IFRD2 regulates myogenic differentiation of bovine skeletal muscle satellite cells through the ERK1/2 pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article IFRD2 regulates myogenic differentiation of bovine skeletal muscle satellite cells through the ERK1/2 pathway Zhian Gong, Xiaoyu zhang, Jingxuan Cui, Wen Chen, Xin Huang, Qingzhu Yang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4300013/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract The proliferation and differentiation of skeletal muscle satellite cells is a complex physiological process in which many transcription factors and small RNA molecules are involved. In this study, interferon-related development factor 2 ( IFRD2 ) was identified as a target gene of bta-miRNA-2400 involved in regulating the proliferation and differentiation of bovine skeletal MDSCs (Muscle-derived satellite cells, MDSCs). The results indicate that bta-miR-2400 can target bind the 3'UTR of IFRD2 and inhibit its translation. mRNA and protein expression levels of IFRD2 increased significantly with increasing days of differentiation. Overexpression of the IFRD2 gene inhibited the proliferation and promoted the differentiation of bovine MDSCs. Conversely, the knockdown of the gene had the opposite effect. Overexpression of IFRD2 resulted in the inhibition of ERK1/2 phosphorylation levels in bovine MDSCs, which in turn promoted differentiation. In summary, IFRD2 , as a target gene of bta-miR-2400 , affects bovine skeletal muscle proliferation and differentiation by regulating ERK1/2 phosphorylation. IFRD2 bovine skeletal muscle satellite cells bta-miR-2400 ERK1/2 myogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Skeletal muscle is the largest tissue in mammals, accounting for approximately 40% of the overall mass, and maintains the body's basic functions such as metabolism, respiration, and locomotion (Egan & Zierath, 2013; Greggio et al., 2017; Salvatore, Simonides, Dentice, Zavacki, & Larsen, 2014). Skeletal muscle has a special ability to regenerate, and the mediators of its regeneration are a group of small adult stem cells, called satellite cells, located basement membrane of the muscle fibers (Dumont, Bentzinger, Sincennes, & Rudnicki, 2015). Under normal physiological conditions, muscle satellite cells are resting. However, upon stimulation, adult myoblasts with the ability to proliferate and differentiate end up forming mature muscle fibers under the regulation of MRFs, which are the regulators of myogenic differentiation, including factors such as MyoD , Myf5 , MyoG , MRF4 , and MyHC (Baghdadi & Tajbakhsh, 2018; Mukund & Subramaniam, 2020; Sousa-Victor, García-Prat, & Muñoz-Cánoves, 2022). However, many unknown regulatory mechanisms still need to be studied in depth. miRNA (microRNA) is a small molecule RNA with a length of about 22 nucleotides, which is widely found in eukaryotic organisms and is involved in many biological processes such as cell proliferation, apoptosis, and differentiation(Kabekkodu et al., 2018). miR-1 and miR-206 are the muscle-specific miRNA molecules, that regulate the proliferation and differentiation of myoblasts by modulating the expression of target genes, thereby affecting the growth and development of skeletal muscle (Anderson, Catoe, & Werner, 2006; Chen et al., 2006; Ge & Chen, 2011). MicroRNA-2400 is a miRNA specifically expressed in cattle that negatively regulates MyoG expression and promotes the proliferation of skeletal muscle SCs (Glazov et al., 2009; W. W. Zhang et al., 2015), its function can be inhibited by the novel cyclic RNA circMYL1 (Elnour et al., 2021). In addition, miR-2400 mediated SUMO1 and PRDM11 to promote the proliferation of bovine preadipocytes(Wei, Cui, Tong, Zhang, & Yan, 2016; Y. Zhang et al., 2021), but the mechanism by which miR-2400 regulates the proliferation and differentiation of bovine skeletal muscle satellite cells remains unclear. The interferon-related developmental regulators ( IFRD ) family is involved in a variety of physiological and pathological regulatory processes. The family consists of two family members, IFRD1 and IFRD2 , which are relatively conserved during evolution. It has been shown that IFRD 1 is involved in the developmental processes of neuronal cells(Tirone & Shooter, 1989), intestinal cells (Yu et al., 2010), myocytes(Lammirato et al., 2016; Micheli et al., 2011) and adipocytes(Nakamura et al., 2013; Park et al., 2017). IFRD2 ( SKMc15 ) has been reported to act as a novel ribosome-binding protein capable of inhibiting translation and thus regulating gene expression (Brown, Baird, Yip, Murray, & Shao, 2018); and can influence the process of lipogenesis through DLK1 (Vietor et al., 2023). Among the signaling pathways involved in myogenesis, the extracellular signal-regulated kinase 1/2 ( ERK1/2 ) pathway plays an important role (Cheng et al., 2023; Oishi, Ogata, Ohira, & Roy, 2019). This pathway, as well as members of the mitogen-activated protein kinase ( MAPK ) pathway, is involved in the regulation of many cellular processes such as cell growth, differentiation, apoptosis, and necrosis (Sun et al., 2015). Previous studies have shown that ERK1/2 is required for myoblast cell proliferation and differentiation (Jones, Fedorov, Rosenthal, & Olwin, 2001), Activated ERK1/2 signaling negatively regulates the myoblast differentiation process (Lake, Corrêa, & Müller, 2016). In this study, we identified IFRD2 as a miR-2400 target gene and was significantly upregulated during the myogenic differentiation of bovine skeletal muscle satellite cells. Using knockdown and overexpression tools, we found that IFRD2 affects the process of bovine skeletal muscle proliferation and differentiation by regulating ERK1/2 phosphorylation. Materials and Methods Cell culture and differentiation Bovine skeletal MDSCs were collected from the hind limb muscles of newborn Chinese Simmental cattle according to the method described by Tong et al (Tong et al., 2015)and cultured in Dulbecco's modified Eagle medium (DMEM) containing 15% fetal bovine serum (FBS; Vivacell), 100 U/mL penicillin and 100 µg/mL streptomycin in a humidified 5% CO 2 and 95% air incubator. For differentiation, MDSCs were seeded at a density of 4 x 10 5 cells/60 mm dish and cultured for 24 hours in DMEM-filled dishes to allow them to adhere to the dish; this stage was defined as the undifferentiated/proliferative phase (P). The attached cells were then cultured in a differentiation medium (DM) consisting of 2% horse serum (Biological Industries), 100 U/ml penicillin 100 µg/ml streptomycin. After 1, 2, 3, 4, and 5 days of culture in the differentiation medium, MDSCs were collected. Plasmid construction. For the IFRD2 3′-UTR reporter assay, the entire 3′-UTR of bovine IFRD2 was PCR-amplified from bovine cDNA and cloned into the psiCHECK-2 dual luciferase reporter plasmid (Promega, Madison, WI, USA) to generate the psiCHECK- IFRD2 -3′-UTR reporter plasmid. The mutant bovine IFRD2 3′-UTR reporter was named psiCHECK- IFRD2 -3′-UTR-mut, respectively, and they were generated by nested PCR mutagenesis of the seed region of the predicted bta-miR-2400 motif, with the binding site mutated from UGUGCUG to ACACGAC. To exogenously overexpress IFRD2 , the coding sequence (CDS) of IFRD2 (NM_001077012) was cloned into the pcDNA3.1 vector and named pcDNA3.1- IFRD2. The overexpression vector of bovine IFRD2 was constructed using seamless cloning. The full-length coding sequence of bovine IFRD2 was amplified using PCR with the following primers: forward 5'- CTT GGT ACC GAG CTC GGA TCC ATG CCC CGC GCC CGA AAA − 3' and reverse 5'- TGC TGG ATA TCT GCA GAA TTC TCA CAG GAC GTC GGC CCG − 3'. The pcDNA3.1(+) vector was linearized with BamH Ⅰ, EcoR Ⅰ. The seamless cloning reaction was performed using ClonExpress II One Step Cloning kit C112 (Vazyme Biotech Co., Ltd.). pcDNA3.1- IFRD2 did not have the 3′-UTR of IFRD2 cloned in it. therefore, miR-2400 -mimic and miR-2400 -inhitibor do not affect the overexpression of IFRD2 . The shRNAs for IFRD2 were designed using the online software: https://rnaiddesigner.invitrogen.com/rnaiexpress(Table.1) . The annealed shRNA was inserted into the pRNA-H1.1/Shuttle-RFP vector. All recombinant vectors were confirmed by sequencing after construction in Sangon Biotech Co., Ltd. (Shanghai, China). Table 1 Target sequence of IFRD2 shRNA oligo Oligo shRNA oligo 5ˊ-- 3ˊ IFRD2 -shRNA1-F GATCCACCATCGCCTTGCTCTTTGAGCGAACTCAAAGAGCAAGGCGATGGTTTTTTTG IFRD2 -shRNA1-R AATTCAAAAAAACCATCGCCTTGCTCTTTGAGTTCGCTCAAAGAGCAAGGCGATGGTG IFRD2 -shRNA2-F GATCCGGAGGACTTTGTTTACGAGGACGAATCCTCGTAAACAAAGTCCTCCTTTTTTG IFRD2 -shRNA2-R AATTCAAAAAAGGAGGACTTTGTTTACGAGGATTCGTCCTCGTAAACAAAGTCCTCCG IFRD2 -shRNA3-F GATCCGCACCACCACCTTCAGAACAACGAATTGTTCTGAAGGTGGTGGTGCTTTTTTG IFRD2 -shRNA3-R AATTCAAAAAAGCACCACCACCTTCAGAACAATTCGTTGTTCTGAAGGTGGTGGTGCG Luciferase reporter assay. The luciferase assay was used to determine whether IFRD2 is a target gene of miR-2400. HEK293 cells (2.0×10 4 cells per well) were placed in 24-well plates (Corning, NY, USA) 24 h before transfection. Cells were co-transfected with 500 ng of psiCHECK-2- IFRD2 , psiCHECK-2- IFRD2 -mut, or empty vector psiCHECK-2 and pcDNA3.1, pcDNA3.1- miR-2400 , miR-2400 -NC, or miR-2400 -I. Forty-eight hours after transfection, cells were lysed with passive lysis buffer (Promega), the firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System with a GloMax 20/20 light meter (Promega) according to the manufacturer's protocol. Cell proliferation assay. Cell proliferation was assessed by EdU binding and flow cytometry. MDSCs were inoculated and transfected with pcDNA3.1, pcDNA3.1- IFRD2 , pRNA-H1.1/Shuttle-RFP and pRNA-H1.1/Shuttle-RFP- IFRD2 . Proliferating cells were determined using Cell-Light ™ EdU Apollo® 488. In quantitative analysis, each data point represents a positive fluorescent region calculated from at least five regions randomly selected from three experiments. Cell cycle flow cytometry was performed 48 h after transfection with pcDNA3.1, pcDNA3.1- IFRD2 , pRNA-H1.1/Shuttle-RFP, and pRNA-H1.1/Shuttle-RFP- IFRD2 . Trypsin-digested cells were fixed for 24 hours in 70% (v/v) ethanol at 4°C. Cells were then incubated in 50 mg/mL propidium iodide solution (100 mg/mL RNase A and 0.2% (v/v) Triton X-100) at 4°C for 30 min. MDSCs were analyzed using Cytomics™ FC 500 and CXP software (Beckman Coulter, Brea, CA, USA). Immunofluorescence staining For immunofluorescence staining, cultured cells were fixed in 4% paraformaldehyde (PFA) at -4°C for 30 minutes and then incubated in blocking buffer (5% BSA, 0.2% Triton X-100, and PBS) at 37°C for 1 hour. Cells were then treated with primary rabbit anti-human IFRD2 antibody (1:50; Cat No. 26952-1-AP; Proteintech Group, Inc.), MyHC (Cat.no. AF7530, Beyotime Institute of Biotechnology) for 12 h at 4°C. Cells were washed three times with PBST and incubated with Alexa Fluor 488-coupled goat anti-rabbit secondary antibody (1:100; Cat. no. 111-545-003 Jackson ImmunoResearch Laboratories, Inc.) for 1 h at room temperature, and DAPI was incubated for 5 min at room temperature. Cells were again rinsed three times with PBST before observation, and examined under an upright microscope (IX71, Olympus, Tokyo, Japan). Images were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA). Total RNA extraction and real-time PCR Total RNA was extracted from transfected MDSCs, using TRIzol Reagent (Invitrogen), according to the manufacturer’s instructions. The concentration of total RNA was determined spectrophotometrically using a NanoDrop 2000C Spectrophotometer (Thermo, USA). According to the manufacturer's instructions, the first-strand cDNA was synthesized from 1 µg of total RNA from each sample using TransScript® One-Step gDNA Removal and cDNA Synthesis Super Mix (Beijing TransGen Biotech Co., Ltd.). TB Green® Premix Ex Taq™ (Tli RNase H Plus; cat. no. RR820A, Takara Bio Inc. Beijing) was used to determine the mRNA expression levels of the IFRD2 , MyoG , CCND2 , and CCNB1 genes. Thermal cycling conditions were as follows: 95˚C for 2 min, followed by 40 cycles: 95˚C for 15 s and 60˚C for 30 s. The bovine β-actin gene was used as an endogenous control for data normalization. The sequences of primers used are presented in Table 2 . Experiments were calculated following the 2 −ΔΔCt method. Table 2 Primer name and sequence Primer name sequence 5ˊ-3ˊ IFRD2 -F CCGTCTGCTCCCCGACTTCT IFRD2 -R CTCCTCGCCCTTGCCTTTCT CCNB1 -F TGATGGAACTAACTATGCTGG CCNB1 -R GCATAACAACGAGAAGGGATT CCND2 -F GGGCAAGTTGAAATGGAA CCND2 -R TCATCGACGGCGGGTAC MyoG -F GACTCAAGAAGGTGAATGAAGCC MyoG -R TATTATAGTGCGCTGCCCCAC β-actin -F GACCTCTACGCCAACACG β-actin -R GCAGCTAACAGTCCGCCTA Protein extraction and western blot analysis The whole cell lysate was extracted using RIPA Lysis Buffer (Art. No. P0013B, Biotek Biotechnology Institute). Lysates were centrifuged at 13,000×g for 15 minutes at 4˚C. The supernatant was collected and protein concentration was determined using the BCA Protein Assay Kit (Beyotime Institute of Biotechnology). The protein supernatant was denatured with SDS-PAGE Sample Loading Buffer (Beyotime Institute of Biotechnology) and boiled for 10 minutes at 95 ℃. Proteins (12 µg/lane) were loaded, separated by 10% SDS-PAGE, and transferred to a PVDF membrane (Millipore Corporation, Billerica, MA, USA). The membranes were blocked with 5% (w/v) nonfat milk in PBS buffer containing 0.05% Tween-20 for 1 h at room temperature and then overnight at 4˚C with primary antibodies as follows: IFRD2 (1:2,000; Cat No. 26952-1-AP; Proteintech Group, Inc.), CCNB1 (1:1500; cat. no. bs-23016R; Bioss), CCND2 (1:1500; Cat No. 10934-1-AP; Proteintech Group, Inc.), MyoG (1:1000; cat. no. AF7542, Beyotime Institute of Biotechnology) and β-actin (1:10,000; cat. no. ab8227; Abcam). The sample was then incubated with IRDye® 800CW goat anti-rabbit IgG secondary antibody (1:15,000; Cat. no: 926-32211, LI-COR Biosciences) or IRDye 800CW goat anti-mouse IgG secondary antibody (1:15,000; Cat. No: 926-32210, LI-COR Biosciences) for 90 min at 20–25˚C and rinsed with PBS. The immunoblots were visualized using the Odyssey IR Imaging System (LI-COR Biosciences). Statistical analysis All results are expressed as means ± SEM. Representative bands were selected from independent western blotting experiments. When data distributions approximated normality and two groups were compared, a Student’s t-test was performed to evaluate the significance of differences. Differences were regarded as significant at a level of P < 0.05. All statistical tests were performed using Prism software (GraphPad). Result miR-2400 targets the 3'UTR of IFRD2 and inhibits its expression. miR-2400 promotes the proliferation of bovine skeletal muscle satellite cells(W. W. Zhang et al., 2015), To investigate its mechanism of action, we predicted the possible target genes of miR-2400 , and the results showed that miR-2400 targets IFRD2 , its binding site is located at positions 320–326 of the 3' untranslated region of IFRD2 mRNA (Fig. 1 A). Dual-luciferase reporter gene assay showed that overexpression of miR-2400 significantly reduced the luciferase activity of wild-type psiCHECK-2- IFRD2 -WT plasmid (WT) compared with the control, whereas overexpression of miR-2400 did not have a major effect on the mutant psiCHECK-2- IFRD2 -MUT plasmid (MUT) (Fig. 1 B). In addition, the addition of both miR-2400 overexpression and inhibitor (pcDNA3. 1(+)-miRNA-2400 + psiCHECK-2- IFRD2 -wt + miR-2400-1) did not significantly change the luciferase activity compared to the control (pcDNA3. 1(+)- miRNA-2400 + psiCHECK-2- IFRD2 -wt + miR-2400 -1) However, the addition of miR-2400 overexpression (pcDNA3. 1(+)-miRNA-2400 + psiCHECK-2- IFRD2 -wt) resulted in a significant decrease in luciferase activity compared with the control group, suggesting that miR-2400 inhibits the expression of luciferase activity by binding to the 3'UTR region of IFRD2 and that the addition of miR-2400 inhibitor can remove this inhibition. miR-2400 inhibitor relieved this inhibition (Fig. 1 c). Using qRT-PCR and Western Blot techniques, it was found that overexpression, as well as inhibition of miR-2400 , would result in altered endogenous expression of IFRD2 (Fig. 1 e-f). The results suggest that IFRD2 is a downstream target gene of miR-2400 and is negatively regulated by miR-2400 . IFRD2 is expressed during the differentiation of bovine skeletal muscle satellite cells miR-2400 promotes proliferation(W. W. Zhang et al., 2015), and inhibits IFRD2 expression in bovine skeletal muscle satellite cells (Fig. 1 ), so we hypothesized that IFRD2 may play a role in the differentiation process. Based on this speculation we examined the expression level of IFRD2 in myoblast differentiation. qRT-PCR analysis revealed that IFRD2 mRNA was most highly expressed on day 3 of the differentiation process, which was also confirmed by Western blot results (Fig. 2 A-C). We further examined the levels of IFRD2 in cultured bovine skeletal muscle satellite cells by immunofluorescence staining. The results showed that on day 1 of differentiation, IFRD2 was detected in adult myoblasts, whereas on day 3, IFRD2 was significantly expressed in newly formed myotubes, accompanied by an increase in the expression of IFRD2 protein in the nucleus (Fig. 2 D). These results suggest that IFRD2 is enriched in differentiated myoblasts and myofibers and may be involved in the proliferation and differentiation process of bovine skeletal muscle satellite cells. IFRD2 inhibits the proliferation of bovine skeletal muscle satellite cells To evaluate whether IFRD2 affected the proliferation of bovine skeletal muscle satellite cells, we examined the proliferation of MDSCs after IFRD2 knockdown and overexpression, the results showed that IFRD2 overexpression reduced the rate of EdU-fluorescent cells compared to control cells, and knockdown of IFRD2 yielded the opposite result plots (Fig. 3 A-B). Using MTT assay to analyze cell viability, we found that ectopic expression of IFRD2 significantly reduced cell viability in bovine skeletal muscle satellite cells (Fig. 3 C), and knockdown of IFRD2 led to an increase in cell viability (Fig. 3 D). In addition to the changes in cell phenotype, the results of qRT-PCR and Western Blot showed that overexpression of IFRD2 reduced the mRNA as well as protein expression levels of cell proliferation marker genes ( cyclin D2 , cyclin B1 ) compared to control cells, and knockdown with IFRD2 elevated their expression profiles (Fig. 3 E-G). In addition, the results of flow cytometry showed that gain and loss of IFRD2 affected the cell cycle changes in bovine skeletal muscle satellite cells (Fig. 3 H), and its overexpression acted to arrest the cells in the G1 phase. In conclusion, the combination of the phenotypes, proliferation marker genes, and cell cycle results described above confirm that IFRD2 will inhibit the proliferative process of bovine skeletal muscle satellite cells. IFRD2 promotes satellite cell differentiation in bovine skeletal muscle Myogenic differentiation of skeletal muscle through a coordinated process of proliferation and differentiation (Zhu & Skoultchi, 2001). Therefore, we discussed the effects of IFRD2 on bovine skeletal muscle satellite cell differentiation and myotube formation. First, we found that knockdown of IFRD2 reduced the expression level of the differentiation signature gene MyoG at both the mRNA and protein levels, MyoG gene expression was promoted after overexpression of IFRD2 (Fig. 4 A-D). In addition, the immunofluorescence assay for MyHC showed that the differentiation degree of IFRD2 overexpressing cells was significantly higher than that of the interfering group, which was confirmed by the number of myotubes and the fusion rate (Fig. 4 E-G). Overall, the above results indicated that IFRD2 promoted the differentiation of bovine skeletal muscle satellite cells. IFRD2 mediates the ERK 1/2 signaling pathway in bovine skeletal muscle satellite cells To analyze the molecular mechanism of IFRD2 to promote differentiation in bovine skeletal muscle satellite cells we evaluated the changes in the phosphorylation levels of ERK 1/2 , NF-κB , and P53 proteins in bovine skeletal muscle satellite cells after overexpression and knockdown of IFRD2 via the differentiation stage. As previously described, the ERK 1/2 signaling pathway is involved in the process of skeletal muscle proliferation and differentiation (Oishi et al., 2019). Overexpression and knockdown with IFRD2 , differentiation treatment for 3 days resulted in suppression of phosphorylated- ERK 1/2 (Thr 202/Tyr 204) levels in overexpression-treated bovine skeletal muscle satellite cells compared with control cells; In contrast, activation of phospho- ERK 1/2 was promoted after knockdown with the IFRD2 gene(Fig. 5 A-B). However, overexpression and knockdown with IFRD2 did not affect NF-κB and P53 protein phosphorylation levels in MDSCs༈Fig. 5 C-D༉. In conclusion, our data suggest that IFRD2 regulates myogenic differentiation of bovine skeletal muscle satellite cells by modulating the ERK 1/2 signaling pathway. Discussion Probing myogenic regulators in myogenesis can help to find novel molecular targets to improve muscle regeneration and muscle disease (Peng et al., 2021). MicroRNAs (miRNAs) can affect muscle regeneration through synergistic as well as antagonistic interactions with myogenic factors in a complex regulatory network during muscle generation (Ballarino, Morlando, Fatica, & Bozzoni, 2016). This study demonstrated that bta-miR-2400 could target the 3'UTR region of IFRD2 and inhibit its expression. In addition, IFRD2 was significantly induced during the myogenic differentiation of bovine skeletal muscle satellite cells, and gain and loss of function studies of the IFRD2 gene demonstrated that IFRD2 was able to inhibit the proliferation of bovine skeletal muscle satellite cells to promote their differentiation. On the effect of the interferon-related developmental regulator ( IFRD ) family on skeletal muscle proliferation and differentiation. Previous studies have shown that the transcription factor IFRD1 , a member of the same family, influences the differentiation process in C2C12 cells (Guardavaccaro, Ciotti, Schäfer, Montagnoli, & Tirone, 1995). Combining the gene expression patterns annotated in the bgee.org database with this experimental study suggests that IFRD2 functions in skeletal muscle development. These findings also confirmed that IFRD2 as a target gene of bta-miR-2400 promoted myogenic differentiation of bovine skeletal muscle satellite cells. Interestingly, the presence of IFRD2 as an inhibitory factor during cell proliferation can be attributed to the fact that the differentiation process of myoblasts requires exit from the cell cycle (Dumont et al., 2015), This study demonstrated that IFRD2 overexpression acts as a regulatory signal of the cell cycle arresting myoblasts in the G1 phase, inhibiting cell proliferation, and controlling the transition of adult myoblasts from a proliferative to a differentiated state. Such results all confirm that IFRD2 is a myogenic regulator during the proliferation and differentiation of bovine skeletal muscle satellite cells. To investigate the mechanism of action of IFRD2 , changes in NF-κB , and P53 proteins and ERK1/2 pathways were examined, and the results showed no changes in NF-κB , and P53 proteins. Interestingly, our data show that bovine skeletal muscle satellite cells treated with expression of IFRD2 exhibit decreased levels of phosphorylated ERK 1/2 (Thr 202/Tyr 204). The ERK 1/2 signaling pathway plays an important role in cell proliferation, differentiation, and apoptosis. In addition, ERK 1/2 activity has been reported to be associated with cell proliferation (Roskoski, 2012). Therefore, based on the effects of IFRD2 on bovine skeletal muscle satellite cells, we hypothesized that ERK1/2 may play a role in IFRD2 -induced inhibition of myogenic differentiation. When the ERK 1/2 signaling pathway is activated, skeletal muscle cell proliferation is enhanced but negatively regulates myogenic differentiation (Jones et al., 2001). IFRD2 silencing significantly increased ERK 1/2 (Thr 202/Tyr 204) phosphorylation levels in bovine skeletal muscle satellite cells. IFRD2 overexpression experiments demonstrated that IFRD2 promotes the differentiation of bovine skeletal muscle satellite cells and that the level of ERK 1/2 phosphorylation was inhibited. In conclusion, our studies based on bovine skeletal muscle satellite cells confirmed that the IFRD2 is a target gene of bta-miR-2400 and is involved in myogenic differentiation of bovine skeletal muscle satellite cells. However, there are still several limitations to be addressed in future research. First, the in vivo function of IFRD2 needs to be studied using a conditional knockout model, which is not currently available. Second, experiments confirmed that IFRD2 can affect the phosphorylation level of ERK1/2 to influence myogenic differentiation, but its downstream regulatory network still needs to be further explored. Declarations Funding This work was supported by the Natural Science Foundation of Heilongjiang Province (Grant No. LH2021C099), Scientific Research Fund of Heilongjiang Provincial Education Department (Grant No.145209515), Qiqihar University Graduate Student Innovative Research Program (Grant No. YJSCX2022024). Ethical statement. The Animal Care Commission of Qiqihar University and Heilongjiang, P.R. China approved the protocol utilized in this study to harvest cells from animal tissues. Skeletal muscle tissues from newborn Chinese Simmental calves were obtained from the Shuangcheng abattoir, a local slaughterhouse in Heilongjiang, P.R. China. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Data availability All data generated or analyzed during this study are included in this published article. References Anderson, C., Catoe, H., & Werner, R. (2006). MIR-206 regulates connexin43 expression during skeletal muscle development. Nucleic Acids Res, 34 (20), 5863-5871. doi:10.1093/nar/gkl743 Baghdadi, M. B., & Tajbakhsh, S. (2018). Regulation and phylogeny of skeletal muscle regeneration. Dev Biol, 433 (2), 200-209. doi:10.1016/j.ydbio.2017.07.026 Ballarino, M., Morlando, M., Fatica, A., & Bozzoni, I. (2016). Non-coding RNAs in muscle differentiation and musculoskeletal disease. J Clin Invest, 126 (6), 2021-2030. doi:10.1172/jci84419 Brown, A., Baird, M. R., Yip, M. C., Murray, J., & Shao, S. (2018). Structures of translationally inactive mammalian ribosomes. Elife, 7 . doi:10.7554/eLife.40486 Chen, J. F., Mandel, E. M., Thomson, J. M., Wu, Q., Callis, T. E., Hammond, S. M., . . . Wang, D. Z. (2006). The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat Genet, 38 (2), 228-233. doi:10.1038/ng1725 Cheng, C., Zhang, S., Gong, Y., Wang, X., Tang, S., Wan, J., . . . Yao, L. H. (2023). Cordycepin inhibits myogenesis via activating the ERK1/2 MAPK signalling pathway in C2C12 cells. Biomed Pharmacother, 165 , 115163. doi:10.1016/j.biopha.2023.115163 Dumont, N. A., Bentzinger, C. F., Sincennes, M. C., & Rudnicki, M. A. (2015). Satellite Cells and Skeletal Muscle Regeneration. Compr Physiol, 5 (3), 1027-1059. doi:10.1002/cphy.c140068 Egan, B., & Zierath, J. R. (2013). Exercise metabolism and the molecular regulation of skeletal muscle adaptation. Cell Metab, 17 (2), 162-184. doi:10.1016/j.cmet.2012.12.012 Elnour, I. E., Wang, X., Zhansaya, T., Akhatayeva, Z., Khan, R., Cheng, J., . . . Chen, H. (2021). Circular RNA circMYL1 Inhibit Proliferation and Promote Differentiation of Myoblasts by Sponging miR-2400. Cells, 10 (1). doi:10.3390/cells10010176 Ge, Y., & Chen, J. (2011). MicroRNAs in skeletal myogenesis. Cell Cycle, 10 (3), 441-448. doi:10.4161/cc.10.3.14710 Glazov, E. A., Kongsuwan, K., Assavalapsakul, W., Horwood, P. F., Mitter, N., & Mahony, T. J. (2009). Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection. PLoS One, 4 (7), e6349. doi:10.1371/journal.pone.0006349 Greggio, C., Jha, P., Kulkarni, S. S., Lagarrigue, S., Broskey, N. T., Boutant, M., . . . Amati, F. (2017). Enhanced Respiratory Chain Supercomplex Formation in Response to Exercise in Human Skeletal Muscle. Cell Metab, 25 (2), 301-311. doi:10.1016/j.cmet.2016.11.004 Guardavaccaro, D., Ciotti, M. T., Schäfer, B. W., Montagnoli, A., & Tirone, F. (1995). Inhibition of differentiation in myoblasts deprived of the interferon-related protein PC4. Cell Growth Differ, 6 (2), 159-169. Jones, N. C., Fedorov, Y. V., Rosenthal, R. S., & Olwin, B. B. (2001). ERK1/2 is required for myoblast proliferation but is dispensable for muscle gene expression and cell fusion. J Cell Physiol, 186 (1), 104-115. doi:10.1002/1097-4652(200101)186:13.0.Co;2-0 Kabekkodu, S. P., Shukla, V., Varghese, V. K., J, D. S., Chakrabarty, S., & Satyamoorthy, K. (2018). Clustered miRNAs and their role in biological functions and diseases. Biol Rev Camb Philos Soc, 93 (4), 1955-1986. doi:10.1111/brv.12428 Lake, D., Corrêa, S. A., & Müller, J. (2016). Negative feedback regulation of the ERK1/2 MAPK pathway. Cell Mol Life Sci, 73 (23), 4397-4413. doi:10.1007/s00018-016-2297-8 Lammirato, A., Patsch, K., Feiereisen, F., Maly, K., Nofziger, C., Paulmichl, M., . . . Vietor, I. (2016). TIS7 induces transcriptional cascade of methylosome components required for muscle differentiation. BMC Biol, 14 (1), 95. doi:10.1186/s12915-016-0318-6 Micheli, L., Leonardi, L., Conti, F., Maresca, G., Colazingari, S., Mattei, E., . . . Tirone, F. (2011). PC4/Tis7/IFRD1 stimulates skeletal muscle regeneration and is involved in myoblast differentiation as a regulator of MyoD and NF-kappaB. J Biol Chem, 286 (7), 5691-5707. doi:10.1074/jbc.M110.162842 Mukund, K., & Subramaniam, S. (2020). Skeletal muscle: A review of molecular structure and function, in health and disease. Wiley Interdiscip Rev Syst Biol Med, 12 (1), e1462. doi:10.1002/wsbm.1462 Nakamura, Y., Hinoi, E., Iezaki, T., Takada, S., Hashizume, S., Takahata, Y., . . . Yoneda, Y. (2013). Repression of adipogenesis through promotion of Wnt/β-catenin signaling by TIS7 up-regulated in adipocytes under hypoxia. Biochim Biophys Acta, 1832 (8), 1117-1128. doi:10.1016/j.bbadis.2013.03.010 Oishi, Y., Ogata, T., Ohira, Y., & Roy, R. R. (2019). Phosphorylated ERK1/2 protein levels are closely associated with the fast fiber phenotypes in rat hindlimb skeletal muscles. Pflugers Arch, 471 (7), 971-982. doi:10.1007/s00424-019-02278-z Park, G., Horie, T., Kanayama, T., Fukasawa, K., Iezaki, T., Onishi, Y., . . . Hinoi, E. (2017). The transcriptional modulator Ifrd1 controls PGC-1α expression under short-term adrenergic stimulation in brown adipocytes. Febs j, 284 (5), 784-795. doi:10.1111/febs.14019 Peng, Y., Yue, F., Chen, J., Xia, W., Huang, K., Yang, G., & Kuang, S. (2021). Phosphatase orphan 1 inhibits myoblast proliferation and promotes myogenic differentiation. Faseb j, 35 (1), e21154. doi:10.1096/fj.202001672R Roskoski, R., Jr. (2012). ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol Res, 66 (2), 105-143. doi:10.1016/j.phrs.2012.04.005 Salvatore, D., Simonides, W. S., Dentice, M., Zavacki, A. M., & Larsen, P. R. (2014). Thyroid hormones and skeletal muscle--new insights and potential implications. Nat Rev Endocrinol, 10 (4), 206-214. doi:10.1038/nrendo.2013.238 Sousa-Victor, P., García-Prat, L., & Muñoz-Cánoves, P. (2022). Control of satellite cell function in muscle regeneration and its disruption in ageing. Nat Rev Mol Cell Biol, 23 (3), 204-226. doi:10.1038/s41580-021-00421-2 Sun, Y., Liu, W. Z., Liu, T., Feng, X., Yang, N., & Zhou, H. F. (2015). Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J Recept Signal Transduct Res, 35 (6), 600-604. doi:10.3109/10799893.2015.1030412 Tirone, F., & Shooter, E. M. (1989). Early gene regulation by nerve growth factor in PC12 cells: induction of an interferon-related gene. Proc Natl Acad Sci U S A, 86 (6), 2088-2092. doi:10.1073/pnas.86.6.2088 Tong, H. L., Yin, H. Y., Zhang, W. W., Hu, Q., Li, S. F., Yan, Y. Q., & Li, G. P. (2015). Transcriptional profiling of bovine muscle-derived satellite cells during differentiation in vitro by high throughput RNA sequencing. Cell Mol Biol Lett, 20 (3), 351-373. doi:10.1515/cmble-2015-0019 Vietor, I., Cikes, D., Piironen, K., Vasakou, T., Heimdörfer, D., Gstir, R., . . . Huber, L. A. (2023). The negative adipogenesis regulator Dlk1 is transcriptionally regulated by Ifrd1 (TIS7) and translationally by its orthologue Ifrd2 (SKMc15). Elife, 12 . doi:10.7554/eLife.88350 Wei, Y., Cui, Y. F., Tong, H. L., Zhang, W. W., & Yan, Y. Q. (2016). MicroRNA-2400 promotes bovine preadipocyte proliferation. Biochem Biophys Res Commun, 478 (3), 1054-1059. doi:10.1016/j.bbrc.2016.08.038 Yu, C., Jiang, S., Lu, J., Coughlin, C. C., Wang, Y., Swietlicki, E. A., . . . Rubin, D. C. (2010). Deletion of Tis7 protects mice from high-fat diet-induced weight gain and blunts the intestinal adaptive response postresection. J Nutr, 140 (11), 1907-1914. doi:10.3945/jn.110.127084 Zhang, W. W., Tong, H. L., Sun, X. F., Hu, Q., Yang, Y., Li, S. F., . . . Li, G. P. (2015). Identification of miR-2400 gene as a novel regulator in skeletal muscle satellite cells proliferation by targeting MYOG gene. Biochem Biophys Res Commun, 463 (4), 624-631. doi:10.1016/j.bbrc.2015.05.112 Zhang, Y., Ma, L., Gu, Y., Chang, Y., Liang, C., Guo, X., . . . Yan, P. (2021). Bta-miR-2400 Targets SUMO1 to Affect Yak Preadipocytes Proliferation and Differentiation. Biology (Basel), 10 (10). doi:10.3390/biology10100949 Zhu, L., & Skoultchi, A. I. (2001). Coordinating cell proliferation and differentiation. Curr Opin Genet Dev, 11 (1), 91-97. doi:10.1016/s0959-437x(00)00162-3 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 13 May, 2024 Reviews received at journal 13 May, 2024 Reviews received at journal 03 May, 2024 Reviewers agreed at journal 25 Apr, 2024 Reviewers agreed at journal 25 Apr, 2024 Reviewers invited by journal 23 Apr, 2024 Editor assigned by journal 22 Apr, 2024 Submission checks completed at journal 22 Apr, 2024 First submitted to journal 21 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4300013","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":294650863,"identity":"8b1dc7b0-cffd-4923-b763-072ae023dd47","order_by":0,"name":"Zhian Gong","email":"","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":false,"prefix":"","firstName":"Zhian","middleName":"","lastName":"Gong","suffix":""},{"id":294650864,"identity":"c560c714-cd87-4aa2-bc26-f18861b30975","order_by":1,"name":"Xiaoyu zhang","email":"","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyu","middleName":"","lastName":"zhang","suffix":""},{"id":294650865,"identity":"b275888e-ad7c-4201-84db-dafd6283b4aa","order_by":2,"name":"Jingxuan Cui","email":"","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":false,"prefix":"","firstName":"Jingxuan","middleName":"","lastName":"Cui","suffix":""},{"id":294650866,"identity":"bd55cd9a-3055-4a7d-88a5-05791d887e57","order_by":3,"name":"Wen Chen","email":"","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":false,"prefix":"","firstName":"Wen","middleName":"","lastName":"Chen","suffix":""},{"id":294650867,"identity":"436d6d3f-8564-491a-a9e9-1bf31ad3d496","order_by":4,"name":"Xin Huang","email":"","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Huang","suffix":""},{"id":294650868,"identity":"ee417997-e83f-4388-a472-d031863675a8","order_by":5,"name":"Qingzhu Yang","email":"","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":false,"prefix":"","firstName":"Qingzhu","middleName":"","lastName":"Yang","suffix":""},{"id":294650869,"identity":"a6e04a3f-d831-432e-8312-ca50e27298b4","order_by":6,"name":"Tie Li","email":"","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":false,"prefix":"","firstName":"Tie","middleName":"","lastName":"Li","suffix":""},{"id":294650870,"identity":"47d26202-af9a-4cc0-9af0-bea3dfb06b91","order_by":7,"name":"Weiwei Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArElEQVRIiWNgGAWjYJCCAx8MbHj4+RuI18F4cEZBmozkjAPEa2E+zPPhsI1BQwKR6uVn5Bgc4DE4z2PAcIDxw8ccYlwF0iJhcJvHnLmBWXLmNmJcJZ274YABUItlwwE2Zl5itLCBtCQYnOMxOJBApBYekJYDIO8QrUVC/v2Hgw0GyTySMw42E+cX+Z5jyZ///LGz5+dvPvjhIzFakABjA2nqR8EoGAWjYBTgBgC5UDf2rnCXUQAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Life Science and Agroforestry, Qiqihar University","correspondingAuthor":true,"prefix":"","firstName":"Weiwei","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-04-21 08:53:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4300013/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4300013/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55253017,"identity":"5935b4ae-1136-4514-89ab-088b601ed9a6","added_by":"auto","created_at":"2024-04-24 18:04:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":216842,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003emiR-2400\u003c/em\u003e inhibits \u003cem\u003eIFRD2\u003c/em\u003e expression by directly targeting the 3'UTR of mRNA. (A) TargetScan identified potential targets of \u003cem\u003emiR-2400\u003c/em\u003e in the 3'-UTR of bovine \u003cem\u003eIFRD2\u003c/em\u003e. (B-C) HEK293 cells were transfected with pcDNA3.1(+), pcDNA3.1(+)-\u003cem\u003emiRNA-2400\u003c/em\u003e in the presence of WT or MUT \u003cem\u003eIFRD2\u003c/em\u003e 3'-UTR and binding was detected by measurement of luciferase activity. (D-F)Levels of mRNA and protein expression of \u003cem\u003eIFRD2\u003c/em\u003e in cells after transfection with pcDNA3.1(+), pcDNA3.1(+) \u003cem\u003emiR-2400\u003c/em\u003e, \u003cem\u003emiR-2400\u003c/em\u003e-NC, and \u003cem\u003emiR-2400\u003c/em\u003e-I were characterized by reverse transcription-quantitative PCR and Western blotting. levels of \u003cem\u003eIFRD2\u003c/em\u003e were normalized to \u003cem\u003eβ-actin\u003c/em\u003elevels were normalized. (NS: no significant difference, *p\u0026lt;0.05, **p\u0026lt;0.01).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4300013/v1/3124181bf98542a7bc33c307.png"},{"id":55253308,"identity":"99abb90e-47ad-448b-a4e9-8d5db20b77ea","added_by":"auto","created_at":"2024-04-24 18:12:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":310435,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e mRNA and protein expression during MDSCs differentiation. (A-C)\u003cstrong\u003e \u003c/strong\u003eqRT-PCR and Western blotting showing \u003cem\u003eIFRD2\u003c/em\u003e mRNA and protein levels during myogenic differentiation. (D) Immunofluorescence staining of \u003cem\u003eIFRD2\u003c/em\u003e during myogenic differentiation at different times of induced MDSCs differentiation (scale bar: 20μm) (*p\u0026lt;0.05, **p\u0026lt;0.01***p\u0026lt;0.01).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4300013/v1/1ae5168b23c464f6a82f41cd.png"},{"id":55253018,"identity":"71c13d1d-e439-420c-b6b0-2d748ef381e2","added_by":"auto","created_at":"2024-04-24 18:04:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":470259,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003einhibits MDSCs proliferation.\u003cstrong\u003e (\u003c/strong\u003eA-B) MDSCs labeled with EdU. EdU-positive cells (green); nuclei (blue), quantitative analysis of EdU-positive cells (scale bar: 100 μm) after \u003cem\u003eIFRD2\u003c/em\u003e knockdown and overexpression. Values represent the mean percentage of EdU-positive cells out of the total number of Hoechst-stained cells from 10 different fields of view. (C-D)\u003cstrong\u003e \u003c/strong\u003eCell viability of MDSCs cells was measured by MTT assay.\u003cstrong\u003e \u003c/strong\u003e(E) MDSCs were transfected with pcDNA3.1-\u003cem\u003eIFRD2\u003c/em\u003eor RNA-H1.1/Shuttle-RFP-sh1, sh2, and after 48 h, total RNA was isolated from the cells and RT-qPCR was performed to analyze \u003cem\u003eCCND 2\u003c/em\u003e and \u003cem\u003eCCNB 1\u003c/em\u003egene expression. Values are expressed relative to the internal control β-actin. The expression value from MDSCs transfected with an empty vector was set to 1; n = 3 cases.\u003cstrong\u003e \u003c/strong\u003e(F-G) Total proteins were extracted from cells after 48h and protein blots were performed using the indicated antibodies. (H)The cell cycle of MDSCs was analyzed by flow cytometry (*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.01).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4300013/v1/563c9474a559c828e8c19193.png"},{"id":55253020,"identity":"ab6acbe6-fe72-41eb-9ac6-b2ddad26b344","added_by":"auto","created_at":"2024-04-24 18:04:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":335938,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e promotes MDSCs myogenic differentiation. MDSCs were transfected with pcDNA3.1-\u003cem\u003eIFRD2\u003c/em\u003e or RNA-H1.1/Shuttle-RFP-sh1, sh2, and then induced differentiation in DM for 3 days. Differentiation was induced in DM for 3 days.\u003cstrong\u003e (\u003c/strong\u003eA-B) The mRNA levels of \u003cem\u003eIFRD2\u003c/em\u003e and myogenic differentiation markers were detected by qPCR. (C-D) Protein levels of \u003cem\u003eIFRD2\u003c/em\u003e and myogenin were detected by Western blot. \u003cem\u003eβ-actin\u003c/em\u003ewas used as a loading control. The intensity of the blot was quantified using Image J software, and gray intensity analysis is shown on the right. (E-F) Immunofluorescence staining, \u003cem\u003eMyHC \u003c/em\u003eimmunofluorescence staining was performed in MDSCs to detect myotube formation. Nuclei were stained with DAPI. (Scale bar = 100 μm).\u003cstrong\u003e \u003c/strong\u003e(G) The fusion index (percentage of nuclei in fused myotubes to total nuclei) was calculated in (Fig.4.E-F). (*p\u0026lt;0.05, **p\u0026lt;0.01,***p\u0026lt;0.01).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4300013/v1/13e386a1ba2eba7837e5f7d0.png"},{"id":55253021,"identity":"465661e2-bd0d-4e1e-837d-2e0d7731c69b","added_by":"auto","created_at":"2024-04-24 18:04:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":190443,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003eaffects the activation of the \u003cem\u003eERK 1/2\u003c/em\u003e signaling pathway. (A-B)\u003cstrong\u003e \u003c/strong\u003eMDSCs were transfected with pcDNA3.1-\u003cem\u003eIFRD2\u003c/em\u003e or RNA-H1.1/Shuttle-RFP-sh1 and sh2, and induced differentiation for 3 days. Treated cells were lysed and analyzed using protein blotting with antibodies against phospho-\u003cem\u003eERKl/2 \u003c/em\u003e(Thr 202/Tyr 204), \u003cem\u003eERKl/2\u003c/em\u003e, and \u003cem\u003eβ-actin\u003c/em\u003e as a supersampling control. (C-D) MDSCs were transfected with pcDNA3.1-\u003cem\u003eIFRD2\u003c/em\u003e or RNA-H1.1/Shuttle-RFP-sh1 and sh2 and induced to differentiate for 3 days. Lysed treated cells were analyzed by protein blotting with antibodies against phospho-\u003cem\u003eNF-κB\u003c/em\u003e, phospho-\u003cem\u003eP53\u003c/em\u003e, \u003cem\u003eNF-κB\u003c/em\u003e, \u003cem\u003eP53\u003c/em\u003e, and \u003cem\u003eβ-actin\u003c/em\u003e as an oversampling control. The intensity of the blots was quantified using Image J software, and gray intensity analysis is shown on the right (NS: no significant difference, *p\u0026lt;0.05, **p\u0026lt;0.01).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4300013/v1/fd94269741c3e147d75f5d1f.png"},{"id":55253315,"identity":"69eaca3e-025c-42f2-94d6-de5955eb0ed5","added_by":"auto","created_at":"2024-04-24 18:12:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1015794,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4300013/v1/18643b4d-e709-4564-8852-318d52dfad84.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"IFRD2 regulates myogenic differentiation of bovine skeletal muscle satellite cells through the ERK1/2 pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSkeletal muscle is the largest tissue in mammals, accounting for approximately 40% of the overall mass, and maintains the body's basic functions such as metabolism, respiration, and locomotion (Egan \u0026amp; Zierath, 2013; Greggio et al., 2017; Salvatore, Simonides, Dentice, Zavacki, \u0026amp; Larsen, 2014). Skeletal muscle has a special ability to regenerate, and the mediators of its regeneration are a group of small adult stem cells, called satellite cells, located basement membrane of the muscle fibers (Dumont, Bentzinger, Sincennes, \u0026amp; Rudnicki, 2015). Under normal physiological conditions, muscle satellite cells are resting. However, upon stimulation, adult myoblasts with the ability to proliferate and differentiate end up forming mature muscle fibers under the regulation of MRFs, which are the regulators of myogenic differentiation, including factors such as \u003cem\u003eMyoD\u003c/em\u003e, \u003cem\u003eMyf5\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e, \u003cem\u003eMRF4\u003c/em\u003e, and \u003cem\u003eMyHC\u003c/em\u003e (Baghdadi \u0026amp; Tajbakhsh, 2018; Mukund \u0026amp; Subramaniam, 2020; Sousa-Victor, Garc\u0026iacute;a-Prat, \u0026amp; Mu\u0026ntilde;oz-C\u0026aacute;noves, 2022). However, many unknown regulatory mechanisms still need to be studied in depth.\u003c/p\u003e \u003cp\u003emiRNA (microRNA) is a small molecule RNA with a length of about 22 nucleotides, which is widely found in eukaryotic organisms and is involved in many biological processes such as cell proliferation, apoptosis, and differentiation(Kabekkodu et al., 2018). \u003cem\u003emiR-1\u003c/em\u003e and \u003cem\u003emiR-206\u003c/em\u003e are the muscle-specific miRNA molecules, that regulate the proliferation and differentiation of myoblasts by modulating the expression of target genes, thereby affecting the growth and development of skeletal muscle (Anderson, Catoe, \u0026amp; Werner, 2006; Chen et al., 2006; Ge \u0026amp; Chen, 2011). \u003cem\u003eMicroRNA-2400\u003c/em\u003e is a miRNA specifically expressed in cattle that negatively regulates \u003cem\u003eMyoG\u003c/em\u003e expression and promotes the proliferation of skeletal muscle SCs (Glazov et al., 2009; W. W. Zhang et al., 2015), its function can be inhibited by the novel cyclic RNA \u003cem\u003ecircMYL1\u003c/em\u003e (Elnour et al., 2021). In addition, \u003cem\u003emiR-2400\u003c/em\u003e mediated \u003cem\u003eSUMO1\u003c/em\u003e and \u003cem\u003ePRDM11\u003c/em\u003e to promote the proliferation of bovine preadipocytes(Wei, Cui, Tong, Zhang, \u0026amp; Yan, 2016; Y. Zhang et al., 2021), but the mechanism by which \u003cem\u003emiR-2400\u003c/em\u003e regulates the proliferation and differentiation of bovine skeletal muscle satellite cells remains unclear.\u003c/p\u003e \u003cp\u003eThe interferon-related developmental regulators (\u003cem\u003eIFRD\u003c/em\u003e) family is involved in a variety of physiological and pathological regulatory processes. The family consists of two family members, \u003cem\u003eIFRD1\u003c/em\u003e and \u003cem\u003eIFRD2\u003c/em\u003e, which are relatively conserved during evolution. It has been shown that \u003cem\u003eIFRD\u003c/em\u003e1 is involved in the developmental processes of neuronal cells(Tirone \u0026amp; Shooter, 1989), intestinal cells (Yu et al., 2010), myocytes(Lammirato et al., 2016; Micheli et al., 2011) and adipocytes(Nakamura et al., 2013; Park et al., 2017). \u003cem\u003eIFRD2\u003c/em\u003e (\u003cem\u003eSKMc15\u003c/em\u003e) has been reported to act as a novel ribosome-binding protein capable of inhibiting translation and thus regulating gene expression (Brown, Baird, Yip, Murray, \u0026amp; Shao, 2018); and can influence the process of lipogenesis through \u003cem\u003eDLK1\u003c/em\u003e (Vietor et al., 2023).\u003c/p\u003e \u003cp\u003eAmong the signaling pathways involved in myogenesis, the extracellular signal-regulated kinase 1/2 (\u003cem\u003eERK1/2\u003c/em\u003e) pathway plays an important role (Cheng et al., 2023; Oishi, Ogata, Ohira, \u0026amp; Roy, 2019). This pathway, as well as members of the mitogen-activated protein kinase (\u003cem\u003eMAPK\u003c/em\u003e) pathway, is involved in the regulation of many cellular processes such as cell growth, differentiation, apoptosis, and necrosis (Sun et al., 2015). Previous studies have shown that \u003cem\u003eERK1/2\u003c/em\u003e is required for myoblast cell proliferation and differentiation (Jones, Fedorov, Rosenthal, \u0026amp; Olwin, 2001), Activated \u003cem\u003eERK1/2\u003c/em\u003e signaling negatively regulates the myoblast differentiation process (Lake, Corr\u0026ecirc;a, \u0026amp; M\u0026uuml;ller, 2016).\u003c/p\u003e \u003cp\u003eIn this study, we identified \u003cem\u003eIFRD2\u003c/em\u003e as a \u003cem\u003emiR-2400\u003c/em\u003e target gene and was significantly upregulated during the myogenic differentiation of bovine skeletal muscle satellite cells. Using knockdown and overexpression tools, we found that \u003cem\u003eIFRD2\u003c/em\u003e affects the process of bovine skeletal muscle proliferation and differentiation by regulating \u003cem\u003eERK1/2\u003c/em\u003e phosphorylation.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and differentiation\u003c/h2\u003e \u003cp\u003eBovine skeletal MDSCs were collected from the hind limb muscles of newborn Chinese Simmental cattle according to the method described by Tong et al (Tong et al., 2015)and cultured in Dulbecco's modified Eagle medium (DMEM) containing 15% fetal bovine serum (FBS; Vivacell), 100 U/mL penicillin and 100 \u0026micro;g/mL streptomycin in a humidified 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% air incubator. For differentiation, MDSCs were seeded at a density of 4 x 10\u003csup\u003e5\u003c/sup\u003e cells/60 mm dish and cultured for 24 hours in DMEM-filled dishes to allow them to adhere to the dish; this stage was defined as the undifferentiated/proliferative phase (P). The attached cells were then cultured in a differentiation medium (DM) consisting of 2% horse serum (Biological Industries), 100 U/ml penicillin 100 \u0026micro;g/ml streptomycin. After 1, 2, 3, 4, and 5 days of culture in the differentiation medium, MDSCs were collected.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePlasmid construction.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFor the IFRD2 3\u0026prime;-UTR reporter assay, the entire 3\u0026prime;-UTR of bovine \u003cem\u003eIFRD2\u003c/em\u003e was PCR-amplified from bovine cDNA and cloned into the psiCHECK-2 dual luciferase reporter plasmid (Promega, Madison, WI, USA) to generate the psiCHECK-\u003cem\u003eIFRD2\u003c/em\u003e-3\u0026prime;-UTR reporter plasmid. The mutant bovine \u003cem\u003eIFRD2\u003c/em\u003e 3\u0026prime;-UTR reporter was named psiCHECK-\u003cem\u003eIFRD2\u003c/em\u003e-3\u0026prime;-UTR-mut, respectively, and they were generated by nested PCR mutagenesis of the seed region of the predicted \u003cem\u003ebta-miR-2400\u003c/em\u003e motif, with the binding site mutated from UGUGCUG to ACACGAC.\u003c/p\u003e \u003cp\u003eTo exogenously overexpress \u003cem\u003eIFRD2\u003c/em\u003e, the coding sequence (CDS) of \u003cem\u003eIFRD2\u003c/em\u003e (NM_001077012) was cloned into the pcDNA3.1 vector and named pcDNA3.1-\u003cem\u003eIFRD2.\u003c/em\u003e The overexpression vector of bovine \u003cem\u003eIFRD2\u003c/em\u003e was constructed using seamless cloning. The full-length coding sequence of bovine \u003cem\u003eIFRD2\u003c/em\u003e was amplified using PCR with the following primers: forward 5'- CTT GGT ACC GAG CTC GGA TCC ATG CCC CGC GCC CGA AAA \u0026minus;\u0026thinsp;3' and reverse 5'- TGC TGG ATA TCT GCA GAA TTC TCA CAG GAC GTC GGC CCG \u0026minus;\u0026thinsp;3'. The pcDNA3.1(+) vector was linearized with BamH Ⅰ, EcoR Ⅰ. The seamless cloning reaction was performed using ClonExpress II One Step Cloning kit C112 (Vazyme Biotech Co., Ltd.). pcDNA3.1-\u003cem\u003eIFRD2\u003c/em\u003e did not have the 3\u0026prime;-UTR of \u003cem\u003eIFRD2\u003c/em\u003e cloned in it. therefore, \u003cem\u003emiR-2400\u003c/em\u003e-mimic and \u003cem\u003emiR-2400\u003c/em\u003e-inhitibor do not affect the overexpression of \u003cem\u003eIFRD2\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThe shRNAs for \u003cem\u003eIFRD2\u003c/em\u003e were designed using the online software: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://rnaiddesigner.invitrogen.com/rnaiexpress(Table.1)\u003c/span\u003e\u003cspan address=\"https://rnaiddesigner.invitrogen.com/rnaiexpress(Table.1)\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. The annealed shRNA was inserted into the pRNA-H1.1/Shuttle-RFP vector.\u003c/p\u003e \u003cp\u003eAll recombinant vectors were confirmed by sequencing after construction in Sangon Biotech Co., Ltd. (Shanghai, China).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTarget sequence of \u003cem\u003eIFRD2\u003c/em\u003e shRNA oligo\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOligo\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eshRNA oligo 5ˊ-- 3ˊ\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-shRNA1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCCACCATCGCCTTGCTCTTTGAGCGAACTCAAAGAGCAAGGCGATGGTTTTTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-shRNA1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTCAAAAAAACCATCGCCTTGCTCTTTGAGTTCGCTCAAAGAGCAAGGCGATGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-shRNA2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCCGGAGGACTTTGTTTACGAGGACGAATCCTCGTAAACAAAGTCCTCCTTTTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-shRNA2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTCAAAAAAGGAGGACTTTGTTTACGAGGATTCGTCCTCGTAAACAAAGTCCTCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-shRNA3-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATCCGCACCACCACCTTCAGAACAACGAATTGTTCTGAAGGTGGTGGTGCTTTTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-shRNA3-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTCAAAAAAGCACCACCACCTTCAGAACAATTCGTTGTTCTGAAGGTGGTGGTGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eLuciferase reporter assay.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe luciferase assay was used to determine whether \u003cem\u003eIFRD2\u003c/em\u003e is a target gene of \u003cem\u003emiR-2400.\u003c/em\u003e HEK293 cells (2.0\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells per well) were placed in 24-well plates (Corning, NY, USA) 24 h before transfection. Cells were co-transfected with 500 ng of psiCHECK-2-\u003cem\u003eIFRD2\u003c/em\u003e, psiCHECK-2- \u003cem\u003eIFRD2\u003c/em\u003e-mut, or empty vector psiCHECK-2 and pcDNA3.1, pcDNA3.1-\u003cem\u003emiR-2400\u003c/em\u003e, \u003cem\u003emiR-2400\u003c/em\u003e-NC, or \u003cem\u003emiR-2400\u003c/em\u003e-I. Forty-eight hours after transfection, cells were lysed with passive lysis buffer (Promega), the firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System with a GloMax 20/20 light meter (Promega) according to the manufacturer's protocol.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell proliferation assay.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCell proliferation was assessed by EdU binding and flow cytometry. MDSCs were inoculated and transfected with pcDNA3.1, pcDNA3.1-\u003cem\u003eIFRD2\u003c/em\u003e, pRNA-H1.1/Shuttle-RFP and pRNA-H1.1/Shuttle-RFP-\u003cem\u003eIFRD2\u003c/em\u003e. Proliferating cells were determined using Cell-Light \u0026trade; EdU Apollo\u0026reg; 488. In quantitative analysis, each data point represents a positive fluorescent region calculated from at least five regions randomly selected from three experiments.\u003c/p\u003e \u003cp\u003eCell cycle flow cytometry was performed 48 h after transfection with pcDNA3.1, pcDNA3.1-\u003cem\u003eIFRD2\u003c/em\u003e, pRNA-H1.1/Shuttle-RFP, and pRNA-H1.1/Shuttle-RFP-\u003cem\u003eIFRD2\u003c/em\u003e. Trypsin-digested cells were fixed for 24 hours in 70% (v/v) ethanol at 4\u0026deg;C. Cells were then incubated in 50 mg/mL propidium iodide solution (100 mg/mL RNase A and 0.2% (v/v) Triton X-100) at 4\u0026deg;C for 30 min. MDSCs were analyzed using Cytomics\u0026trade; FC 500 and CXP software (Beckman Coulter, Brea, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence staining\u003c/h2\u003e \u003cp\u003eFor immunofluorescence staining, cultured cells were fixed in 4% paraformaldehyde (PFA) at -4\u0026deg;C for 30 minutes and then incubated in blocking buffer (5% BSA, 0.2% Triton X-100, and PBS) at 37\u0026deg;C for 1 hour. Cells were then treated with primary rabbit anti-human \u003cem\u003eIFRD2\u003c/em\u003e antibody (1:50; Cat No. 26952-1-AP; Proteintech Group, Inc.), \u003cem\u003eMyHC\u003c/em\u003e (Cat.no. AF7530, Beyotime Institute of Biotechnology) for 12 h at 4\u0026deg;C. Cells were washed three times with PBST and incubated with Alexa Fluor 488-coupled goat anti-rabbit secondary antibody (1:100; Cat. no. 111-545-003 Jackson ImmunoResearch Laboratories, Inc.) for 1 h at room temperature, and DAPI was incubated for 5 min at room temperature. Cells were again rinsed three times with PBST before observation, and examined under an upright microscope (IX71, Olympus, Tokyo, Japan). Images were analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eTotal RNA extraction and real-time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from transfected MDSCs, using TRIzol Reagent (Invitrogen), according to the manufacturer\u0026rsquo;s instructions. The concentration of total RNA was determined spectrophotometrically using a NanoDrop 2000C Spectrophotometer (Thermo, USA). According to the manufacturer's instructions, the first-strand cDNA was synthesized from 1 \u0026micro;g of total RNA from each sample using TransScript\u0026reg; One-Step gDNA Removal and cDNA Synthesis Super Mix (Beijing TransGen Biotech Co., Ltd.). TB Green\u0026reg; Premix Ex Taq\u0026trade; (Tli RNase H Plus; cat. no. RR820A, Takara Bio Inc. Beijing) was used to determine the mRNA expression levels of the \u003cem\u003eIFRD2\u003c/em\u003e, \u003cem\u003eMyoG\u003c/em\u003e, \u003cem\u003eCCND2\u003c/em\u003e, and \u003cem\u003eCCNB1\u003c/em\u003e genes. Thermal cycling conditions were as follows: 95˚C for 2 min, followed by 40 cycles: 95˚C for 15 s and 60˚C for 30 s. The bovine β-actin gene was used as an endogenous control for data normalization. The sequences of primers used are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Experiments were calculated following the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer name and sequence\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003esequence 5ˊ-3ˊ\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGTCTGCTCCCCGACTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIFRD2\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCTCGCCCTTGCCTTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCCNB1\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGATGGAACTAACTATGCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCCNB1\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATAACAACGAGAAGGGATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCCND2\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGCAAGTTGAAATGGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCCND2\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCATCGACGGCGGGTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMyoG\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACTCAAGAAGGTGAATGAAGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMyoG\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTATTATAGTGCGCTGCCCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCTCTACGCCAACACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGCTAACAGTCCGCCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eProtein extraction and western blot analysis\u003c/h2\u003e \u003cp\u003eThe whole cell lysate was extracted using RIPA Lysis Buffer (Art. No. P0013B, Biotek Biotechnology Institute). Lysates were centrifuged at 13,000\u0026times;g for 15 minutes at 4˚C. The supernatant was collected and protein concentration was determined using the BCA Protein Assay Kit (Beyotime Institute of Biotechnology). The protein supernatant was denatured with SDS-PAGE Sample Loading Buffer (Beyotime Institute of Biotechnology) and boiled for 10 minutes at 95 ℃. Proteins (12 \u0026micro;g/lane) were loaded, separated by 10% SDS-PAGE, and transferred to a PVDF membrane (Millipore Corporation, Billerica, MA, USA). The membranes were blocked with 5% (w/v) nonfat milk in PBS buffer containing 0.05% Tween-20 for 1 h at room temperature and then overnight at 4˚C with primary antibodies as follows: \u003cem\u003eIFRD2\u003c/em\u003e(1:2,000; Cat No. 26952-1-AP; Proteintech Group, Inc.), \u003cem\u003eCCNB1\u003c/em\u003e (1:1500; cat. no. bs-23016R; Bioss), \u003cem\u003eCCND2\u003c/em\u003e(1:1500; Cat No. 10934-1-AP; Proteintech Group, Inc.), \u003cem\u003eMyoG\u003c/em\u003e (1:1000; cat. no. AF7542, Beyotime Institute of Biotechnology) and \u003cem\u003eβ-actin\u003c/em\u003e (1:10,000; cat. no. ab8227; Abcam). The sample was then incubated with IRDye\u0026reg; 800CW goat anti-rabbit IgG secondary antibody (1:15,000; Cat. no: 926-32211, LI-COR Biosciences) or IRDye 800CW goat anti-mouse IgG secondary antibody (1:15,000; Cat. No: 926-32210, LI-COR Biosciences) for 90 min at 20\u0026ndash;25˚C and rinsed with PBS. The immunoblots were visualized using the Odyssey IR Imaging System (LI-COR Biosciences).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll results are expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Representative bands were selected from independent western blotting experiments. When data distributions approximated normality and two groups were compared, a Student\u0026rsquo;s t-test was performed to evaluate the significance of differences. Differences were regarded as significant at a level of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. All statistical tests were performed using Prism software (GraphPad).\u003c/p\u003e \u003c/div\u003e"},{"header":"Result","content":"\u003cp\u003e \u003cb\u003emiR-2400\u003c/b\u003e \u003cb\u003etargets the 3'UTR of\u003c/b\u003e \u003cb\u003eIFRD2\u003c/b\u003e \u003cb\u003eand inhibits its expression.\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003emiR-2400\u003c/em\u003e promotes the proliferation of bovine skeletal muscle satellite cells(W. W. Zhang et al., 2015), To investigate its mechanism of action, we predicted the possible target genes of \u003cem\u003emiR-2400\u003c/em\u003e, and the results showed that \u003cem\u003emiR-2400\u003c/em\u003e targets \u003cem\u003eIFRD2\u003c/em\u003e, its binding site is located at positions 320\u0026ndash;326 of the 3' untranslated region of \u003cem\u003eIFRD2\u003c/em\u003e mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Dual-luciferase reporter gene assay showed that overexpression of \u003cem\u003emiR-2400\u003c/em\u003e significantly reduced the luciferase activity of wild-type psiCHECK-2-\u003cem\u003eIFRD2\u003c/em\u003e-WT plasmid (WT) compared with the control, whereas overexpression of \u003cem\u003emiR-2400\u003c/em\u003e did not have a major effect on the mutant psiCHECK-2-\u003cem\u003eIFRD2\u003c/em\u003e-MUT plasmid (MUT) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). In addition, the addition of both \u003cem\u003emiR-2400\u003c/em\u003e overexpression and inhibitor (pcDNA3. 1(+)-miRNA-2400\u0026thinsp;+\u0026thinsp;psiCHECK-2-\u003cem\u003eIFRD2\u003c/em\u003e-wt\u0026thinsp;+\u0026thinsp;miR-2400-1) did not significantly change the luciferase activity compared to the control (pcDNA3. 1(+)-\u003cem\u003emiRNA-2400\u003c/em\u003e\u0026thinsp;+\u0026thinsp;psiCHECK-2-\u003cem\u003eIFRD2\u003c/em\u003e-wt\u0026thinsp;+\u0026thinsp;\u003cem\u003emiR-2400\u003c/em\u003e-1) However, the addition of \u003cem\u003emiR-2400\u003c/em\u003e overexpression (pcDNA3. 1(+)-miRNA-2400\u0026thinsp;+\u0026thinsp;psiCHECK-2-\u003cem\u003eIFRD2\u003c/em\u003e-wt) resulted in a significant decrease in luciferase activity compared with the control group, suggesting that \u003cem\u003emiR-2400\u003c/em\u003e inhibits the expression of luciferase activity by binding to the 3'UTR region of \u003cem\u003eIFRD2\u003c/em\u003e and that the addition of \u003cem\u003emiR-2400\u003c/em\u003e inhibitor can remove this inhibition. \u003cem\u003emiR-2400\u003c/em\u003e inhibitor relieved this inhibition (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Using qRT-PCR and Western Blot techniques, it was found that overexpression, as well as inhibition of \u003cem\u003emiR-2400\u003c/em\u003e, would result in altered endogenous expression of \u003cem\u003eIFRD2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee-f). The results suggest that \u003cem\u003eIFRD2\u003c/em\u003e is a downstream target gene of \u003cem\u003emiR-2400\u003c/em\u003e and is negatively regulated by \u003cem\u003emiR-2400\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIFRD2\u003c/b\u003e \u003cb\u003eis expressed during the differentiation of bovine skeletal muscle satellite cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003emiR-2400\u003c/em\u003e promotes proliferation(W. W. Zhang et al., 2015), and inhibits \u003cem\u003eIFRD2\u003c/em\u003e expression in bovine skeletal muscle satellite cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), so we hypothesized that \u003cem\u003eIFRD2\u003c/em\u003e may play a role in the differentiation process. Based on this speculation we examined the expression level of \u003cem\u003eIFRD2\u003c/em\u003e in myoblast differentiation. qRT-PCR analysis revealed that \u003cem\u003eIFRD2\u003c/em\u003e mRNA was most highly expressed on day 3 of the differentiation process, which was also confirmed by Western blot results (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C). We further examined the levels of \u003cem\u003eIFRD2\u003c/em\u003e in cultured bovine skeletal muscle satellite cells by immunofluorescence staining. The results showed that on day 1 of differentiation, \u003cem\u003eIFRD2\u003c/em\u003e was detected in adult myoblasts, whereas on day 3, \u003cem\u003eIFRD2\u003c/em\u003e was significantly expressed in newly formed myotubes, accompanied by an increase in the expression of \u003cem\u003eIFRD2\u003c/em\u003e protein in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). These results suggest that \u003cem\u003eIFRD2\u003c/em\u003e is enriched in differentiated myoblasts and myofibers and may be involved in the proliferation and differentiation process of bovine skeletal muscle satellite cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIFRD2\u003c/b\u003e \u003cb\u003einhibits the proliferation of bovine skeletal muscle satellite cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo evaluate whether \u003cem\u003eIFRD2\u003c/em\u003e affected the proliferation of bovine skeletal muscle satellite cells, we examined the proliferation of MDSCs after \u003cem\u003eIFRD2\u003c/em\u003e knockdown and overexpression, the results showed that \u003cem\u003eIFRD2\u003c/em\u003e overexpression reduced the rate of EdU-fluorescent cells compared to control cells, and knockdown of \u003cem\u003eIFRD2\u003c/em\u003e yielded the opposite result plots (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). Using MTT assay to analyze cell viability, we found that ectopic expression of \u003cem\u003eIFRD2\u003c/em\u003e significantly reduced cell viability in bovine skeletal muscle satellite cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), and knockdown of \u003cem\u003eIFRD2\u003c/em\u003e led to an increase in cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). In addition to the changes in cell phenotype, the results of qRT-PCR and Western Blot showed that overexpression of \u003cem\u003eIFRD2\u003c/em\u003e reduced the mRNA as well as protein expression levels of cell proliferation marker genes (\u003cem\u003ecyclin D2\u003c/em\u003e, \u003cem\u003ecyclin B1\u003c/em\u003e) compared to control cells, and knockdown with \u003cem\u003eIFRD2\u003c/em\u003e elevated their expression profiles (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-G). In addition, the results of flow cytometry showed that gain and loss of \u003cem\u003eIFRD2\u003c/em\u003e affected the cell cycle changes in bovine skeletal muscle satellite cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH), and its overexpression acted to arrest the cells in the G1 phase. In conclusion, the combination of the phenotypes, proliferation marker genes, and cell cycle results described above confirm that \u003cem\u003eIFRD2\u003c/em\u003e will inhibit the proliferative process of bovine skeletal muscle satellite cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIFRD2\u003c/b\u003e \u003cb\u003epromotes satellite cell differentiation in bovine skeletal muscle\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMyogenic differentiation of skeletal muscle through a coordinated process of proliferation and differentiation (Zhu \u0026amp; Skoultchi, 2001). Therefore, we discussed the effects of \u003cem\u003eIFRD2\u003c/em\u003e on bovine skeletal muscle satellite cell differentiation and myotube formation. First, we found that knockdown of \u003cem\u003eIFRD2\u003c/em\u003e reduced the expression level of the differentiation signature gene \u003cem\u003eMyoG\u003c/em\u003e at both the mRNA and protein levels, \u003cem\u003eMyoG\u003c/em\u003e gene expression was promoted after overexpression of \u003cem\u003eIFRD2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-D). In addition, the immunofluorescence assay for \u003cem\u003eMyHC\u003c/em\u003e showed that the differentiation degree of IFRD2 overexpressing cells was significantly higher than that of the interfering group, which was confirmed by the number of myotubes and the fusion rate (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-G). Overall, the above results indicated that \u003cem\u003eIFRD2\u003c/em\u003e promoted the differentiation of bovine skeletal muscle satellite cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIFRD2\u003c/b\u003e \u003cb\u003emediates the ERK 1/2 signaling pathway in bovine skeletal muscle satellite cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo analyze the molecular mechanism of \u003cem\u003eIFRD2\u003c/em\u003e to promote differentiation in bovine skeletal muscle satellite cells we evaluated the changes in the phosphorylation levels of \u003cem\u003eERK 1/2\u003c/em\u003e, \u003cem\u003eNF-κB\u003c/em\u003e, and \u003cem\u003eP53\u003c/em\u003e proteins in bovine skeletal muscle satellite cells after overexpression and knockdown of \u003cem\u003eIFRD2\u003c/em\u003e via the differentiation stage. As previously described, the \u003cem\u003eERK 1/2\u003c/em\u003e signaling pathway is involved in the process of skeletal muscle proliferation and differentiation (Oishi et al., 2019). Overexpression and knockdown with \u003cem\u003eIFRD2\u003c/em\u003e, differentiation treatment for 3 days resulted in suppression of phosphorylated-\u003cem\u003eERK 1/2\u003c/em\u003e (Thr 202/Tyr 204) levels in overexpression-treated bovine skeletal muscle satellite cells compared with control cells; In contrast, activation of phospho-\u003cem\u003eERK 1/2\u003c/em\u003e was promoted after knockdown with the \u003cem\u003eIFRD2\u003c/em\u003e gene(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). However, overexpression and knockdown with \u003cem\u003eIFRD2\u003c/em\u003e did not affect \u003cem\u003eNF-κB\u003c/em\u003e and \u003cem\u003eP53\u003c/em\u003e protein phosphorylation levels in MDSCs༈Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D༉. In conclusion, our data suggest that \u003cem\u003eIFRD2\u003c/em\u003e regulates myogenic differentiation of bovine skeletal muscle satellite cells by modulating the \u003cem\u003eERK 1/2\u003c/em\u003e signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eProbing myogenic regulators in myogenesis can help to find novel molecular targets to improve muscle regeneration and muscle disease (Peng et al., 2021). MicroRNAs (miRNAs) can affect muscle regeneration through synergistic as well as antagonistic interactions with myogenic factors in a complex regulatory network during muscle generation (Ballarino, Morlando, Fatica, \u0026amp; Bozzoni, 2016). This study demonstrated that \u003cem\u003ebta-miR-2400\u003c/em\u003e could target the 3'UTR region of \u003cem\u003eIFRD2\u003c/em\u003e and inhibit its expression. In addition, \u003cem\u003eIFRD2\u003c/em\u003e was significantly induced during the myogenic differentiation of bovine skeletal muscle satellite cells, and gain and loss of function studies of the \u003cem\u003eIFRD2\u003c/em\u003e gene demonstrated that \u003cem\u003eIFRD2\u003c/em\u003e was able to inhibit the proliferation of bovine skeletal muscle satellite cells to promote their differentiation.\u003c/p\u003e \u003cp\u003eOn the effect of the interferon-related developmental regulator (\u003cem\u003eIFRD\u003c/em\u003e) family on skeletal muscle proliferation and differentiation. Previous studies have shown that the transcription factor \u003cem\u003eIFRD1\u003c/em\u003e, a member of the same family, influences the differentiation process in C2C12 cells (Guardavaccaro, Ciotti, Sch\u0026auml;fer, Montagnoli, \u0026amp; Tirone, 1995). Combining the gene expression patterns annotated in the bgee.org database with this experimental study suggests that \u003cem\u003eIFRD2\u003c/em\u003e functions in skeletal muscle development. These findings also confirmed that \u003cem\u003eIFRD2\u003c/em\u003e as a target gene of \u003cem\u003ebta-miR-2400\u003c/em\u003e promoted myogenic differentiation of bovine skeletal muscle satellite cells. Interestingly, the presence of \u003cem\u003eIFRD2\u003c/em\u003e as an inhibitory factor during cell proliferation can be attributed to the fact that the differentiation process of myoblasts requires exit from the cell cycle (Dumont et al., 2015), This study demonstrated that \u003cem\u003eIFRD2\u003c/em\u003e overexpression acts as a regulatory signal of the cell cycle arresting myoblasts in the G1 phase, inhibiting cell proliferation, and controlling the transition of adult myoblasts from a proliferative to a differentiated state. Such results all confirm that \u003cem\u003eIFRD2\u003c/em\u003e is a myogenic regulator during the proliferation and differentiation of bovine skeletal muscle satellite cells.\u003c/p\u003e \u003cp\u003eTo investigate the mechanism of action of \u003cem\u003eIFRD2\u003c/em\u003e, changes in \u003cem\u003eNF-κB\u003c/em\u003e, and \u003cem\u003eP53\u003c/em\u003e proteins and \u003cem\u003eERK1/2\u003c/em\u003e pathways were examined, and the results showed no changes in \u003cem\u003eNF-κB\u003c/em\u003e, and \u003cem\u003eP53\u003c/em\u003e proteins. Interestingly, our data show that bovine skeletal muscle satellite cells treated with expression of \u003cem\u003eIFRD2\u003c/em\u003e exhibit decreased levels of phosphorylated \u003cem\u003eERK 1/2\u003c/em\u003e (Thr 202/Tyr 204). The \u003cem\u003eERK 1/2\u003c/em\u003e signaling pathway plays an important role in cell proliferation, differentiation, and apoptosis. In addition, \u003cem\u003eERK 1/2\u003c/em\u003e activity has been reported to be associated with cell proliferation (Roskoski, 2012). Therefore, based on the effects of \u003cem\u003eIFRD2\u003c/em\u003e on bovine skeletal muscle satellite cells, we hypothesized that \u003cem\u003eERK1/2\u003c/em\u003e may play a role in \u003cem\u003eIFRD2\u003c/em\u003e-induced inhibition of myogenic differentiation. \u003cem\u003eWhen\u003c/em\u003e the \u003cem\u003eERK 1/2\u003c/em\u003e signaling pathway is activated, skeletal muscle cell proliferation is enhanced but negatively regulates myogenic differentiation (Jones et al., 2001). \u003cem\u003eIFRD2\u003c/em\u003e silencing significantly increased \u003cem\u003eERK 1/2\u003c/em\u003e (Thr 202/Tyr 204) phosphorylation levels in bovine skeletal muscle satellite cells. \u003cem\u003eIFRD2\u003c/em\u003e overexpression experiments demonstrated that \u003cem\u003eIFRD2\u003c/em\u003e promotes the differentiation of bovine skeletal muscle satellite cells and that the level of \u003cem\u003eERK 1/2\u003c/em\u003e phosphorylation was inhibited.\u003c/p\u003e \u003cp\u003eIn conclusion, our studies based on bovine skeletal muscle satellite cells confirmed that the \u003cem\u003eIFRD2\u003c/em\u003e is a target gene of \u003cem\u003ebta-miR-2400\u003c/em\u003e and is involved in myogenic differentiation of bovine skeletal muscle satellite cells. However, there are still several limitations to be addressed in future research. First, the in vivo function of \u003cem\u003eIFRD2\u003c/em\u003e needs to be studied using a conditional knockout model, which is not currently available. Second, experiments confirmed that \u003cem\u003eIFRD2\u003c/em\u003e can affect the phosphorylation level of \u003cem\u003eERK1/2\u003c/em\u003e to influence myogenic differentiation, but its downstream regulatory network still needs to be further explored.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of Heilongjiang Province (Grant No. LH2021C099), Scientific Research Fund of Heilongjiang Provincial Education Department (Grant No.145209515), Qiqihar University Graduate Student Innovative Research Program (Grant No. YJSCX2022024).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical statement.\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Animal Care Commission of Qiqihar University and Heilongjiang, P.R. China approved the protocol utilized in this study to harvest cells from animal tissues. Skeletal muscle tissues from newborn Chinese Simmental calves were obtained from the Shuangcheng abattoir, a local slaughterhouse in Heilongjiang, P.R. China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAnderson, C., Catoe, H., \u0026amp; Werner, R. (2006). MIR-206 regulates connexin43 expression during skeletal muscle development. \u003cem\u003eNucleic Acids Res, 34\u003c/em\u003e(20), 5863-5871. doi:10.1093/nar/gkl743\u003c/li\u003e\n\u003cli\u003eBaghdadi, M. B., \u0026amp; Tajbakhsh, S. (2018). Regulation and phylogeny of skeletal muscle regeneration. \u003cem\u003eDev Biol, 433\u003c/em\u003e(2), 200-209. doi:10.1016/j.ydbio.2017.07.026\u003c/li\u003e\n\u003cli\u003eBallarino, M., Morlando, M., Fatica, A., \u0026amp; Bozzoni, I. (2016). Non-coding RNAs in muscle differentiation and musculoskeletal disease. \u003cem\u003eJ Clin Invest, 126\u003c/em\u003e(6), 2021-2030. doi:10.1172/jci84419\u003c/li\u003e\n\u003cli\u003eBrown, A., Baird, M. R., Yip, M. C., Murray, J., \u0026amp; Shao, S. (2018). Structures of translationally inactive mammalian ribosomes. \u003cem\u003eElife, 7\u003c/em\u003e. doi:10.7554/eLife.40486\u003c/li\u003e\n\u003cli\u003eChen, J. F., Mandel, E. M., Thomson, J. M., Wu, Q., Callis, T. E., Hammond, S. M., . . . Wang, D. Z. (2006). The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. \u003cem\u003eNat Genet, 38\u003c/em\u003e(2), 228-233. doi:10.1038/ng1725\u003c/li\u003e\n\u003cli\u003eCheng, C., Zhang, S., Gong, Y., Wang, X., Tang, S., Wan, J., . . . Yao, L. H. (2023). Cordycepin inhibits myogenesis via activating the ERK1/2 MAPK signalling pathway in C2C12 cells. \u003cem\u003eBiomed Pharmacother, 165\u003c/em\u003e, 115163. doi:10.1016/j.biopha.2023.115163\u003c/li\u003e\n\u003cli\u003eDumont, N. A., Bentzinger, C. F., Sincennes, M. C., \u0026amp; Rudnicki, M. A. (2015). Satellite Cells and Skeletal Muscle Regeneration. \u003cem\u003eCompr Physiol, 5\u003c/em\u003e(3), 1027-1059. doi:10.1002/cphy.c140068\u003c/li\u003e\n\u003cli\u003eEgan, B., \u0026amp; Zierath, J. R. (2013). Exercise metabolism and the molecular regulation of skeletal muscle adaptation. \u003cem\u003eCell Metab, 17\u003c/em\u003e(2), 162-184. doi:10.1016/j.cmet.2012.12.012\u003c/li\u003e\n\u003cli\u003eElnour, I. E., Wang, X., Zhansaya, T., Akhatayeva, Z., Khan, R., Cheng, J., . . . Chen, H. (2021). Circular RNA circMYL1 Inhibit Proliferation and Promote Differentiation of Myoblasts by Sponging miR-2400. \u003cem\u003eCells, 10\u003c/em\u003e(1). doi:10.3390/cells10010176\u003c/li\u003e\n\u003cli\u003eGe, Y., \u0026amp; Chen, J. (2011). MicroRNAs in skeletal myogenesis. \u003cem\u003eCell Cycle, 10\u003c/em\u003e(3), 441-448. doi:10.4161/cc.10.3.14710\u003c/li\u003e\n\u003cli\u003eGlazov, E. A., Kongsuwan, K., Assavalapsakul, W., Horwood, P. F., Mitter, N., \u0026amp; Mahony, T. J. (2009). Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection. \u003cem\u003ePLoS One, 4\u003c/em\u003e(7), e6349. doi:10.1371/journal.pone.0006349\u003c/li\u003e\n\u003cli\u003eGreggio, C., Jha, P., Kulkarni, S. S., Lagarrigue, S., Broskey, N. T., Boutant, M., . . . Amati, F. (2017). Enhanced Respiratory Chain Supercomplex Formation in Response to Exercise in Human Skeletal Muscle. \u003cem\u003eCell Metab, 25\u003c/em\u003e(2), 301-311. doi:10.1016/j.cmet.2016.11.004\u003c/li\u003e\n\u003cli\u003eGuardavaccaro, D., Ciotti, M. T., Sch\u0026auml;fer, B. W., Montagnoli, A., \u0026amp; Tirone, F. (1995). Inhibition of differentiation in myoblasts deprived of the interferon-related protein PC4. \u003cem\u003eCell Growth Differ, 6\u003c/em\u003e(2), 159-169. \u003c/li\u003e\n\u003cli\u003eJones, N. C., Fedorov, Y. V., Rosenthal, R. S., \u0026amp; Olwin, B. B. (2001). ERK1/2 is required for myoblast proliferation but is dispensable for muscle gene expression and cell fusion. \u003cem\u003eJ Cell Physiol, 186\u003c/em\u003e(1), 104-115. doi:10.1002/1097-4652(200101)186:1\u0026lt;104::Aid-jcp1015\u0026gt;3.0.Co;2-0\u003c/li\u003e\n\u003cli\u003eKabekkodu, S. P., Shukla, V., Varghese, V. K., J, D. S., Chakrabarty, S., \u0026amp; Satyamoorthy, K. (2018). Clustered miRNAs and their role in biological functions and diseases. \u003cem\u003eBiol Rev Camb Philos Soc, 93\u003c/em\u003e(4), 1955-1986. doi:10.1111/brv.12428\u003c/li\u003e\n\u003cli\u003eLake, D., Corr\u0026ecirc;a, S. A., \u0026amp; M\u0026uuml;ller, J. (2016). Negative feedback regulation of the ERK1/2 MAPK pathway. \u003cem\u003eCell Mol Life Sci, 73\u003c/em\u003e(23), 4397-4413. doi:10.1007/s00018-016-2297-8\u003c/li\u003e\n\u003cli\u003eLammirato, A., Patsch, K., Feiereisen, F., Maly, K., Nofziger, C., Paulmichl, M., . . . Vietor, I. (2016). TIS7 induces transcriptional cascade of methylosome components required for muscle differentiation. \u003cem\u003eBMC Biol, 14\u003c/em\u003e(1), 95. doi:10.1186/s12915-016-0318-6\u003c/li\u003e\n\u003cli\u003eMicheli, L., Leonardi, L., Conti, F., Maresca, G., Colazingari, S., Mattei, E., . . . Tirone, F. (2011). PC4/Tis7/IFRD1 stimulates skeletal muscle regeneration and is involved in myoblast differentiation as a regulator of MyoD and NF-kappaB. \u003cem\u003eJ Biol Chem, 286\u003c/em\u003e(7), 5691-5707. doi:10.1074/jbc.M110.162842\u003c/li\u003e\n\u003cli\u003eMukund, K., \u0026amp; Subramaniam, S. (2020). Skeletal muscle: A review of molecular structure and function, in health and disease. \u003cem\u003eWiley Interdiscip Rev Syst Biol Med, 12\u003c/em\u003e(1), e1462. doi:10.1002/wsbm.1462\u003c/li\u003e\n\u003cli\u003eNakamura, Y., Hinoi, E., Iezaki, T., Takada, S., Hashizume, S., Takahata, Y., . . . Yoneda, Y. (2013). Repression of adipogenesis through promotion of Wnt/\u0026beta;-catenin signaling by TIS7 up-regulated in adipocytes under hypoxia. \u003cem\u003eBiochim Biophys Acta, 1832\u003c/em\u003e(8), 1117-1128. doi:10.1016/j.bbadis.2013.03.010\u003c/li\u003e\n\u003cli\u003eOishi, Y., Ogata, T., Ohira, Y., \u0026amp; Roy, R. R. (2019). Phosphorylated ERK1/2 protein levels are closely associated with the fast fiber phenotypes in rat hindlimb skeletal muscles. \u003cem\u003ePflugers Arch, 471\u003c/em\u003e(7), 971-982. doi:10.1007/s00424-019-02278-z\u003c/li\u003e\n\u003cli\u003ePark, G., Horie, T., Kanayama, T., Fukasawa, K., Iezaki, T., Onishi, Y., . . . Hinoi, E. (2017). The transcriptional modulator Ifrd1 controls PGC-1\u0026alpha; expression under short-term adrenergic stimulation in brown adipocytes. \u003cem\u003eFebs j, 284\u003c/em\u003e(5), 784-795. doi:10.1111/febs.14019\u003c/li\u003e\n\u003cli\u003ePeng, Y., Yue, F., Chen, J., Xia, W., Huang, K., Yang, G., \u0026amp; Kuang, S. (2021). Phosphatase orphan 1 inhibits myoblast proliferation and promotes myogenic differentiation. \u003cem\u003eFaseb j, 35\u003c/em\u003e(1), e21154. doi:10.1096/fj.202001672R\u003c/li\u003e\n\u003cli\u003eRoskoski, R., Jr. (2012). ERK1/2 MAP kinases: structure, function, and regulation. \u003cem\u003ePharmacol Res, 66\u003c/em\u003e(2), 105-143. doi:10.1016/j.phrs.2012.04.005\u003c/li\u003e\n\u003cli\u003eSalvatore, D., Simonides, W. S., Dentice, M., Zavacki, A. M., \u0026amp; Larsen, P. R. (2014). Thyroid hormones and skeletal muscle--new insights and potential implications. \u003cem\u003eNat Rev Endocrinol, 10\u003c/em\u003e(4), 206-214. doi:10.1038/nrendo.2013.238\u003c/li\u003e\n\u003cli\u003eSousa-Victor, P., Garc\u0026iacute;a-Prat, L., \u0026amp; Mu\u0026ntilde;oz-C\u0026aacute;noves, P. (2022). Control of satellite cell function in muscle regeneration and its disruption in ageing. \u003cem\u003eNat Rev Mol Cell Biol, 23\u003c/em\u003e(3), 204-226. doi:10.1038/s41580-021-00421-2\u003c/li\u003e\n\u003cli\u003eSun, Y., Liu, W. Z., Liu, T., Feng, X., Yang, N., \u0026amp; Zhou, H. F. (2015). Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. \u003cem\u003eJ Recept Signal Transduct Res, 35\u003c/em\u003e(6), 600-604. doi:10.3109/10799893.2015.1030412\u003c/li\u003e\n\u003cli\u003eTirone, F., \u0026amp; Shooter, E. M. (1989). Early gene regulation by nerve growth factor in PC12 cells: induction of an interferon-related gene. \u003cem\u003eProc Natl Acad Sci U S A, 86\u003c/em\u003e(6), 2088-2092. doi:10.1073/pnas.86.6.2088\u003c/li\u003e\n\u003cli\u003eTong, H. L., Yin, H. Y., Zhang, W. W., Hu, Q., Li, S. F., Yan, Y. Q., \u0026amp; Li, G. P. (2015). Transcriptional profiling of bovine muscle-derived satellite cells during differentiation in vitro by high throughput RNA sequencing. \u003cem\u003eCell Mol Biol Lett, 20\u003c/em\u003e(3), 351-373. doi:10.1515/cmble-2015-0019\u003c/li\u003e\n\u003cli\u003eVietor, I., Cikes, D., Piironen, K., Vasakou, T., Heimd\u0026ouml;rfer, D., Gstir, R., . . . Huber, L. A. (2023). The negative adipogenesis regulator Dlk1 is transcriptionally regulated by Ifrd1 (TIS7) and translationally by its orthologue Ifrd2 (SKMc15). \u003cem\u003eElife, 12\u003c/em\u003e. doi:10.7554/eLife.88350\u003c/li\u003e\n\u003cli\u003eWei, Y., Cui, Y. F., Tong, H. L., Zhang, W. W., \u0026amp; Yan, Y. Q. (2016). MicroRNA-2400 promotes bovine preadipocyte proliferation. \u003cem\u003eBiochem Biophys Res Commun, 478\u003c/em\u003e(3), 1054-1059. doi:10.1016/j.bbrc.2016.08.038\u003c/li\u003e\n\u003cli\u003eYu, C., Jiang, S., Lu, J., Coughlin, C. C., Wang, Y., Swietlicki, E. A., . . . Rubin, D. C. (2010). Deletion of Tis7 protects mice from high-fat diet-induced weight gain and blunts the intestinal adaptive response postresection. \u003cem\u003eJ Nutr, 140\u003c/em\u003e(11), 1907-1914. doi:10.3945/jn.110.127084\u003c/li\u003e\n\u003cli\u003eZhang, W. W., Tong, H. L., Sun, X. F., Hu, Q., Yang, Y., Li, S. F., . . . Li, G. P. (2015). Identification of miR-2400 gene as a novel regulator in skeletal muscle satellite cells proliferation by targeting MYOG gene. \u003cem\u003eBiochem Biophys Res Commun, 463\u003c/em\u003e(4), 624-631. doi:10.1016/j.bbrc.2015.05.112\u003c/li\u003e\n\u003cli\u003eZhang, Y., Ma, L., Gu, Y., Chang, Y., Liang, C., Guo, X., . . . Yan, P. (2021). Bta-miR-2400 Targets SUMO1 to Affect Yak Preadipocytes Proliferation and Differentiation. \u003cem\u003eBiology (Basel), 10\u003c/em\u003e(10). doi:10.3390/biology10100949\u003c/li\u003e\n\u003cli\u003eZhu, L., \u0026amp; Skoultchi, A. I. (2001). Coordinating cell proliferation and differentiation. \u003cem\u003eCurr Opin Genet Dev, 11\u003c/em\u003e(1), 91-97. doi:10.1016/s0959-437x(00)00162-3\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"journal-of-muscle-research-and-cell-motility","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jure","sideBox":"Learn more about [Journal of Muscle Research and Cell Motility](http://link.springer.com/journal/10974)","snPcode":"10974","submissionUrl":"https://submission.nature.com/new-submission/10974/3","title":"Journal of Muscle Research and Cell Motility","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"IFRD2, bovine skeletal muscle satellite cells, bta-miR-2400, ERK1/2, myogenesis","lastPublishedDoi":"10.21203/rs.3.rs-4300013/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4300013/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe proliferation and differentiation of skeletal muscle satellite cells is a complex physiological process in which many transcription factors and small RNA molecules are involved. In this study, interferon-related development factor 2 (\u003cem\u003eIFRD2\u003c/em\u003e) was identified as a target gene of \u003cem\u003ebta-miRNA-2400\u003c/em\u003e involved in regulating the proliferation and differentiation of bovine skeletal MDSCs (Muscle-derived satellite cells, MDSCs). The results indicate that \u003cem\u003ebta-miR-2400\u003c/em\u003e can target bind the 3'UTR of \u003cem\u003eIFRD2\u003c/em\u003e and inhibit its translation. mRNA and protein expression levels of \u003cem\u003eIFRD2\u003c/em\u003e increased significantly with increasing days of differentiation. Overexpression of the \u003cem\u003eIFRD2\u003c/em\u003e gene inhibited the proliferation and promoted the differentiation of bovine MDSCs. Conversely, the knockdown of the gene had the opposite effect. Overexpression of \u003cem\u003eIFRD2\u003c/em\u003e resulted in the inhibition of \u003cem\u003eERK1/2\u003c/em\u003e phosphorylation levels in bovine MDSCs, which in turn promoted differentiation. In summary, \u003cem\u003eIFRD2\u003c/em\u003e, as a target gene of \u003cem\u003ebta-miR-2400\u003c/em\u003e, affects bovine skeletal muscle proliferation and differentiation by regulating \u003cem\u003eERK1/2\u003c/em\u003e phosphorylation.\u003c/p\u003e","manuscriptTitle":"IFRD2 regulates myogenic differentiation of bovine skeletal muscle satellite cells through the ERK1/2 pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-24 18:04:17","doi":"10.21203/rs.3.rs-4300013/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-13T09:51:16+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-13T09:05:41+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-03T15:06:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"9d7a980b-d5da-4b5f-9013-5917dded890e","date":"2024-04-25T11:01:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"78166103-85f1-40cb-a46d-4bf7878b7b6e","date":"2024-04-25T06:05:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-23T10:32:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-22T17:26:23+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-22T04:50:55+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Muscle Research and Cell Motility","date":"2024-04-21T08:42:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"journal-of-muscle-research-and-cell-motility","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jure","sideBox":"Learn more about [Journal of Muscle Research and Cell Motility](http://link.springer.com/journal/10974)","snPcode":"10974","submissionUrl":"https://submission.nature.com/new-submission/10974/3","title":"Journal of Muscle Research and Cell Motility","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"bee61def-3b80-49b2-ae55-a5a390f4812f","owner":[],"postedDate":"April 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-06-13T14:25:45+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-24 18:04:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4300013","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4300013","identity":"rs-4300013","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.