e \u003cb\u003eStudy design, setting, isolation and identification of\u003c/b\u003e \u003cb\u003eA. baumannii\u003c/b\u003e\u003c/p\u003e \u003cp\u003e This hospital-based cross-sectional study was conducted in the Department of Microbiology, among the inpatients of Tribhuvan University Teaching Hospital (TUTH), Kathmandu, a tertiary care referral center with 750 beds, from March to December 2021. Different clinical specimens (blood, urine, pus, cerebrospinal fluid, endotracheal tube, tracheal aspirate, fluids, lesion swab, genital swab, catheter tips, and sputum) were processed according to the American Society for Microbiology (ASM) guidelines (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). The specimens were inoculated onto suitable culture media (5% Human blood agar, MacConkey agar, Chocolate agar, Brain Heart Infusion (BHI); HiMedia, Laboratories Pvt. Ltd India) according to their specific requirements. Identification of isolates was performed following standard microbiological techniques. The purity of the culture inoculum was ensured by employing a purity plate in conjunction with biochemical tests.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial susceptibility testing\u003c/h2\u003e \u003cp\u003eAfter identifying \u003cem\u003eA. baumannii\u003c/em\u003e isolates, their susceptibility to different antibiotics was determined by the Kirby\u0026ndash;Bauer disk diffusion method on Mueller-Hinton agar, following standard procedures recommended by the Clinical and Laboratory Standards Institute (CLSI), USA (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). The CLSI-recommended battery of antibiotics (HiMedia, Laboratories Pvt. Ltd, India) was used. The control strains included \u003cem\u003eEscherichia coli\u003c/em\u003e ATCC 25922 and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e ATCC 27853, with known susceptibilities. Isolates resistant to at least one antibiotic from three different groups of first line drugs tested were regarded as multidrug-resistant (MDR). Extensively drug resistance (XDR) was defined as resistant to at least one agent in all antimicrobial categories (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMotility detection\u003c/h2\u003e \u003cp\u003eLuria-Bertani (LB) broth containing 0.4% or 0.8% agar was used for motility assays (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). For swarming motility, bacteria from overnight grown colonies were stabbed on the surface of the 0.4% semisolid medium using a sterile wooden stick to enable spread of bacteria. For twitching motility, colonies were stabbed at interphase between the bottom of the Petri dish and medium (0.8% semisolid). The agar plates were then incubated at 37\u0026deg;C for 48 hours. For each isolate, assays were performed at least three times.\u003c/p\u003e \u003cp\u003eSwarming motility was considered positive (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003e) if isolates showed a zone of \u0026gt;\u0026thinsp;10 mm around the site of inoculation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFor twitching motility, after incubation the agar bacteria were visualized by staining with 0.2% crystal violet. Bacteria (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e) were classified as non-motile (\u0026lt;\u0026thinsp;5 mm spread from inoculation site), or with intermediate (5\u0026ndash;20 mm spread from inoculation site) or high twitching motility (\u0026gt;\u0026thinsp;20 mm spread).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eBiofilm Formation assay\u003c/h2\u003e \u003cp\u003eBiofilm formation was detected as previously described (25). Briefly, 200\u0026micro;L of a 1/100 times dilution (in BHI broth with 1% glucose) of 0.5 McFarland adjusted bacterial suspension was placed into wells of polystyrene microtiter plates and incubated in static conditions for 24 hours at 37\u0026deg;C. Negative controls were wells containing sterile BHI broth only. The test was run in triplicate. After incubation, the microtiter plates were vigorously washed in physiological saline three times to remove planktonic and loosely adhered cells. The remaining adherent bacteria were fixed with 200 \u0026micro;L of 99% (v/v) methanol for 15 minutes then left to dry. Plates were stained with a 2% Hucker\u0026rsquo;s crystal violet for 5 minutes and rinsed with tap water. After complete drying, 200 \u0026micro;L of 33% glacial acetic acid was added to dissolve the crystal violet and the OD of the resulting solution was measured at 550 nm using an automated ELISA reader. The cut-off optical density (ODc) was defined as three standard deviations above the mean OD of the negative control (culture medium). Strains were classified as non-biofilm producers (OD\u0026thinsp;\u0026le;\u0026thinsp;Odc), weak biofilm producers (Odc\u0026thinsp;\u0026lt;\u0026thinsp;OD\u0026thinsp;\u0026le;\u0026thinsp;2 \u0026times; Odc), moderate biofilm producers (2 \u0026times; Odc\u0026thinsp;\u0026lt;\u0026thinsp;OD\u0026thinsp;\u0026le;\u0026thinsp;4 \u0026times; Odc) or strong biofilm producers (4 \u0026times; Odc\u0026thinsp;\u0026lt;\u0026thinsp;OD).\u003c/p\u003e \u003cp\u003e \u003cb\u003eDetection of gene(s) involved in biofilm formation of MDR\u003c/b\u003e \u003cb\u003eA. baumannii\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThese tests were performed at the molecular laboratory of Annapurna Research Centre, Kathmandu, Nepal. Three to four isolated colonies of biofilm producing MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates were inoculated in 3 mL of Trypticase Soy Broth. After overnight incubation at 37⁰C, genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) method (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe presence of the biofilm related genes \u003cem\u003ebap\u003c/em\u003e (biofilm-associated protein), \u003cem\u003eompA\u003c/em\u003e (outer membrane protein A), \u003cem\u003ecsuE\u003c/em\u003e (chaperone-usher pili assembly system), and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER\u0026minus;1\u003c/sub\u003e (beta-lactamase PER-1) was assessed using PCR (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). The primers sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The PCR was performed by using DreamTaq PCR Master Mix (Thermo Fisher Scientific), which contains Taq polymerase, dNTPs, MgCl\u003csub\u003e2\u003c/sub\u003e and the appropriate buffer. Each PCR tube contained 15 \u0026micro;L reaction mixture composed of 10.4 \u0026micro;L of master mix, 0.6 \u0026micro;l of each forward and reverse primer solution (Macrogen, South Korea), 4 \u0026micro;L of extracted DNA template. The PCR was conducted in a ProFlex PCR system and performed according to the following conditions: initial denaturation at 94\u0026deg;C for 5 min, then, 30 cycles of denaturation (94\u0026deg;C, 1 min), annealing (the annealing temperatures for each gene are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) for 1 min, extension at 72\u0026deg;C for 1 min, followed by a final extension at 72\u0026deg;C for 5 min. PCR products were analyzed by electrophoresis in 1% agarose gel containing 2 \u0026micro;l ethidium bromide. DNA bands were observed under UV transilluminator (UVITEC Cambridge) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Previously isolated in-house strains of \u003cem\u003eA. baumannii\u003c/em\u003e known to contain the respective genes were used as positive controls, and PCR buffer with no extracted DNA was used as the negative control.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers sequences and annealing temperature for the detection of biofilm-related genes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTargeted genes (Primers)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAnnealing Temperature(\u0026deg;c)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDNA amplicon Size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ecsuE\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFW\u0026thinsp;=\u0026thinsp;CATCTTCTATTTCGGTCCC\u003c/p\u003e \u003cp\u003eRV\u0026thinsp;=\u0026thinsp;CGGTCTGAGCATTGGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e59\u003cb\u003e\u0026deg;\u003c/b\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e184\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eompA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFW\u0026thinsp;=\u0026thinsp;GTTAAAGGCGACGTAGACG\u003c/p\u003e \u003cp\u003eRV\u0026thinsp;=\u0026thinsp;CCAGTGTTATCTGTGTGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e49\u003cb\u003e\u0026deg;\u003c/b\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e578\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ebap\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFW\u0026thinsp;=\u0026thinsp;TGCTGACAGTGACGTAGAACCACA RV\u0026thinsp;=\u0026thinsp;TGCAACTAGTGGAATAGCAGCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e49\u003cb\u003e\u0026deg;\u003c/b\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e168\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ebla\u003c/b\u003e\u003csub\u003e\u003cb\u003ePER\u0026minus;1\u003c/b\u003e\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFW\u0026thinsp;=\u0026thinsp;GCAACTGCTGCAATACTCGG\u003c/p\u003e \u003cp\u003eRV\u0026thinsp;=\u0026thinsp;ATGTGCGACCACAGTACCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e55\u003cb\u003e\u0026deg;\u003c/b\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e340\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eBiofilm inhibition assays\u003c/h2\u003e \u003cp\u003eSeveral experiments were conducted in which different natural and chemical agents were used to examine their ability to inhibit biofilm formation. Ethylenediaminetetraacetic acid (EDTA) (125 mg /L), cinnamaldehyde (0.875 mg/ml), glycine (100 mM), glutamic acid (100mM) and Tween 80 were purchased from HiMedia, India.\u003c/p\u003e \u003cp\u003eThe rhizomes of turmeric and ginger, bulbs of garlic and onion, and chilli peppers were purchased from the local market of Kathmandu, Nepal and the leaves of \u003cem\u003eAgeratina adenophora\u003c/em\u003e (identified as \u003cem\u003eAgeratina denophora\u003c/em\u003e in the Department of Pharmacy, Institute of Medicine using standard techniques (27, 28) were collected from the garden of TUTH. Before extraction, plants were washed with clean tap water.\u003c/p\u003e \u003cp\u003eThe extraction of essential oils (EOs) from turmeric, ginger, garlic and \u003cem\u003eAgeratina adenophora\u003c/em\u003e used a Clevenger apparatus. Fifty grams of each of the rhizomes of turmeric, ginger, the bulb of garlic and leaves of \u003cem\u003eAgeratina adenophora\u003c/em\u003e were ground and heated in a one- liter round-bottom flask containing 500 ml water for 45 minutes in a Clevenger apparatus using steam distillation. Subsequently, the EO was separated from the water phase using a separatory funnel and the resulting oils were kept in Eppendorf tubes wrapped with aluminum foil and stored at 4 \u0026ordm;C prior to further analysis (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e29\u003c/span\u003e). The extraction of onion and chilli peppers was performed using the reflux condensation extraction method. Fifty grams each of onion and chilli pepper were ground, then added to a one litre capacity round-bottom flask containing 200 ml of aqueous ethanol, and refluxed for 2.5 hours (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e30\u003c/span\u003e). Any remaining ethanol was evaporated in a water bath and the remaining extracted residues were kept in an airtight container at 4 \u0026ordm;C until use. Tween 80 (0.1%) and dimethyl sulfoxide (DMSO) (5%) were used as solvents for the preparation of stock solutions of these different plant extracts. The stock solutions were further diluted to make 200 mg/L which was used as the working solution for biofilm inhibition method.\u003c/p\u003e \u003cp\u003eThe chemical constituents in the EOs of turmeric, ginger, garlic and \u003cem\u003eAgeratina adenophora\u003c/em\u003e were analyzed by gas chromatography-mass spectrometry (GC-MS). The GC-MS analysis was performed on a Shimadzu GC-MS-QP2010 Plus available at the Instrument Section of the Department of Plant Resources, Kathmandu. The capillary column used for the analysis was RTX-5MS (60 m \u0026times; 0.32 mm \u0026times; 0.25 \u0026micro;m) with a crossbond of 5% diphenyl/95% dimethyl polysiloxane as the stationary phase. The GC analysis was performed under the following conditions: column oven temperature, 50\u0026ordm;C; injection temperature, 250\u0026ordm;C; ion source temperature, 250\u0026ordm;C; interface temperature, 200\u0026ordm;C; split injection mode with a split ratio of 80; helium with a pressure of 53.8 kPa; total gas flow, 112.3 mL/min; column flow, 1.35 mL/min. The GC-MS system started with an initial oven temperature of 50\u0026ordm;C for 1 min, then this was increased to 230\u0026ordm;C at a rate of 3\u0026ordm;C per 9 mins. Mass spectral detection was carried out in electron ionization mode by scanning at 40 to 350 m/z. The total time required for analyzing a single sample was 60 min. The chemical components of the EOs were identified by comparing their mass spectral fragmentation patterns with those in the National Institute of Standard Technology Library (NIST) 2017 and Flavor and Fragrance Natural and Synthetic Compounds (FFNSC) 4.0 library, and also by comparing the retention times of the components with those of the reference compounds. The percentage of each component (Area %) was reported as raw percentages based on the total ion chromatogram (TIC) without standardization.\u003c/p\u003e \u003cp\u003eAfter extraction of EOs and collection of the other samples, the biofilm inhibition assay was performed on strong biofilm producing MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates. The bacterial inocula were prepared as described for biofilm formation assay (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). A total of 100 \u0026micro;L of bacterial growth were added to wells of polystyrene, U-bottom 96-well microplates (TARSONS, Catalog No. 941296) and incubated for one hour at 37\u0026deg;C to allow cell adhesion. After incubation, 100 \u0026micro;L of each plant extract or the chemical compounds were added at their previously prepared concentrations to the wells. The growth control wells contained standardized amounts of bacteria in BHI (100 \u0026micro;L) plus an additional aliquot of sterile BHI (100 \u0026micro;L) to bring the final volume to 200 \u0026micro;L without any antibiofilm agent. Each isolate was tested in duplicate and incubated at a temperature of 37⁰C for 24 hours. After incubation, biofilm staining and quantification procedure was performed as previously described (\u003cspan additionalcitationids=\"CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e33\u003c/span\u003e). The anti-biofilm activity was calculated as the percentage of reduction ([(OD growth control \u0026ndash; OD experimental sample)/OD growth control] \u0026times; 100%) (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e32\u003c/span\u003e) The final results were reported as the mean value of percentage inhibition of each corresponding anti-biofilm agents using against MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data was finally entered in MS Excel 10 version as well as recorded manually. The data were analyzed using SPSS 20 (Armonk, NY:IBM Corp.). Chi-square test was applied to test the significance of the relation between categorical values; \u003cem\u003eP\u003c/em\u003e value ˂ 0.05 was considered statistically significant. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e was made with OriginPro (OriginLab Corporation 2017).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCharacteristics of isolates\u003c/h2\u003e \u003cp\u003eOf a total of 18,343 specimens, 4,249 (23.1%) showed bacterial growth among which 200 (4.7%) were \u003cem\u003eA. baumannii\u003c/em\u003e. Out of the 200 \u003cem\u003eA. baumannii\u003c/em\u003e isolates, 195 (97.5%) were classified as being MDR. Among the total of 195 MDR \u003cem\u003eA. baumannii\u003c/em\u003e, 84.6% were isolated from clinical specimens (non-medical devices) whereas 15.4% were recovered from medical devices (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Almost all (98.5%) of the MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates were biofilm producers. The majority of biofilm producers were recovered from general intensive care unit (ICU) (n\u0026thinsp;=\u0026thinsp;65) followed by COVID ICU (n\u0026thinsp;=\u0026thinsp;18), medical ICU (n\u0026thinsp;=\u0026thinsp;12).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDistribution of MDR \u003cem\u003eA. baumannii\u003c/em\u003e growth in different clinical specimens\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource of specimens\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFrequency\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e%\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNon-medical devices\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e164\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e84.1\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBlood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBody fluid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUrine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBronchoalveolar lavage (BAL)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMedical devices\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e30\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e15.9\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEndotracheal aspirate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCentral venous line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUrinary catheter\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCSF shunt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e195\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e100\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDistribution of biofilm producing capacity and motility of MDR\u003c/b\u003e \u003cb\u003eA. baumannii\u003c/b\u003e \u003cb\u003eisolated from medical devices and non- medical devices specimens\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, among the 195 MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates, 192 (98.5%) could produce biofilms, with 83% (162 isolates) identified as strong biofilm producers. Regardless of the source of isolation (tissue or medical devices), most isolates (n\u0026thinsp;=\u0026thinsp;113, 57%) did not produce twitching motility, whereas the majority (n\u0026thinsp;=\u0026thinsp;129, 69%) demonstrated swarming motility (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Similarly, irrespective of their resistance to any particular antibiotic, twitching motility was not seen in the majority of the isolates whereas swarming motility was observed most often (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBiofilm production and motility of MDR \u003cem\u003eA. baumannii\u003c/em\u003e from medical and non- medical device-associated infections.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"10\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSource of isolate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eBiofilm production\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003eTwitching motility\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e \u003cp\u003eSwarming motility\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e \u003cp\u003en (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWeak\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMod-erate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eStrong\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eInter-mediate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c10\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTissues (n\u0026thinsp;=\u0026thinsp;165)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e132 (80)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e93 (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e56\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e66\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e40\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e6\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e57\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e35\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e108\u003c/p\u003e \u003cp\u003e(65)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMedical devices (n\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e(0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e(0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e(0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30 (100)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e20 (67)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8\u003c/p\u003e \u003cp\u003e(27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e2\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e9\u003c/p\u003e \u003cp\u003e(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e30\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e21\u003c/p\u003e \u003cp\u003e(70)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u0026thinsp;=\u0026thinsp;195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c9\"\u003e \u003cp\u003e66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c10\"\u003e \u003cp\u003e129\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMotility pattern of MDR \u003cem\u003eA. baumannii\u003c/em\u003e showing resistance to different antibiotics\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c7\" namest=\"c3\"\u003e \u003cp\u003e% of resistant isolates\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cb\u003eAntibiotics\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNumber of MDR isolates showing resistance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eTwitching motility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eSwarming motility\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIntermediate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCotrimoxazole\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e187\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGentamicin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e190\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e57.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmikacin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e184\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e56.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e65.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCiprofloxacin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e193\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e37.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e65.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLevofloxacin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e181\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e56.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e65.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCeftazidime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMeropenem\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eImipenem\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCefepime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePiperacillin-tazobactam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCefoperazone-sulbactam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e138\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e45.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e34.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmpicillin-sulbactam\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e165\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e57.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e40.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e35.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e64.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDoxycycline\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e33.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e66.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDistribution of biofilm formation in MDR\u003c/b\u003e \u003cb\u003eA. baumannii\u003c/b\u003e \u003cb\u003ewith respect to twitching and surface-associated motility\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSwarming motility was primarily seen in strong biofilm producers (119/162), whereas the majority (100/162) did not exhibit twitching motility (100/162) as shown in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDistribution of biofilm formation with motility in MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBiofilm types\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eTwitching motility\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eSwarming motility\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIntermediate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNegative\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePositive\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNon-producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWeak producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eModerate producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrong producer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e119\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGenes involved in biofilm formation in MDR\u003c/b\u003e \u003cb\u003eA. baumannii\u003c/b\u003e \u003cb\u003eisolates from medical devices\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThirty \u003cem\u003eA. baumannii\u003c/em\u003e isolates from medical devices, all showing strong biofilm production, possessed at least one biofilm-associated gene. Among these, the prevalence decreased in the following order: \u003cem\u003ecsuE\u003c/em\u003e (90.0%), \u003cem\u003eompA\u003c/em\u003e (53.3%), \u003cem\u003ebap\u003c/em\u003e (46.6%) and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER\u0026minus;1\u003c/sub\u003e (26.6%). Notably, the MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates from endotracheal tubes showed the highest number of biofilm-related genes (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDistribution of biofilm related genes among 30 MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates from medical devices\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMedical devices\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecsuE\u003c/em\u003e gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eompA\u003c/em\u003e gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ebap\u003c/em\u003e gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER-1\u003c/sub\u003e gene\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEndotracheal aspirate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e15 (50.0%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (20.0%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6 (20.0%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3 (10.0%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCentral venous line\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7 (23.3%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (20.0%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (16.6%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4 (13.3%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eUrinary catheter\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e5 (16.6%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e3 (10.0%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e3 (10.0%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e1 (3.3%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCSF shunt\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e0.0%\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e1 (3.3%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e0.0%\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e0.0%\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDistribution of biofilm-related genes among antibiotic resistant\u003c/b\u003e \u003cb\u003eA. baumannii\u003c/b\u003e \u003cb\u003eisolates\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe majority of antibiotic resistant isolates carried several biofilm related genes (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDistribution of biofilm-related genes among \u003cem\u003eA. baumannii\u003c/em\u003e isolates resistant to different antibiotics (n\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibiotics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecsuE\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;27)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eompA\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;16)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003ebap\u003c/em\u003e (n\u0026thinsp;=\u0026thinsp;14)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER-1\u003c/sub\u003e (n\u0026thinsp;=\u0026thinsp;8)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCotrimoxazole\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGentamicin\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAmikacin\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCiprofloxacin\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLevofloxacin\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCeftazidime\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCefepime\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePiperacillin-tazobactam\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMeropenem\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eImipenem\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDoxycycline\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCefoperazone-sulbactam\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e24\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAmpicillin-sulbactam\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e25\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003ePhytochemical constituents of the Essential Oils of plant extract\u003c/h2\u003e \u003cp\u003eThe major compounds identified in EO of ginger were β-curcumene (14.9%), β-sesquiphellandrene (10.3%), geranial (9.0%), camphene (6.8%), neral (5.7%). allitridin (35.8%), trisulfide allyl methyl (18.6%), allyl disulfide (16.3%) and disulfide methyl allyl (4.4%) were major constituents found in EO of garlic. Similarly, the major compounds identified by GC-MS in EO of turmeric were Z-γ-atlantone (29.0%), ar-tumerone (19.9%), E-γ-atlantone (18.0%), Likewise, α-muurolol (12.0%), α-bisabolol (8.3%), cyperotundone (6.4%), bornyl acetate (5.8%) and \u003cem\u003ep\u003c/em\u003e-cymene (4.8%) were main constituents found in EO of \u003cem\u003eAgeratina adenophora.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBiofilm inhibition by different compounds\u003c/h2\u003e \u003cp\u003eBiofilm inhibition assay was performed on strong biofilm-producing MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates (n\u0026thinsp;=\u0026thinsp;162). Cinnamaldehyde (0.875 mg/mL) and EDTA (125 mg/L) inhibited the biofilm biomass by 77.3% and 54.8% respectively. Different concentrations of Tween 80 (0.01%, 0.1% and 0.5%) showed concentration dependent inhibition of biofilm. The concentration of EOs (200 mg/L) of ginger, garlic, turmeric, \u003cem\u003eAgeratina adenophora\u003c/em\u003e prevented biofilm formation by 70.8%, 68.6%, 51.9% and 67.6% respectively. Ethanolic extract of onion (200 mg/L) prevented biofilm formation by 77.2% which was more as compared to that by ethanolic extract of chili pepper (68.1%). Glutamic acid and glycine inhibited biofilm by 66.6% and 33.7% respectively. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study reveals a high prevalence of MDR and XDR clinical isolates of \u003cem\u003eA. baumannii\u003c/em\u003e at the study site over the last decade (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e35\u003c/span\u003e). The high rates of MDR \u003cem\u003eA. baumannii\u003c/em\u003e observed may be attributed to factors such as emergence of bacteria with different resistance mechanisms, increased likelihood of resistance dissemination in hospital environments, absence of a robust nosocomial infection surveillance system, and suboptimal infection control practices (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the present study, biofilm production was observed in nearly all isolates of MDR \u003cem\u003eA. baumannii\u003c/em\u003e, with 83.1% exhibiting strong biofilm production. This finding aligns with a study conducted in a tertiary care hospital in Nepal, where 99.6% of \u003cem\u003eAcinetobacter\u003c/em\u003e isolates were identified as biofilm producers, and 89% of them were characterized as strong biofilm producers (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Strong biofilm producers are significantly associated with recurrent infections and antimicrobial resistance (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e39\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur study revealed that among the 195 MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates, twitching motility was observed in 42.0%, while surface-associated motility was observed in 66.2%. These findings are consistent with another study where 50.0% of isolates exhibited twitching motility, and 62.5% displayed surface-associated motility phenotypes (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Approximately 4.1% and 61.0% of MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates exhibited strong twitching motility and surface-associated motility, respectively, along with a robust capacity for strong biofilm production. Notably, this study marks the first from Nepal to establish a correlation between biofilm formation and the motility traits of MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates. Our findings also revealed a significant difference in resistance to ampicillin-sulbactam and cefoperazone-sulbactam, specifically in relation to twitching motility among the isolates. Twitching motility was more commonly seen among the isolates from sputum (data not shown). We speculate that the greater degree of motility observed in sputum isolates may be attributed to the overexpression of type IV pili-related genes compared to isolates from other specimens. Motility, as a trait, relies on the presence of type IV pili, and it has been demonstrated in other bacteria that biofilm-forming cells often downregulate genes associated with motility (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e41\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDue to the escalating resistance of \u003cem\u003eA. baumannii\u003c/em\u003e to various antibiotics, often attributed to biofilm formation, there is an urgent need to identify therapeutic strategies aimed at inhibiting biofilm formation and effectively treating established biofilms (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e43\u003c/span\u003e). In our study, treatment with EDTA (125 mg/L) resulted in a notable 54.8% inhibition in biofilm formation, consistent with findings in other studies (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e45\u003c/span\u003e). The ability of EDTA to chelate and potentiate bacterial cell walls, along with its capacity to destabilize biofilms by sequestering calcium, magnesium, zinc, and iron, positions it as a suitable agent for biofilm inhibition (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Similarly, cinnamaldehyde demonstrated a promising inhibition of 77.3% in average biofilm formation, surpassing the findings by Mohamed et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). In our study, Tween 80 exhibited a concentration-dependent reduction in biofilm formation, ranging from 61.8\u0026ndash;76.8% as concentrations increased. Moreover, at a concentration of 100 mM, glutamic acid and glycine showed average reductions of 66.6% and 33.7%, respectively in biofilm formation. A study from Iraq also reported significant anti-biofilm activity of these compounds.(\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) Additionally, inhibitory effects observed against \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, and \u003cem\u003eBacillus subtilis\u003c/em\u003e suggest that D-amino acids may serve as a general strategy for inhibiting biofilm formation in opportunistic pathogens (\u003cspan additionalcitationids=\"CR48\" citationid=\"CR46\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e49\u003c/span\u003e). D-amino acids play a role in regulating bacterial cell wall remodeling during the stationary phase, contributing to biofilm dispersal in aging bacterial communities (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e50\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe use of anti-biofilm agents, capable of either inhibiting or eliminating biofilm without inducing resistance, is essential for a potential therapeutic approach to managing MDR biofilm-associated infections. As our study primarily focused on identifying alternative technologies for controlling \u003cem\u003eA. baumannii\u003c/em\u003e biofilms, we turned to EOs derived from edible plants, which have been consumed by humanity since ancient times and are known for their diverse benefits. In our investigation, we employed EOs from ginger, garlic, turmeric, and \u003cem\u003eAgeratina adenophora\u003c/em\u003e, along with ethanolic extracts of onion and chili, as anti-biofilm agents. Notably, to our knowledge, this study represents the first exploration in Nepal of bacterial biofilm inhibition using natural plant extracts.\u003c/p\u003e \u003cp\u003eThe Gas Chromatography-Mass Spectrometry (GC-MS) analysis of the ginger EO revealed the presence of phenolic compounds (geraniol, citronellol), volatile sesquiterpenes (bisabolene), and monoterpenoids (curcumene, β-sesquiphellandrene), aligning with another study (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e51\u003c/span\u003e). In our study, the EO of ginger demonstrated an average 70.8% reduction in biofilm in \u003cem\u003eA. baumannii\u003c/em\u003e isolates which is comparable to another study (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e52\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe EO of turmeric was found to contain secondary metabolites such as zingiberene, tumerone, ar-tumerone, curlone, and the phenolic compound curcumin, which is recognized as the most essential bioactive component among curcuminoids. Tumerone, in particular, exhibited anti-biofilm properties against bacterial isolates. Our study demonstrated an average 51.9% reduction in \u003cem\u003eA. baumannii\u003c/em\u003e biofilm. Similarly, Ahamad et al. showed a reduction of \u003cem\u003eA. baumannii\u003c/em\u003e biofilm from 2.0170\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14863 (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD) to 0.2470\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11314 by 200 mg/L turmeric extract. Additionally, Suwal et al. assessed the anti-biofilm activity of \u003cem\u003eCurcuma longa\u003c/em\u003e (turmeric) rhizome extracts against, reporting inhibition ranging from 26.7\u0026ndash;77.7% for \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e53\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe EO of garlic revealed major compounds such as allyl disulfide and allitridine, known for their biofilm inhibiting properties. In our study, we observed a substantial 68.6% inhibition of biofilm in \u003cem\u003eA. baumannii\u003c/em\u003e at a concentration of 200 mg/L, aligning with findings by Somrani et al., who reported a 68.0% inhibition of biofilm when garlic EO was exposed to bacteria for one hour at its Minimum Inhibitory Concentration (MIC) (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Garlic has also been recommended in different studies as an agent to prevent wound pathogen biofilm formation when formulated as garlic ointment (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e54\u003c/span\u003e). Additionally, it can be applied on catheters to prevent catheter-associated biofilm infections (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e55\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, the GCMS analysis of the EO of \u003cem\u003eAgeratina adenophora\u003c/em\u003e identified major chemical constituents such as α-phellandrene, camphene, bornyl acetate, p-cymene, γ-curcumene, germacrene, and α-bisabolol, consistent with previous reports (\u003cspan additionalcitationids=\"CR57\" citationid=\"CR55\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e58\u003c/span\u003e) These compounds have demonstrated antibacterial activity against both Gram-positive and Gram-negative bacteria (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e56\u003c/span\u003e). In our study, 200 mg/L of \u003cem\u003eAgeratina adenophora\u003c/em\u003e inhibited 67.6% of biofilm formation in \u003cem\u003eA. baumannii\u003c/em\u003e. Chili pepper, another focus of our study, contained secondary metabolites such as dihydrocapsaicin and luteolin, which exhibit antimicrobial and anti-quorum sensing activities against bacterial pathogens (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e60\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAnother compound investigated in our study was the ethanolic extract of onion, which exhibited a notable 77.2% inhibition against \u003cem\u003eA. baumannii\u003c/em\u003e biofilm. This efficacy aligns with findings demonstrating its effectiveness against \u003cem\u003eListeria monocytogenes\u003c/em\u003e biofilms as well (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e32\u003c/span\u003e). The anti-biofilm property of onion is attributed to its sulfur compounds. These compounds interact with the sulfhydryl (SH) groups of cellular proteins, forming mixed disulfides that have the potential to inflict damage upon microbial cells (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e61\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNumerous studies have elucidated the role of biofilm-related genes (\u003cem\u003ecsuE, ompA, bap\u003c/em\u003e, and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER\u0026minus;1\u003c/sub\u003e) in \u003cem\u003eA. baumannii\u003c/em\u003e in biofilm development and antibiotic resistance (\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e62\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e63\u003c/span\u003e). In our study, these genes were identified in 30 strong biofilm-producing isolates of MDR \u003cem\u003eA. baumannii\u003c/em\u003e obtained from medical devices. The results revealed the most prevalent gene was \u003cem\u003ecsuE\u003c/em\u003e (89.9%), followed by \u003cem\u003eompA\u003c/em\u003e (53.3%), \u003cem\u003ebap\u003c/em\u003e (46.7%), and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER\u0026minus;1\u003c/sub\u003e (26.6%). Similar result was reported by Thummeepak et al., who showed a prevalence of 48% and 30.2% for \u003cem\u003ebap\u003c/em\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER\u0026minus;1\u003c/sub\u003e genes, respectively (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e39\u003c/span\u003e). The highest frequency of biofilm-related genes was observed in isolates from endotracheal aspirate samples. The \u003cem\u003ecsuE\u003c/em\u003e gene, a member of the usher-chaperone assembly system, plays a crucial role in mediating attachment and biofilm formation. The high prevalence of \u003cem\u003ecsuE\u003c/em\u003e in \u003cem\u003eA. baumannii\u003c/em\u003e is consistent with findings from other studies (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan additionalcitationids=\"CR63\" citationid=\"CR61\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e64\u003c/span\u003e). \u003cem\u003eOmpA\u003c/em\u003e, another biofilm-related gene in \u003cem\u003eA. baumannii\u003c/em\u003e, is likely essential for attachment to human epithelial cells, biofilm development, and antimicrobial resistance.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eCinnamaldehyde, Tween 80, ethanolic extract of onion and essential oil of ginger showed good antibiofilm activity. \u003cem\u003eCsuE, ompA, bap\u003c/em\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER\u0026minus;1\u003c/sub\u003e genes were associated for biofilm formation in MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates from medical devices. Further research is warranted to elucidate the mechanism of action of anti-biofilm activities of these natural and chemical agents. Detailed phenotypic and genotypic characterization of MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates should be conducted to understand their pathobiology and pathophysiology.\u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eLimitation of Study\u003c/h2\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eThe cytotoxicity assay and MIC of different antibiotics and antibiofilm agents were not performed.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eBiofilm related genes were only studied in isolates from medical devices.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cem\u003eAcinetobacter baumannii\u003c/em\u003e (\u003cem\u003eA. baumannii\u003c/em\u003e); Acyl homoserine lactones (AHLs); American Society for Microbiology (ASM); American Type Culture Collection (ATCC); Biofilm-associated protein (Bap); Brain heart infusion (\u003cem\u003eBHI\u003c/em\u003e); Catheter-associated urinary tract infection (CAUTI); Central-line associated bloodstream infection (CLABSI); Cetyltrimethylammonium bromide (CTAB); Clinical and Laboratory Standards Institute (CLSI); Coronavirus disease 2019 (COVID-19); \u0026nbsp;Dimethyl sulfoxide (DMSO); Essential oil (EO); Ethylenediaminetetraacetic acid (EDTA); Extensively drug-resistant (XDR); Forward primer (FW); Gas Chromatography- Mass Spectrophotometer (GC-MS); Intensive care unit (ICU); Luria-Bertani (LB); Minimum inhibitory concentration (MIC); Multidrug-resistant (MDR); Nepal Health Research Council (NHRC); Optical density (OD); \u0026nbsp;Outer membrane protein A (OmpA); Polymerase chain reaction (PCR); ); Reverse primer (RV); Tribhuvan University Teaching Hospital (TUTH); Ventilator-associated pneumonia (VAP).\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by\u0026nbsp;Institutional Review Committee of Institute of Medicine (Ref: 338(6-11)E\u003csup\u003e2\u003c/sup\u003e/077/078)\u0026nbsp;and written consent was taken from patient\u0026apos;s local guardian for participation in the study before enrolment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAvailability of data and materials\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the postgraduate research grant of Nepal Health Research Council (NHRC), Kathmandu, Nepal. (Grant number: 17/2078-079) and faculty research grant by Rector\u0026rsquo;s Office, Tribhuvan University, Nepal (2078).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank laboratory staff, faculty members of Microbiology department of TUTH, patients who are the source for our bacterial strains. SKM is grateful to UNSW Sydney for Scientia PhD scholarship.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSKM, PY and MW conceived and designed the research. SKM, PY and DB developed the methodology. SKM and PY were responsible for the acquisition of research funds. PY conducted experiments, analyzed data and wrote the original draft of the manuscript. PY, SS, AT, AS and BY helped in the interpretation of data. SKM, RS and MW supervised the project. All authors read, contributed significantly by reviewing and editing the manuscript, and approved the final draft for publication.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1 Department of Microbiology, Chitwan Medical College, Tribhuvan University, Nepal\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePY: (Orcid - https://orcid.org/0000-0002-7113-3690)\u003c/p\u003e\n\u003cp\u003e2 National Public Health Laboratory, Ministry of Health and Population, Kathmandu, Nepal\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e3 Department of Pharmacy, Maharajgunj Medical Campus, Institute of Medicine, Tribhuvan University, Kathmandu, Nepal\u003c/p\u003e\n\u003cp\u003e4 Department of Pharmacognosy, Keimyung University, Daegu, South Korea\u003c/p\u003e\n\u003cp\u003e5Department of Health Security, Expert Microbiology Research Unit, Finnish Institute for Health and Welfare.\u003c/p\u003e\n\u003cp\u003e6 Department of Microbiology, Tribhuvan University Teaching Hospital, Kathmandu, Nepal\u003c/p\u003e\n\u003cp\u003e7. Annapurna Research Center, Maitighar, Kathmandu\u003c/p\u003e\n\u003cp\u003e8 Department of General Practice and Emergency Medicine, Chitwan Medical College, Tribhuvan University, Nepal\u003c/p\u003e\n\u003cp\u003e9 School of Optometry and Vision Science, Faculty of Medicine and Health, University of New South Wales, Sydney, Australia\u003c/p\u003e\n\u003cp\u003eMW: (Orcid - https://orcid.org/0000-0003-3842-7563)\u003c/p\u003e\n\u003cp\u003eSKM: (Orcid - https://orcid.org/0000-0002-3888-7319)\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eShlaes DM, Bradford PA. Antibiotics\u0026mdash;From There to Where?: How the antibiotic miracle is threatened by resistance and a broken market and what we can do about it. Pathogens \u0026amp; Immunity. 2018;3(1):19. (DOI: 10.20411/pai.v3i1.231)\u003c/li\u003e\n \u003cli\u003eWong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B, Spellberg BJCmr. Clinical and pathophysiological overview of Acinetobacter infections: a century of challenges. Clinical Microbiology Reviews. 2017;30(1):409-47. (https://doi.org/10.1128/cmr.00058-16)\u003c/li\u003e\n \u003cli\u003eSunenshine RH, Wright M-O, Maragakis LL, Harris AD, Song X, Hebden J, et al. Multidrug-resistant Acinetobacter infection mortality rate and length of hospitalization. Emerging infectious diseases. 2007;13(1):97. (DOI: 10.3201/eid1301.060716)\u003c/li\u003e\n \u003cli\u003eBhargava N, Sharma P, Capalash N. Quorum sensing in Acinetobacter: an emerging pathogen. Critical reviews in microbiology. 2010;36(4):349-60. (https://doi.org/10.3109/1040841X.2010.512269)\u003c/li\u003e\n \u003cli\u003eZeighami H, Valadkhani F, Shapouri R, Samadi E, Haghi F. Virulence characteristics of multidrug resistant biofilm forming Acinetobacter baumannii isolated from intensive care unit patients. BMC infectious diseases. 2019;19(1):1-9. (https://doi.org/10.1186/s12879-019-4272-0)\u003c/li\u003e\n \u003cli\u003eErhardt M. Strategies to block bacterial pathogenesis by interference with motility and chemotaxis. How to overcome the antibiotic crisis: facts, challenges, technologies and future perspectives. 2016:185-205.\u003c/li\u003e\n \u003cli\u003eClemmer KM, Bonomo RA, Rather PN. Genetic analysis of surface motility in Acinetobacter baumannii. Microbiology. 2011;157(Pt 9):2534. (https://doi.org/10.1099/mic.0.049791-0)\u003c/li\u003e\n \u003cli\u003eEijkelkamp BA, Stroeher UH, Hassan KA, Papadimitrious MS, Paulsen IT, Brown MH, et al. Adherence and motility characteristics of clinical Acinetobacter baumannii isolates. FEMS microbiology letters. 2011;323(1):44-51. (https://doi.org/10.1111/j.1574-6968.2011.02362.x)\u003c/li\u003e\n \u003cli\u003eSkiebe E, de Berardinis V, Morczinek P, Kerrinnes T, Faber F, Lepka D, et al. Surface-associated motility, a common trait of clinical isolates of Acinetobacter baumannii, depends on 1, 3-diaminopropane. International Journal of Medical Microbiology. 2012;302(3):117-28. (https://doi.org/10.1016/j.ijmm.2012.03.003)\u003c/li\u003e\n \u003cli\u003eTomaras AP, Dorsey CW, Edelmann RE, Actis LA. Attachment to and biofilm formation on abiotic surfaces by Acinetobacter baumannii: involvement of a novel chaperone-usher pili assembly system. Microbiology. 2003;149(12):3473-84. (https://doi.org/10.1099/mic.0.26541-0)\u003c/li\u003e\n \u003cli\u003eMonfared AM, Rezaei A, Poursina F, Faghri J. Detection of genes involved in biofilm formation in MDR and XDR Acinetobacter baumannii isolated from human clinical specimens in Isfahan, Iran. Archives of Clinical Infectious Diseases. 2019;14(2).\u003c/li\u003e\n \u003cli\u003eYong YY, Dykes GA, Choo WS. Biofilm formation by staphylococci in health-related environments and recent reports on their control using natural compounds. Critical reviews in microbiology. 2019;45(2):201-22. (https://doi.org/10.1080/1040841X.2019.1573802)\u003c/li\u003e\n \u003cli\u003eLu L, Hu W, Tian Z, Yuan D, Yi G, Zhou Y, et al. Developing natural products as potential anti-biofilm agents. Chinese medicine. 2019;14(1):1-17. (https://doi.org/10.1186/s13020-019-0232-2)\u003c/li\u003e\n \u003cli\u003eNiu C, Afre S, Gilbert ES. Subinhibitory concentrations of cinnamaldehyde interfere with quorum sensing. Letters in applied microbiology. 2006;43(5):489-94. (https://doi.org/10.1111/j.1472-765X.2006.02001.x)\u003c/li\u003e\n \u003cli\u003eBai A J, Vittal RR. Quorum sensing inhibitory and anti-biofilm activity of essential oils and their in vivo efficacy in food systems. Food Biotechnology. 2014;28(3):269-92. (https://doi.org/10.1080/08905436.2014.932287)\u003c/li\u003e\n \u003cli\u003eAhmad NH, Mohammad GA. Evaluation of Some Material to inhibit Biofilm Formed by Acinetobacter baumannii Isolates. Tikrit Journal of Pure Science. 2019;24(4):19-24. (http://dx.doi.org/10.25130/tjps.24.2019.066)\u003c/li\u003e\n \u003cli\u003eMohamed SH, Salem D, Azmy M, Fam NS. Antibacterial and antibiofilm activity of cinnamaldehyde against carbapenem-resistant Acinetobacter baumannii in Egypt: In vitro study. Journal of Applied Pharmaceutical Science. 2018;8(11):151-6. (http://dx.doi.org/10.7324/JAPS.2018.81121)\u003c/li\u003e\n \u003cli\u003eZegans ME, Wozniak D, Griffin E, Toutain-Kidd CM, Hammond JH, Garfoot A, et al. Pseudomonas aeruginosa exopolysaccharide Psl promotes resistance to the biofilm inhibitor polysorbate 80. Antimicrobial agents and chemotherapy. 2012;56(8):4112-22. (https://doi.org/10.1128/aac.00373-12)\u003c/li\u003e\n \u003cli\u003eBrown M, Geaton E, Gilbert P. Additivity of action between polysorbate 80 and polymyxin B towards spheroplasts of Pseudomonas aeruginosa NCTC 6750. Journal of Pharmacy and Pharmacology. 1979;31(1):168-70. (https://doi.org/10.1111/j.2042-7158.1979.tb13463.x)\u003c/li\u003e\n \u003cli\u003eGarcia LS. Clinical microbiology procedures handbook: American Society for Microbiology Press; 2010.\u003c/li\u003e\n \u003cli\u003eAbbey TC, Deak E. What\u0026apos;s new from the CLSI subcommittee on antimicrobial susceptibility testing M100. Clinical Microbiology Newsletter. 2019;41(23):203-9. (DOI: 10.1016/j.clinmicnews.2019.11.002)\u003c/li\u003e\n \u003cli\u003eMagiorakos A-P, Srinivasan A, Carey RB, Carmeli Y, Falagas M, Giske C, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clinical microbiology and infection. 2012;18(3):268-81. (DOI: 10.1111/j.1469-0691.2011.03570.x)\u003c/li\u003e\n \u003cli\u003eVijayakumar S, Rajenderan S, Laishram S, Anandan S, Balaji V, Biswas I. Biofilm formation and motility depend on the nature of the Acinetobacter baumannii clinical isolates. Frontiers in public health. 2016;4:105. (https://doi.org/10.3389/fpubh.2016.00105)\u003c/li\u003e\n \u003cli\u003eLoraine J, Heinz E, Soontarach R, Blackwell GA, Stabler RA, Voravuthikunchai SP, et al. Genomic and phenotypic analyses of Acinetobacter baumannii isolates from three tertiary care hospitals in Thailand. Frontiers in Microbiology. 2020;11:548. (https://doi.org/10.3389/fmicb.2020.00548)\u003c/li\u003e\n \u003cli\u003e)25. Stephanovic S, Cirkovic I, Ranin L, Svabic-Vlahovic M. Biofilm formation by Salmonella spp. and Listeria monocytognes on plastic surfaces. Lett Appl Microbiol. 2004;38:428-32. (DOI: 10.1111/j.1472-765X.2004.01513.x)\u003c/li\u003e\n \u003cli\u003eTiwari K, Jadhav S, Gupta S. Modified CTAB technique for isolation of DNA from some medicinal plants. Research Journal of Medicinal Plant. 2012;6(1):65-73. \u003cu\u003e(\u003c/u\u003eDOI: 10.3923/rjmp.2012.65.73)\u003c/li\u003e\n \u003cli\u003ePoudel R, Neupane NP, Mukeri IH, Alok S, Verma A. An updated review on invasive nature, phytochemical evaluation, \u0026amp; pharmacological activity of Ageratina adenophora. Int J Pharm Sci Res. 2020;11:2510-20. (http://dx.doi.org/10.13040/IJPSR.0975-8232.11(6).2510-20)\u003c/li\u003e\n \u003cli\u003ePoudel AS, Shrestha BB, Joshi MD, Muniappan R, Adiga A, Venkatramanan S, et al. Predicting the current and future distribution of the invasive weed Ageratina adenophora in the Chitwan\u0026ndash;Annapurna Landscape, Nepal. Mountain Research and Development. 2020;40(2):R61. (https://doi.org/10.1659/MRD-JOURNAL-D-19-00069.1)\u003c/li\u003e\n \u003cli\u003eDidar Z, Mohamadisani A. Comparison of the Effects of Hydrosol Extracted from Turmeric (Curcuma longa) and Cinnamon (Cinnamomum verum) on staphylococcal biofilm. Journal of Babol University of Medical Sciences. 2019;21(1):293-8. (http://dx.doi.org/10.22088/jbums.21.1.293)\u003c/li\u003e\n \u003cli\u003eLaghari AQ, Memon S, Nelofar A, Laghari AH. Extraction, identification and antioxidative properties of the flavonoid-rich fractions from leaves and flowers of Cassia angustifolia. American Journal of Analytical Chemistry. 2011;2(08):871. (DOI:10.4236/ajac.2011.28100)\u003c/li\u003e\n \u003cli\u003eFarrag HA, Hosny AE-DM, Hawas AM, Hagras SA, Helmy OM. Potential efficacy of garlic lock therapy in combating biofilm and catheter-associated infections; experimental studies on an animal model with focus on toxicological aspects. Saudi Pharmaceutical Journal. 2019;27(6):830-40. (https://doi.org/10.1016/j.jsps.2019.05.004)\u003c/li\u003e\n \u003cli\u003eSomrani M, Ingl\u0026eacute;s M-C, Debbabi H, Abidi F, Palop A. Garlic, onion, and cinnamon essential oil anti-biofilms\u0026rsquo; effect against Listeria monocytogenes. Foods. 2020;9(5):567. (https://doi.org/10.3390/foods9050567)\u003c/li\u003e\n \u003cli\u003eRossi MW, Heuertz RM. Cinnamaldehyde inhibits MRSA biofilm formation and reduces cell viability. American Society for Clinical Laboratory Science. 2017;30(4):214-8. (DOI: https://doi.org/10.29074/ascls.30.4.214)\u003c/li\u003e\n \u003cli\u003eYadav SK, Bhujel R, Hamal P, Mishra SK, Sharma S, Sherchand JB. Burden of multidrug-resistant Acinetobacter baumannii infection in hospitalized patients in a tertiary care hospital of Nepal. Infection and drug resistance. 2020:725-32. (DOI: 10.2147/IDR.S239514)\u003c/li\u003e\n \u003cli\u003eMishra SK, Rijal BP, Pokhrel BM. Emerging threat of multidrug resistant bugs\u0026ndash;Acinetobacter calcoaceticus baumannii complex and methicillin resistant Staphylococcus aureus. BMC research notes. 2013;6:1-6. (DOI: 10.1186/1756-0500-6-98)\u003c/li\u003e\n \u003cli\u003eShrestha SK, Trotter A, Shrestha PK. Epidemiology and risk factors of healthcare-associated infections in critically ill patients in a tertiary care teaching hospital in Nepal: a prospective cohort study. Infectious Diseases: Research and Treatment. 2022;15:11786337211071120. (https://doi.org/10.1177/11786337211071120)\u003c/li\u003e\n \u003cli\u003eKhanal BR, Wagle S, TiWaRi BR. Biofilm formation and colistin susceptibility of clinical isolates of Acinetobacter species in a tertiary care hospital of Nepal. National J Lab Med. 2019;8(1):12-5.\u003c/li\u003e\n \u003cli\u003eMalchau KS, Tillander J, Zaborowska M, Hoffman M, Lasa I, Thomsen P, et al. Biofilm properties in relation to treatment outcome in patients with first-time periprosthetic hip or knee joint infection. Journal of Orthopaedic Translation. 2021;30:31-40. (https://doi.org/10.1016/j.jot.2021.05.008)\u003c/li\u003e\n \u003cli\u003eThummeepak R, Kongthai P, Leungtongkam U, Sitthisak S. Distribution of virulence genes involved in biofilm formation in multi-drug resistant Acinetobacter baumannii clinical isolates. Int Microbiol. 2016;19(2):121-9. (DOI:10.2436/20.1501.01.270)\u003c/li\u003e\n \u003cli\u003eJain AL, Harding CM, Assani K, Shrestha CL, Haga M, Leber A, et al. Characteristics of invasive Acinetobacter species isolates recovered in a pediatric academic center. BMC Infectious Diseases. 2016;1(16):1-9. (DOI: 10.1186/s12879-016-1678-9)\u003c/li\u003e\n \u003cli\u003ePesavento C, Becker G, Sommerfeldt N, Possling A, Tschowri N, Mehlis A, et al. Inverse regulatory coordination of motility and curli-mediated adhesion in Escherichia coli. Genes \u0026amp; development. 2008;22(17):2434-46. (http://www.genesdev.org/cgi/doi/10.1101/gad.475808)\u003c/li\u003e\n \u003cli\u003eKuppusamy R, Yasir M, Yee E, Willcox M, Black DS, Kumar N. Guanidine functionalized anthranilamides as effective antibacterials with biofilm disruption activity. Organic \u0026amp; Biomolecular Chemistry. 2018;16(32):5871-88. (https://doi.org/10.1039/C8OB01699B)\u003c/li\u003e\n \u003cli\u003eMishra SK, Baidya S, Bhattarai A, Shrestha S, Homagain S, Rayamajhee B, et al. Bacteriology of Endotracheal Tube Biofilms and Antibiotic Resistance: A Systematic Review. Journal of Hospital Infection. 2024. (https://doi.org/10.1016/j.jhin.2024.03.004)\u003c/li\u003e\n \u003cli\u003eLee H-W, Koh Y, Kim J, Lee J-C, Lee Y-C, Seol S-Y, et al. Capacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to form biofilm and adhere to epithelial cell surfaces. Clinical microbiology and infection. 2008;14(1):49-54. (https://doi.org/10.1111/j.1469-0691.2007.01842.x)\u003c/li\u003e\n \u003cli\u003eAnish C, Abhisek R, Radha M. Evaluation of biofilm production in Acinetobacter baumanii with reference to imipenem resistance. Inter J Sci Res Pub. 2017;7:732-7.\u003c/li\u003e\n \u003cli\u003eFinnegan S, Percival SL. EDTA: an antimicrobial and antibiofilm agent for use in wound care. Advances in wound care. 2015;4(7):415-21. (https://doi.org/10.1089/wound.2014.0577)\u003c/li\u003e\n \u003cli\u003eSanchez Z, Tani A, Kimbara K. Extensive reduction of cell viability and enhanced matrix production in Pseudomonas aeruginosa PAO1 flow biofilms treated with a D-amino acid mixture. Applied and environmental microbiology. 2013;79(4):1396-9. (https://doi.org/10.1128/AEM.02911-12)\u003c/li\u003e\n \u003cli\u003eLeiman SA, May JM, Lebar MD, Kahne D, Kolter R, Losick R. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis. Journal of bacteriology. 2013;195(23):5391-5.\u003c/li\u003e\n \u003cli\u003eHochbaum AI, Kolodkin-Gal I, Foulston L, Kolter R, Aizenberg J, Losick R. Inhibitory effects of D-amino acids on Staphylococcus aureus biofilm development. Journal of bacteriology. 2011;193(20):5616-22. (https://doi.org/10.1128/jb.05534-11)\u003c/li\u003e\n \u003cli\u003eCava F, Lam H, de Pedro MA, Waldor MK. Emerging knowledge of regulatory roles of d-amino acids in bacteria. Cellular and Molecular Life Sciences. 2011;68(5):817. (DOI: 10.1007/s00018-010-0571-8)\u003c/li\u003e\n \u003cli\u003eAli BH, Blunden G, Tanira MO, Nemmar A. Some phytochemical, pharmacological and toxicological properties of ginger (Zingiber officinale Roscoe): a review of recent research. Food and chemical Toxicology. 2008;46(2):409-20. (https://doi.org/10.1016/j.fct.2007.09.085)\u003c/li\u003e\n \u003cli\u003eNikolić M, Vasić S, Đurđević J, Stefanović O, Čomić L. Antibacterial and anti-biofilm activity of ginger (Zingiber officinale (Roscoe)) ethanolic extract. Kragujevac Journal of Science. 2014(36):129-36. (https://doi.org/10.5937/KgJSci1436129N)\u003c/li\u003e\n \u003cli\u003eSuwal N, Subba RK, Paudyal P, Khanal DP, Panthi M, Suwal N, Nassan MA, Alqarni M, Batiha GE, Koirala N. Antimicrobial and antibiofilm potential of Curcuma longa Linn. Rhizome extract against biofilm producing Staphylococcus aureus and Pseudomonas aeruginosa isolates. Cellular and Molecular Biology. 2021 Jan 31;67(1):17-23. (doi: 10.14715/cmb/2021.67.1.3)\u003c/li\u003e\n \u003cli\u003eNidadavolu P, Amor W, Tran PL, Dertien J, Colmer-Hamood JA, Hamood AN. Garlic ointment inhibits biofilm formation by bacterial pathogens from burn wounds. Journal of medical microbiology. 2012;61(5):662-71. (https://doi.org/10.1099/jmm.0.038638-0)\u003c/li\u003e\n \u003cli\u003eRatthawongjirakul P, Thongkerd V. Fresh garlic extract inhibits Staphylococcus aureus biofilm formation under chemopreventive and chemotherapeutic conditions. Songklanakarin Journal of Science \u0026amp; Technology. 2016;38(4).\u003c/li\u003e\n \u003cli\u003eSubba B, Kandel RC. Chemical composition and bioactivity of essential oil of Ageratina adenophora from Bhaktapur District of Nepal. Journal of Nepal Chemical Society. 2012;30:78-86.\u003c/li\u003e\n \u003cli\u003eKurade NP, Jaitak V, Kaul VK, Sharma OP. Chemical composition and antibacterial activity of essential oils of Lantana camara, Ageratum houstonianum and Eupatorium adenophorum. Pharmaceutical Biology. 2010;48(5):539-44. (https://doi.org/10.3109/13880200903193336)\u003c/li\u003e\n \u003cli\u003ePala-Paul J, Perez-Alonso M, Velasco-Negueruela A, Sanz J. Analysis by gas chromatography\u0026ndash;mass spectrometry of the volatile components of Ageratina adenophora Spreng., growing in the Canary Islands. Journal of Chromatography A. 2002;947(2):327-31. (https://doi.org/10.1016/S0021-9673(02)00016-X)\u003c/li\u003e\n \u003cli\u003eRivera MLC, Hassimotto NMA, Bueris V, Sircili MP, de Almeida FA, Pinto UM. Effect of Capsicum frutescens extract, capsaicin, and luteolin on quorum sensing regulated phenotypes. Journal of food science. 2019;84(6):1477-86. (https://doi.org/10.1111/1750-3841.14648)\u003c/li\u003e\n \u003cli\u003eQais FA, Ahmad I, Altaf M, Alotaibi SH. Biofabrication of Gold Nanoparticles Using Capsicum annuum Extract and Its Antiquorum Sensing and Antibiofilm Activity against Bacterial Pathogens. ACS Omega. 2021. (https://doi.org/10.1021/acsomega.1c02297)\u003c/li\u003e\n \u003cli\u003eEl-Sayed HS, Chizzola R, Ramadan AA, Edris AE. Chemical composition and antimicrobial activity of garlic essential oils evaluated in organic solvent, emulsifying, and self-microemulsifying water based delivery systems. Food Chemistry. 2017;221:196-204. (https://doi.org/10.1016/j.foodchem.2016.10.052)\u003c/li\u003e\n \u003cli\u003eGhasemi E, Ghalavand Z, Goudarzi H, Yeganeh F, Hashemi A, Dabiri H, et al. Phenotypic and Genotypic Investigation of Biofilm Formation in Clinical and Environmental Isolates of Acinetobacter baumannii. 2018. (https://doi.org/10.5812/archcid.12914)\u003c/li\u003e\n \u003cli\u003eSung JY. Molecular characterization and antimicrobial susceptibility of biofilm-forming Acinetobacter baumannii clinical isolates from Daejeon, Korea. Korean Journal of Clinical Laboratory Science. 2018;50(2):100-9. (https://doi.org/10.15324/kjcls.2018.50.2.100)\u003c/li\u003e\n \u003cli\u003eYang C-H, Su P-W, Moi S-H, Chuang L-Y. Biofilm formation in Acinetobacter Baumannii: genotype-phenotype correlation. Molecules. 2019;24(10):1849. (https://doi.org/10.3390/molecules24101849)\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"A. baumannii, multidrug-resistant (MDR), biofilm production, biofilm inhibition, essential oils, biofilm-related gene(s)","lastPublishedDoi":"10.21203/rs.3.rs-4343442/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4343442/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eMultidrug-resistant (MDR)\u0026nbsp;\u003ca href=\"https://www.sciencedirect.com/topics/medicine-and-dentistry/acinetobacter-baumannii\" title=\"Learn more about Acinetobacter baumannii from ScienceDirect's AI-generated Topic Pages\"\u003e\u003cem\u003eAcinetobacter baumannii\u003c/em\u003e\u003c/a\u003e\u0026nbsp;poses a significant therapeutic challenge due to its resistance to multiple antibiotics and biofilm formation capabilities. This study characterized MDR \u003cem\u003eA. baumannii \u003c/em\u003estrains for the possession of genes related to biofilm formation and their ability to form biofilms. Additionally, it evaluated compounds, particularly essential oils, for their antibiofilm activity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethod: \u003c/strong\u003eThis was a cross-sectional study conducted at the 750-bed Tribhuvan University Teaching Hospital in Nepal. Identification and antibiotic sensitivity of \u003cem\u003eA. baumannii\u003c/em\u003e isolates from clinical specimens were performed following the guidelines of the American Society for Microbiology. Strains were screened for their motility profiles, ability to form biofilms in a microtiter plate assay, and for possession of biofilm-related gene(s) by conventional polymerase chain reaction. The ability of cinnamaldehyde, ethylenediaminetetraacetic acid (EDTA), Tween 80, the amino acids glycine and glutamic acid, and natural plant extracts to inhibit biofilm formation also used the microtitre plate system.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResult:\u003c/strong\u003e Out of the total 200 \u003cem\u003eA. baumannii\u003c/em\u003e isolates, 195 were MDR, with 192 able to produce biofilms. Among them, 83.1% were \u0026nbsp;strong biofilm producers. In this study, 42.0% and 66.2% of the isolates showed twitching motility and surface-associated motility, respectively. Thirty MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates from medical devices contained the biofilm-associated genes \u003cem\u003ecsuE, ompA, bap\u003c/em\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003ePER-1, \u003c/sub\u003epresent in 90.0%, 53.3%, 46.6%, and 26.6% of strains. respectively. Cinnamaldehyde was the most effective compound, inhibiting biofilm formation by 77.3%, followed by the ethanolic extract of onion (77.2%) , 0.5% Tween 80 (76.8%), essential oils of ginger (70.8% ) and garlic (68.6%), the ethanolic extract of chili pepper (68.1%), the essential oil of \u003cem\u003eAgeratina adenophora \u003c/em\u003e(67.6%), EDTA (54.8%) and the essential oil of turmeric (51.9%). The amino acids glutamic acid and glycine reduced biofilm formation by 66.6% and 33.7% of the isolates, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion:\u003c/strong\u003e \u003cem\u003eA. baumannii\u003c/em\u003e isolates were commonly strong biofilm producers and often possessed the biofilm-associated genes \u003cem\u003ecsuE\u003c/em\u003e\u0026nbsp; and \u003cem\u003eompA\u003c/em\u003e. Essential oils, along with Tween 80, were the most effective (≥67%) at reducing the amount of biofilms. These findings help to understand the biofilm production and provide valuable insights into MDR \u003cem\u003eA. baumannii\u003c/em\u003e isolates in this clinical setting.\u003c/p\u003e","manuscriptTitle":"Characterization of Multidrug-Resistant Acinetobacter baumannii isolates and inhibition of biofilm","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-13 11:02:31","doi":"10.21203/rs.3.rs-4343442/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e52f3b5e-d8cc-497f-826b-a779f12bc14d","owner":[],"postedDate":"May 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-04T06:08:26+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-13 11:02:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4343442","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4343442","identity":"rs-4343442","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00