Multiple Cross Displacement Amplification-a more applicable technique in detecting Pseudomonas Aeruginosa of Ventilator-associated Pneumonia ( VAP)

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-14

This study developed and validated a rapid, instrument-free Pseudomonas aeruginosa multiple cross displacement amplification assay for detecting the bacteria in ventilator-associated pneumonia patient samples.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-14 · read from full text

This preprint studied whether an instrument-free P. aeruginosa multiple cross displacement amplification (PA-MCDA) assay could rapidly detect P. aeruginosa in suspected ventilator-associated pneumonia (VAP), using MCDA primers targeting the oprL gene and colorimetric visual readout after 1 hour of isothermal amplification. Testing 77 cultured bacterial strains showed 100% analytical specificity and a limit of detection down to 100 fg DNA per reaction, with a recommended amplification temperature of 65°C, and BALF from 102 ICU patients demonstrated 91.18% agreement with bacterial culture (κ=0.787) plus sensitivity/specificity values of 92.31%/90.78%; a stated caveat is that the work is a preprint and not peer reviewed. Relevance to endometriosis: the paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background: Early and rapid identification of Pseudomonas aeruginosa (P. aeruginosa) in patients with suspected ventilator-associated pneumonia (VAP) provides theoretical clinical advantages in therapeutic optimization strategies. Methods: The P. aeruginosa-multiple cross displacement amplification (PA-MCDA) assay was conducted at an isothermal temperature during the amplification stage, and products were visually detected by color changes. The entire process was completed within 1 h. A total of 77 strains, including P. aeruginosa species and various other species of non-P. aeruginosa were used to evaluate PA-MCDA assays. Bronchoalveolar lavage fluid (BALF) of suspected VAP patients were examined by the MCDA assay. Results: The MCDA assay exhibited a 100 percent analytical specificity in detecting PA from all 77 strains, and the limit of detection were as low as 100 fg DNA per reaction. A temperature of 65ºC was recommended as standard during the amplification stage. The agreement between PA-MCDA and bacteria culture was 91.18% (κ= 0.787; p =0.000) in identification of P. aeruginosa in BALF from suspected VAP. The PA-MCDA assay showed values of 92.31%, 90.78%, 77.41% and 97.18% for sensitivity, specificity, positive predictive value and negative predictive value, respectively. PA-MCDA had higher detective rate of P. aeruginosa than bacteria culture in patients with antipseudomonal therapy. Conclusions: The instrument-free platform of the MCDA assay makes it a simple, rapid and applicable procedure for “on-site” diagnosis and point-of-care testing for the presence of P. aeruginosa without the need for specific bacterial culture.
Full text 135,656 characters · extracted from preprint-html · click to expand
Multiple Cross Displacement Amplification-a more applicable technique in detecting Pseudomonas Aeruginosa of Ventilator-associated Pneumonia ( VAP) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Multiple Cross Displacement Amplification-a more applicable technique in detecting Pseudomonas Aeruginosa of Ventilator-associated Pneumonia ( VAP) Juxiang Wang, Huimin Chen, Xiaomin Lin, Chengyi Ji, Bin Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.22930/v3 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 08 Jun, 2020 Read the published version in Critical Care → Version 3 posted 9 You are reading this latest preprint version Show more versions Abstract Background: Early and rapid identification of Pseudomonas aeruginosa (P. aeruginosa) in patients with suspected ventilator-associated pneumonia (VAP) provides theoretical clinical advantages in therapeutic optimization strategies. Methods: The P. aeruginosa-multiple cross displacement amplification (PA-MCDA) assay was conducted at an isothermal temperature during the amplification stage, and products were visually detected by color changes. The entire process was completed within 1 h. A total of 77 strains, including P. aeruginosa species and various other species of non-P. aeruginosa were used to evaluate PA-MCDA assays. Bronchoalveolar lavage fluid (BALF) of suspected VAP patients were examined by the MCDA assay. Results: The MCDA assay exhibited a 100 percent analytical specificity in detecting PA from all 77 strains, and the limit of detection were as low as 100 fg DNA per reaction. A temperature of 65ºC was recommended as standard during the amplification stage. The agreement between PA-MCDA and bacteria culture was 91.18% (κ= 0.787; p =0.000) in identification of P. aeruginosa in BALF from suspected VAP. The PA-MCDA assay showed values of 92.31%, 90.78%, 77.41% and 97.18% for sensitivity, specificity, positive predictive value and negative predictive value, respectively. PA-MCDA had higher detective rate of P. aeruginosa than bacteria culture in patients with antipseudomonal therapy. Conclusions: The instrument-free platform of the MCDA assay makes it a simple, rapid and applicable procedure for “on-site” diagnosis and point-of-care testing for the presence of P. aeruginosa without the need for specific bacterial culture. Critical Care & Emergency Medicine Pseudomonas aeruginosa multiple cross displacement amplification ventilated-associated pneumonia bronchoalveolar lavage fluid Limit of Detection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Ventilator-associated pneumonia (VAP) develops in intensive care unit (ICU) patients that have been mechanically ventilated for at least 48 h[1]. The infection rate was related to disease severity and the degree of organ failure[2]. Further, the EU-VAP study[3]identified that the overall incidence of VAP was 18.3 episodes per 1000 ventilator-days. Moreover, Pseudomonas aeruginosa ( P. aeruginosa ) and Staphylococcus aureus were the most frequently isolated pathogens in patients with VAP. In a multicenter study[4], P. aeruginosa , Acinetobacter baumannii, and Klebsiella pneumonia were found the most frequent bacteria (97/212, 45.8%) in VAP patients. In addition, VAP induced a more prolonged need for mechanical ventilation, number of ICU stays and hospitalization, far worse outcomes, and increased associated healthcare costs[5, 6]. Rapid completion of antibiotic administration might decrease the incidence of subsequent organ dysfunction and could be associated with a lower risk-adjusted in-hospital mortality rate [7] . The conventional detection of P. aeruginosa in the clinical setting was generally achieved by growing the target pathogen on agar plate surfaces and cultures[8]. Although the culture-based technique is reliable, the time required for conducting it is at least for a period of 48 h [9]. Furthermore, published guidelines recommended an initial empiric combinatorial coverage with antibiotics targeted to Gram-negative and Gram-positive bacteria Methicillin-resisitant Staphylococcus aureus (MRSA) in the setting of high-risk VAP patients prior to obtaining culture results[1]. Inappropriate initial anti-microbial therapy and antibiotic exposure attributed to antibiotic-resistance[10, 11]was associated with increased in-hospital mortality rates [12]. Rapid and accurate identification of the suspected pathogens was thus warranted to provide the potential to maximize administration of appropriate specific antibiotic and possibly avoid a need for empiric broad-spectrum antibiotic therapy. Rapid excluding some specific and common pathogens would be possible to avoid unnecessary antibiotic exposure and minimize some undesirable consequences[13]. More recently, multiple cross displacement amplification (MCDA, Chinese IP Office Patent Application CN201510280765.X), auto-cycling, and strand displacement DNA synthesis was devised and validated as a possible replacement for PCR-based assays and applicability in the detection of specific nucleic-acid sequences[14, 15]. The assay employed an isothermal temperature during amplification, and the products were visually detected by color changes. The entire process is completed in 1 h and benefits from being an instrument-free, simple and practical procedure for ‘on-site’ diagnosis and point-of-care testing. The current study is the first to report application of the novel MCDA assay to rapidly detect the target pathogen, P. aeruginosa . Methods P A-MCDA assay primer design Based on the mechanism of MCDA, a set of MCDA primers used for P. aeruginosa . detection was designed that targeted the oprL gene, which encodes L-lipoprotein. The details of MCDA primers used in the report are shown in Figure 1 and Table 2. The primers were commercially synthesized and purified by Tsingke (Beijing, China). PA- MCDA reactions MCDA reactions were performed in a one-step reaction in a 25 μl mixture containing 12.5 μl 2×the supplied buffer (BeiJing- Hai Tai Zheng Yuan Technology Co., Ltd.), 0.1 μl each of the displacement primers F1 and F2, 0.2 μl each of the amplification primers C1, C2, R1, R2, D1 and D2, 0.4μl each of the cross primers CP1 and CP2, 1μl (8U) of Bst 2.0 DNA polymerase, 1μl of the DNA template and 0.8 μl of the colorimetric indicator. Moreover, negative control mixtures contained 10 ng of the Staphylococcus aureus and Klebsiella pneumoniae genomic templates, and blank control mixtures contained 1μl of double distilled water (DW). To evaluate the feasibility of the MCDA primer set that was designed to detect P. aeruginosa , we initially conducted the MCDA reactions at 63ºC for 45 min and terminated the MCDA reaction by heating at 85ºC for 5 min. Then, the optimal amplification temperature of the MCDA primer set was examined at fixed temperatures from 59ºC-68ºC at steps of 1ºC intervals. In particular, MCDA products were detected using a colorimetric indicator and agarose gel electrophoresis. Bacterial strains and genomic template preparation A total of 124 bacterial strains and 14 fungi of positive culture were isolated in the clinical microorganism laboratory of the Third Hospital of Xiamen from 26th June to 26th July, 2017 The bacterial strains list of standard culture is detailed in Additional file 1 . The positive bacterial strains including 6/124(4.84%) polymicrobial growth and 32/124(22.81%) Multidrug-Resistant (MDR) strains were isolated from 118 clinical samples in which the tracheal aspirate and BALF in 38 cases, the secretion and drainage in 33 cases, the blood in 16 cases, urine, faeces, catheter and other samples in 31 cases. We chose top 13 bacteria strains, 77 samples to design the PA-MCDA reactions (Table 3). The bacteria strains identified by conventional cultivation method,automatic bacterial identification system (VITEK 2,Bio-Merieux, France) were stored in a 15% (w/v) glycerol broth at -70°C. After refreshing the culture three times on a nutrient agar plate at 37°C, the genomic templates were then extracted from all cultured strains using DNA extraction kits Qiagen Co.,Ltd. Beijing, China), and subsequently tested with an ultraviolet spectrophotometer and stored under -20ºC before use. Specificity of the PA –MCDA assay To evaluate the analytical specificity of the PA -MCDA assay, MCDA reactions were conducted under conditions that were described above with the 77 P. aeruginosa and non- P. aeruginosa pure genomic templates that were derived from all pure bacterial strains. Sensitivity of the PA -MCDA assay The genomic templates of P. aeruginosa were serially diluted (10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg per microliter) with the intent of verifying the limit of detection (LoD), and 1μl of each serial dilution was then added to the MCDA reaction mixtures. The LoD of the MCDA assay was confirmed by the genomic DNA concentration of the template. MCDA results were detected using a colorimetric indicator, malachite green, MG (BeiJing- Hai Tai Zheng Yuan Technology Co., Ltd.) and 2.5% agarose gel electrophoresis. Verification of the PA –MCDA assay This study was conducted in the 30-bed ICU of The Third Hospital of Xiamen in Fujian province, which is a 1200-bed hospital in China. A total of 102 patients enrolled in this study who were suspected VAP from 1st January 2018 to 14th March 2020. Patients satisfied two or more of the following criteria: fever > 38.5°C, leukocytosis > 10 9 /L or leukopenia < 4×10 8 /L, purulent tracheobronchial secretions, and a new or persistent infiltrate on chest radiography. The following data were recorded: demographic characteristics, indication(s) for ICU admission, prior antimicrobial therapy within 2 months before VAP, duration of mechanical ventilation before VAP, Clinical pulmonary infection score (CPIS[16]) including temperature, blood leukocytes, tracheal secretions, oxygenation and pulmonary radiography, usual biochemical and hematological tests. The BALF were abstracted in one bottle, following which, one half (5ml) processed for standard culture by the clinical microorganism laboratory of the Third Hospital of Xiamen and the other 5ml stored at -70°C until the time of DNA extraction. BALF was plated on chocolate, sheep blood, and MacConkey agar plates and incubated for 48-72 h according to routine clinical protocol. The DNA extraction from BALF method was described before. In this procedure, 1μl of the extracted DNA template of the BALF specimen was added to the PA- MCDA assay and the reactions were performed at an optimal amplification temperature for 45 min. The products were detected by a color change and compared to the results of a standard clinical culture, which was blinded to the research investigators. This study was approved by the local ethics committee of the Third Hospital of Xiamen, and performed according to the ethical standards of the latest revision of the Declaration of Helsinki. Written and informed consent was obtained from family members or the appropriate responsible parties. Statistical analysis Continuous variables of patients’ characteristics were reported as the means±standard deviations (SD) or the medians (interquartile ranges (IQR)), and categorical variables were reported as numbers (%). The accuracy of the PA-MCDA assay was compared with the microbiological culture in a cross-sectional analysis. P value < 0.05 was considered significant. Statistical analysis was performed using SPSS version 20.0 for Windows (SPSS Inc., Chicago, IL, USA). Results Successful establishment of the PA-MCDA assay To verify the feasibility of PA -MCDA primers, the MCDA reactions were initially carried out in the presence or absence of genomic DNA templates within 45 min at a constant temperature of 63ºC[14]. A color shift of positive amplification in PA -MCDA tubes was directly observed to change from one of colorless to one of green, while the negative control tube remained colorless by the naked eye (Fig. 2A). The positive MCDA products were seen as ladder-like patterned bands on ethidium bromide-stained 2.5% agarose gels that were resolved by electrophoresis; however, these were not seen in the Staphylococcus aureus , Klebsiella pneumonia or blank control (Fig.2B). Hence, the designed MCDA primer was a good candidate to establish the MCDA methodology for detecting P. aeruginosa . Optimizing the temperature for the PA-MCDA assay To confirm the optimal reaction temperature for the P A -MCDA assay, the P. aeruginosa strain was used as a positive control at a concentration of 1ng per tube and the MCDA amplifications were monitored by a real-time turbidity technique. Performing the P A -MCDA assay at temperatures that ranged from 59˚C to 67˚C at 1˚C increments, verified that 65˚C was an optimal temperature for amplification – with a faster amplification procedure obtained from assay temperatures of 65˚C (Fig. 3 ). Specificity and sensitivity for P. aeruginosa detection by MCDA assays When genomic templates were used in MCDA assays, only the genomic DNAs that were isolated from the P. aeruginosa strains (tubes 1 to 17) generated positive results. Genomic templates from all non- P. aeruginosa strains (1tubes 8 to 34) did not provide production of detectable amplification products (Fig. 4). The color change was observed in positive MCDA tubes (tubes 1 to 17), and a ladder-like pattern was seen on an ethidium bromide-stained 2.5% agarose gel via electrophoresis resolution. These were not seen in negative tubes (Fig. 4). Serial dilution of the P. aeruginosa genomic DNA (10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg per microliter) were used in MCDA assays. Fig. 5A and 5B). It indicated that the LoD, and the sensitivity of the PA-MCDA assay was 100 fg genomic templates per reaction. Application of PA-MCDA to clinical samples The MCDA assay was used to examine 102 BALF from patients who were suspected of presenting with VAP. Demographic and clinical characteristics of our patients are shown in Table 1. The median duration of mechanical ventilation was 7 days (IQR 4.00-32.50) before suspected VAP onset and 97 patients had received antibiotics within two months before suspected VAP. The clinical diagnosis of VAP was given by physician judgment with respect to particular patients or special clinical situations combination with culture results. A total of 94 positive bacteria results were detected by conventional culture in 82/102(80.39%) BALFs in which Polymicrobial growth was 12/102(11.76%) and Polymicrobial included P. aeruginosa were 4/102(3.92%). Bacterial strains list of BALF by standard culture is detailed in Additional file 2. After extracting DNA from these BALF specimens and adding 1μl of the DNA template to the PA- MCDA assay, the reactions were carried out at 65℃ for 45 min and the results were compared to those of the standard culture. The P. aeruginosa was detected in 26 samples by microbiological culture and in 31 samples by PA-MCDA. Two methods unanimously detected 24 P. aeruginosa strains while the MCDA detected 7 P. aeruginosa strains in culture negative patients who received antipseudomonal therapy. The positive results of PA-MCDA and microbiological culture were 24/76(31.58%) and 17/76(22.37%) respectively in 76 patients who had received antipseudomonal therapy. In the cross-sectional analysis, the agreement between the tests was 91.18% (κ= 0.787 ; p =0.000 ) , likelihood ratio positive was 10.02 and likelihood ratio negative was 0.08.The PA-MCDA assay showed values of 92.31%, 90.78%, 77.41% and 97.18% for sensitivity, specificity, positive predictive value and negative predictive value, respectively. Discussion PA-MCDA reaction was performed with a set of 10 oligonucleo tide primers, which specifically recognized 10 distinct sites on the target sequence, wherein the optimal temperature for amplification was 65˚C. In particular, a colorimetric indicator (malachite green, MG) had been applied and the color changed from colorless to a light green color when the reaction was positive. The specificity of the PA-MCDA assay was 100 percent, and the sensitivity achieved a level as low as 100fg of the template. The entire procedure, including that of specimen processing (15 min), the isothermal reaction, and result reporting (45 min), could be completed in approximately 1h. The agreement between PA-MCDA and bacteria culture was 91.18% (κ= 0.787 ; p =0.000 ) in identification of P. aeruginosa in BALF from suspected VAP. PA-MCDA had higher detective rate of P. aeruginosa than bacteria culture in patients who had received antipseudomonal therapy. A rapid, simple and accurate detection method of pathogenic microorganisms was necessary for the timely administration of appropriate therapy and arriving at a time to discontinue unnecessary antibiotic(s). Delayed receipt of an appropriate antibiotic(s) was independently associated with poorer clinical and economic outcomes in patients with serious Gram-negative bacterial infections, regardless of any resistance status[9].Molecular diagnostic assays, such as PCR-based methods (e.g., conventional PCR, real-time PCR [17], and PCR-Electro Spray Ionization MS (PCR/ESI-MS)[18], permit more rapid detection of targeted bacterium by nucleic acid amplification, and have been established and applied in the clinic. However, these PCR-based techniques have some shortcomings, which include the following: (i) the instrument used is extremely expensive; (ii) the diagnostic specificity is highly affected by the amplification conditions and the primer design; (iii) use of these techniques indicate that PCR results require gel electrophoretic analysis or real-time analytical apparatus. Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF)[19] consistently decreased the time for successful identification of the pathogenic organism, shorten the period of time for administering an effective and optimal antibiotic and thus arrive at improved patient outcomes. However, it also needs a bacterial culture and expensive instruments. For diagnosis of VAP, not the standard culture but the MCDA assay are intended to supplant physician judgment respect to particular patients or special clinical situations.The PA-MCDA assay just represents a rapid, sensitive and nearly instrument-free method of P. aeruginosa detection. Only a water bath or heat block was needed during the reaction stage and the cost is about $8 per sample compared to standard culture is $10 per sample. Due to MCDA being able to provide results within only one hour, the clinician can save time to provide targeted therapy for patients, especially in the context of severe sepsis or septic shock patients. The positive test of PA-MCDA means there were P. aeruginosa in BALF, an initial narrow antibiotic therapy with antipseudomonal activity should be given in stable patients with suspected VAP in order to provide targeted therapy and reduce antibiotic exposure. The broad-spectrum empiric therapy with antipseudomonal activity needed to given in patients with severe acute respiratory distress syndrome and profound (unstable) septic shock when the PA-MCDA were positive because the high sensitivity for PA-MCDA assays and the polymicrobial growth always existed. The negative test indicated that there were no P. aeruginosa growth or the number of P. aeruginosa was very below the 10 4 cfu/ml in the BALFs as the high sensitivity of PA-MCDA assay[20]. The value was that empiric combination coverage for P. aeruginosa might not be necessary and the discontinuation of antibiotic therapy with antipseudomonal activity needed to be considered by clinicians[13]. Although, the bacterium specific-MCDA assay cannot differentiate the infection from colonization for it cannot quantitative the bacteria strains of BALF that is the methodology to diagnose VAP, the different time of color change of positive MCDA assay may relate to the amount of DNA templates of bacteria because its reaction products could be detected by real-time fluorescence and less time of positive reactions were produced in more specific-DNA templates[20]. Whether a threshold time of color change for MCDA reflects the quantitative or semiquantitative bacterium for clinical application needs a precise design and analysis.The PA-MCDA assay also detected 7 positive P. aeruginosa , while standard culture was negative in 76 patients who had received antipseudomonal therapy.The interpretation might suggest the MCDA approach had a higher sensitivity than standard culture[15, 21], or that the culture negativity might reflect the presence of active culture inhibitors in the samples[22], or that the P. aeruginosa had become non-viable before or even between the standard culture periods since the growth conditions had changed. Clinical factors should also be taken into account because they might alter the decision of whether to withhold or continue antibiotics. The ultimate clinical determination of VAP, pathogens and regarding antibiotics application was made by the physician in the light of each patient’s individual circumstances[13]. In order to use MCDA method to clinical application, this study also has limitations. The first is the bacterium specific-MCDA assay cannot differentiate the infection from colonization because it cannot provide the results of quantitative bacterium of BALF. A more precise study will be designed recently to explore the relationship between a cutoff time for MCDA color change and the quantitative or semiquantitative bacterium in clinical samples. In addition, whether or not the assay could detect the target pathogen in other specimens such as blood, urine or serous effusion needs further study. Consequently, both the negative and positive results of PA-MCDA cannot rule out the presence of other pathogens, Gram-positive or Gram-negative bacteria or fungi, for polymicrobial growth always existed. MCDA cannot provide precise information to prescribe or withdrew pathogen-specific therapy[23] until more pathogen specific-MCDA and resistance-associated genes be designed[20]. We propose to assign some microorganism-specific MCDA assays and resistance-associated genes (e.g., the nfxB gene and the blaPER-1 gene)[18, 19, 24, 25] that are aligned to common pathogens in ICU, which would include Staphylococcus. aureus (MRSA)[26] , Acinetobacter baumannii , Escherichia coli , fungal species, and others in one template. Conclusions The PA-MCDA assay for rapid detection of P. aeruginosa , which was based on the oprL gene was successfully developed. This approach enabled its reaction products to be identified by the naked eye, and the assay established a high degree of both specificity and sensitivity for target template analysis. The PA-MCDA assay does not only have the benefit of a rapid, reliable and nearly instrument-free procedure, but it can differentiate P. aeruginosa from pure strains of bacteria and clinical specimens without the need for time-consuming bacterial culture and its clinical significance needs further establishment. Declarations Acknowledgements This study was supported by the Third Hospital of Xiamen Affiliated of Fujian University of Traditional Chinese Medicine. We would also like to express our gratitude to the clinicians and healthcare professionals who helped us in this study. Funding This study was supported by a grant from the Medical Innovation Project of Fujian Province funded by the Xiamen Municipal Health Commission [grant number 2015-CXB-48] Availability of data and materials The dataset analysed during the current study is available from the corresponding author on reasonable request. Authors' contributions The corresponding author (BC) was in charge of study design. The first author (JXW) was responsible for manuscript writing and cooperated with the rest three authors (HMC, XML and CYJ) in clinical research work. JXW was in charge of data collection and experiment, BC was responsible for data analysis. HMC, XML and CYJ were responsible for sample collection, experiment technical and material support during the study. All authors have read and approved the publication of this manuscript. Ethics approval and consent to participate All procedures in the study were performed in accordance with the ethical standards of the institutional research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Written and informed consent was obtained from family members or the appropriate responsible parties. Consent for publication Not applicable Competing interests All authors declared that they have no competing interests. References Torres A, Niederman MS, Chastre J, Ewig S, Fernandez-Vandellos P, Hanberger H, Kollef M, Li Bassi G, Luna CM, Martin-Loeches I et al : International ERS/ESICM/ESCMID/ALAT guidelines for the management of hospital-acquired pneumonia and ventilator-associated pneumonia . Guidelines for the management of hospital-acquired pneumonia (HAP)/ventilator-associated pneumonia (VAP) of the European Respiratory Society (ERS), European Society of Intensive Care Medicine (ESICM), European Society of Clinical Microbiology and Infectious Diseases (ESCMID) and Asociación Latinoamericana del Tórax (ALAT) 2017, 50 (3):1700582. Vincent JL, Rello J, Marshall J, Silva E, Anzueto A, Martin CD, Moreno R, Lipman J, Gomersall C, Sakr Y et al : International study of the prevalence and outcomes of infection in intensive care units . Jama 2009, 302 (21):2323-2329. Koulenti D, Tsigou E, Rello J: Nosocomial pneumonia in 27 ICUs in Europe: perspectives from the EU-VAP/CAP study . European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology 2017, 36 (11):1999-2006. Cisneros JM, Rosso-Fernández CM, Roca-Oporto C, De Pascale G, Jiménez-Jorge S, Fernández-Hinojosa E, Matthaiou DK, Ramírez P, Díaz-Miguel RO, Estella A et al : Colistin versus meropenem in the empirical treatment of ventilator-associated pneumonia (Magic Bullet study): an investigator-driven, open-label, randomized, noninferiority controlled trial . Critical Care 2019, 23 (1):383. Safdar N, Dezfulian C, Collard HR, Saint S: Clinical and economic consequences of ventilator-associated pneumonia: a systematic review . Crit Care Med 2005, 33 (10):2184-2193. Zimlichman E, Henderson D, Tamir O, Franz C, Song P, Yamin CK, Keohane C, Denham CR, Bates DW: Health Care–Associated Infections: A Meta-analysis of Costs and Financial Impact on the US Health Care SystemMeta-analysis of Health Care–Associated InfectionsMeta-analysis of Health Care–Associated Infections . JAMA Internal Medicine 2013, 173 (22):2039-2046. Rhodes A, Evans LE, Alhazzani W, Levy MM, Antonelli M, Ferrer R, Kumar A, Sevransky JE, Sprung CL, Nunnally ME et al : Surviving Sepsis Campaign: International Guidelines for Management of Sepsis and Septic Shock: 2016 . Intensive care medicine 2017, 43 (3):304-377. Jacobs JA, De Brauwer EI, Cornelissen EI, Drent M: Accuracy and precision of quantitative calibrated loops in transfer of bronchoalveolar lavage fluid . J Clin Microbiol 2000, 38 (6):2117-2121. Bonine NG, Berger A, Altincatal A, Wang R, Bhagnani T, Gillard P, Lodise T: Impact of Delayed Appropriate Antibiotic Therapy on Patient Outcomes by Antibiotic Resistance Status From Serious Gram-negative Bacterial Infections . The American Journal of the Medical Sciences 2019, 357 (2):103-110. Ong DS, Jongerden IP, Buiting AG, Leverstein-van Hall MA, Speelberg B, Kesecioglu J, Bonten MJ: Antibiotic exposure and resistance development in Pseudomonas aeruginosa and Enterobacter species in intensive care units . Crit Care Med 2011, 39 (11):2458-2463. Kollef KE, Schramm GE, Wills AR, Reichley RM, Micek ST, Kollef MH: Predictors of 30-Day Mortality and Hospital Costs in Patients With Ventilator-Associated Pneumonia Attributed to Potentially Antibiotic-Resistant Gram-Negative Bacteria . CHEST 2008, 134 (2):281-287. Micek ST, Wunderink RG, Kollef MH, Chen C, Rello J, Chastre J, Antonelli M, Welte T, Clair B, Ostermann H et al : An international multicenter retrospective study of Pseudomonas aeruginosa nosocomial pneumonia: impact of multidrug resistance . Critical care (London, England) 2015, 19 (1):219-227. Kalil AC, Metersky ML, Klompas M, Muscedere J, Sweeney DA, Palmer LB, Napolitano LM, O'Grady NP, Bartlett JG, Carratala J et al : Management of Adults With Hospital-acquired and Ventilator-associated Pneumonia: 2016 Clinical Practice Guidelines by the Infectious Diseases Society of America and the American Thoracic Society . Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2016, 63 (5):e61-e111. Wang Y, Wang Y, Luo L, Liu D, Luo X, Xu Y, Hu S, Niu L, Xu J, Ye C: Rapid and Sensitive Detection of Shigella spp. and Salmonella spp. by Multiple Endonuclease Restriction Real-Time Loop-Mediated Isothermal Amplification Technique . Front Microbiol 2015, 6 :1400-1400. Wang Y, Wang Y, Ma A-J, Li D-X, Luo L-J, Liu D-X, Jin D, Liu K, Ye C-Y: Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification . Sci Rep 2015, 5 :11902-11902. Pugin J, Auckenthaler R, Mili N, Janssens JP, Lew PD, Suter PM: Diagnosis of ventilator-associated pneumonia by bacteriologic analysis of bronchoscopic and nonbronchoscopic "blind" bronchoalveolar lavage fluid . The American review of respiratory disease 1991, 143 (5 Pt 1):1121-1129. Frye AM, Baker CA, Rustvold DL, Heath KA, Hunt J, Leggett JE, Oethinger M: Clinical impact of a real-time PCR assay for rapid identification of staphylococcal bacteremia . J Clin Microbiol 2012, 50 (1):127-133. Bogaerts P, Hamels S, de Mendonca R, Huang T-D, Roisin S, Remacle J, Markine-Goriaynoff N, de Longueville F, Plüster W, Denis O et al : Analytical validation of a novel high multiplexing real-time PCR array for the identification of key pathogens causative of bacterial ventilator-associated pneumonia and their associated resistance genes . Journal of Antimicrobial Chemotherapy 2012, 68 (2):340-347. Huang AM, Newton D, Kunapuli A, Gandhi TN, Washer LL, Isip J, Collins CD, Nagel JL: Impact of Rapid Organism Identification via Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Combined With Antimicrobial Stewardship Team Intervention in Adult Patients With Bacteremia and Candidemia . Clinical Infectious Diseases 2013, 57 (9):1237-1245. Wang Y, Wang Y, Zhang L, Liu D, Luo L, Li H, Cao X, Liu K, Xu J, Ye C: Multiplex, Rapid, and Sensitive Isothermal Detection of Nucleic-Acid Sequence by Endonuclease Restriction-Mediated Real-Time Multiple Cross Displacement Amplification . Front Microbiol 2016, 7 :753. Kumar A, Ellis P, Arabi Y, Roberts D, Light B, Parrillo JE, Dodek P, Wood G, Kumar A, Simon D et al : Initiation of Inappropriate Antimicrobial Therapy Results in a Fivefold Reduction of Survival in Human Septic Shock . CHEST 2009, 136 (5):1237-1248. Dickson RP, Erb-Downward JR, Prescott HC, Martinez FJ, Curtis JL, Lama VN, Huffnagle GB: Analysis of culture-dependent versus culture-independent techniques for identification of bacteria in clinically obtained bronchoalveolar lavage fluid . J Clin Microbiol 2014, 52 (10):3605-3613. Giani T, Arena F, Pollini S, Di Pilato V, D’Andrea MM, Henrici De Angelis L, Bassetti M, Rossolini GM, Group PaW: Italian nationwide survey on Pseudomonas aeruginosa from invasive infections: activity of ceftolozane/tazobactam and comparators, and molecular epidemiology of carbapenemase producers . Journal of Antimicrobial Chemotherapy 2017, 73 (3):664-671. Jenny M, Kingsbury J: Properties and Prevention: A Review of Pseudomonas aeruginosa . J Biol Med Res 2018, 2 (3):8. Evans SR, Tran TTT, Hujer AM, Hill CB, Hujer KM, Mediavilla JR, Manca C, Domitrovic TN, Perez F, Farmer M: Rapid Molecular Diagnostics to Inform Empiric Use of Ceftazidime/Avibactam and Ceftolozane/Tazobactam Against Pseudomonas aeruginosa: PRIMERS IV . Clinical Infectious Diseases 2018. Gong L, Liu E, Che J, Li J, Liu X, Xu H, Liang J: Multiple Cross Displacement Amplification Coupled With Gold Nanoparticles-Based Lateral Flow Biosensor for Detection of the Mobilized Colistin Resistance Gene mcr-1 . Front Cell Infect Microbiol 2019, 9 :226-226. Tables Table 1. Demographic, clinical and biological characteristics of patients Characteristics at ICU admission Total ( n=102 ) Male sex, n(%) 75 ( 73.5% ) Age(years),median(IQR) 54.62 ± 19.59, 57 ( 39.75-70.75 ) Medical patients, n (%) 39 ( 38.2% ) Surgery patients, n (%) 63 ( 61.8% ) Prior antibiotics in 90 days, n (%) 61 ( 59.8% ) Characteristics upon VAP onset ICU stay (days),median(IQR) 37.87 ± 80.45, 8 ( 4.00-37.75 ) Duration of MV* (days), median(IQR) 35.42 ± 80.05, 7 ( 4.00-32.50 ) Septic shock, n (%) 57 ( 55.9% ) new or persistent infiltrate on chest radiography 72 (70.59%) CPIS** 6.59 ± 1.70,7 ( 5.00-8.00 ) CRP 84.59 ± 57.98, 69.45(46.00-104.80) PCT 17.34 ± 24.29, 10 ( 2.34-21.30 ) Antibiotics -within 3 days None 5 ( 4.9% ) Monotherapy 41 ( 40.2% ) Combination antibiotic therapy 56 (54.9) covering PA 76(74.5%) Change of antibiotics, n (%) 45(44.1%) Clinical diagnosis of VAP 68(66.7%) *: duration of mechanical ventilation before suspected VAP, **CPIS, Clinical pulmonary infection score. Table 2. Primers used for multiple cross displacement amplification in this study. Primers Sequences (5’-3’) Length CP1 GCCGAATTTCAGCATTTCCATCATG-CCTGAACTGACGGTCGCC 43mer CP2 CGATGCTTCCGGTGAAGGTGC-AACGGCACCGCTGTTG 37mer F1 GCCTTCCTGGTCCCCTTA 18nt F2 CGGCTTCGTCGCTCAG 16nt C1 GCCGAATTTCAGCATTTCCATCATG 25nt C2 CGATGCTTCCGGTGAAGGTGC 21nt D1 ACTCCTAATGAACCCCAGT 19nt D2 ACCCGAACGCAGGCTATG 18nt R1 CAGAGCCAGCGCAGCA 16nt R2 GGCTGTGGCTGTGGGT 16nt P1 CCTGAACTGACGGTCGCC 18nt P2 AACGGCACCGCTGTTG 16nt Table 3 . List of bacterial strains A total of 77 bacterial strains, which included 17 PA and 60 non-PA strains were identified by MALDI-TOF (microflex LT/SH, Bruker corporation, Karlsruhe, Germany) by the clinical microorganism laboratory of the Third Hospital of Xiamen. Bacteria strains Bacteria Strains P seudomonas. aeruginosa 17 Streplococcus agalactiae 5 Escherichia coli 5 Enterococcus faecalis 5 Staphylococcus. aureus 5 Salmonella typhimurium 5 Acinetobacter baumannii 5 K lebsiella. pneumoniae 5 Staphylococcus epidermidis 5 Enterobacter cloacae 5 Staphylococcus capitis 5 Stenotrophomonas maltophilia 5 Streptococcus pyogenes 5 Supplementary Files Additionalfiles.pdf Cite Share Download PDF Status: Published Journal Publication published 08 Jun, 2020 Read the published version in Critical Care → Version 3 posted Editorial decision: Accept 18 May, 2020 Reviewer # 2 agreed at journal 16 May, 2020 Review # 2 received at journal 16 May, 2020 Review # 1 received at journal 16 May, 2020 Editor assigned by journal 13 May, 2020 Reviewers invited by journal 13 May, 2020 Reviewer # 1 agreed at journal 13 May, 2020 Submission checks completed at journal 12 May, 2020 Editor invited by journal 12 May, 2020 You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-13503","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":574751,"identity":"5befc1aa-392d-4abd-9c1d-91a04e3074f7","order_by":1,"name":"Juxiang Wang","email":"","orcid":"","institution":"xiamen Cardiovascular Hospital, Xiamen University","correspondingAuthor":false,"prefix":"","firstName":"Juxiang","middleName":"","lastName":"Wang","suffix":""},{"id":574752,"identity":"2ca561d7-0dd6-46bd-8112-2344368435d8","order_by":2,"name":"Huimin Chen","email":"","orcid":"","institution":"the third hospital of xiamen","correspondingAuthor":false,"prefix":"","firstName":"Huimin","middleName":"","lastName":"Chen","suffix":""},{"id":574753,"identity":"d9061aa9-6dc1-4a9b-a830-8ab6673513d6","order_by":3,"name":"Xiaomin Lin","email":"","orcid":"","institution":"Xiamen Branch, Zhongshan Hospital, Fudan Unversity","correspondingAuthor":false,"prefix":"","firstName":"Xiaomin","middleName":"","lastName":"Lin","suffix":""},{"id":574754,"identity":"63bc12ca-aaa4-449b-b29f-757bf1443e9e","order_by":4,"name":"Chengyi Ji","email":"","orcid":"","institution":"the third hospital of Xiamen","correspondingAuthor":false,"prefix":"","firstName":"Chengyi","middleName":"","lastName":"Ji","suffix":""},{"id":574755,"identity":"5e6420d5-91a7-4e76-bec6-515d1485efcb","order_by":5,"name":"Bin Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvklEQVRIiWNgGAWjYDCCAwxsIJKHgb2x8cEH0rTwHG42nEGKFgYGifQ2aQ5idPDdPvzswccdd2TMJR82SDMw2MnpNhDQInkuzdxw5plnPJazExuMCxiSjc0OENBicIaHTZq37TCPwe3EhuQZDAcStxGl5S9Iy82DDYd5iNbCCNJyg7GxmSgtkmfYzCR7257xGJxJbGacYUCEX/jOMD+T+Nl2x97g+PHnPz5U2MkR1ILuTtKUj4JRMApGwSjAAQAkdUZyrwCJawAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-3152-4021","institution":"Xiamen Port Clinic of Xiamen Customs","correspondingAuthor":true,"prefix":"","firstName":"Bin","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2020-02-06 11:42:37","currentVersionCode":3,"declarations":"","doi":"10.21203/rs.2.22930/v3","doiUrl":"https://doi.org/10.21203/rs.2.22930/v3","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13054-020-03003-4","type":"published","date":"2020-06-08T20:14:39+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":1177834,"identity":"350094e7-1ed0-4b2b-a874-2a8788c98547","added_by":"auto","created_at":"2020-05-26 16:39:17","extension":"tif","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":122716,"visible":true,"origin":"","legend":"Schematic depiction of the primer sequences and positions for MCDA. \nThe location and nucleotide sequence of the P. aeruginosa oprL gene that assisted in designing MCDA primers. The primer site sequences are underlined. Right and left arrows indicate sense and complementary sequences that were used in the assay.","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-13503/v3/Fig1.tif"},{"id":1177835,"identity":"5d9cfa84-1e8f-4f3e-ae8e-3c0b0c1e6b96","added_by":"auto","created_at":"2020-05-26 16:39:17","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":31004,"visible":true,"origin":"","legend":"Confirmation and detection of products.\n(A) The color change seen in MCDA tubes: tube 1 is the positive amplification of P. aeruginosa, the green color was observed directly; tubes 2 and 3 are the negative amplifications of S. aureus and K. pneumoniae respectively; tube 4 is the negative amplification of the control (no DNA);tubes 2, 3 and 4 remained colorless.\n(B) 2.5% agarose gel electrophoresis applied to MCDA; lane 0:DL 100-bp DNA marker; lane 1: positive MCDA products of P. aeruginosa; lane 2 and 3: negative products of S. aureus and K. pneumoniae respectively; and lane 4, negative control (no DNA).","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-13503/v3/fig2.jpg"},{"id":1177836,"identity":"75e05418-fdf4-48e9-8aee-c9d77a9e77c9","added_by":"auto","created_at":"2020-05-26 16:39:17","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":223417,"visible":true,"origin":"","legend":"Optimal reaction temperature for the PA-MCDA primer assay. \nMCDA reactions when detecting the P. aeruginosa gene were monitored by real-time measurement of turbidity. A turbidity of\u003e0.1 was considered positive. Nine kinetic graphs were obtained at various temperatures (59–67◦C, at 1◦C intervals) with P. aeruginosa DNA at a concentration of 1ng per tube. The graphs showed that 65˚C was an optimal temperature for amplification.","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-13503/v3/Fig3.jpg"},{"id":1177837,"identity":"ca3be320-3e8e-45f1-b156-f1c4327b248f","added_by":"auto","created_at":"2020-05-26 16:39:17","extension":"tif","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":157514,"visible":true,"origin":"","legend":"Specificity for P. aeruginosa detection by MCDA assays.\nOf all 77 pure genomic templates, only the genomic DNAs from the P. aeruginosa strains generated positive results. The color shift in the PA-MCDA tubes (tubes 1-17) was directly observed as a green color. A grey color was seen in tubes 18-34, in which 18-21 were E.coli. Tubes 22-23 were S. aureus, of which, tubes 24-25 were A. baumannii, and tubes 26-34 were respectively S. epidermidis, S. capitis, Streptococcus pyogenes, S. agalactiae, E. faecalis,S. typhimurium, K. pneumoniae, E. cloacae, and S. maltophilia. A 2% agarose gel electrophoresis assay was applied to detect P. aeruginosa MCDA; lane 0, DL 100-bp DNA marker; lanes 1- 17 were positive MCDA products that corresponded to P. aeruginosa tubes 1-17; and lanes 18-34 were negative and corresponded to tube 18-34 respectively.","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-13503/v3/Fig4.tif"},{"id":1177838,"identity":"da0a36ff-2bf0-481b-86d6-a12549386531","added_by":"auto","created_at":"2020-05-26 16:39:17","extension":"tif","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":210573,"visible":true,"origin":"","legend":"Sensitivity of the MCDA assays using serially diluted P. aeruginosa genomic DNA.\n(A) P. aeruginosa genomic DNA was serially diluted to 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg per microliter. When the dilution was more than 100fg/uL, the green color by MG and the laddering P. aeruginosattern by agarose gel electrophoresis were directly observed. The LoD of the PA MCDA assay was as low as 100 fg per microliter (white arrow). \n(B) Real-time turbidity was applied to analyze the amplification products. Genomic DNA levels \u003e100fg per reaction produced positive reactions.","description":"","filename":"Fig5.tif","url":"https://assets-eu.researchsquare.com/files/rs-13503/v3/Fig5.tif"},{"id":13532244,"identity":"6ddcf1b1-ef72-4336-9ed2-33c68c4db7c6","added_by":"auto","created_at":"2021-09-17 01:16:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1919660,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-13503/v3/15e81b86-ca01-4fed-b144-a861ca6ec02b.pdf"},{"id":1177833,"identity":"26856a1c-6888-40ac-8964-c47a80312aa7","added_by":"auto","created_at":"2020-05-26 16:39:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":62257,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfiles.pdf","url":"https://assets-eu.researchsquare.com/files/rs-13503/v3/Additionalfiles.pdf"}],"financialInterests":"","formattedTitle":"Multiple Cross Displacement Amplification-a more applicable technique in detecting Pseudomonas Aeruginosa of Ventilator-associated Pneumonia ( VAP)","fulltext":[{"header":"Background","content":"\u003cp\u003eVentilator-associated pneumonia (VAP) develops in intensive care unit (ICU) patients that have been mechanically ventilated for at least 48 h[1]. The infection rate was related to disease severity and the degree of organ failure[2]. Further, the EU-VAP study[3]identified that the overall incidence of VAP was 18.3 episodes per 1000 ventilator-days. Moreover, \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e (\u003cem\u003eP. aeruginosa\u003c/em\u003e) and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e were the most frequently isolated pathogens in patients with VAP. In a multicenter study[4], \u003cem\u003eP. aeruginosa\u003c/em\u003e, \u003cem\u003eAcinetobacter baumannii,\u003c/em\u003e and \u003cem\u003eKlebsiella pneumonia\u003c/em\u003e were found the most frequent bacteria (97/212, 45.8%) in VAP\u0026nbsp; patients. In addition, VAP induced a more prolonged need for mechanical ventilation, number of ICU stays and hospitalization, far worse outcomes, and increased associated healthcare costs[5, 6].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eRapid completion of antibiotic administration might decrease the incidence of subsequent organ dysfunction and could be associated with a lower risk-adjusted in-hospital mortality rate [7]\u003cem\u003e.\u003c/em\u003e The conventional detection of \u003cem\u003eP. aeruginosa\u003c/em\u003e in the clinical setting was generally achieved by growing the target pathogen on agar plate surfaces and cultures[8]. Although the culture-based technique is reliable, the time required for conducting it is at least for a period of 48 h [9]. Furthermore, published guidelines recommended an initial empiric combinatorial coverage with antibiotics targeted to Gram-negative and Gram-positive bacteria Methicillin-resisitant Staphylococcus aureus (MRSA) in the setting of high-risk VAP patients prior to obtaining culture results[1]. Inappropriate initial anti-microbial therapy and antibiotic exposure attributed to antibiotic-resistance[10, 11]was associated with increased in-hospital mortality rates [12]. Rapid and accurate identification of the suspected pathogens was thus warranted to provide the potential to maximize administration of appropriate specific antibiotic and possibly avoid a need for empiric broad-spectrum antibiotic therapy. Rapid excluding some specific and common pathogens would be possible to avoid unnecessary antibiotic exposure and minimize some undesirable consequences[13].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMore recently, multiple cross displacement amplification (MCDA, Chinese IP Office Patent Application CN201510280765.X), auto-cycling, and strand displacement DNA synthesis was devised and validated as a possible replacement for PCR-based assays and applicability in the detection of specific nucleic-acid sequences[14, 15]. The assay employed an isothermal temperature during amplification, and the products were visually detected by color changes. The entire process is completed in 1 h and benefits from being an instrument-free, simple and practical procedure for \u0026lsquo;on-site\u0026rsquo; diagnosis and point-of-care testing. The current study is the first to report application of the novel MCDA assay to rapidly detect the target pathogen, \u003cem\u003eP. aeruginosa\u003c/em\u003e.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eP\u003c/strong\u003e\u003cstrong\u003eA-MCDA assay primer design \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the mechanism of MCDA, a set of MCDA primers used for \u003cem\u003eP. aeruginosa\u003c/em\u003e. \u003cem\u003e\u0026nbsp;\u003c/em\u003edetection was designed that targeted the \u003cem\u003eoprL\u003c/em\u003e gene, which encodes L-lipoprotein. The details of MCDA primers used in the report are shown in Figure 1 and Table 2. The primers were commercially synthesized and purified by Tsingke (Beijing, China).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePA-\u003c/em\u003eMCDA reactions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMCDA reactions were performed in a one-step reaction in a 25 \u0026mu;l mixture containing 12.5 \u0026mu;l 2\u0026times;the supplied buffer (BeiJing- Hai Tai Zheng Yuan Technology Co., Ltd.), 0.1 \u0026mu;l each of the displacement primers F1 and F2, 0.2 \u0026mu;l each of the amplification primers C1, C2, R1, R2, D1 and D2, 0.4\u0026mu;l each of the cross primers CP1 and CP2, 1\u0026mu;l (8U) of \u003cem\u003eBst\u003c/em\u003e 2.0 DNA polymerase, 1\u0026mu;l of the DNA template and 0.8 \u0026mu;l of the colorimetric indicator. Moreover, negative control mixtures contained 10 ng of the \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e genomic templates, and blank control mixtures contained 1\u0026mu;l of double distilled water (DW). To evaluate the feasibility of the MCDA primer set that was designed to detect \u003cem\u003eP. aeruginosa\u003c/em\u003e, we initially conducted the MCDA reactions at 63\u0026ordm;C for 45 min and terminated the MCDA reaction by heating at 85\u0026ordm;C for 5 min. Then, the optimal amplification temperature of the MCDA primer set was examined at fixed temperatures from 59\u0026ordm;C-68\u0026ordm;C at steps of 1\u0026ordm;C intervals. In particular, MCDA products were detected using a colorimetric indicator and agarose gel electrophoresis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial strains and genomic template preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 124 bacterial strains and 14 fungi of positive culture were isolated in the clinical microorganism laboratory of the Third Hospital of Xiamen from 26th June to 26th July, 2017 The bacterial strains list of standard culture is detailed in Additional file 1\u003cem\u003e. \u003c/em\u003eThe positive bacterial strains including 6/124(4.84%) polymicrobial growth and 32/124(22.81%) Multidrug-Resistant (MDR) strains were isolated from 118 clinical samples in which the tracheal aspirate and BALF in 38 cases, the secretion and drainage in 33 cases, the blood in 16 cases, urine, faeces, catheter and other samples in 31 cases. We chose top 13 bacteria strains, 77 samples to design the PA-MCDA reactions (Table 3). The bacteria strains identified by\u0026nbsp; conventional cultivation method,automatic bacterial identification system (VITEK 2,Bio-Merieux, France) were stored in a 15% (w/v) glycerol broth at -70\u0026deg;C. After refreshing the culture three times on a nutrient agar plate at 37\u0026deg;C, the genomic templates were then extracted from all cultured strains using DNA extraction kits Qiagen Co.,Ltd. Beijing, China), and subsequently tested with an ultraviolet spectrophotometer and stored under -20\u0026ordm;C before use.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSpecificity of the \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePA\u003c/em\u003e \u0026ndash;MCDA assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the analytical specificity of the \u003cem\u003ePA\u003c/em\u003e-MCDA assay, MCDA reactions were conducted under conditions that were described above with the 77 \u003cem\u003eP. aeruginosa\u003c/em\u003e and non-\u003cem\u003eP. aeruginosa\u003c/em\u003e pure genomic templates that were derived from all pure bacterial strains.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSensitivity of the \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePA\u003c/em\u003e-MCDA assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe genomic templates of\u003cem\u003e P. aeruginosa\u003c/em\u003e were serially diluted (10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg per microliter) with the intent of verifying the limit of detection (LoD), and 1\u0026mu;l of each serial dilution was then added to the MCDA reaction mixtures. The LoD of the MCDA assay was confirmed by the genomic DNA concentration of the template. MCDA results were detected using a colorimetric indicator, malachite green, MG (BeiJing- Hai Tai Zheng Yuan Technology Co., Ltd.) and 2.5% agarose gel electrophoresis.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVerification of the \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePA\u003c/em\u003e\u0026ndash;MCDA assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted in the 30-bed ICU of The Third Hospital of Xiamen in Fujian province, which is a 1200-bed hospital in China. A total of 102 \u0026nbsp;patients enrolled in this study who were suspected VAP from 1st January 2018 to 14th March 2020. Patients satisfied two or more of the following criteria: fever \u0026gt; 38.5\u0026deg;C, leukocytosis \u0026gt; 10\u003csup\u003e9\u003c/sup\u003e/L or leukopenia \u0026lt; 4\u0026times;10\u003csup\u003e8\u003c/sup\u003e/L, purulent tracheobronchial secretions, and a new or persistent infiltrate on chest radiography. The following data were recorded: demographic characteristics, indication(s) for ICU admission, prior antimicrobial therapy within 2 months before VAP, duration of mechanical ventilation before VAP, Clinical pulmonary infection score (CPIS[16]) including temperature, blood leukocytes, tracheal secretions, oxygenation and pulmonary radiography, usual biochemical and hematological tests.\u003c/p\u003e\n\u003cp\u003eThe BALF were abstracted in one bottle, following which, one half (5ml) processed for standard culture by the clinical microorganism laboratory of the Third Hospital of Xiamen and the other 5ml stored at -70\u0026deg;C until the time of DNA extraction. BALF was plated on chocolate, sheep blood, and MacConkey agar plates and incubated for 48-72 h according to routine clinical protocol. The DNA extraction from BALF method was described before. In this procedure, 1\u0026mu;l of the extracted DNA template of the BALF specimen was added to the \u003cem\u003ePA-\u003c/em\u003eMCDA assay and the reactions were performed at an optimal amplification temperature for 45 min. The products were detected by a color change and compared to the results of a standard clinical culture, which was blinded to the research investigators. This study was approved by the local ethics committee of the Third Hospital of Xiamen, and performed according to the ethical standards of the latest revision of the Declaration of Helsinki. Written and informed consent was obtained from family members or the appropriate responsible parties.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eContinuous variables of patients\u0026rsquo; characteristics were reported as the means\u0026plusmn;standard deviations (SD) or the medians (interquartile ranges (IQR)), and categorical variables were reported as numbers (%). The accuracy of the PA-MCDA assay was compared with the microbiological culture in a cross-sectional analysis. P\u003cem\u003e value\u003c/em\u003e \u0026lt; 0.05 was considered significant. Statistical analysis was performed using SPSS version 20.0 for Windows (SPSS Inc., Chicago, IL, USA).\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003eSuccessful establishment of the PA-MCDA assay\u003c/h2\u003e\n\u003cp\u003eTo verify the feasibility of \u003cem\u003ePA\u003c/em\u003e-MCDA primers, the MCDA reactions were initially carried out in the presence or absence of genomic DNA templates within 45 min at a constant temperature of 63\u0026ordm;C[14]. A color shift of positive amplification in \u003cem\u003ePA\u003c/em\u003e-MCDA tubes was directly observed to change from one of colorless to one of green, while the negative control tube remained colorless by the naked eye (Fig. 2A). The positive MCDA products were seen as ladder-like patterned bands on ethidium bromide-stained 2.5% agarose gels that were resolved by electrophoresis; however, these were not seen in the \u003cem\u003eStaphylococcus\u003c/em\u003e \u003cem\u003eaureus\u003c/em\u003e, \u003cem\u003eKlebsiella\u003c/em\u003e \u003cem\u003epneumonia\u003c/em\u003e or blank control (Fig.2B). Hence, the designed MCDA primer was a good candidate to establish the MCDA methodology for detecting \u003cem\u003eP. aeruginosa\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eOptimizing the temperature for the PA-MCDA assay\u003c/h2\u003e\n\u003cp\u003eTo confirm the optimal reaction temperature for the \u003cem\u003eP\u003c/em\u003e\u003cem\u003eA\u003c/em\u003e-MCDA assay, the \u003cem\u003eP. aeruginosa\u003c/em\u003e strain was used as a positive control at a concentration of 1ng per tube and the MCDA amplifications were monitored by a real-time turbidity technique. Performing the \u003cem\u003eP\u003c/em\u003e\u003cem\u003eA\u003c/em\u003e-MCDA assay at temperatures that ranged from 59˚C to 67˚C at 1˚C increments, verified that 65˚C was an optimal temperature for amplification \u0026ndash; with a faster amplification procedure obtained from assay temperatures of 65˚C (Fig. 3 ).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eSpecificity and sensitivity for\u003cem\u003e P. aeruginosa\u003c/em\u003e detection by MCDA assays\u003c/h2\u003e\n\u003cp\u003eWhen genomic templates were used in MCDA assays, only the genomic DNAs that were isolated from the \u003cem\u003eP. aeruginosa\u003c/em\u003e strains (tubes 1 to 17) generated positive results. Genomic templates from all non-\u003cem\u003eP. aeruginosa\u003c/em\u003e strains (1tubes 8 to 34) did not provide production of detectable amplification products (Fig. 4). The color change was observed in positive MCDA tubes (tubes 1 to 17), and a ladder-like pattern was seen on an ethidium bromide-stained 2.5% agarose gel via electrophoresis resolution. These were not seen in negative tubes (Fig. 4).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSerial dilution of the \u003cem\u003eP. aeruginosa\u003c/em\u003e genomic DNA (10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg per microliter) were used in MCDA assays. Fig. 5A and 5B). It indicated that the LoD, and the sensitivity of the PA-MCDA assay was 100 fg genomic templates per reaction.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eApplication of PA-MCDA to clinical samples\u003c/h2\u003e\n\u003cp\u003eThe MCDA assay was used to examine 102 BALF from patients who were suspected of presenting with VAP. Demographic and clinical characteristics of our patients are shown in Table 1. The median duration of mechanical ventilation was 7 days (IQR 4.00-32.50) before suspected VAP onset and 97 patients had received antibiotics within two months before suspected VAP. The clinical diagnosis of VAP was given by physician judgment with respect to particular patients or special clinical situations combination with culture results. A total of 94 positive bacteria results were detected by conventional culture in 82/102(80.39%) BALFs in which Polymicrobial growth was 12/102(11.76%) and Polymicrobial included \u003cem\u003eP. aeruginosa\u003c/em\u003e were 4/102(3.92%). Bacterial strains list of BALF by standard culture is detailed in Additional file 2. After extracting DNA from these BALF specimens and adding 1\u0026mu;l of the DNA template to the \u003cem\u003ePA-\u003c/em\u003eMCDA assay, the reactions were carried out at 65℃ for 45 min and the results were compared to those of the standard culture. The \u003cem\u003eP. aeruginosa\u003c/em\u003e was detected in 26 samples by microbiological culture and in 31 samples by PA-MCDA. Two methods unanimously detected 24 \u003cem\u003eP. aeruginosa \u003c/em\u003estrains while the MCDA detected 7 \u003cem\u003eP. aeruginosa\u003c/em\u003e strains in culture negative patients who received antipseudomonal therapy. The positive results of PA-MCDA and microbiological culture were 24/76(31.58%) and 17/76(22.37%) respectively in 76 patients who had received antipseudomonal therapy. In the cross-sectional analysis, the agreement between the tests was 91.18% (\u0026kappa;= 0.787\u003cem\u003e; p =0.000\u003c/em\u003e) , likelihood ratio\u0026nbsp;positive was 10.02 and likelihood ratio\u0026nbsp;negative was 0.08.The PA-MCDA assay showed values of 92.31%, 90.78%, 77.41% and 97.18% for sensitivity, specificity, positive predictive value and negative predictive value, respectively.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePA-MCDA reaction was performed with a set of 10 oligonucleo tide primers, which specifically recognized 10 distinct sites on the target sequence, wherein the optimal temperature for amplification was 65˚C.\u0026nbsp; In particular, a colorimetric indicator (malachite green, MG) had been applied and the color changed from colorless to a light green color when the reaction was positive. The specificity of the PA-MCDA assay was 100 percent, and the sensitivity achieved a level as low as 100fg of the template. The entire procedure, including that of specimen processing (15 min), the isothermal reaction, and result reporting (45 min), could be completed in approximately 1h. The agreement between PA-MCDA and bacteria culture was 91.18% (\u0026kappa;= 0.787\u003cem\u003e; p =0.000\u003c/em\u003e) \u0026nbsp;in identification of \u003cem\u003eP. aeruginosa\u003c/em\u003e in BALF from suspected VAP. PA-MCDA had higher detective rate of \u003cem\u003eP. aeruginosa\u003c/em\u003e than bacteria culture in patients who had received antipseudomonal therapy.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA rapid, simple and accurate detection method of pathogenic microorganisms was necessary for the timely administration of appropriate therapy and arriving at a time to discontinue unnecessary antibiotic(s). Delayed receipt of an appropriate antibiotic(s) was independently associated with poorer clinical and economic outcomes in patients with serious Gram-negative bacterial infections, regardless of any resistance status[9].Molecular diagnostic assays, such as PCR-based methods (e.g., conventional PCR, real-time PCR [17], and PCR-Electro Spray Ionization MS (PCR/ESI-MS)[18], permit more rapid detection of targeted bacterium by nucleic acid amplification, and have been established and applied in the clinic. However, these PCR-based techniques have some shortcomings, which include the following: (i) the instrument used is extremely expensive; (ii) the diagnostic specificity is highly affected by the amplification conditions and the primer design; (iii) use of these techniques indicate that PCR results require gel electrophoretic analysis or real-time analytical apparatus. Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF)[19] consistently decreased the time for successful identification of the pathogenic organism, shorten the period of time for administering an effective and optimal antibiotic and thus arrive at improved patient outcomes. However, it also needs a bacterial culture and expensive instruments.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor diagnosis of VAP, not the standard culture but the MCDA assay are intended to supplant physician judgment respect to particular patients or special clinical situations.The PA-MCDA assay just represents a rapid, sensitive and nearly instrument-free method of \u003cem\u003eP. aeruginosa\u003c/em\u003e detection. Only a water bath or heat block was needed during the reaction stage and the cost is about $8 per sample compared to standard culture is $10 per sample. Due to MCDA being able to provide results within only one hour, the clinician can save time to provide targeted therapy for patients, especially in the context of severe sepsis or septic shock patients. The positive test of PA-MCDA means there were \u003cem\u003eP. aeruginosa\u003c/em\u003e \u0026nbsp;in BALF, \u0026nbsp;an initial narrow antibiotic therapy with antipseudomonal activity should be given \u0026nbsp;in stable patients with suspected VAP in order to provide targeted therapy and reduce antibiotic exposure. The broad-spectrum empiric therapy with antipseudomonal activity needed to given in patients with severe acute respiratory distress syndrome and profound (unstable) septic shock when the PA-MCDA were positive because the high sensitivity for PA-MCDA assays and the polymicrobial growth always existed. The negative test indicated that there were no \u003cem\u003eP. aeruginosa\u003c/em\u003e growth or the number of\u003cem\u003e P. aeruginosa \u003c/em\u003ewas very below the 10\u003csup\u003e4\u003c/sup\u003ecfu/ml in the BALFs as the high sensitivity of PA-MCDA assay[20]. The value was that empiric combination coverage for \u003cem\u003eP. aeruginosa\u003c/em\u003e might not be necessary and the discontinuation of antibiotic therapy with antipseudomonal activity needed to be considered by clinicians[13]. Although, the bacterium specific-MCDA assay cannot differentiate the infection from colonization for it cannot quantitative the bacteria strains of BALF that is the methodology to diagnose VAP, the different time of color change of positive MCDA assay may relate to the amount of DNA templates of bacteria because its reaction products could be detected by real-time fluorescence and less time of positive reactions were produced in more specific-DNA templates[20]. Whether a threshold time of color change for MCDA reflects the quantitative or semiquantitative bacterium for clinical application needs a precise design and analysis.The PA-MCDA assay also detected 7 positive \u003cem\u003eP. aeruginosa\u003c/em\u003e, while standard culture was negative in 76 patients who had received antipseudomonal therapy.The interpretation might suggest the MCDA approach had a higher sensitivity than standard culture[15, 21], or that the culture negativity might reflect the presence of active culture inhibitors in the samples[22], or that the \u003cem\u003eP. aeruginosa\u003c/em\u003e had become non-viable before or even between the standard culture periods since the growth conditions had changed. Clinical factors should also be taken into account because they might alter the decision of whether to withhold or continue antibiotics. The ultimate clinical determination of VAP, pathogens and regarding antibiotics application was made by the physician in the light of each patient\u0026rsquo;s individual circumstances[13].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn order to use MCDA method to clinical application, this study also has limitations. The first is the bacterium specific-MCDA assay cannot differentiate the infection from colonization because it cannot provide the results of quantitative bacterium of BALF. A more precise study will be designed recently to explore the relationship between a cutoff time for MCDA color change and the quantitative or semiquantitative bacterium in clinical samples. \u0026nbsp;In addition, whether or not the assay could detect the target pathogen in other specimens such as blood, urine or serous effusion needs further study. Consequently, both the negative and positive results of PA-MCDA cannot rule out the presence of other pathogens, Gram-positive or Gram-negative bacteria or fungi, for polymicrobial growth always existed. MCDA cannot provide precise information to prescribe or withdrew pathogen-specific therapy[23] until more pathogen specific-MCDA and resistance-associated genes be designed[20]. We propose to assign some microorganism-specific MCDA assays and resistance-associated genes (e.g., the nfxB gene and the blaPER-1 gene)[18, 19, 24, 25] that are aligned to common pathogens in ICU, which would include \u003cem\u003eStaphylococcus. aureus\u003c/em\u003e (MRSA)[26] , \u003cem\u003eAcinetobacter baumannii\u003c/em\u003e, \u003cem\u003eEscherichia coli\u003c/em\u003e, fungal species, and others in one template.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe PA-MCDA assay for rapid detection of \u003cem\u003eP. aeruginosa\u003c/em\u003e, which was based on the oprL gene was successfully developed. This approach enabled its reaction products to be identified by the naked eye, and the assay established a high degree of both specificity and sensitivity for target template analysis. The PA-MCDA assay does not only have the benefit of a rapid, reliable and nearly instrument-free procedure, but it can differentiate \u003cem\u003eP. aeruginosa\u003c/em\u003e from pure strains of bacteria and clinical specimens without the need for time-consuming bacterial culture and its clinical significance needs further establishment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the Third Hospital of Xiamen Affiliated of Fujian University of Traditional Chinese Medicine. We would also like to express our gratitude to the clinicians and healthcare professionals who helped us in this study.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by a grant from the Medical Innovation Project of Fujian Province funded by the Xiamen Municipal Health Commission [grant number 2015-CXB-48]\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003cbr /\u003e The dataset analysed during the current study is available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe corresponding author (BC) was in charge of study design. The first author (JXW) was responsible for manuscript writing and cooperated with the rest three authors (HMC, XML and CYJ) in clinical research work. JXW was in charge of data collection and experiment, BC was responsible for data analysis. HMC, XML and CYJ were responsible for sample collection, experiment technical and material support \u0026nbsp;during the study. All authors have read and approved the publication of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003cbr /\u003e \u003c/strong\u003eAll procedures in the study were performed in accordance with the ethical standards of the institutional research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Written and informed consent was obtained from family members or the appropriate responsible parties.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cbr /\u003e Not applicable\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declared that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTorres A, Niederman MS, Chastre J, Ewig S, Fernandez-Vandellos P, Hanberger H, Kollef M, Li\u0026nbsp;Bassi G, Luna CM, Martin-Loeches I\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eInternational ERS/ESICM/ESCMID/ALAT guidelines for the management of hospital-acquired pneumonia and ventilator-associated pneumonia\u003c/strong\u003e. \u003cem\u003eGuidelines for the management of hospital-acquired pneumonia (HAP)/ventilator-associated pneumonia (VAP) of the European Respiratory Society (ERS), European Society of Intensive Care Medicine (ESICM), European Society of Clinical Microbiology and Infectious Diseases (ESCMID) and Asociaci\u0026oacute;n Latinoamericana del T\u0026oacute;rax (ALAT) \u003c/em\u003e2017, \u003cstrong\u003e50\u003c/strong\u003e(3):1700582.\u003c/li\u003e\n\u003cli\u003eVincent JL, Rello J, Marshall J, Silva E, Anzueto A, Martin CD, Moreno R, Lipman J, Gomersall C, Sakr Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eInternational study of the prevalence and outcomes of infection in intensive care units\u003c/strong\u003e. \u003cem\u003eJama \u003c/em\u003e2009, \u003cstrong\u003e302\u003c/strong\u003e(21):2323-2329.\u003c/li\u003e\n\u003cli\u003eKoulenti D, Tsigou E, Rello J: \u003cstrong\u003eNosocomial pneumonia in 27 ICUs in Europe: perspectives from the EU-VAP/CAP study\u003c/strong\u003e. \u003cem\u003eEuropean journal of clinical microbiology \u0026amp; infectious diseases : official publication of the European Society of Clinical Microbiology \u003c/em\u003e2017, \u003cstrong\u003e36\u003c/strong\u003e(11):1999-2006.\u003c/li\u003e\n\u003cli\u003eCisneros JM, Rosso-Fern\u0026aacute;ndez CM, Roca-Oporto C, De Pascale G, Jim\u0026eacute;nez-Jorge S, Fern\u0026aacute;ndez-Hinojosa E, Matthaiou DK, Ram\u0026iacute;rez P, D\u0026iacute;az-Miguel RO, Estella A\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eColistin versus meropenem in the empirical treatment of ventilator-associated pneumonia (Magic Bullet study): an investigator-driven, open-label, randomized, noninferiority controlled trial\u003c/strong\u003e. \u003cem\u003eCritical Care \u003c/em\u003e2019, \u003cstrong\u003e23\u003c/strong\u003e(1):383.\u003c/li\u003e\n\u003cli\u003eSafdar N, Dezfulian C, Collard HR, Saint S: \u003cstrong\u003eClinical and economic consequences of ventilator-associated pneumonia: a systematic review\u003c/strong\u003e. \u003cem\u003eCrit Care Med \u003c/em\u003e2005, \u003cstrong\u003e33\u003c/strong\u003e(10):2184-2193.\u003c/li\u003e\n\u003cli\u003eZimlichman E, Henderson D, Tamir O, Franz C, Song P, Yamin CK, Keohane C, Denham CR, Bates DW: \u003cstrong\u003eHealth Care\u0026ndash;Associated Infections: A Meta-analysis of Costs and Financial Impact on the US Health Care SystemMeta-analysis of Health Care\u0026ndash;Associated InfectionsMeta-analysis of Health Care\u0026ndash;Associated Infections\u003c/strong\u003e. \u003cem\u003eJAMA Internal Medicine \u003c/em\u003e2013, \u003cstrong\u003e173\u003c/strong\u003e(22):2039-2046.\u003c/li\u003e\n\u003cli\u003eRhodes A, Evans LE, Alhazzani W, Levy MM, Antonelli M, Ferrer R, Kumar A, Sevransky JE, Sprung CL, Nunnally ME\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eSurviving Sepsis Campaign: International Guidelines for Management of Sepsis and Septic Shock: 2016\u003c/strong\u003e. \u003cem\u003eIntensive care medicine \u003c/em\u003e2017, \u003cstrong\u003e43\u003c/strong\u003e(3):304-377.\u003c/li\u003e\n\u003cli\u003eJacobs JA, De Brauwer EI, Cornelissen EI, Drent M: \u003cstrong\u003eAccuracy and precision of quantitative calibrated loops in transfer of bronchoalveolar lavage fluid\u003c/strong\u003e. \u003cem\u003eJ Clin Microbiol \u003c/em\u003e2000, \u003cstrong\u003e38\u003c/strong\u003e(6):2117-2121.\u003c/li\u003e\n\u003cli\u003eBonine NG, Berger A, Altincatal A, Wang R, Bhagnani T, Gillard P, Lodise T: \u003cstrong\u003eImpact of Delayed Appropriate Antibiotic Therapy on Patient Outcomes by Antibiotic Resistance Status From Serious Gram-negative Bacterial Infections\u003c/strong\u003e. \u003cem\u003eThe American Journal of the Medical Sciences \u003c/em\u003e2019, \u003cstrong\u003e357\u003c/strong\u003e(2):103-110.\u003c/li\u003e\n\u003cli\u003eOng DS, Jongerden IP, Buiting AG, Leverstein-van Hall MA, Speelberg B, Kesecioglu J, Bonten MJ: \u003cstrong\u003eAntibiotic exposure and resistance development in Pseudomonas aeruginosa and Enterobacter species in intensive care units\u003c/strong\u003e. \u003cem\u003eCrit Care Med \u003c/em\u003e2011, \u003cstrong\u003e39\u003c/strong\u003e(11):2458-2463.\u003c/li\u003e\n\u003cli\u003eKollef KE, Schramm GE, Wills AR, Reichley RM, Micek ST, Kollef MH: \u003cstrong\u003ePredictors of 30-Day Mortality and Hospital Costs in Patients With Ventilator-Associated Pneumonia Attributed to Potentially Antibiotic-Resistant Gram-Negative Bacteria\u003c/strong\u003e. \u003cem\u003eCHEST \u003c/em\u003e2008, \u003cstrong\u003e134\u003c/strong\u003e(2):281-287.\u003c/li\u003e\n\u003cli\u003eMicek ST, Wunderink RG, Kollef MH, Chen C, Rello J, Chastre J, Antonelli M, Welte T, Clair B, Ostermann H\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAn international multicenter retrospective study of Pseudomonas aeruginosa nosocomial pneumonia: impact of multidrug resistance\u003c/strong\u003e. \u003cem\u003eCritical care (London, England) \u003c/em\u003e2015, \u003cstrong\u003e19\u003c/strong\u003e(1):219-227.\u003c/li\u003e\n\u003cli\u003eKalil AC, Metersky ML, Klompas M, Muscedere J, Sweeney DA, Palmer LB, Napolitano LM, O'Grady NP, Bartlett JG, Carratala J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eManagement of Adults With Hospital-acquired and Ventilator-associated Pneumonia: 2016 Clinical Practice Guidelines by the Infectious Diseases Society of America and the American Thoracic Society\u003c/strong\u003e. \u003cem\u003eClinical infectious diseases : an official publication of the Infectious Diseases Society of America \u003c/em\u003e2016, \u003cstrong\u003e63\u003c/strong\u003e(5):e61-e111.\u003c/li\u003e\n\u003cli\u003eWang Y, Wang Y, Luo L, Liu D, Luo X, Xu Y, Hu S, Niu L, Xu J, Ye C: \u003cstrong\u003eRapid and Sensitive Detection of Shigella spp. and Salmonella spp. by Multiple Endonuclease Restriction Real-Time Loop-Mediated Isothermal Amplification Technique\u003c/strong\u003e. \u003cem\u003eFront Microbiol \u003c/em\u003e2015, \u003cstrong\u003e6\u003c/strong\u003e:1400-1400.\u003c/li\u003e\n\u003cli\u003eWang Y, Wang Y, Ma A-J, Li D-X, Luo L-J, Liu D-X, Jin D, Liu K, Ye C-Y: \u003cstrong\u003eRapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification\u003c/strong\u003e. \u003cem\u003eSci Rep \u003c/em\u003e2015, \u003cstrong\u003e5\u003c/strong\u003e:11902-11902.\u003c/li\u003e\n\u003cli\u003ePugin J, Auckenthaler R, Mili N, Janssens JP, Lew PD, Suter PM: \u003cstrong\u003eDiagnosis of ventilator-associated pneumonia by bacteriologic analysis of bronchoscopic and nonbronchoscopic \"blind\" bronchoalveolar lavage fluid\u003c/strong\u003e. \u003cem\u003eThe American review of respiratory disease \u003c/em\u003e1991, \u003cstrong\u003e143\u003c/strong\u003e(5 Pt 1):1121-1129.\u003c/li\u003e\n\u003cli\u003eFrye AM, Baker CA, Rustvold DL, Heath KA, Hunt J, Leggett JE, Oethinger M: \u003cstrong\u003eClinical impact of a real-time PCR assay for rapid identification of staphylococcal bacteremia\u003c/strong\u003e. \u003cem\u003eJ Clin Microbiol \u003c/em\u003e2012, \u003cstrong\u003e50\u003c/strong\u003e(1):127-133.\u003c/li\u003e\n\u003cli\u003eBogaerts P, Hamels S, de Mendonca R, Huang T-D, Roisin S, Remacle J, Markine-Goriaynoff N, de Longueville F, Pl\u0026uuml;ster W, Denis O\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAnalytical validation of a novel high multiplexing real-time PCR array for the identification of key pathogens causative of bacterial ventilator-associated pneumonia and their associated resistance genes\u003c/strong\u003e. \u003cem\u003eJournal of Antimicrobial Chemotherapy \u003c/em\u003e2012, \u003cstrong\u003e68\u003c/strong\u003e(2):340-347.\u003c/li\u003e\n\u003cli\u003eHuang AM, Newton D, Kunapuli A, Gandhi TN, Washer LL, Isip J, Collins CD, Nagel JL: \u003cstrong\u003eImpact of Rapid Organism Identification via Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Combined With Antimicrobial Stewardship Team Intervention in Adult Patients With Bacteremia and Candidemia\u003c/strong\u003e. \u003cem\u003eClinical Infectious Diseases \u003c/em\u003e2013, \u003cstrong\u003e57\u003c/strong\u003e(9):1237-1245.\u003c/li\u003e\n\u003cli\u003eWang Y, Wang Y, Zhang L, Liu D, Luo L, Li H, Cao X, Liu K, Xu J, Ye C: \u003cstrong\u003eMultiplex, Rapid, and Sensitive Isothermal Detection of Nucleic-Acid Sequence by Endonuclease Restriction-Mediated Real-Time Multiple Cross Displacement Amplification\u003c/strong\u003e. \u003cem\u003eFront Microbiol \u003c/em\u003e2016, \u003cstrong\u003e7\u003c/strong\u003e:753.\u003c/li\u003e\n\u003cli\u003eKumar A, Ellis P, Arabi Y, Roberts D, Light B, Parrillo JE, Dodek P, Wood G, Kumar A, Simon D\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eInitiation of Inappropriate Antimicrobial Therapy Results in a Fivefold Reduction of Survival in Human Septic Shock\u003c/strong\u003e. \u003cem\u003eCHEST \u003c/em\u003e2009, \u003cstrong\u003e136\u003c/strong\u003e(5):1237-1248.\u003c/li\u003e\n\u003cli\u003eDickson RP, Erb-Downward JR, Prescott HC, Martinez FJ, Curtis JL, Lama VN, Huffnagle GB: \u003cstrong\u003eAnalysis of culture-dependent versus culture-independent techniques for identification of bacteria in clinically obtained bronchoalveolar lavage fluid\u003c/strong\u003e. \u003cem\u003eJ Clin Microbiol \u003c/em\u003e2014, \u003cstrong\u003e52\u003c/strong\u003e(10):3605-3613.\u003c/li\u003e\n\u003cli\u003eGiani T, Arena F, Pollini S, Di Pilato V, D\u0026rsquo;Andrea MM, Henrici De Angelis L, Bassetti M, Rossolini GM, Group PaW: \u003cstrong\u003eItalian nationwide survey on Pseudomonas aeruginosa from invasive infections: activity of ceftolozane/tazobactam and comparators, and molecular epidemiology of carbapenemase producers\u003c/strong\u003e. \u003cem\u003eJournal of Antimicrobial Chemotherapy \u003c/em\u003e2017, \u003cstrong\u003e73\u003c/strong\u003e(3):664-671.\u003c/li\u003e\n\u003cli\u003eJenny M, Kingsbury J: \u003cstrong\u003eProperties and Prevention: A Review of Pseudomonas aeruginosa\u003c/strong\u003e. \u003cem\u003eJ Biol Med Res \u003c/em\u003e2018, \u003cstrong\u003e2 \u003c/strong\u003e(3):8.\u003c/li\u003e\n\u003cli\u003eEvans SR, Tran TTT, Hujer AM, Hill CB, Hujer KM, Mediavilla JR, Manca C, Domitrovic TN, Perez F, Farmer M: \u003cstrong\u003eRapid Molecular Diagnostics to Inform Empiric Use of Ceftazidime/Avibactam and Ceftolozane/Tazobactam Against Pseudomonas aeruginosa: PRIMERS IV\u003c/strong\u003e. \u003cem\u003eClinical Infectious Diseases \u003c/em\u003e2018.\u003c/li\u003e\n\u003cli\u003eGong L, Liu E, Che J, Li J, Liu X, Xu H, Liang J: \u003cstrong\u003eMultiple Cross Displacement Amplification Coupled With Gold Nanoparticles-Based Lateral Flow Biosensor for Detection of the Mobilized Colistin Resistance Gene mcr-1\u003c/strong\u003e. \u003cem\u003eFront Cell Infect Microbiol \u003c/em\u003e2019, \u003cstrong\u003e9\u003c/strong\u003e:226-226.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp style=\"text-align: justify; text-justify: inter-ideograph; tab-stops: 45.8pt 91.6pt 137.4pt 183.2pt 229.0pt 274.8pt 320.6pt 366.4pt 412.2pt 458.0pt 503.8pt 549.6pt 595.4pt 641.2pt 687.0pt 732.8pt;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 11pt; line-height: 150%; font-family: 'Arial', sans-serif;\"\u003eTable 1. Demographic, clinical and biological characteristics of patients\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse: collapse; border: none;\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eCharacteristics at ICU admission\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eTotal\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003en=102\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eMale sex, n(%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e75\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e73.5%\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eAge(years),median(IQR)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e54.62\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e\u0026plusmn;\u003c/span\u003e19.59, 57\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e39.75-70.75\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u0026nbsp;\u0026nbsp;Medical patients, n (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e39\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e38.2%\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eSurgery patients, n (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e63\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e61.8%\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003ePrior antibiotics in 90 days, n (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e61\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e59.8%\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cstrong\u003eCharacteristics upon VAP onset\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u0026nbsp; ICU stay (days),median(IQR)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e37.87\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e\u0026plusmn;\u003c/span\u003e80.45, 8\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e4.00-37.75\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eDuration of MV* (days), median(IQR)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e35.42\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e\u0026plusmn;\u003c/span\u003e80.05, 7\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e4.00-32.50\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eSeptic shock, n (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e57\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e55.9%\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003enew or persistent infiltrate on chest radiography\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e72 \u0026nbsp;(70.59%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eCPIS**\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e6.59\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e\u0026plusmn;\u003c/span\u003e1.70,7\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e5.00-8.00\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eCRP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e84.59\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e\u0026plusmn;\u003c/span\u003e57.98, 69.45(46.00-104.80)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003ePCT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e17.34\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e\u0026plusmn;\u003c/span\u003e24.29, 10\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e2.34-21.30\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u003cstrong\u003eAntibiotics \u003c/strong\u003e\u003cstrong\u003e-within 3 days\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eNone\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e4.9%\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eMonotherapy\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e41\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e(\u003c/span\u003e40.2%\u003cspan style=\"font-family: 'Calibri',sans-serif;\"\u003e)\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eCombination antibiotic therapy\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e56 (54.9)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003ecovering PA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e76(74.5%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; text-indent: 12.0pt;\"\u003eChange of antibiotics, n (%)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e45(44.1%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 218.05pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"291\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u003cstrong\u003eClinical diagnosis of VAP\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 184.25pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"246\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e68(66.7%)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e*: duration of mechanical ventilation before suspected VAP, **CPIS, Clinical pulmonary infection score.\u003c/p\u003e\n\u003cp style=\"line-height: normal;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eTable 2. Primers used for multiple cross displacement amplification in this study.\u003c/h2\u003e\n\u003ctable style=\"background: #D0DDEF; border-collapse: collapse; border: none;\" width=\"564\"\u003e\n\u003ctbody\u003e\n\u003ctr style=\"height: 10.1pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 10.1pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u003cstrong\u003ePrimers \u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border: solid black 1.0pt; border-left: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 10.1pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u003cstrong\u003eSequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border: solid black 1.0pt; border-left: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 10.1pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u003cstrong\u003eLength\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eCP1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eGCCGAATTTCAGCATTTCCATCATG-CCTGAACTGACGGTCGCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e43mer\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eCP2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eCGATGCTTCCGGTGAAGGTGC-AACGGCACCGCTGTTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e37mer\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eF1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eGCCTTCCTGGTCCCCTTA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e18nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eF2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eCGGCTTCGTCGCTCAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e16nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eC1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eGCCGAATTTCAGCATTTCCATCATG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e25nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eC2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eCGATGCTTCCGGTGAAGGTGC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e21nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eD1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eACTCCTAATGAACCCCAGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e19nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eD2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eACCCGAACGCAGGCTATG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e18nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eR1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eCAGAGCCAGCGCAGCA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e16nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eR2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eGGCTGTGGCTGTGGGT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e16nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eP1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eCCTGAACTGACGGTCGCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e18nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 11.05pt;\"\u003e\n\u003ctd style=\"width: 53.75pt; border: solid black 1.0pt; border-top: none; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"72\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eP2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 316.2pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"422\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003eAACGGCACCGCTGTTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 53.05pt; border-top: none; border-left: none; border-bottom: solid black 1.0pt; border-right: solid black 1.0pt; background: transparent; padding: 4.0pt 4.0pt 4.0pt 4.0pt; height: 11.05pt;\" width=\"71\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e16nt\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph; line-height: normal;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 11pt; line-height: 150%; font-family: 'Arial', sans-serif;\"\u003eTable\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 11pt; line-height: 150%; font-family: 'Arial', sans-serif;\"\u003e3\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cspan style=\"font-size: 11pt; line-height: 150%; font-family: 'Arial', sans-serif;\"\u003e. List of bacterial strains\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"line-height: 200%;\"\u003eA total of 77 bacterial strains, which included 17 PA and 60 non-PA strains were identified by MALDI-TOF (microflex LT/SH, Bruker corporation, Karlsruhe, Germany) by the clinical microorganism laboratory of the Third Hospital of Xiamen.\u003c/p\u003e\n\u003ctable style=\"border-collapse: collapse; border: none;\" width=\"568\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: center;\"\u003eBacteria\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: center;\"\u003estrains\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: center;\"\u003eBacteria\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border: solid windowtext 1.0pt; border-left: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: center;\"\u003eStrains\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eP\u003c/em\u003e\u003cem\u003eseudomonas. aeruginosa\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e17\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eStreplococcus agalactiae\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eEnterococcus faecalis\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eStaphylococcus. aureus\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eSalmonella typhimurium\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eAcinetobacter baumannii \u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eK\u003c/em\u003e\u003cem\u003elebsiella. pneumoniae\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eEnterobacter cloacae\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eStaphylococcus capitis \u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eStenotrophomonas maltophilia \u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 154.25pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"206\"\u003e\n\u003cp style=\"text-align: left;\"\u003e\u003cem\u003eStreptococcus pyogenes\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 42.55pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"57\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 170.1pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"227\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 58.8pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"78\"\u003e\n\u003cp style=\"text-align: justify; text-justify: inter-ideograph;\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"critical-care","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cric","sideBox":"Learn more about [Critical Care](http://ccforum.biomedcentral.com/)","snPcode":"13054","submissionUrl":"https://submission.nature.com/new-submission/13054/3","title":"Critical Care","twitterHandle":"@Crit_Care","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Pseudomonas aeruginosa, multiple cross displacement amplification, ventilated-associated pneumonia, bronchoalveolar lavage fluid, Limit of Detection","lastPublishedDoi":"10.21203/rs.2.22930/v3","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.22930/v3","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Early and rapid identification of Pseudomonas aeruginosa (P. aeruginosa) in patients with suspected ventilator-associated pneumonia (VAP) provides theoretical clinical advantages in therapeutic optimization strategies. \u003c/p\u003e\u003cp\u003eMethods: The P. aeruginosa-multiple cross displacement amplification (PA-MCDA) assay was conducted at an isothermal temperature during the amplification stage, and products were visually detected by color changes. The entire process was completed within 1 h. A total of 77 strains, including P. aeruginosa species and various other species of non-P. aeruginosa were used to evaluate PA-MCDA assays. Bronchoalveolar lavage fluid (BALF) of suspected VAP patients were examined by the MCDA assay. \u003c/p\u003e\u003cp\u003eResults: The MCDA assay exhibited a 100 percent analytical specificity in detecting PA from all 77 strains, and the limit of detection were as low as 100 fg DNA per reaction. A temperature of 65ºC was recommended as standard during the amplification stage. The agreement between\u0026nbsp;PA-MCDA and bacteria culture was 91.18% (κ= 0.787; p =0.000) in identification of P. aeruginosa in BALF from suspected VAP. The PA-MCDA assay showed values of 92.31%, 90.78%, 77.41% and 97.18% for sensitivity, specificity, positive predictive value and negative predictive value, respectively.\u0026nbsp;PA-MCDA had higher detective rate of P. aeruginosa than bacteria culture in patients with antipseudomonal therapy. \u003c/p\u003e\u003cp\u003eConclusions: The instrument-free platform of the MCDA assay makes it a simple, rapid and applicable procedure for “on-site” diagnosis and point-of-care testing for the presence of\u0026nbsp;P. aeruginosa without the need for specific bacterial culture.\u003c/p\u003e","manuscriptTitle":"Multiple Cross Displacement Amplification-a more applicable technique in detecting Pseudomonas Aeruginosa of Ventilator-associated Pneumonia ( VAP)","msid":"","msnumber":"","nonDraftVersions":[{"code":3,"date":"2020-05-26 16:39:16","doi":"10.21203/rs.2.22930/v3","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accept","date":"2020-05-18T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-05-16T12:00:00+00:00","index":2,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-05-16T12:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorInvitedReview","content":"","date":"2020-05-16T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorAssigned","content":"","date":"2020-05-13T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-05-13T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-05-13T12:00:00+00:00","index":1,"fulltext":""},{"type":"checksComplete","content":"","date":"2020-05-12T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-05-12T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"critical-care","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cric","sideBox":"Learn more about [Critical Care](http://ccforum.biomedcentral.com/)","snPcode":"13054","submissionUrl":"https://submission.nature.com/new-submission/13054/3","title":"Critical Care","twitterHandle":"@Crit_Care","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":2,"date":"2020-04-14 19:22:42","doi":"10.21203/rs.2.22930/v2","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2020-04-13T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-04-12T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewerAgreed","content":"","date":"2020-04-09T12:00:00+00:00","index":2,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-04-09T12:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorAssigned","content":"","date":"2020-04-08T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-04-08T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-04-08T12:00:00+00:00","index":1,"fulltext":""},{"type":"checksComplete","content":"","date":"2020-04-07T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-04-07T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"critical-care","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cric","sideBox":"Learn more about [Critical Care](http://ccforum.biomedcentral.com/)","snPcode":"13054","submissionUrl":"https://submission.nature.com/new-submission/13054/3","title":"Critical Care","twitterHandle":"@Crit_Care","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2020-02-07 23:49:11","doi":"10.21203/rs.2.22930/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2020-02-28T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-02-22T12:00:00+00:00","index":2,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-02-22T12:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"editorInvitedReview","content":"","date":"2020-02-21T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"reviewerAgreed","content":"","date":"2020-02-17T12:00:00+00:00","index":1,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-02-16T12:00:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2020-02-10T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-02-09T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-02-06T12:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2020-02-04T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"critical-care","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cric","sideBox":"Learn more about [Critical Care](http://ccforum.biomedcentral.com/)","snPcode":"13054","submissionUrl":"https://submission.nature.com/new-submission/13054/3","title":"Critical Care","twitterHandle":"@Crit_Care","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e657d282-d61b-46d9-9bcc-ba639268ff19","owner":[],"postedDate":"May 26th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":83415,"name":"Critical Care \u0026 Emergency Medicine"}],"tags":[],"updatedAt":"2021-07-22T20:14:39+00:00","versionOfRecord":{"articleIdentity":"rs-13503","link":"https://doi.org/10.1186/s13054-020-03003-4","journal":{"identity":"critical-care","isVorOnly":false,"title":"Critical Care"},"publishedOn":"2020-06-08 20:14:39","publishedOnDateReadable":"June 8th, 2020"},"versionCreatedAt":"2020-05-26 16:39:16","video":"","vorDoi":"10.1186/s13054-020-03003-4","vorDoiUrl":"https://doi.org/10.1186/s13054-020-03003-4","workflowStages":[]},"version":"v3","identity":"rs-13503","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-13503","version":["v3"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00