A tRNA-derived fragment tRF3019a promotes LUAD metastasis by stabilizing hnRNPK and enhancing MYH11 expression.

The differential expression and prognostic value of tRF3019a in LUAD were obtained from the OncotRF database [ 18 ]. OncotRF integrates multiple publicly available small RNA-sequencing (RNA-seq) datasets, including The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO). Because the database provides only processed expression matrices and survival outcomes without patient-level demographic or clinicopathological variables, no further demographic information could be extracted. The collection and utilization of human specimens received approval from the Ethics Committee of Xiangya Hospital (grant no. 202103192). We acquired a total of 100 pairs of LUAD tumor tissues from patient specimens collected between January 2016 and December 2017, sourced from the surgical specimen bank established by the Thoracic Surgery team at Xiangya Hospital, Central South University. The diagnostic criteria adhered to the Staging Classification of Lung Cancer (eighth edition). Importantly, none of the patients had undergone any treatment or had a history of other malignancies prior to their surgical procedures. Our research team conducted follow-ups every 3 months via telephone or in-person visits to assess survival and recurrence until death or the end of the study. For survival analysis, patients were divided into high- and low-expression groups according to the median expression level of tRF3019a, and overall survival was analyzed using the Kaplan–Meier method. Total RNA was extracted from LUAD pathological tissues and cells using TRIzol reagent (Invitrogen) in accordance with the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized from small RNA using the Mir-X™ miRNA First Strand Synthesis Kit (TaKaRa) following the manufacturer’s guidelines, and messenger RNA (mRNA) was converted to first-strand cDNA using the PrimeScript RT Reagent Kit (TaKaRa). Quantitative real-time polymerase chain reaction (PCR) was conducted with the SYBR Premix Ex Taq II (TaKaRa) and the ViiA 7 Real-Time PCR System (Applied Biosystems) as per the manufacturer’s instructions. U6 or GAPDH was measured as the internal control. The quantification of tRF levels was performed using the 2 −ΔCt or 2 −ΔΔCt methods for relative expression analysis, where ΔCt = Ct (tRFs/mRNAs) − Ct (U6/GAPDH); ΔΔCt = ΔCt (case) − ΔCt (control). The list of primers is presented in Supplementary Table S1. All qRT–PCR primers were designed using Primer-BLAST and verified for specificity against the human RefSeq database to ensure unique target amplification. RNA FISH was performed on both formalin-fixed, paraffin-embedded (FFPE) human LUAD tissue sections and cultured LUAD cells. A tRF3019a-specific probe was designed and synthesized by Servicebio (Wuhan, China). For tissue RNA FISH, FFPE LUAD tissue sections were deparaffinized, rehydrated, and subjected to protease treatment. Hybridization with the tRF3019a probe was performed according to the manufacturer’s instructions. After stringent washing, nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI), and images were acquired using a fluorescence microscope. For cellular RNA FISH, H1299 and PC-9 cells were seeded onto glass coverslips, fixed with 4% paraformaldehyde for 10 min at room temperature, and permeabilized with 0.5% Triton X-100 for 10 min. Cells were then hybridized with the tRF3019a probe following the manufacturer’s protocol. After washing, nuclei were counterstained with DAPI and fluorescence images were captured using a confocal microscope (Leica). The human lung adenocarcinoma cell lines H1299 (cat. no. TCHu160) and PC-9 (cat. no. TCHu171) and the mouse Lewis lung carcinoma (LLC) cell line (cat. no. TCM13) were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cell lines were authenticated by short tandem repeat (STR) DNA profiling and tested negative for mycoplasma contamination prior to use. LUAD cell lines were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco), while LLC cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco). All culture media were supplemented with 10% fetal bovine serum (FBS) (Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco). Synthetic tRF3019a mimics and the tRF antisense oligonucleotide (tRF3019a inhibitor) were purchased from GenePharma (Shanghai, China), and the corresponding sequences are presented in Supplementary Table S2. Cells were seeded into six-well plates at 40–50% confluence 1 day prior to transfection. Both tRF mimics and tRF inhibitor were transfected at a final concentration of 50 nM using Lipofectamine 3000 (Invitrogen) in reduced-serum Opti-MEM medium (Life Technologies), following the manufacturer’s instructions. The transfection mixture was incubated with cells for 6 h, after which it was replaced with fresh complete medium. Cells were harvested 24–48 h post transfection for subsequent assays, including qRT–PCR, western blotting, and functional experiments. For the Transwell assay, 4 × 10 4 cells in serum-free medium were seeded into the upper chamber of the insert (pore size 8 μm, Corning). For invasion assays, 8 × 10 4 cells in serum-free medium were added to the upper chamber pre-coated with Matrigel (Corning). In both assays, medium containing 20% FBS was placed in the lower chamber. Cells were incubated at 37 °C for 24 h. Non-migrating cells were then removed with a cotton swab. Migrated or invaded cells on the underside of the membrane were fixed with 4% paraformaldehyde for 30 min and stained with crystal violet for another 30 min. Stained cells were assessed by counting cells in multiple randomly selected microscopic fields per chamber under a microscope. For the wound healing assay, 1 × 10 6 cells were seeded into six-well plates and incubated overnight. The following day, the plasmid was transfected into the cells. Once confluence reached 95–100%, a scratch was made using a 10-μL pipette tip, and the cells were rinsed with phosphate-buffered saline (PBS). Cells were then cultured in serum-free medium for 48 h. Images were captured at 0 and 48 h post scratch. Representative microscopic fields were selected to evaluate the gap closure, and the healing width was calculated as the difference between the wound width at 0 and 48 h. Cells were lysed using Western and IP Lysis Buffer (Beyotime) supplemented with 1× protease inhibitor cocktail without ethylenediaminetetraacetic acid (EDTA) (HY-K0010, MedChemExpress). Approximately 25 μg of protein extract was separated on a 10% sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (PAGE) gel and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore). The membranes were then blocked with 5% nonfat milk and incubated with specific antibodies. After incubation with primary antibodies, membranes were incubated with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies and visualized using enhanced chemiluminescence. The antibodies used for western blotting were as follows: hnRNPK (1:100 000, ab52600, Abcam), E-cadherin (1:1000, ab76055, Abcam), N-cadherin (1:1000, ab18203, Abcam), vimentin (1:1000, ab92547, Abcam), ubiquitin (1:3000, 102201–2-AP, Proteintech), MYH11 (1:10,000, ab124679, Abcam), FBXO4 (1:1000, A9968, Abclonal), GAPDH (1:5000, 10494–1-AP, Proteintech), His-tag (1:1000, 2365 T, Cell Signaling Technology), HA-tag (1:4000, ab9110, Abcam), and Myc-tag (1:4000, 60003–2-Ig, Proteintech). All original western blotting images are presented in the full uncropped gels and blots images (Additional file 2 ). To block proteasome-mediated protein degradation, cells were treated with MG132, a potent 26S proteasome inhibitor (MedChemExpress, HY-13259). Cells were incubated with 10 μM MG132 for 8 h before lysis. After treatment, cells were collected immediately for western blotting or ubiquitination analyses. Cells were first rinsed with PBS, harvested, and transferred into 2.5-mL tubes for subsequent immunoprecipitation. Non-denaturing cell lysates were prepared using Western and IP Lysis Buffer (Beyotime) supplemented with 1× protease inhibitor cocktail without EDTA (MedChemExpress). The supernatants were incubated overnight with the indicated antibodies (2 μg of antibody per 500 μg of protein) and Protein A + G magnetic beads (MedChemExpress) for 3 h at 4 °C. The antibodies used for immunoprecipitation were: hnRNPK (ab52600, Abcam), anti-His-tag (ab213204, Abcam), hnRNPK (ab23644, Abcam), and FBXO4 (MA5-21,639, Thermo Scientific). The magnetic beads were isolated using a magnetic rack and washed with phosphate-buffered saline containing 0.5% Triton X-100 (PBST). Samples were then eluted with 0.1 M glycine (pH 3.0), neutralized to pH 7.5 with Tris buffer, and analyzed by western blotting. Mice lung tissues were fixed in 10% formalin, dehydrated, embedded in paraffin, and sectioned at 5 μm thickness. Sections were stained with hematoxylin and eosin (H&E) following standard procedures. For IHC, tissue sections were deparaffinized, rehydrated, and subjected to antigen retrieval. Endogenous peroxidase activity was blocked, followed by incubation with primary antibodies at 4 °C overnight. Signal detection was performed using appropriate secondary antibodies according to standard protocols. For immunofluorescence analysis, LUAD cells were seeded on glass coverslips and incubated overnight at 37 °C. Cells were fixed with 4% formaldehyde for 10 min at room temperature, permeabilized with 0.5% Triton X-100 for 15 min, and blocked with 3% bovine serum albumin for 1 h. Cells were then incubated with primary antibodies overnight at 4 °C. The antibodies used for immunofluorescence included hnRNPK (1:2000, ab52600, Abcam), MYH11 (1:200, ab124679, Abcam), N-cadherin (1:1000, ab18203, Abcam), E-cadherin (1:100, ab76055, Abcam), and vimentin (1:200, ab92547, Abcam). After incubation with appropriate fluorescent secondary antibodies, nuclei were counterstained with DAPI. Fluorescence images were acquired using a confocal microscope (Leica). To visualize actin cytoskeleton organization, H1299 and PC-9 cells were fixed with 4% paraformaldehyde for 10 min at room temperature and permeabilized with 0.5% Triton X-100 for 10 min. F-actin staining was performed using a commercial F-actin staining kit (Servicebio, Wuhan, China) according to the manufacturer’s instructions. Briefly, cells were incubated with fluorescently labeled phalloidin for 30 min at room temperature in the dark. Nuclei were counterstained with DAPI. Fluorescence images were acquired using a confocal microscope (Leica). All animal experiments were approved by the Animal Ethics Committee of Xiangya Hospital, Central South University (approval no. 202103192) and were conducted in strict accordance with the Laboratory Animal Care and Use Guidelines of the institution. The tRF3019a inhibitor and its negative control (NC) were synthesized by Suzhou GenePharma Biological Company. LLC cells were transfected in vitro with either the tRF3019a inhibitor or NC. A total of 48 h after transfection, 3 × 10 6 LLC cells suspended in 100 μL of PBS were randomly injected into the tail veins of 4-week-old BALB/c nude mice (five mice per group). To maintain the effective concentration of small-interfering RNA (siRNA) in vivo, 2 nmol of tRF3019a siRNA or NC dissolved in 200 μL of PBS was administered via tail vein injection every 4 days. Tumor localization and progression were monitored by intraperitoneal injection of d -luciferin potassium salt (PerkinElmer) followed by bioluminescence imaging. After 4 weeks, the mice were euthanized and the xenograft tumors were harvested, fixed in formalin, embedded in paraffin, or snap-frozen at −80 °C for subsequent analyses. A total of 1 × 10 7 cells were washed in ice-cold phosphate buffer and lysed using a standard lysis buffer. The lysates were incubated with 3 μg of a biotin-labeled RNA oligonucleotide probe targeting either endogenous or ectopically expressed tRF3019a for 2 h at room temperature. RNA-binding protein complexes were then washed, and the bound proteins were analyzed by protein blotting or liquid chromatography tandem mass spectrometry (LC–MS/MS). The complete LC–MS/MS protein identification list is presented in Supplementary Table S3 for reference. For RNA immunoprecipitation assays, the PureBinding ® RNA Immunoprecipitation Kit (Geneseed, P0102) was used. A total of 5 × 10 7 cells were incubated overnight with either an hnRNPK antibody (ab52600, Abcam), anti-His-tag antibody (ab18184, Abcam), or control IgG, with rotation at 4 °C. Following immunoprecipitation of the RNA–protein complexes, RNA was extracted using phenol–chloroform and analyzed by qRT–PCR. HA-Ubiquitin, Myc-FBXO4, and Myc-FBXO4-ΔF plasmids were obtained from GeneChem (Shanghai, China). Full-length human coding sequences were cloned into pcDNA3.1 ( +) vectors, and mutant constructs were generated using a gene fusion cloning kit (Tsingke). For rescue experiments, MYH11 overexpression plasmids or MYH11-specific short hairpin (sh)RNAs were cotransfected with tRF3019a mimics or tRF3019a inhibitors as indicated. Three independent shRNAs targeting MYH11 were initially designed and evaluated for knockdown efficiency. Among them, shRNA-3 exhibited the most robust and reproducible silencing effect and was therefore selected for subsequent functional rescue experiments. All plasmid and oligonucleotide transfections were performed using Lipofectamine 3000 reagent (Invitrogen). For hnRNPK knockdown, three shRNAs targeting hnRNPK were designed, and knockdown efficiency was assessed by qRT–PCR. His-hnRNPK-OE, His-hnRNPK-ΔKH1, His-hnRNPK-ΔKH2, His-hnRNPK-ΔKH3, and His-hnRNPK-Δ(KH1 + KH2 + KH3) lentiviruses were obtained from GeneChem. Lentiviral transduction was performed following the manufacturer’s protocol, and transduced cells were selected with 2 μg/mL puromycin (Beyotime) to establish stable cell lines. The CUT&Tag assay was performed using the Hyperactive Universal CUT&Tag Assay Kit for Illumina (Vazyme), following the manufacturer’s instructions with minor modifications. Briefly, 30,000 cells were harvested and attached to activated Concanavalin A (ConA) beads. Cells were sequentially incubated with primary and secondary antibodies, followed by protein A/G-Tn5 transposase tethering. After washing, tagmentation was performed at 37 °C for 1 h. DNA was purified using magnetic beads. Libraries were prepared by PCR amplification with indexed primers, then purified and quantified. Sequencing was conducted on an Illumina platform. Raw CUT&Tag sequencing data were processed following a standard bioinformatics pipeline provided by the sequencing service company. Low-quality reads and adapter sequences were removed using fastp. Clean reads were aligned to the hg38 human reference genome using Bowtie2. PCR duplicates were removed to avoid artificial signal inflation. Peak calling was performed using MACS2 with the default parameters recommended for CUT&Tag assays. A total of 74,588 high-confidence hnRNPK peaks were identified (false discovery rate [FDR] < 0.05). Peak genomic annotation was performed using HOMER and ChIPseeker, and the distribution of peaks across promoters, TSS regions, introns, exons, and intergenic regions was summarized. Signal heat maps and average binding profiles were generated using deepTools, and the read density was displayed using RPKM-normalized CUT&Tag signal. RNA sequencing was performed by BGI (Shenzhen, China). Raw reads generated from the Illumina platform were first subjected to quality control using SOAPnuke, including removal of adapter sequences, reads with > 5% unknown bases, and low-quality reads. High-quality clean reads were then aligned to the human reference genome (GRCh38.p13) using HISAT2 (v2.2.1) with default parameters. Gene-level read counts were quantified with featureCounts (Subread v2.0.3) on the basis of GENCODE v38 gene annotation. Differential expression analysis was performed using DESeq2 (v1.34.0). Gene expression was normalized using the DESeq2 median-of-ratios method. Differentially expressed genes (DEGs) were identified using |log 2 fold change|> 1 and p -value < 0.05 as the significance threshold. Adjusted p -values ( q -values) were calculated using the Benjamini–Hochberg false discovery rate (FDR) method. The complete list of DEGs, including raw counts, normalized counts, fold change values, p -values, and q -values, is presented in Supplementary Table S4. ChIP experiments were conducted using the Pierce™ Magnetic ChIP Kit (Thermo Scientific) according to the manufacturer’s instructions. Briefly, cells were fixed with 1% formaldehyde for 10 min and quenched with 125 mM glycine for 5 min at room temperature to crosslink DNA and proteins. The cells were lysed, and chromatin was sheared by sonication to fragments of 200–1000 base pairs (bp). Immunoprecipitation was performed using antibodies against RNA Pol II, hnRNPK, or IgG (negative control). The immunoprecipitated DNA was then analyzed by qRT–PCR. ChIP–PCR primers were designed to target representative hnRNPK-associated genomic regions within the MYH11 gene locus identified by CUT&Tag analysis. Primer specificity and unique genomic localization were confirmed in silico. qPCR primers for ChIP are as follows: MYH11 forward primer: AGGCTGCCTGAGAGGCTACA, reverse primer: TCCAGGGTGTGTTGCTGTAA. Statistical analyses were performed using GraphPad Prism 8.0.2 software. Data are presented as mean ± standard deviation (SD) and were analyzed by two-tailed unpaired or paired Student’s t -tests or one-way analysis of variance (ANOVA), as appropriate. Cox proportional hazards regression models were used to identify independent prognostic factors for LUAD. For survival analysis of the Xiangya LUAD cohort, patients were stratified into high and low tRF3019a expression groups on the basis of the median expression value. All statistical tests were two-sided, and p values < 0.05 were considered statistically significant.

Using the OncotRF database ( http://bioinformatics.zju.edu.cn/OncotRF/index.html ), we identified a tRF—3′-M-tRNA-Asp-ATC-chr6-103_L18 (5′-TCCCCAGTACCTCCACCA-3′)—that was significantly upregulated in LUAD tumor tissues (Fig.  1 a). This tRF originates from the 3′ end of mature tRNA-Ala-AGC-1–1 (Fig.  1 b) and corresponds to tRF3019a in the tRFdb database. Furthermore, patients with LUAD exhibiting high expression levels of tRF3019a demonstrated significantly shorter overall survival (OS), disease-free survival (DFS), and recurrence-free survival (RFS) rates compared with those with lower expression levels (Fig.  1 c–e). On the basis of these observations, we selected tRF3019a as the focal point of this study. To validate our findings from the database, we examined tRF3019a expression in 100 paired samples of LUAD and adjacent non-tumor tissues. Consistent with our initial results, we found that tRF3019a expression was significantly higher in LUAD tissues than in adjacent non-tumor tissues (Fig.  1 f). Specifically, elevated levels of tRF3019a were observed in 72% of LUAD samples, with 56% showing more than a two-fold increase relative to adjacent non-tumor tissues (Fig.  1 g). Moreover, high expression of tRF3019a was significantly associated with reduced overall survival (OS) in patients with LUAD (Fig.  1 h). Patients were stratified into high- and low-expression groups on the basis of the median expression level of tRF3019a. Fig. 1 tRF3019a is significantly upregulated in LUAD. a The OncotRF database indicates a notable upregulation of tRF3019a (3′-M-tRNA-Asp-ATC-chr6-103_L18) in LUAD tissues. b The sequence and genomic origin of tRF3019a are derived from the 3′ end of tRNA-Ala-AGC-1–1. c – e Correlation between the expression levels of tRF3019a and OS, DFS, and RFS in patients with LUAD are illustrated using data from the database. ( f ) Relative expression levels of tRF3019a were compared between tumor versus adjacent normal tissues from 100 patients with LUAD. g Individual comparison of tRF3019a expression in paired LUAD and adjacent normal tissues ( n  = 100). h Kaplan–Meier analysis of overall survival (OS) in 100 patients with LUAD stratified by tRF3019a expression level. i RNA FISH analysis of tRF3019a expression in human LUAD tissues and paired adjacent non-tumor tissues ( n  = 3) (scale bar: 100 μm). Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test or log-rank test. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 tRF3019a is significantly upregulated in LUAD. a The OncotRF database indicates a notable upregulation of tRF3019a (3′-M-tRNA-Asp-ATC-chr6-103_L18) in LUAD tissues. b The sequence and genomic origin of tRF3019a are derived from the 3′ end of tRNA-Ala-AGC-1–1. c – e Correlation between the expression levels of tRF3019a and OS, DFS, and RFS in patients with LUAD are illustrated using data from the database. ( f ) Relative expression levels of tRF3019a were compared between tumor versus adjacent normal tissues from 100 patients with LUAD. g Individual comparison of tRF3019a expression in paired LUAD and adjacent normal tissues ( n  = 100). h Kaplan–Meier analysis of overall survival (OS) in 100 patients with LUAD stratified by tRF3019a expression level. i RNA FISH analysis of tRF3019a expression in human LUAD tissues and paired adjacent non-tumor tissues ( n  = 3) (scale bar: 100 μm). Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test or log-rank test. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 In addition, RNA FISH analysis further validated the high expression of tRF3019a in human LUAD tissues compared with adjacent non-tumor tissues, providing spatial confirmation of its upregulation in clinical specimens (Fig.  1 i). Subsequently, we assessed the correlation between levels of tRF3019a expression and various clinicopathological features among the patients as presented in Table  1 . The results revealed that relatively high expression of tRF3019a in tumor tissues was significantly associated with the low differentiation of tumor, lymph node metastasis, and advanced TNM tumor grade. These findings suggest that the upregulation of tRF3019a may be linked to more aggressive clinical characteristics in LUAD. Table 1 Correlation between tRF3019a expression and clinicopathological features in 100 patients with LUAD Variables n tRF-3019a expression p value Low expression High expression Sex 0.5406  Male 60 28 32  Female 40 22 18 Age (years) 0.6529  < 60 73 38 35  ≥ 60 27 12 15 Smoking history 0.2276  Yes 55 24 31  No 45 26 19 Tumor differentiation 0.0363  High 30 20 10  High-middle 20 12 8  Middle 18 9 9  Middle-low 18 5 13  Low 14 4 10 Tumor size (cm) 0.1422   > 3 35 14 21  ≤ 3 65 36 29 Lymphatic metastasis 0.0089  Yes 31 9 22  No 69 41 28 TNM classification 0.0141  I 53 33 20  II 27 12 15  III + IV 20 5 15 TNM, tumor, node, metastasisundefined Correlation between tRF3019a expression and clinicopathological features in 100 patients with LUAD TNM, tumor, node, metastasisundefined We next investigated the biological function of tRF3019a in LUAD cells using H1299 and PC-9 cell lines as experimental models. The efficiency of tRF3019a overexpression and knockdown was first confirmed by qRT–PCR. Given that the biogenesis of tRNA-derived fragments can be mediated by distinct nucleases in a context-dependent manner, including Dicer and angiogenin (ANG) [ 19 ], we further examined the potential involvement of these enzymes in tRF3019a production. Knockdown of Dicer, but not ANG, significantly reduced tRF3019a expression levels, whereas modulation of tRF3019a did not markedly affect LUAD cell proliferation (Supplementary Fig. S1). Subsequently, we evaluated the impact of tRF3019a on LUAD cell migration and invasion through Transwell and wound-healing assays. Transwell migration and invasion assays demonstrated that overexpression of tRF3019a significantly enhanced the migratory and invasive capabilities of LUAD cells in vitro, whereas knockdown markedly suppressed these behaviors (Fig.  2 a, b). Consistently, wound healing assays revealed that overexpression of tRF3019a significantly accelerated the wound closure rate in LUAD cells, while knockdown significantly impaired it (Fig.  2 c, d). Furthermore, western blot analysis revealed that knockdown of tRF3019a led to increased expression of the epithelial marker E-cadherin, alongside decreased levels of mesenchymal markers N-cadherin and vimentin. Conversely, overexpression of tRF3019a reduced E-cadherin levels and increased N-cadherin and vimentin levels (Fig.  2 e, f). In summary, these findings indicate that tRF3019a promotes the migratory and invasive capabilities of LUAD cells in vitro. Fig. 2 tRF3019a promotes migration and invasion in vitro among LUAD cells. a Transwell migration assays and Matrigel invasion assays were conducted to evaluate the migratory and invasive capabilities of H1299 cells transfected with either a tRF3019a mimic or scrambled control, as well as those treated with either a siRNA targeting tRF3019a or negative control siRNA (scale bar: 100 μm). b Transwell migration and Matrigel invasion assays were also performed in PC-9 LUAD cells following tRF3019a overexpression or knockdown (scale bar: 200 μm). c , d Wound healing assays were used to assess the migratory abilities of H1299 cells after overexpressing or knocking down tRF3019a, as well as those for PC-9 cells under similar conditions. e , f Western blotting analyses were employed to investigate the effects of overexpression and knockdown of tRF3019a on epithelial–mesenchymal transition (EMT)-related markers in LUAD cells. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 tRF3019a promotes migration and invasion in vitro among LUAD cells. a Transwell migration assays and Matrigel invasion assays were conducted to evaluate the migratory and invasive capabilities of H1299 cells transfected with either a tRF3019a mimic or scrambled control, as well as those treated with either a siRNA targeting tRF3019a or negative control siRNA (scale bar: 100 μm). b Transwell migration and Matrigel invasion assays were also performed in PC-9 LUAD cells following tRF3019a overexpression or knockdown (scale bar: 200 μm). c , d Wound healing assays were used to assess the migratory abilities of H1299 cells after overexpressing or knocking down tRF3019a, as well as those for PC-9 cells under similar conditions. e , f Western blotting analyses were employed to investigate the effects of overexpression and knockdown of tRF3019a on epithelial–mesenchymal transition (EMT)-related markers in LUAD cells. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 To elucidate the regulatory mechanism underlying tRF3019a’s role in LUAD metastasis, RNA pulldown assays combined with liquid chromatography–tandem mass spectrometry (LC–MS/MS) were performed to identify potential binding partners and clarify the molecular mechanisms through which tRF3019a promotes the migration and invasion of LUAD cells. Through RNA pulldown and subsequent LC–MS/MS analysis, 220 proteins were quantitatively identified as specifically interacting with tRF3019a (Fig.  3 a). Among identified candidates, hnRNPK was selected for further investigation owing to its strongest binding signal (Fig.  3 b) as well as its well-documented involvement in tumor biology. RIP assays confirmed the enrichment of tRF3019a in complexes immunoprecipitated by hnRNPK antibody compared with IgG control (Fig.  3 c, Supplementary Fig. S2), indicating an interaction between tRF3019a and hnRNPK. Furthermore, IF staining revealed that hnRNPK is present in both the nucleus and cytoplasm, with predominant localization in the nucleus of LUAD cells (Fig.  3 d). Concurrently, qRT–PCR analysis of subcellular fractions demonstrated that tRF3019a was distributed in both nucleus and cytoplasm as well (Fig.  3 e). These findings suggest the potential direct interaction between tRF3019a and hnRNPK at the subcellular level. hnRNPK interacts with RNA primarily through three KH domains: KH1 (amino acids 42–104), KH2 (amino acids 144–209), and KH3 (amino acids 387–451) [ 20 ]. To identify the specific domain responsible for interacting with tRF3019a, we constructed four His-tagged truncated expression vectors for hnRNPK: ΔKH1 + KH2 + KH3, ΔKH1, ΔKH2, and ΔKH3 (Fig.  3 f). Subsequently, these vectors were transfected into H1299 LUAD cells. RIP assays utilizing anti-His-tag antibodies demonstrated a significant reduction in tRF3019a binding in cells expressing the ΔKH1 + KH2 + KH3 and ΔKH1 truncations compared with the full-length control (Fig.  3 g). Similarly, biotin-labeled RNA pulldown assays showed markedly reduced interaction between tRF3019a and His-hnRNPK proteins lacking either KH1 + KH2 + KH3 or just KH1 domains (Fig.  3 h). Molecular docking simulations were conducted using AlphaFold3, followed by three-dimensional visualization analysis with PyMOL 3.1. The results indicate that several amino acid residues in the hnRNPK protein play a critical role in binding to tRF3019a (Fig.  3 i). Fig. 3 Interaction of tRF3019a with hnRNPK. a LC–MS/MS analysis following RNA pulldown identified 220 proteins that specifically interact with tRF3019a. b Mass spectrometry analysis of hnRNPK showing its specific enrichment. c RIP assays confirmed the interaction between tRF3019a and hnRNPK. d Immunofluorescence staining revealed the subcellular localization of hnRNPK in both the cytoplasm and nucleus of H1299 cells. e qRT–PCR analysis assessed the expression levels of tRF3019a in cytoplasmic and nuclear fractions of H1299 cells. f A schematic diagram illustrates the truncation constructs of hnRNPK targeting its KH domains. g , h RIP and RNA pulldown assays demonstrated that tRF3019a primarily interacts with the KH1 domain of hnRNPK. i Predicted three-dimensional (3D) structure of the tRF3019a–hnRNPK complex. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. ns, p  > 0.05, * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 Interaction of tRF3019a with hnRNPK. a LC–MS/MS analysis following RNA pulldown identified 220 proteins that specifically interact with tRF3019a. b Mass spectrometry analysis of hnRNPK showing its specific enrichment. c RIP assays confirmed the interaction between tRF3019a and hnRNPK. d Immunofluorescence staining revealed the subcellular localization of hnRNPK in both the cytoplasm and nucleus of H1299 cells. e qRT–PCR analysis assessed the expression levels of tRF3019a in cytoplasmic and nuclear fractions of H1299 cells. f A schematic diagram illustrates the truncation constructs of hnRNPK targeting its KH domains. g , h RIP and RNA pulldown assays demonstrated that tRF3019a primarily interacts with the KH1 domain of hnRNPK. i Predicted three-dimensional (3D) structure of the tRF3019a–hnRNPK complex. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. ns, p  > 0.05, * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 To further elucidate the relationship between tRF3019a and hnRNPK expression levels, qRT–PCR and western blot analyses were conducted. The results demonstrated that knockdown of tRF3019a in LUAD cells led to a downregulation of hnRNPK protein expression, whereas overexpression of tRF3019a resulted in elevated protein levels (Fig.  4 a). Notably, the mRNA levels of hnRNPK remained unchanged following either the knockdown or overexpression of tRF3019a in LUAD cells (Fig.  4 b). These findings suggest that tRF3019a may regulate hnRNPK at a post-transcriptional level. Given the presence of multiple ubiquitination sites within the KH domains of hnRNPK, as indicated by the data from the PhosphoSitePlus database ( https://www.phosphosite.org/homeAction , Fig.  4 c), we hypothesized that tRF3019a might suppress the ubiquitin-mediated degradation of hnRNPK. To validate this hypothesis, we initially treated H1299 LUAD cells with tRF3019a knockdown, and assessed the ubiquitination levels of hnRNPK. The results revealed an increase in hnRNPK ubiquitination in cells with tRF3019a knockdown compared with the control group (Fig.  4 d). Subsequently, H1299 cells were treated with cycloheximide (CHX) to evaluate hnRNPK protein stability. The results indicated that knockdown of tRF3019a shortened the half-life of hnRNPK (Fig.  4 e). Furthermore, both H1299 and PC-9 LUAD cells exhibited downregulated levels of hnRNPK protein upon tRF3019a knockdown; however, this effect was rescued by MG132 treatment (Fig.  4 f). Collectively, these findings suggest that tRF3019a enhances hnRNPK protein stability by inhibiting its ubiquitination and subsequent proteasomal degradation. Fig. 4 tRF3019a inhibits hnRNPK protein ubiquitination degradation in LUAD cells. a Western blot analysis of hnRNPK protein levels in LUAD cells following either knockdown or overexpression of tRF3019a. b qRT–PCR analysis showing no significant change in hnRNPK mRNA levels upon tRF3019a knockdown. c Ubiquitination modification sites within the hnRNPK domain were predicted using data from the PhosphoSitePlus database. d IP assay assessing the effect of tRF3019a on hnRNPK ubiquitination levels in LUAD cells. e Western blot analysis examined hnRNPK protein stability after CHX treatment in tRF3019a knockdown H1299 cells. f MG132 treatment for 8 h restored suppressed hnRNPK protein levels caused by tRF3019a knockdown. g H1299 cells were cotransfected with His-hnRNPK, tRF3019a siRNA, or NC and either HA-tagged wild-type ubiquitin, K48-only ubiquitin, or K63-only ubiquitin for 48 h. Ubiquitination levels of hnRNPK were assessed by IP using anti-His and western blotting with anti-HA. h H1299 cells were transfected with HA-ubiquitin, His-hnRNPK, tRF3019a siRNA, or NC and either wild-type Myc-Fbxo4 or the catalytically inactive Myc-Fbxo4 △F mutant for 48 h. Ubiquitination of hnRNPK was evaluated by IP and western blotting. i Co-immunoprecipitation (Co-IP) assay detecting the interaction between hnRNPK and the Fbxo4 protein of the Skp-Cullin1-F-box (SCF) E3 ubiquitin ligase in LUAD cells with tRF3019a knockdown and NC. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. ns, p  > 0.05, * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 tRF3019a inhibits hnRNPK protein ubiquitination degradation in LUAD cells. a Western blot analysis of hnRNPK protein levels in LUAD cells following either knockdown or overexpression of tRF3019a. b qRT–PCR analysis showing no significant change in hnRNPK mRNA levels upon tRF3019a knockdown. c Ubiquitination modification sites within the hnRNPK domain were predicted using data from the PhosphoSitePlus database. d IP assay assessing the effect of tRF3019a on hnRNPK ubiquitination levels in LUAD cells. e Western blot analysis examined hnRNPK protein stability after CHX treatment in tRF3019a knockdown H1299 cells. f MG132 treatment for 8 h restored suppressed hnRNPK protein levels caused by tRF3019a knockdown. g H1299 cells were cotransfected with His-hnRNPK, tRF3019a siRNA, or NC and either HA-tagged wild-type ubiquitin, K48-only ubiquitin, or K63-only ubiquitin for 48 h. Ubiquitination levels of hnRNPK were assessed by IP using anti-His and western blotting with anti-HA. h H1299 cells were transfected with HA-ubiquitin, His-hnRNPK, tRF3019a siRNA, or NC and either wild-type Myc-Fbxo4 or the catalytically inactive Myc-Fbxo4 △F mutant for 48 h. Ubiquitination of hnRNPK was evaluated by IP and western blotting. i Co-immunoprecipitation (Co-IP) assay detecting the interaction between hnRNPK and the Fbxo4 protein of the Skp-Cullin1-F-box (SCF) E3 ubiquitin ligase in LUAD cells with tRF3019a knockdown and NC. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. ns, p  > 0.05, * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 Ubiquitination is a critical posttranslational modification that regulates not only protein degradation but also a wide range of cellular processes. This regulation is largely attributed to the unique characteristics inherent to ubiquitin itself, which can form diverse homo- and heterotypic polyubiquitin chains through seven distinct lysine residues: K6, K11, K27, K29, K33, K48, and K63. Each type of linkage conveys specific cellular signals. Among them, K48- and K63-linked ubiquitin chains are the most abundant and well characterized. K48-linked polyubiquitin chains, the first to be discovered, primarily target substrate proteins for proteasomal degradation [ 21 ]. Conversely, K63-linked ubiquitin chains are predominantly associated with DNA damage repair, signal transduction, and the endocytosis and degradation of membrane proteins [ 22 ]. To determine which ubiquitin chain formation was primarily affected by tRF3019a, we transfected H1299 LUAD cells with wild-type ubiquitin, ubiquitin mutants retaining only K48, and ubiquitin mutants retaining only K63. The tRF3019a-mediated inhibition of hnRNPK ubiquitination persisted in cells expressing wild-type ubiquitin and K48-only ubiquitin mutants; however, this inhibition was abolished in cells expressing K63-only ubiquitin mutants (Fig.  4 g). These results indicate that tRF3019a specifically suppresses hnRNPK ubiquitination through the inhibition of K48-linked ubiquitin chain formation. Previous studies have reported that the Skp-Cullin1-F-box (SCF) E3 ubiquitin ligase complex specifically targets hnRNPK for ubiquitination [ 23 ]. Within this complex, the F-box protein, characterized by an F-box motif near its N terminus—functions as an adapter that bridges core ligase components with the substrate protein [ 24 ]. To assess whether tRF3019a regulates hnRNPK stability through this pathway, we conducted immunoprecipitation (IP) assays in LUAD cells transfected with either the wild-type Fbxo4 or a catalytically inactive mutant lacking the F-box domain (SCF Fbxo4△F ). Cells expressing SCF Fbxo4△F exhibited a marked reduction in hnRNPK ubiquitination, and notably, the knockdown of tRF3019a did not further alter hnRNPK ubiquitination in SCF Fbxo4△F -transfected cells (Fig.  4 h). Moreover, Co-IP experiments revealed that knockdown of tRF3019a impaired the interaction between hnRNPK and Fbxo4 in H1299 cells (Fig.  4 i). Together, these findings suggest that tRF3019a interacts with hnRNPK to inhibit its SCF-mediated ubiquitination and degradation. To investigate the role of hnRNPK in mediating the effects of tRF3019a on LUAD cell migration and invasion, we conducted rescue experiments by knocking down hnRNPK in H1299 and PC-9 cells overexpressing tRF3019a or by overexpressing hnRNPK in cells with tRF3019a knockdown. Transfection efficiency was confirmed by western blotting (Supplementary Fig. S3). Among the shRNAs tested, hnRNPK-shRNA1 showed the highest knockdown efficiency and was selected for further experiments. Transwell migration and invasion assays demonstrated that hnRNPK knockdown partially reversed the promotive effects of tRF3019a overexpression on LUAD cell migration and invasion; conversely, hnRNPK overexpression rescued the inhibitory effects observed following tRF3019a knockdown (Figs.  5 a, S3). Similar results were observed in wound healing assays (Fig.  5 b, Supplementary Fig. S3). In addition, western blot analysis of EMT-related markers (including E-cadherin, N-cadherin, and vimentin) further supported that tRF3019a primarily promotes LUAD cells migration and invasion through regulation of hnRNPK (Fig.  5 c, d). Fig. 5 tRF3019a enhances the migration and invasion of LUAD cells in vitro by upregulating hnRNPK. a Transwell migration and Matrigel invasion assays were performed to evaluate the effects of hnRNPK knockdown or overexpression on the migration and invasion of tRF3019a-mediated LUAD cells in vitro (scale bar: 100 μm). b Wound healing assays were performed to assess the impact of hnRNPK knockdown or overexpression on the pro-migratory effects induced by tRF3019a (scale bar: 100 μm). c Western blot analysis was conducted to examine EMT markers following hnRNPK overexpression in LUAD cells with tRF3019a knockdown, assessing the rescue effect. d Western blot analysis was also performed to investigate EMT markers after hnRNPK knockdown in LUAD cells with tRF3019a overexpression, assessing the reversal of EMT promotion. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 tRF3019a enhances the migration and invasion of LUAD cells in vitro by upregulating hnRNPK. a Transwell migration and Matrigel invasion assays were performed to evaluate the effects of hnRNPK knockdown or overexpression on the migration and invasion of tRF3019a-mediated LUAD cells in vitro (scale bar: 100 μm). b Wound healing assays were performed to assess the impact of hnRNPK knockdown or overexpression on the pro-migratory effects induced by tRF3019a (scale bar: 100 μm). c Western blot analysis was conducted to examine EMT markers following hnRNPK overexpression in LUAD cells with tRF3019a knockdown, assessing the rescue effect. d Western blot analysis was also performed to investigate EMT markers after hnRNPK knockdown in LUAD cells with tRF3019a overexpression, assessing the reversal of EMT promotion. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 hnRNPK has been implicated in oncogenesis across various tumor types, primarily owing to its role in regulating downstream gene transcription and translation [ 25 – 29 ]. In this study, we employed a combination of RNA sequencing (RNA-seq) and CUT&Tag assays to identify downstream genes regulated by the interaction between tRF3019a and hnRNPK [ 30 ]. RNA-seq analysis revealed 35 significantly downregulated genes and 71 significantly upregulated genes in tRF3019a-knockdown cells compared with negative control (NC) cells (Fig.  6 a). No classical EMT-related markers achieved statistical significance under the FDR threshold in our RNA-seq dataset. The combined heat map and averaged signal profile (Fig.  6 b) showed that hnRNPK binding was enriched around transcription start sites, while global genomic annotation revealed that hnRNPK occupancy was broadly distributed across multiple genomic regions, including intronic and intergenic regions (Fig.  6 c). These findings prompted us to investigate the transcription-associated regulation of hnRNPK target genes. By intersecting the RNA-seq results with hnRNPK-associated genes identified by CUT&Tag, we obtained a subset of 37 genes whose expression was altered upon tRF3019a knockdown and that were associated with hnRNPK chromatin occupancy (Fig.  6 d). Further literature review and analysis of The Cancer Genome Atlas (TCGA) data refined this list to five genes implicated in tumor progression. Among these five genes, only MYH11 mRNA expression was found to be upregulated in H1299 and PC-9 LUAD cells overexpressing tRF3019a, while it was downregulated in tRF3019a-knockdown cells, as determined by qRT–PCR (Figs.  6 e, S4). Western blot analysis further demonstrated that MYH11 protein expression is regulated by tRF3019a expression (Fig.  6 f). MYH11 serves as a marker for mesenchymal and endothelial cell differentiation; it is closely associated with the migration and invasion capabilities of various tumors [ 31 – 33 ]. On the basis of these analyses, MYH11 was selected as a representative hnRNPK-associated gene whose expression is regulated in response to tRF3019a perturbation. Moreover, ChIP–PCR analysis indicated that knockdown of tRF3019a significantly diminished the binding of both hnRNPK and RNA polymerase II (Pol II) to genomic regions within the MYH11 locus (Fig.  6 g), suggesting that tRF3019a modulates hnRNPK association with the MYH11 genomic region and influences MYH11 transcriptional output. Consistently, an Integrative Genomics Viewer (IGV) browser snapshot of hnRNPK CUT&Tag data revealed detectable hnRNPK occupancy across the MYH11 genomic locus, whereas IgG controls showed minimal background signal (Supplementary Fig. S3), supporting chromatin association of hnRNPK at this gene region. Analyzing the correlation between MYH11 gene expression and cancer phenotype revealed a significant positive association between MYH11 gene expression and cancer phenotypes and biological behaviors related to cancer invasion and metastasis, along with expression linked to EMT pathway (Supplementary Fig. S4). In summary, our findings indicate that tRF3019a enhances transcriptional activity of the MYH11 gene through upregulation of hnRNPK expression, thereby playing a crucial role in promoting migration and invasion in LUAD cells. In addition, combined RNA fluorescence in situ hybridization (FISH) and immunofluorescence (IF) assays were performed in H1299 cells to visualize intracellular levels of tRF3019a and the subcellular localization of of hnRNPK and MYH11. Knockdown of tRF3019a markedly reduced the fluorescence intensity of both hnRNPK and MYH11, whereas overexpression of tRF3019a led to enhanced signals for these proteins (Fig.  6 h). These results indicate that modulation of tRF3019a expression influences the protein levels of hnRNPK and MYH11 in LUAD cells. Fig. 6 tRF3019a enhances hnRNPK-mediated transcriptional regulation of MYH11 . a Volcano plot showing differentially expressed genes identified by RNA-seq analysis in tRF3019a-knockdown cells compared with negative control cells (unadjusted p values calculated by DESeq2). b Average signal profile and heat map of hnRNPK CUT&Tag signals across ± 3 kb regions centered on transcription start site (TSS), normalized to RPKM. c Genome-wide distribution of hnRNPK CUT&Tag peaks across different genomic features. d Venn diagram illustrating the overlap between genes bound by hnRNPK as identified by CUT&Tag and differentially expressed genes identified by RNA-seq. e qRT–PCR analysis of MYH11 mRNA expression levels in LUAD cells following knockdown or overexpression of tRF3019a. f Western blot analysis of MYH11 protein levels in LUAD cells upon tRF3019a knockdown or overexpression. g ChIP–PCR analysis of hnRNPK and RNA polymerase II (Pol II) occupancy at the MYH11 genomic locus after tRF3019a knockdown. h RNA fluorescence in situ hybridization (FISH) and immunofluorescence (IF) images depicting intracellular levels of tRF3019a and the subcellular localization of hnRNPK and MYH11 in H1299 cells following tRF3019a knockdown or overexpression (scale bar: 50 μm). i Representative images of F-actin staining illustrating cytoskeletal organization in LUAD cells upon modulation of tRF3019a and MYH11 expression (scale bar: 100 μm). Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 tRF3019a enhances hnRNPK-mediated transcriptional regulation of MYH11 . a Volcano plot showing differentially expressed genes identified by RNA-seq analysis in tRF3019a-knockdown cells compared with negative control cells (unadjusted p values calculated by DESeq2). b Average signal profile and heat map of hnRNPK CUT&Tag signals across ± 3 kb regions centered on transcription start site (TSS), normalized to RPKM. c Genome-wide distribution of hnRNPK CUT&Tag peaks across different genomic features. d Venn diagram illustrating the overlap between genes bound by hnRNPK as identified by CUT&Tag and differentially expressed genes identified by RNA-seq. e qRT–PCR analysis of MYH11 mRNA expression levels in LUAD cells following knockdown or overexpression of tRF3019a. f Western blot analysis of MYH11 protein levels in LUAD cells upon tRF3019a knockdown or overexpression. g ChIP–PCR analysis of hnRNPK and RNA polymerase II (Pol II) occupancy at the MYH11 genomic locus after tRF3019a knockdown. h RNA fluorescence in situ hybridization (FISH) and immunofluorescence (IF) images depicting intracellular levels of tRF3019a and the subcellular localization of hnRNPK and MYH11 in H1299 cells following tRF3019a knockdown or overexpression (scale bar: 50 μm). i Representative images of F-actin staining illustrating cytoskeletal organization in LUAD cells upon modulation of tRF3019a and MYH11 expression (scale bar: 100 μm). Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, and *** p  < 0.001 MYH11 encodes smooth muscle myosin heavy chain, a core component of the actomyosin contractile apparatus that regulates cytoskeletal organization and cellular contractility [ 34 ]. Actin–myosin dynamics are well established as key drivers of cell migration and invasion [ 35 , 36 ]. Given these roles, we next investigated whether MYH11 mediates the effects of tRF3019a on cytoskeletal remodeling in LUAD cells. F-actin staining revealed that tRF3019a knockdown led to disorganized and fragmented actin filament structures, whereas ectopic overexpression of MYH11 effectively restored cytoskeletal integrity. Conversely, the enhanced actin filament organization induced by tRF3019a overexpression was significantly attenuated upon MYH11 knockdown (Fig.  6 i). These findings suggest that MYH11 acts downstream of tRF3019a to regulate actin cytoskeletal architecture in LUAD cells. Functionally, Transwell migration and invasion assays (Supplementary Fig. S5), as well as wound-healing assays (Supplementary Fig. S6), demonstrated that MYH11 overexpression significantly rescued the impaired migratory and invasive capacities caused by tRF3019a knockdown. In contrast, depletion of MYH11 largely abolished the enhanced migration and invasion promoted by tRF3019a overexpression. Collectively, these rescue experiments provide direct functional evidence that MYH11 is a critical downstream effector through which tRF3019a exerts its pro-migratory and pro-invasive effects of in LUAD cells. To further elucidate the role of tRF3019a in promoting LUAD cell migration and metastasis in vivo, we employed luciferase-labeled LLC cells that were transfected with either tRF3019a-siRNA or a corresponding negative control. The transfected LLC cells were subsequently injected into the tail veins of nude mice. A total of 4 weeks post injection, in vivo bioluminescence imaging revealed a significant reduction in lung metastatic luciferase signal within the tRF3019a knockdown group (Fig.  7 a). Following dissection, the number of metastatic nodules in the lungs of mice injected with tRF3019a knockdown cells was significantly lower compared with the control group (Fig.  7 b). These findings indicate that tRF3019a facilitates both the migration and colonization of LUAD cells in vivo. Furthermore, H&E staining along with IHC analysis of the resected tumor sections demonstrated that knockdown of tRF3019a markedly suppressed tumor formation in vivo. In addition, expression levels of hnRNPK and MYH11 were significantly decreased in lung tissues from the tRF3019a knockdown group, while EMT markers were also notably suppressed (Fig.  7 c). In summary, these results demonstrate that tRF3019a promotes LUAD cell migration and metastasis both in vitro and in vivo by inhibiting the ubiquitination-mediated degradation of hnRNPK, thereby enhancing MYH11 transcriptional activity. Fig. 7 tRF3019a promotes the migration and invasion of LUAD cells in vivo. a in vivo bioluminescence imaging was performed on nude mice ( n  = 5), which were injected via tail vein with luciferase-labeled LLC cells transfected with either tRF3019a-siRNA or NC, showing the fluorescence intensity of lung metastases. b Representative images of lung metastatic lesions from the two groups. c H&E and IHC staining to detect the lung tissues from both groups to evaluate the expression of hnRNPK, MYH11, and EMT-related markers (scale bar: 100 µm). d A schematic diagram (created in BioRender.com) illustrating the mechanism by which tRF3019a promotes LUAD migration and invasion through the suppression of hnRNPK ubiquitination. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, *** p  < 0.001 tRF3019a promotes the migration and invasion of LUAD cells in vivo. a in vivo bioluminescence imaging was performed on nude mice ( n  = 5), which were injected via tail vein with luciferase-labeled LLC cells transfected with either tRF3019a-siRNA or NC, showing the fluorescence intensity of lung metastases. b Representative images of lung metastatic lesions from the two groups. c H&E and IHC staining to detect the lung tissues from both groups to evaluate the expression of hnRNPK, MYH11, and EMT-related markers (scale bar: 100 µm). d A schematic diagram (created in BioRender.com) illustrating the mechanism by which tRF3019a promotes LUAD migration and invasion through the suppression of hnRNPK ubiquitination. Data are presented as mean ± SD of three independent experiments; statistical significance was determined using two-tailed Student’s t -test. * p  < 0.05, ** p  < 0.01, *** p  < 0.001

Lung cancer is the most prevalent malignant neoplasm worldwide, characterized by persistently high morbidity and mortality rates. Recent data indicate that lung cancer accounts for approximately 12.4% of all cancer cases globally, making it the most frequently diagnosed malignancy [ 1 ]. Moreover, it remains the leading cause of cancer-related deaths, responsible for about 18.7% of all cancer fatalities [ 1 ]. Lung cancer is broadly classified into non-small-cell lung cancer (NSCLC) and small-cell lung cancer, with NSCLC comprising approximately 85% of all cases. Among the subtypes of NSCLC, lung adenocarcinoma (LUAD) is the most prevalent, representing more than 60% of NSCLC diagnoses [ 2 ]. Despite significant advancements in multimodal treatment strategies—including minimally invasive surgery, radiation therapy, chemotherapy, targeted molecular therapies, and immunotherapy—the overall 5-year survival rate for LUAD remains unsatisfactory, with patients with lung cancer exhibiting a survival rate of only ~20% [ 3 , 4 ]. Therefore, a comprehensive exploration of the molecular mechanisms underlying LUAD and the identification of novel diagnostic and therapeutic targets are essential for enhancing our understanding of the disease and improving clinical outcomes. tRNA-derived fragments (tRFs) represent a newly identified class of small noncoding RNAs (ncRNAs) [ 5 ]. These fragments are generated through the cleavage of tRNA precursors or mature tRNAs at specific sites by various ribonucleases and typically range from 13 to 48 nucleotides in length [ 6 ]. On the basis of their lengths, cleavage sites, and sequence alignment with parental tRNAs, tRFs are generally classified into five isoforms: 5′-half, 3′-half, 5′-tRF, 3′-tRF, and i-tRF [ 7 ]. The 5′-half and 3′-half are produced through cleavage at the anticodon region of the mature tRNA. The 5′-half comprises the segment from the 5′ terminus to the anticodon loop, while the 3′-half spans from the anticodon loop to the 3′ terminus [ 8 ]. The 5′-tRF is produced by Dicer-mediated cleavage at the 5′ end of the D loop, D stem, or anticodon stem [ 9 ], whereas the 3′-tRF results from cleavage at the TψC loop by Dicer, angiogenin, or other ribonucleases [ 10 ]. The i-tRF originates from the internal region of the mature tRNA, excluding its 5′ and 3′ termini [ 11 ]. Although historically considered mere degradation products or nonspecific cleavage intermediates, tRFs have gained increasing recognition owing to advances in high-throughput RNA sequencing. Accumulating evidence suggests that tRFs have functional significance and are associated with a variety of human diseases, including cancer [ 12 – 17 ]. However, the role and regulatory mechanisms of tRFs in the tumorigenesis of LUAD remain largely unclear. In this study, we identified a novel tRF, designated tRF3019a according to the tRFdb database [ 7 ]. This 18-nucleotide tRF (5′-TCCCCAGTACCTCCACCA-3′) originates from the 3′ terminus of mature tRNA-Ala-AGC-1–1. Our analysis revealed that the expression of tRF3019a was significantly upregulated in LUAD tissues and exhibited a positive correlation with both disease progression and metastasis. Employing a combination of molecular biology techniques, cell biology assays, and statistical analyses, we demonstrated that tRF3019a enhances hnRNPK expression through direct interaction, thereby inhibiting its ubiquitin-mediated degradation. This upregulation subsequently contributes to the transcription of MYH11 , facilitating LUAD cell migration and metastasis. Collectively, these findings suggest that the tRF3019a–hnRNPK–MYH11 regulatory axis contributes to enhanced migratory and invasive behaviors in LUAD cells and may provide mechanistic insight into LUAD metastasis.

In this study, we identified tRF3019a as a pro-metastatic regulator in lung adenocarcinoma. tRF3019a was significantly upregulated in LUAD tumor tissues compared with adjacent normal tissues, and its elevated expression was associated with enhanced migratory and invasive capabilities of LUAD cells as well as poorer patient prognosis. Both in vitro and in vivo experiments further demonstrated that tRF3019a promotes LUAD cell migration, invasion, and metastatic colonization. Mechanistically, our findings support a model in which tRF3019a modulates the stability and transcriptional activity of the RNA-binding protein hnRNPK by inhibiting its ubiquitin-mediated proteasomal degradation. Through this mechanism, tRF3019a enhances hnRNPK-associated transcriptional regulation of downstream genes, including MYH11 , a cytoskeletal regulator closely associated with tumor cell motility and invasion. Importantly, although tRF3019a perturbation induces broad transcriptomic changes, our integrative RNA-seq and CUT&Tag analyses enabled us to focus on hnRNPK-bound target genes, allowing the identification of MYH11 as one representative hnRNPK-dependent effector, while acknowledging that additional hnRNPK-independent regulatory pathways may also contribute to the overall phenotype. tRFs have been shown to play critical biological roles in tumor development and progression [ 37 , 38 ]. Increasing evidence suggests that tRFs are actively involved in tumor metastasis. For instance, tRF-GluCTC-0005 promotes pancreatic cancer metastasis by activating hepatic stellate cells [ 39 ]. Similarly, 5′-tRF-GlyGCC promotes breast cancer metastasis by increasing the activity of obesity-related protein demethylases [ 40 ]. Meanwhile, 5′-tRF-Cys facilitates breast cancer metastasis by stabilizing ribonucleoprotein complexes through the oligomerization of RNA-binding proteins on transcripts [ 41 ]. Although the involvement of tRFs in tumor metastasis has been extensively studied, our study demonstrates that tRF3019a promotes LUAD cell migration and invasion by inhibiting the ubiquitination and degradation of hnRNPK, thereby enhancing hnRNPK-associated transcriptional regulation of downstream genes, including MYH11 . These findings elucidate the biological function and underlying molecular mechanism of tRF3019a in LUAD metastasis. hnRNPK, a well-characterized member of the hnRNP family, is implicated in various critical cellular processes, including the regulation of nuclear noncoding RNAs, tumorigenesis, and osteogenesis [ 42 ]. As a key RNA-binding protein, hnRNPK participates in multiple stages of gene expression, such as maintaining genomic stability, regulating mRNA splicing, chromatin remodeling, transcription regulation, and translation regulation [ 43 – 45 ]. In cancer, hnRNPK is widely recognized as an oncogene and is closely associated with poor prognosis in various malignancies [ 27 ]. Specifically in LUAD, hnRNPK has also been shown to promote cell proliferation and invasion [ 46 ]. Previous studies indicate that hnRNPK primarily interacts with nucleic acids—such as microRNAs—via its KH domains; this interaction may influence both transcriptional and translational regulation of target genes [ 23 , 47 ]. The SKP1–Cullin1–F-box (SCF) protein complex functions as an E3 ubiquitin ligase for hnRNPK by promoting its ubiquitin-dependent proteasomal degradation or reducing its binding affinity to downstream target genes [ 23 ]. Furthermore, phosphorylation events mediated by GSK3β and ERK have also been shown to induce ubiquitination and subsequent degradation of hnRNPK [ 48 ]. Therefore, the dynamic balance of ubiquitination and deubiquitination of hnRNPK within the cell serves as a mechanism for regulating its protein levels in response to cellular stress. In this study, we found that tRF3019a inhibits the ubiquitination and degradation of hnRNPK in LUAD cells by preventing Fbxo4-mediated K48-linked polyubiquitination, thereby enhancing hnRNPK protein stability. Although our data clearly demonstrate that tRF3019a suppresses Fbxo4-mediated K48-linked ubiquitination of hnRNPK, the precise molecular mechanism underlying this regulation remains to be fully elucidated. One plausible model is that the binding of tRF3019a to the KH1 domain of hnRNPK sterically hinders its interaction with the SCF Fbxo4 E3 ubiquitin ligase complex, thereby inhibiting ubiquitin chain. Alternatively, tRF3019a binding may induce conformational changes in hnRNPK that impair recognition by Fbxo4 or reduce accessibility to key ubiquitination sites. Distinguishing between these non-mutually exclusive mechanisms will require future structural or biochemical investigations. Notably, hnRNPK is a multifunctional RNA-binding protein that interacts with a broad range of coding and noncoding RNAs and has been shown to associate with chromatin to regulate gene expression in a context-dependent manner, rather than functioning as a classical sequence-specific transcription factor [ 49 , 50 ]. Therefore, it is unlikely that tRF3019a exerts its effects by completely displacing other endogenous RNA partners of hnRNPK. Instead, our findings support a model in which tRF3019a acts as one of several regulatory RNAs that fine-tune hnRNPK stability and activity, thereby modulating hnRNPK-dependent transcriptional programs. Future studies employing locus-specific chromatin–RNA interaction assays will be necessary to further delineate the exact mechanisms at individual gene loci. Consistent with this view, previous studies have demonstrated that hnRNPK binding within gene bodies and non-promoter regions can contribute to transcription-associated regulation through the formation of RNA–chromatin–protein complexes [ 49 ]. Importantly, we do not propose that hnRNPK functions as a canonical sequence-specific transcription factor at the MYH11 locus. In line with prior reports characterizing hnRNPK as a chromatin-associated RNA-binding protein [ 49 ], the hnRNPK binding detected by CUT&Tag likely reflects its association with broader gene regions rather than discrete promoter elements. Thus, although our data demonstrate hnRNPK occupancy within the MYH11 genomic region and its responsiveness to modulation by tRF3019a, the specific cis -regulatory elements and chromatin contexts involved remain to be fully elucidated. This regulatory mechanism appears to be functionally significant yet it may not be entirely exclusive. Consistent with these hnRNPK-dependent transcriptional and phenotypic alterations, modulation of tRF3019a expression influenced the levels of canonical epithelial and mesenchymal markers—such as E-cadherin, N-cadherin, and vimentin—supporting the presence of molecular features associated with EMT in LUAD cells. However, EMT is a complex and multifaceted process governed by an extensive network of transcription factors, including Snail, ZEB1/2, and Twist. The role of these key EMT regulators was not investigated in the current study and warrants further exploration in future work. MYH11 is a core component of the actomyosin cytoskeleton and plays an essential role in regulating cellular contractility, cytoskeletal tension, and stress fiber formation [ 51 ]. Accumulating evidence has established a link between MYH11 dysregulation and the pathogenesis of various malignancies. For instance, the chromosomal inversion inv [ 16 ] (p13q22), which involves the MYH11 gene, represents one of the most prevalent translocations in acute myeloid leukemia (AML) [ 52 ]. Moreover, aberrant expression of MYH11 has also been implicated in the development of several solid tumors, including gastric cancer [ 53 ], pancreatic cancer [ 32 ], bladder cancer [ 54 ], breast cancer [ 55 ], and hepatocellular carcinoma [ 56 ]. In addition, studies in endometriosis have shown that MYH11 enhances cell migration and invasion [ 57 ]. Collectively, these findings suggest that dysregulated MYH11 expression may critically influence cytoskeletal dynamics and tumor cell motility, thereby contributing to malignant progression [ 58 , 59 ]. In this study, we demonstrate that tRF3019a regulates MYH11 expression, at least partially, through hnRNPK, thereby promoting the migratory and invasive phenotypes of LUAD cells. These findings expand the functional implications of MYH11 in LUAD and uncover a previously unrecognized tRF3019a–hnRNPK–MYH11 regulatory axis involved in tumor metastasis. Despite these advances, several limitations warrant acknowledgement. First, although our data suggest that Dicer contributes to generation of tRF3019a, the precise molecular mechanisms underlying its biogenesis remain to be fully elucidated. Second, while CUT&Tag analysis confirmed hnRNPK occupancy at the MYH11 genomic locus, the precise functional binding sites—and whether hnRNPK directly interacts with promoter or enhancer elements—require further determination. Third, although MYH11 has been identified as a key downstream effector, the detailed molecular mechanisms by which MYH11-mediated cytoskeletal remodeling facilitates migration and invasion of LUAD cells merit further investigation. Finally, although tRF3019a holds promise as a potential prognostic biomarker and therapeutic target, its clinical applicability necessitates validation through comprehensive preclinical studies and prospective clinical trials.

In summary, we identified tRF3019a as a previously unrecognized tRNA-derived fragment that contributes to the progression of lung adenocarcinoma. Our findings demonstrate that tRF3019a promotes LUAD cell migration, invasion, and metastatic potential both in vitro and in vivo. Mechanistically, tRF3019a interacts with the RNA-binding protein hnRNPK and inhibits its ubiquitination-mediated proteasomal degradation, thereby enhancing hnRNPK-associated transcriptional regulation of downstream genes, including MYH11 . Collectively, these results highlight a critical role of the tRF3019a–hnRNPK–MYH11 regulatory axis in LUAD metastasis and suggest that tRF3019a may serve as a biomarker associated with disease progression and a candidate therapeutic target warranting further investigation.

Supplementary Material 1. Supplementary Material 2. Supplementary Material 3. Supplementary Material 4. Supplementary Material 5. Supplementary Material 1. Supplementary Material 2. Supplementary Material 3. Supplementary Material 4. Supplementary Material 5.