Hyperglycemia induces histological abnormalities and dysregulates angiotensin-converting enzymes and inflammatory signaling in zebrafish brain: Possible relationship with memory impairment

Hyperglycemia induces histological abnormalities and dysregulates angiotensin-converting enzymes and inflammatory signaling in zebrafish brain: Possible relationship with memory impairment | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Hyperglycemia induces histological abnormalities and dysregulates angiotensin-converting enzymes and inflammatory signaling in zebrafish brain: Possible relationship with memory impairment Mariana Torri Claro¹, Matheus Mülling dos Santos¹, Gabriel Teixeira de Macedo¹, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5783801/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Dysregulation of renin-angiotensin system (RAS), through the actions of angiotensin-converting enzymes significantly impacts inflammatory responses. Recent studies have demonstrated the relevance of RAS in Coronavirus Disease 2019 (COVID-19), where outcomes worsen in diabetic patients. We investigate the effects of hyperglycemia on RAS components and inflammatory gene expression in adult zebrafish brain. Hyperglycemia was induced by exposing zebrafish to a 111 mM glucose solution for 14 days. Behavioral tasks were conducted to evaluate learning/memory and anxiety-like behavior. After fasting, blood glucose levels were measured, and brain collected for histological and q-RT-PCR analyses. Exposure to glucose resulted in a significant hyperglycemic state, inducing anxiety-like phenotypes and impairing learning and memory. These alterations were followed by an upregulation of ace and a downregulation of ace2 brain transcripts. Additionally, there was an increase in the transcript levels of the gene adam17a. Furthermore, hyperglycemia increased the transcript levels of il-6, il-10 , and il-1β , along with a decrease in rela transcripts. Several histological abnormalities were found in the telencephalon, cerebellum and optic tectum of hyperglycemic fish, including neuronal and synaptic loss, gliosis, edema and necrosis. Collectively, our results demonstrate that hyperglycemia significantly disrupts behavioral and cognitive functions in adult zebrafish. These conditions correlate with dysregulated expression of critical components of RAS and inflammatory markers, suggesting a potential neuroinflammatory pathway that may underlie the observed neurodegenerative effects in brain. The dysregulation of angiotensin-converting enzymes signaling, which play critical roles in the pathophysiology of COVID-19, may exacerbate inflammation and contribute to the neurological complications associated with the disease. Hyperglycemia Memory Zebrafish Neuroinflammation Angiotensin-converting-enzymes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 INTRODUCTION The renin-angiotensin system (RAS) is a hormonal system that regulates various bodily processes, including blood pressure, electrolyte balance, and vascular resistance [ 1 ]. This regulation is achieved through the modulation of vasoactive peptides, such as angiotensin I, angiotensin II, angiotensin-(1–9), and angiotensin-(1–7). The enzymes angiotensin-converting enzyme I (ACE) and angiotensin-converting enzyme II (ACE2) play a key role in maintaining this balance. Specifically, ACE converts angiotensin I into angiotensin II, while ACE2 acts to convert angiotensin II into angiotensin-(1–7), ensuring precise control over the peptide levels in the RAS. The balance between these peptide axes has significant implications for inflammatory responses. The ACE/Ang II/AT1 receptor axis is known to activate pro-inflammatory pathways, contributing to inflammation. Conversely, the ACE2/Ang (1–7)/MAS receptor axis is associated with anti-inflammatory responses. Additionally, a disintegrin and metalloproteinase 17 (ADAM17) modulates the RAS by cleaving the extracellular domain of ACE2, which leads to an increase in soluble angiotensin-converting enzyme 2 (sACE2) levels in the circulation [ 2 , 3 ]. This complex interplay highlights the intricate regulatory mechanisms underlying the RAS and its impact on inflammation. Of note, ADAM17 also functions processing other substrates, including the cleavage and release of soluble TNF-α from the membrane-bound precursor, which serve as a proinflammatory mediator [ 4 , 5 ]. Currently, RAS has come into the focus of coronavirus disease 2019 (COVID-19) studies, since ACE2 is the receptor for SARSCoV-2 entry into human lung cells [ 6 ]. Patients affected by COVID-19 have different clinical courses, developing mild, moderate or severe symptoms [ 7 , 8 ]. The cytokine storm and the consequent hyperinflammatory state have been intimately linked with severe COVID-19, and mortality [ 9 – 12 ]. There is also the so-called long COVID or post-COVID, where adverse symptoms appear and affect patients in the long term [ 13 , 14 ]. Memory impairment is one of the most common disabilities in patients who have had COVID-19, condition that affects approximately 17% individuals up to 12 weeks after infection and can persist for prolonged periods [ 15 ]. Diabetes mellitus (DM) is one of the biggest public health problems worldwide and one of the most important risk factors for the development of vascular, cardiovascular and cognitive disorders [ 16 , 17 ]. Currently, DM has also been considered a risk factor for a severe course of COVID-19 [ 18 ]. Clinical evidence shows that diabetic patients have poorer outcomes during the infection, with a significant increase in progression, severity and mortality [ 19 , 20 ]. Several hypotheses have already been raised, but knowledge about the shared molecular markers between the two diseases is still elusive. In this context, our study was designed to identify molecular networks in DM that could help explain how the disorder intensifies the effects of COVID-19. For that, we investigated how hyperglycemia affects the transcript levels of ace2 and inflammatory signaling-related genes, the main pathways targeted in COVID-19. As memory impairment is a symptom that has been reported in both diseases, we investigated the learning-memory retention and histological changes in brain. Herein, we used Zebrafish as an alternative model to replicate DM-phenotypes and conduct molecular, histological and behavioral assays. Our hypothesis is that hyperglycemia-induced modulation of the RAS and inflammatory signaling pathways may exacerbate brain infection and inflammation with COVID-19. Furthermore, the neuroinflammation resulting from this modulation could contribute to memory impairments observed in both conditions. 2 MATERIALS AND METHODS 2.1 Animals and Experimental design Adult zebrafish ( Danio rerio ), of both sexes (approximately 50:50 male-to-female ratio), and 3–6 months old, were purchased from a local supplier (Santa Maria, Brazil). A total of 40 animals were used in the experiment following the recommendations of the National Institute of Health Guide for the Care and Use of Laboratory Animals (2011) [ 21 ]. The fish were maintained in 40 L aquariums (1 fish per liter) for 15-day acclimatization period before starting the experiments. The water was treated with a water conditioner Prime™ (1drop/2L), with constant filtration and aeration, maintained at 26 ± 2°C and pH adjusted to 7.0-7.2. Illumination was provided by a 14:10 light-dark artificial photoperiod cycle (lights on at 7:00). The fish were feed with a commercial flake food (Alcon Basic™, Alcon, Brazil) until satiety. For the experiments, 2 groups of 20 fish were allocated in 4 L aquariums (5 fish/L). To induce hyperglycemia, the fish were maintained in 111mM of glucose solution for 14 days [ 22 , 23 ]. The control group was kept under similar conditions but without glucose. All the experimental protocols were approved by the Ethics Commission on Animal Use of Federal University of Santa Maria (process number: 8468271022). 2.2 Behavioral Tasks 2.2.1 Novel tank test The Novel tank test is used to evaluate both anxiety-like phenotypes and locomotor activity in zebrafish [ 24 , 25 ]. After 14 days of treatment, the animals were placed in aquariums with dimensions of 25 cm length x 15 cm height x 6 cm width. The tank was filled with 3 L dechlorinated water at a temperature of 26 ± 2°C and pH adjusted to 7.0-7.2. During test, animals’ behavior was recorded for a period of 6 min with a webcam connected to a laptop and subsequently the records were analyzed using Any-Maze™ (Stoelting, CO, USA). Areas of aquarium were virtually divided in top and bottom, and parameters of time spent in the top, transitions to the top area, total distance traveled, and absolute turn angle were analyzed. A total of 40 fish were utilized in the test (n = 20 per group). 2.2.2 Light/dark test The light/dark test was performed as a complementary assay to analyze the anxiety-like phenotypes in zebrafish [ 25 , 26 ]. After treatment, each fish was placed in a tank with a dimension of 30 cm length x 15 cm height x 10 cm width and divided into equals white and black compartments. The aquarium was filled with water to a height of 8 cm, under the same conditions as the previous test. The videos were recorded for 6 min and parameters such as latency to enter in the dark area, time spent in the lit area, shuttling, and number of risk assessment episodes were assessed [ 27 ]. A total of 40 fish were utilized in the test (n = 20 per group). 2.3 Passive avoidance test The passive avoidance test was used to assess learning and memory parameters as previously described by [ 28 ] with some modifications. First, each fish was placed in a dark apparatus (20 cm long x 10 cm wide x 15 cm high), which was divided into two compartments, one 7 cm long and the other 13 cm long, separated by a screen made of dark acrylic (10 cm wide x 15 cm high) with a circular opening measuring 3 cm in diameter. After 3 min of acclimatization, a light was turned on through a transparent window on the side of one of the compartments and the door between them was opened from above for illumination by the light beam to occur. After the fish crossed the door and went into the illuminated compartment, a glass sphere (8.5 g in mass, 1.5 cm in diameter) was dropped in front of the fish as a noxious stimulus. Each fish was then gently led into the dark compartment with a net and the gate closed and the light turned off. During 3 min intervals the process was repeated three times. Each crossing was considered a training session, and the training session was complete when three training sessions were carried out. After each training session, the crossing time was measured to 300s. To evaluate memory retention capacity, after 2h of the training session, the animals were subjected to training that consisted of reintroducing the animal into the dark compartment and evaluating the crossing time in a period of 300s. Only one test was performed without the harmful stimulus occurring. 2.4 Fasting blood glucose measurement The animals were fasted for 24 hours to measure blood glucose. The fish were euthanized by method of hypothermia previously described by [ 29 ] to reduce possible blood glucose variations induced by chemical anesthetics [ 30 ]. The tail of animals was cut in the anterior portion. The blood glucose level was measured by applying a droplet of blood from the tail to a portable glucometer (G-Tech Free 1) and expressed in mg/dL. 2.5 Sample collection and storage After the fasting blood glucose measurement, the animals were kept on the ice and subsequently dissected as previously described by [ 31 ]. Brain samples were pooled (n = 3), and immediately transferred to RNAse-free microtubes (1.5mL) on ice, then stored at -80 ºC for subsequent quantitative reverse transcription polymerase chain reaction (q-RT-PCR) analyses. 2.6 Gene expression assay by quantitative reverse transcription PCR (q-RT-PCR) The brains were homogenized with 500 µL of Trizol reagent (Invitrogen®, Brazil). The RNA extraction was performed using the Trizol method according to the manufacturer’s protocol with some modifications. After extraction, RNA quantity and quality were analyzed using a NanoDrop™ 2000/2000c (Thermo Scientific). After quantification, the total RNA was treated with TURBO DNase (Invitrogen), and the cDNA was synthesized with Platinum Taq DNA Polymerase following the manufacturer's protocol (Invitrogen). The q-RT-PCRs were carried out in 20 µL reaction volumes in 96-well plates, with each reaction containing 10 µL of cDNA as the template, 3.52 µL of Milli-Q water, 2µL of 10x PCR buffer, 1.2 µL 50 mM MgCl 2 , 0.4µL of 10 mM dNTPs Mix, 0.4 µL of 10 µM Forward Primer, 0.4 µL of 10 µM Reverse Primer, 2µL of SYBR Green, and 0.08 µL of 2U/rxm Taq DNA Polymerase. Threshold and baselines were manually determined using the StepOne Software v2.3 (Applied Biosystems, NY) and the cycle threshold (CT) value for each sample was calculated and recorded using the formula 2 −ΔΔCT [ 32 ]. Each sample was analyzed in triplicate, and the ΔCT value was obtained by subtracting the β-actin CT value from the CT value of the gene of interest. Results were expressed as relative mRNA expression. All primer sequences used in this study are listed in Table 1 . Table 1 Sequences of primers (5’ – 3’). Name Forward Reverse Acession NCBI β-actin GATGATGAATTGCCGCACTG ACCAACCATGACACCCTGATGT NM_131031.2 ace GCATCTCAAATGGACGGCTTT AGCGTGCAGGTTTTGGTAGA XM_689244.9 ace2 ACAACAGAGTTCCTGGCTGG TGCGTTCCAGGTGTATGCTT NM_001007297.1 adam17a TGTTGGATCAGTGGTGGTCTT TATCTCTCCGCTACTGGGGT NM_199673.1 adam17b AGACGACGAGTACGACCATCT TGCACATCTCTCTTGCGAACT XM_021468637.1 tnfa CAACAAGATGGAAGTGTGCTGA AGCCTTGGAAGTGAAATTGCC NM_212859.2 il6r GCGGTTAAAGTTCAGTCTGCC AAACTCCAGAAGGAGGATCTTGT NM_001330258.2 il6 GCGGTTAAAGTTCAGTCTGCC GCGTTAGACATCTTTCCGTGC NM_001261449.1 il10 GGAACTCAAGCGGGATATGGT ACCCCCTTTTCCTTCATCTTTTCA NM_001020785.2 rela AGCTGAAGATCTGCCGTGTC CGCACCTCAATGTCCTCTTTC NM_001001839.2 il1b AGTCATTCAACACACACTTTCACA CCGCATGCCATCATTTCAGAG NM_212844.2 2.7 Brain Regions Histology Whole brains from zebrafish were preserved by immersion in 10% formalin for 48 hours, and then subjected to a dehydration process involving a series of ethanol (ETOH) concentrations. The dehydration protocol included treatment with 70% ETOH for 1 hour, followed by 95% ETOH for 1 hour, and then 100% ETOH for two sequential changes, each lasting 1 hour. After dehydration, the specimens were treated with xylene for 1 hour, and with fresh xylene for an additional hour. Subsequently, the specimens were embedded in paraffin heated to 60°C. Once embedding was complete, the paraffin blocks were sectioned into slices of 5 µm thickness using a microtome. These sections were floated on a warm water bath and then placed on glass slides. To deparaffinize, sections underwent a series of washes in xylene, with two changes of xylene for 5 minutes each. This was followed by two washes in 100% ETOH for 5 minutes each, 1X wash in 95% ETOH for 5 minutes, and finally 1x wash in 70% ETOH for 5 minutes. The sections were rehydrated by rinsing in water. For staining, sections were first incubated in hematoxylin solution for 5 minutes, then rinsed in running tap water until excess hematoxylin was removed. This was followed by incubation in eosin solution for 2 minutes and a brief rinse in 95% ETOH to remove excess eosin. The sections were then dehydrated again through a graded ETOH series: 70% ETOH for 1 minute, 95% ETOH for 1 minute, and 100% ETOH for two changes, each for 1 minute. After dehydration, the sections were cleared in xylene with two changes of xylene for 2 minutes each. Finally, the sections were mounted using Dibutylphthalate Polystyrene Xylene (DPX) mounting medium and covered with a coverslip. The prepared sections were examined and photographed using Olympus IX81 inverted microscope. A semi-quantitative scoring system was used, following an ordinal approach to evaluate multiple lesion parameters. The scoring criteria were adapted from Haridevamuthu et al. (2023) and categorized as follows: ++++ for very severe histopathological alteration, +++ for severe histopathological alteration, ++ for moderate alteration, + for mild alteration, and − for no alteration [ 33 ](Table 2 ). Table 2 General Histological Alterations caused by glucose exposure in Zebrafish Brain. HISTOLOGICAL ALTERATIONS TREATMENTS Control Glucose Immune cell Infiltration - +++ Structural degeneration - +++ Vacuolation - ++ Necrosis - ++++ Pyknosis - +++ 2.8 Statistical analysis Results were analyzed by unpaired t-test and the data were parametric. Behavioral data of the novel tank and light dark tests were expressed by mean ± SD and all other data were expressed as mean ± SEM. The data were analyzed using GraphPad Prism software (San Diego, CA, USA) version 8.0. p- values < 0.05 were considered statistically significant. 3 RESULTS 3.1. Glucose exposure induces hyperglycemia and learning/memory impairments in zebrafish Exposure of fish to 111mM glucose for 14 days induced a hyperglycemic state, increasing the fasting blood glucose levels by approximately 3-fold compared to the control group (FIG. 1 A). Fish from the control group did not show changes in learning/memory as assessed by the passive avoidance test, since the time to across the door in the test was significantly higher than the time spent during the training section (Fig. 1 B). In contrast, the hyperglycemic state was associated with learning/memory decline since there was no difference between the time to across the door in the test and training sections in fish from glucose group (Fig. 1 C). 3.2. Hyperglycemia alters the exploratory and locomotor profile of zebrafish The analysis of novel tank test revealed that fish from glucose group had a significant decrease in both time in the top and number of entries in the top when compared to the control (Fig. 2 A and C). No alteration was observed between control and glucose groups in the parameters of distance traveled and absolute turn angle (Fig. 2 B and D). 3.3. Hyperglycemia induces anxiety-like phenotypes in zebrafish By light-dark analysis, we found that the hyperglycemic fish spent less time in the lit area, exhibited more risk episodes and showed greater latency to enter the dark area than the controls (Fig. 3 A, B, and D). The number of crossings did not differ between control and glucose groups (Fig. 3 C). 3.4. Hyperglycemia dysregulates ace/ace2 and inflammatory signaling in zebrafish brain In this set, we checked the brain transcript levels of ace , ace2 , adam17 isoforms ( adam17a and adam17b ), and some inflammatory mediators (interleukin 6: il6 ; interleukin 6 receptor: il6r ; interleukin 1 beta: il1b ; tumor necrosis factor alpha: tnfa ; nuclear factor NF-kappa-B: rela and interleukin 10: il10 ). We found that the hyperglycemic state was associated with an upregulation of ace and a downregulation of ace2 transcripts when compared to the control fish (Fig. 4 A and B). There was also a significant increase in the transcript levels of gene adam17a when compared to the control (Fig. 4 C). No alterations were observed on transcript levels of adam17b between glucose and control groups (Fig. 4 D). Among the inflammatory mediators, we found that hyperglycemia caused a significant increase in the il6 , il10 and il1b transcript levels (Fig. 5 A, C and D), concomitantly with a decrease in rela transcripts (Fig. 5 F). The transcript levels of genes il6r and tnfa did not differ between control and glucose groups (Fig. 5 B and E). 3.5. Hyperglycemia induces histological abnormalities in Zebrafish brain regions Herein we analyzed the histology of some Zebrafish brain regions: Telencephalon, Cerebellum and Optic tectum. Conjunctly, these structures are involved in cognitive, motor and visual processing In telencephalon of hyperglycemic fish, we observed structural disorganization in the pallium and subpallium regions, reflecting a loss of synaptic connections and reduced synaptic activity (FIG. 6 A and 6 B). There was also a noticeable reduction in neuronal density, and a marked increase in the number of glial cells, particularly astrocytes. In the optic Tectum, the stratum periventricular of hyperglycemic fish exhibited extensive necrosis and fibrosis when compared to the control. We also found signals of spongiosis, edema and degeneration of connective tissues throughout the optic tectum, suggesting widespread neuroinflammation and necrosis (6C and 6D). In cerebellum, hyperglycemia also caused a noticeable neuronal and synaptic loss, particularly of Purkinje and granule cells, along with extensive reactive gliosis and edema (FIG. 6 E and 6 F). 4. DISCUSSION In the present study, we demonstrated that hyperglycemia influences ACE/ACE2 and inflammatory signaling in the zebrafish brain, potentially leading to neuroinflammation and memory deficits. We hypothesize that this pro-inflammatory profile may contribute to the clinical worsening of diabetic patients with COVID-19. Hyperinflammation is a pathological process implicated in a diverse array of diseases, ranging from infectious condition such as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to non-communicable diseases like obesity, Alzheimer's, and notably, Type 2 Diabetes Mellitus (T2DM) [ 34 – 36 ]. The molecular and cellular mechanisms underlying inflammation are complex, involving a network of inducers, mediators, and signaling pathways that can be disease-specifics. In T2DM, inflammation can occur as a result of dysfunction of the immune response, production of inflammatory mediators by adipocytes and macrophages in adipose tissue, and aberrant activation of the RAS [ 37 , 38 ]. Herein, we investigated the molecular expression of the RAS components: ACE and ACE2. ACE/ACE2 signaling is widely expressed in various tissues, including the lungs, cardiovascular system, intestine, kidneys, central nervous system, and adipose tissue [ 5 , 39 ]. A recent study by Mkhize (2022) demonstrated that diet-induced diabetes can lead to an increase in the relative expression of ace , angiotensin II , and angiotensin II type 1 receptors (AT1Rs) across various tissues, including skeletal muscle, liver, and heart [ 40 ]. Consistent with these findings, our result show that hyperglycemia also increases the cerebral expression of ace and adam17a , followed by a decrease in ace2 transcripts. This modulation may result in elevated Ang II levels, potentially exerting an inflammatory effect on cerebral tissue. In fact, chronic activation of the RAS is known to be a significant contributor to diabetic complications, primarily through the elevation of tissue Ang II, which acts as an inflammatory mediator [ 41 , 42 ]. Previous studies have shown that chronic activation of the RAS and the resulting increase in angiotensin II contribute to metabolic dysregulation. Hayashi (2010) and Steckelings (2009) showed that Ang II exerts an inhibitory effect on the insulin signaling pathway, contributing to glucose dysregulation, insulin resistance, and the development of oxidative stress, endothelial damage, and fibrosis [ 43 , 44 ]. Our research extends this understanding by demonstrating an increase in inflammatory cytokines, specifically IL-6, IL-1β, and IL-10, which are indicative of neuroinflammation. This is consistent with the notion that Ang II not only disrupts insulin signaling but also triggers an inflammatory response that could exacerbate metabolic dysfunction. Clinical studies have supported that T2DM and related conditions have a profound impact on neuronal and glial physiology [ 45 – 47 ]. In accordance, our histological findings showed several changes in the telencephalon, cerebellum and optic tectum of hyperglycemic fish in relation to the controls. In general, the tissue abnormalities were accompanied by pathological processes including edema, spongiosis, gliosis and necrosis. In the pallium and sub-pallium regions of the telencephalon, we identified significant structural disorganization in hyperglycemic fish. The findings also revealed a notable reduction in neuronal density, suggesting the possibility of loss of synaptic connection and synaptic activity. This observation is consistent with previous research indicating that hyperglycemia can lead to neurodegenerative changes across various models. Baker et al. (2012) reported that chronic hyperglycemic conditions are associated with increased oxidative stress and inflammation, detrimental to synaptic integrity and neuronal viability [ 48 ]. Additionally, our study elucidates the detrimental effects of hyperglycemic environments on neuronal integrity, particularly highlighting notable neuronal loss in cerebellar Purkinje and granule cells. These findings align with Sonneville et al. (2012), who emphasized the vulnerability of cerebellar neurons to metabolic disturbances, reinforcing the idea that hyperglycemia significantly impacts neuronal health [ 49 ]. Furthermore, we observed extensive necrosis and fibrosis in the optic tectum, alongside indications of spongiosis, edema, and degeneration of connective tissues. These findings point to a significant neuroinflammatory response, which aligns with the results reported by Chen et al. (2018)[ 50 ]. Their study documented similar patterns of necrosis and gliosis under hyperglycemic conditions, suggesting that hyperglycemia disrupts neuronal architecture and induces a widespread inflammatory response. Moreover, the presence of necrosis and gliosis suggests that reactive glial cells respond to neuronal injury, potentially amplifying inflammatory signals and contributing to tissue degeneration. Collectively, our histological results reinforce the notion that hyperglycemia leads to significant neuroinflammation, which may have profound implications for the integrity and function of the nervous system. As telencephalon, cerebellum and optic tectum control a wide range of brain activities, hyperglycemia may affect visual processing, spatial navigation, sensorimotor integration, and motor and cognitive functions. Cognitive dysfunction is a common aggravating factor resulting from T2DM. Insulin resistance, along with alteration in glucose uptake and utilization are pathological features highlighted in clinical studies that have shown an increased risk of dementia among T2DM patients [ 51 ]. Additionally, diabetes has been linked to high incidence of mood disorders such as depression and anxiety [ 51 , 52 ]. These phenotypes have also been replicated in animal models of experimental diabetes. In zebrafish, hyperglycemia disrupts brain insulin signaling, leading to anxiety-like behavior and memory impairment [ 22 , 23 ]. In agreement, our study demonstrated that the hyperglycemic state induced anxiety-like behavior and memory deficits in zebrafish. Notably, we observed cell changes and an imbalance in brain ace/ace2 and cytokine transcripts. We hypothesize that these molecular and cellular disturbances contribute to memory loss through subsequent neuroinflammation. Supporting this hypothesis, evidence suggests that the excessive activation of the ACE/Ang II/AT-1R axis promotes neurodegeneration in several brain disorders by increasing apoptosis and neuroinflammation [ 53 , 54 ]. In addition, our findings contribute to the growing body of literature highlighting the role of the ACE/Ang II/AT1 axis in neurodegenerative processes associated with Alzheimer’s disease. The overactivation of this pathway has been identified as a key factor in amyloid-β ( Aβ) -induced neurodegeneration and apoptosis [ 55 ] facilitating also the Aβ deposition in both in vitro and in vivo settings. Additionally, chronic activation of this axis has been associated with upregulation of pro-inflammatory mediators, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and transforming growth factor (TGF)-β have been reported in brain tissue from patients with vascular dementia and animal models of vascular dementia [ 56 ]. Given the current global health crisis posed by COVID-19, our study's molecular endpoints also bear significant implications in this context. The recent identification of ACE2 as the primary receptor for SARS-CoV-2 infection suggests that alterations in the ACE/ACE2 balance may play a critical role in the severity of COVID-19 symptoms. The phenomenon of the “cytokine storm,” characterized by an exaggerated inflammatory response, is particularly relevant, as it has been associated with severe complications in COVID-19 patients. Based on our findings, we hypothesize that diabetes, an established risk factor for adverse COVID-19 outcomes, could interact with these mechanisms in several ways. First, the dysregulation of the ACE/ACE2 pathway and the subsequent increase in pro-inflammatory cytokines could exacerbate the inflammatory response, amplifying the cytokine storm that is critical in severe COVID-19 cases. Second, cognitive deficits associated with hyperglycemia may worsen the cognitive impairments reported in patients experiencing long COVID, suggesting a compounding effect on neurocognitive health. 5. CONCLUSION Overall, this study provided a deeper understanding of how hyperglycemia induces significant alterations in the behavioral and cognitive functions of adult zebrafish. Furthermore, hyperglycemic conditions demonstrated a correlation with the dysregulation of important components of the RAS and with an increase in inflammatory markers, suggesting a potential neuroinflammatory pathway that may underlie the observed neurodegenerative effects in the brain. The results obtained in this study evidence that hyperglycemia induces behavioral deficits through the dysregulation of the signaling of angiotensin-converting enzymes, which play critical roles in the pathophysiology of COVID-19. Such dysregulation can exacerbate the inflammatory process and contribute to the neurological complications associated with the virus, concomitantly with the upregulation of pro-inflammatory genes. Declarations Authors’ Contributions Mariana Torri Claro: Methodology, Validation, Formal analysis, Investigation, Writing – original draft, Writing – review & editing. Matheus Mülling dos Santos: Validation, Investigation, Methodology, Writing – review & editing. Gabriel Teixeira de Macedo: Validation, Investigation, Methodology, Writing – review & editing. Talise Ellwanger Müller: Validation, Investigation, Methodology, Writing – review & editing. Sabrina Antunes Ferreira: Validation, Investigation, Methodology, Writing – review & editing. Babajide Oluwaseun Ajayi: Validation, Investigation, Methodology, Writing – review & editing. João Batista Teixeira da Rocha : Validation, Investigation, Writing – review & editing. Nilda Vargas Barbosa : Validation, Investigation, Writing – review & editing, Supervision, Project administration. Funding This work was financially supported by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). N.V.B. and J.T.R. are the recipients of CNPq fellowships. CAPES (grant number: CAPES EPIDEMIAS 09 PROC.88887.505377/2020). Compliance with Ethical Standards Conflict of Interest The authors declare that they have no conflict of interest. Ethics Approval All the experimental protocols were approved by the Ethics Commission on Animal Use of Federal University of Santa Maria (process number: 8468271022). Code Availability Not applicable References Verano-Braga T, Martins ALV, Motta-Santos D et al (2020) ACE2 in the renin-angiotensin system. Clin Sci (Lond). 2020;134(23):3063–3078. https://doi.org/10.1042/CS20200478 Jiang S, Yang H, Sun Z et al (2023) The basis of complications in the context of SARS-CoV-2 infection: Pathological activation of ADAM17. Biochem Biophys Res Commun. 2023;679:37–46. https://doi.org/10.1016/j.bbrc.2023.08.063 Zipeto D, Palmeira J, da Argañaraz F, Argañaraz GA (2020) ER ACE2/ADAM17/TMPRSS2 Interplay May Be the Main Risk Factor for COVID-19. Front Immunol. 2020;11:576745. https://doi.org/10.3389/fimmu.2020.576745 Zlacká J, Stebelová K, Zeman M, Herichová I (2021) Interactions of Renin-Angiotensin System and COVID-19: The Importance of Daily Rhythms in ACE2, ADAM17 and TMPRSS2 Expression. Physiol Res 70:S177–S194. https://doi.org/10.33549/physiolres.934754 Gheblawi M, Wang K, Viveiros A et al (2020) Angiotensin-Converting Enzyme 2: SARS-CoV-2 Receptor and Regulator of the Renin-Angiotensin System: Celebrating the 20th Anniversary of the Discovery of ACE2. Circ Res. 2020;126(10):1456–1474. https://doi.org/10.1161/CIRCRESAHA.120.317015 Zhang Q, Xiang R, Huo S et al (2021) Molecular mechanism of interaction between SARS-CoV-2 and host cells and interventional therapy. Signal Transduct Target Ther. 2021;6(1):233. https://doi.org/10.1038/s41392-021-00653-w Crook H, Raza S, Nowell J et al (2021) Long covid - Mechanisms, risk factors, and management. BMJ. 2021;374:n1648. https://doi.org/10.1136/bmj.n1648 Mehandru S, Merad M (2022) Pathological sequelae of long-haul COVID. Nat Immunol. 2022;23(2):194–202. https://doi.org/10.1038/s41590-021-01104-y Pignalosa FC, Desiderio A, Mirra P et al (2021) Diabetes and cognitive impairment: A role for glucotoxicity and dopaminergic dysfunction. Int J Mol Sci. 2021;22(22):12366. https://doi.org/10.3390/ijms222212366 Ehtewish H, Arredouani A, El-Agnaf O (2022) Diagnostic, Prognostic, and Mechanistic Biomarkers of Diabetes Mellitus-Associated Cognitive Decline. Int J Mol Sci. 2022;23(11):6144. https://doi.org/10.3390/ijms23116144 Harapan BN, Yoo HJ (2021) Neurological symptoms, manifestations, and complications associated with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and coronavirus disease 19 (COVID-19). J Neurol. 2021;268(9):3059–3071. https://doi.org/10.1007/s00415-021-10406-y Mahboubi Mehrabani M, Karvandi MS, Maafi P, Doroudian M (2022) Neurological complications associated with Covid-19; molecular mechanisms and therapeutic approaches. Rev Med Virol. 2022;32(6):e2334. https://doi.org/10.1002/rmv.2334 Ceban F, Ling S, Lui LMW et al (2022) Fatigue and cognitive impairment in Post-COVID-19 Syndrome: A systematic review and meta-analysis. Brain Behav Immun. 2022;101:93–135. https://doi.org/10.1016/j.bbi.2021.12.020 Graham EL, Clark JR, Orban ZS et al (2021) Persistent neurologic symptoms and cognitive dysfunction in non-hospitalized Covid-19 long haulers. Ann Clin Transl Neurol. 2021;8(5):1073–1085. https://doi.org/10.1002/acn3.51350 Möller M, Borg K, Janson C et al (2023) Cognitive dysfunction in post-COVID-19 condition: Mechanisms, management, and rehabilitation. J Intern Med. 2023;294(5):563–581. https://doi.org/10.1111/joim.13720 Zhang S, Zhang Y, Wen Z et al (2023) Cognitive dysfunction in diabetes: abnormal glucose metabolic regulation in the brain. Front Endocrinol (Lausanne). 2023;14:1192602. https://doi.org/10.3389/fendo.2023.1192602 Biessels GJ, Strachan MWJ, Visseren FLJ et al (2014) Dementia and cognitive decline in type 2 diabetes and prediabetic stages: Towards targeted interventions. Lancet Diabetes Endocrinol. 2014;2(3):246 – 55. https://doi.org/10.1016/S2213-8587(13)70088-3 Chourasia P, Goyal L, Kansal D et al (2023) Risk of New-Onset Diabetes Mellitus as a Post-COVID-19 Condition and Possible Mechanisms: A Scoping Review. J Clin Med. 2023;12(3):1159. https://doi.org/10.3390/jcm12031159 Ilic I, Ilic M (2023) Diabetes Mellitus after SARS-CoV-2 Infection: An Epidemiological Review. Life (Basel). 2023;13(6):1233. https://doi.org/10.3390/life13061233 Kastora S, Patel M, Carter B et al (2022) Impact of diabetes on COVID-19 mortality and hospital outcomes from a global perspective: An umbrella systematic review and meta-analysis. Endocrinol Diabetes Metab. 2022;5(3):e00338. https://doi.org/10.1002/edm2.338 Hubrecht R, Use of Laboratory Animals (2011) Guide for the Care and Use of Laboratory Animals, Eighth Edition 2011 The Committee for the Update of the Guide for the Care and (2011). Published by the National Research Council of the National Academies, Washington DC, USA. Animal Welfare 20:455–456. https://doi.org/10.1017/S0962728600003067 Capiotti KM, De Moraes DA, Menezes FP et al (2014) Hyperglycemia induces memory impairment linked to increased acetylcholinesterase activity in zebrafish (Danio rerio). Behav Brain Res Nov. https://doi.org/10.1016/j.bbr.2014.08.033 . 1;274:319 – 25 dos Santos MM, de Macedo GT, Prestes AS et al (2018) Hyperglycemia elicits anxiety-like behaviors in zebrafish: Protective role of dietary diphenyl diselenide. Prog Neuropsychopharmacol Biol Psychiatry Jul 1385:128–135. https://doi.org/10.1016/j.pnpbp.2018.04.017 Egan RJ, Bergner CL, Hart PC et al (2009) Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav Brain Res. 2009;205(1):38–44 https://doi.org/10.1016/j.bbr.2009.06.022 Maximino C, de Brito TM, da Silva Batista AW et al (2010) Measuring anxiety in zebrafish: A critical review. Behav Brain Res. 2010;214(2):157 – 71. https://doi.org/10.1016/j.bbr.2010.05.031 Maximino C, de Brito TM, Colmanetti R et al (2010) Parametric analyses of anxiety in zebrafish scototaxis. Behav Brain Res. 2010;210(1). https://doi.org/10.1016/j.bbr.2010.01.031 Maximino C, Araujo J, Leão LKR et al (2011) Possible role of serotoninergic system in the neurobehavioral impairment induced by acute methylmercury exposure in zebrafish (Danio rerio). Neurotoxicol Teratol. 2011 Nov-Dec;33(6):727 – 34. https://doi.org/10.1016/j.ntt.2011.08.006 Lee Y, Lee S, Park JW et al (2018) Hypoxia-Induced Neuroinflammation and Learning–Memory Impairments in Adult Zebrafish Are Suppressed by Glucosamine. Mol Neurobiol. 2018;55(11):8738–8753. https://doi.org/10.1007/s12035-018-1017-9 Wilson JM, Bunte RM, Carty AJ (2009) Evaluation of rapid cooling and tricaine methanesulfonate (MS222) as methods of euthanasia in zebrafish (Danio rerio). J Am Assoc Lab Anim Sci. 2009;48(6):785-9 PMID: 19930828 Eames SC, Philipson LH, Prince VE, Kinkel MD (2010) Blood Sugar Measurement in Zebrafish Reveals Dynamics of Glucose Homeostasis. Zebrafish. 2010;7(2):205 – 13 https://doi.org/10.1089/zeb.2009.0640 Gupta T, Mullins MC (2010) Dissection of Organs from the Adult Zebrafish. 2010;(37):1717 https://doi.org/10.3791/1717 Schmittgen TD, Livak KJ (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. https://doi.org/10.1006/meth.2001.1262 Haridevamuthu B, Raj D, Kesavan D et al (2023) Trihydroxy piperlongumine protects aluminium induced neurotoxicity in zebrafish: Behavioral and biochemical approach. Comp Biochem Physiol C Toxicol Pharmacol. 2023;268:109600 https://doi.org/10.1016/j.cbpc.2023.109600 Morris G, Bortolasci CC, Puri BK et al (2021) The cytokine storms of COVID-19, H1N1 influenza, CRS and MAS compared. Can one sized treatment fit all? Comp Biochem Physiol C Toxicol Pharmacol. 2023;268:109600 https://doi.org/10.1016/j.cyto.2021.155593 Hotamisligil GS (2017) Inflammation, metaflammation and immunometabolic disorders. Nature. 2017;542(7640):177–185 https://doi.org/10.1038/nature21363 Dansokho C, Heneka MT (2018) Neuroinflammatory responses in Alzheimer’s disease 2018;125(5):771–779 https://doi.org/10.1007/s00702-017-1831-7 Zatterale F, Longo M, Naderi J et al (2020) Chronic Adipose Tissue Inflammation Linking Obesity to Insulin Resistance and Type 2 Diabetes. Front Physiol. 2020;10:1607 https://doi.org/10.3389/fphys.2019.01607 Lee DK, Kim T, Byeon J et al (2022) REDD1 promotes obesity-induced metabolic dysfunction via atypical NF-κB activation. Nat Commun. 2022;13(1):6303 https://doi.org/10.1038/s41467-022-34110-1 Bourgonje AR, Abdulle AE, Timens W et al (2020) Angiotensin-converting enzyme 2 (ACE2), SARS-CoV-2 and the pathophysiology of coronavirus disease 2019 (COVID-19). J Pathol. 2020;251(3):228–248. https://doi.org/10.1002/path.5471 Mkhize BC, Mosili P, Ngubane PS et al (2022) Diet-induced prediabetes: Effects on the activity of the renin–angiotensin–aldosterone system in selected organs. J Diabetes Investig. 2022;13(5):768–780 https://doi.org/10.1111/jdi.13690 Cooper ME (2004) The role of the renin-angiotensin-aldosterone system in diabetes and its vascular complications. Am J Hypertens. 2004;17(11 Pt 2):16S-20S https://doi.org/10.1016/j.amjhyper.2004.08.004 Tikellis C, Thomas MC (2012) Angiotensin-converting enzyme 2 (ACE2) is a key modulator of the renin angiotensin system in health and disease. Int J Pept. 2012;2012:256294 https://doi.org/10.1155/2012/256294 Hayashi T, Takai S, Yamashita C (2010) Impact of the Renin-Angiotensin-Aldosterone-System on Cardiovascular and Renal Complications in Diabetes Mellitus. Curr Vasc Pharmacol. 2010;8(2):189 – 97 https://doi.org/10.2174/157016110790886947 Steckelings UM, Rompe F, Kaschina E, Unger T (2009) The evolving story of the RAAS in hypertension, diabetes and CV disease - Moving from macrovascular to microvascular targets. Fundam Clin Pharmacol. 2009;23(6):693–703 https://doi.org/10.1111/j.1472-8206.2009.00780.x Vargas-Soria M, García-Alloza M, Corraliza-Gómez M (2023) Effects of diabetes on microglial physiology: a systematic review of in vitro, preclinical and clinical studies. J Neuroinflammation. 2023;20(1):57. https://doi.org/10.1186/s12974-023-02740-x Sims-Robinson C, Kim B, Rosko A, Feldman EL (2010) How does diabetes accelerate Alzheimer disease pathology? Nat Rev Neurol. 2010;6(10):551-9. https://doi.org/10.1038/nrneurol.2010.130 Biessels GJ, Despa F (2018) Cognitive decline and dementia in diabetes mellitus: mechanisms and clinical implications. Nat Rev Endocrinol. 2018;14(10):591–604. https://doi.org/10.1038/s41574-018-0048-7 Baker SA, Kwok S, Berry GJ, Montine TJ (2021) Angiotensin-converting enzyme 2 (ACE2) expression increases with age in patients requiring mechanical ventilation. PLoS One. 2021;16(2):e0247060 https://doi.org/10.1371/journal.pone.0247060 Sonneville R, Den Hertog HM, Güiza F et al (2012) Impact of hyperglycemia on neuropathological alterations during critical illness. J Clin Endocrinol Metab. 2012;97(6):2113-23 https://doi.org/10.1210/jc.2011-2971 Chen L, Deng H, Cui H et al (2018) Inflammatory responses and inflammation-associated diseases in organs. Oncotarget. 2017;9(6):7204–7218. https://doi.org/10.18632/oncotarget.23208 Pelle MC, Zaffina I, Giofrè F et al (2023) Potential Role of Glucagon-like Peptide-1 Receptor Agonists in the Treatment of Cognitive Decline and Dementia in Diabetes Mellitus. Int J Mol Sci. 2023;24(14):11301 https://doi.org/10.3390/ijms241411301 Shinalieva K, Kasenova A, Akhmetzhanova Z et al (2023) Association of Insomnia with Anxiety and Depression in Type 2 Diabetic Patients: A Cross-Sectional Study. Iran J Med Sci Sep 48(5):448–455. https://doi.org/10.30476/ijms.2023.96017.2755 Lanz TV, Ding Z, Ho PP et al (2010) Angiotensin II sustains brain inflammation in mice via TGF-β. J Clin Invest. 2010;120(8):2782-94 https://doi.org/10.1172/JCI41709 Abiodun OA, Ola MS (2020) Role of brain renin angiotensin system in neurodegeneration: An update. Saudi J Biol Sci. 2020;27(3):905–912. https://doi.org/10.1016/j.sjbs.2020.01.026 Gebre AK, Altaye BM, Atey TM et al (2018) Targeting Renin-Angiotensin System Against Alzheimer’s disease. 2018;9:440. https://doi.org/10.3389/fphar.2018.00440 Tran S, Kuruppu S, Rajapakse NW (2022) Chronic Renin-Angiotensin System Activation Induced Neuroinflammation: Common Mechanisms Underlying Hypertension and Dementia? Journal of Alzheimers Dis. 2022;85(3):943–955 https://doi.org/10.3233/JAD-215231 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5783801","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":409136548,"identity":"bf74461a-40ff-4776-a587-2fce3d257681","order_by":0,"name":"Mariana Torri Claro¹","email":"","orcid":"","institution":"Federal University of Santa Maria","correspondingAuthor":false,"prefix":"","firstName":"Mariana","middleName":"Torri","lastName":"Claro¹","suffix":""},{"id":409136549,"identity":"12a80abc-6cd8-48b1-b795-01ffa70c76d9","order_by":1,"name":"Matheus Mülling dos Santos¹","email":"","orcid":"","institution":"Federal University of Santa Maria","correspondingAuthor":false,"prefix":"","firstName":"Matheus","middleName":"Mülling dos","lastName":"Santos¹","suffix":""},{"id":409136550,"identity":"1573d992-9408-41e1-bdbd-7c25e15c5791","order_by":2,"name":"Gabriel Teixeira de Macedo¹","email":"","orcid":"","institution":"Federal University of Santa Maria","correspondingAuthor":false,"prefix":"","firstName":"Gabriel","middleName":"Teixeira","lastName":"de Macedo¹","suffix":""},{"id":409136551,"identity":"c8717429-adef-4522-992b-32c702370ae5","order_by":3,"name":"Talise Ellwanger Müller¹","email":"","orcid":"","institution":"Federal University of Santa Maria","correspondingAuthor":false,"prefix":"","firstName":"Talise","middleName":"Ellwanger","lastName":"Müller¹","suffix":""},{"id":409136552,"identity":"31b997e0-cdea-43e0-be0d-8a98f40a97c3","order_by":4,"name":"Sabrina Antunes Ferreira¹","email":"","orcid":"","institution":"Federal University of Santa Maria","correspondingAuthor":false,"prefix":"","firstName":"Sabrina","middleName":"Antunes","lastName":"Ferreira¹","suffix":""},{"id":409136553,"identity":"c391d327-ab30-407a-9760-056c2db66201","order_by":5,"name":"Babajide Oluwaseun Ajayi","email":"","orcid":"","institution":"Ajayi Crowther University","correspondingAuthor":false,"prefix":"","firstName":"Babajide","middleName":"Oluwaseun","lastName":"Ajayi","suffix":""},{"id":409136554,"identity":"f0dd4473-a39c-494e-961e-53c2c9187aa4","order_by":6,"name":"João Batista Teixeira da Rocha¹","email":"","orcid":"","institution":"Federal University of Santa Maria","correspondingAuthor":false,"prefix":"","firstName":"João","middleName":"Batista Teixeira da","lastName":"Rocha¹","suffix":""},{"id":409136555,"identity":"e077e41f-e2bc-4ebd-b6c0-51d913801333","order_by":7,"name":"Nilda de Vargas Barbosa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYFACHgYGxgYgzd7AwAwTY8atHFkLzwGStUgkEKnFXCL34OfKHTb2/DPfGH4uqLBh4G/vTmAu3INbi+WMvGTJs2fSEmfczjGWnnEmjUHizNkNzDOe4dZicOaMgWRj2+EEhts5BtK8bYcZDCRyNzADPYZPi/FPoBZ7+ZtnjH8Tp+V4jxnIFsYNN3jMiLTleF+aZSPQLxvPpJVZ85xJ4wH55fAMfFoO8x6+2QgMMbnjhzff5qmwkeNv7934uACPFiTAYQAieUAEcRqAKeYBkQpHwSgYBaNgpAEAh65Sxi7NxW4AAAAASUVORK5CYII=","orcid":"","institution":"Federal University of Santa Maria","correspondingAuthor":true,"prefix":"","firstName":"Nilda","middleName":"de Vargas","lastName":"Barbosa","suffix":""}],"badges":[],"createdAt":"2025-01-07 19:08:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5783801/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5783801/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75406441,"identity":"97d17a0e-f09b-4e71-9499-05c0c98d4597","added_by":"auto","created_at":"2025-02-04 08:52:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":27746,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hyperglycemia on fasting blood glucose and memory retention in zebrafish. The control group (CT) was maintained without glucose for 14 days, while the glucose group (GLU) was exposed to 111mM of glucose in the water for 14 days. (A) Blood glucose levels, (B) Memory test - Control Group and (C) Memory test - Glucose group. Data were expressed as mean ± S.E.M and analyzed by unpaired t-test. Significant differences were considered when p\u0026lt;0.05 (n=9 - 18) per group.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5783801/v1/4ea7bb46125613ea38374d92.png"},{"id":75408555,"identity":"bfad7544-5639-41e3-a41e-503662169c44","added_by":"auto","created_at":"2025-02-04 09:00:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":113118,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hyperglycemia on exploratory and locomotor parameters evaluated by novel tank test. (A) Time in the top, (B) Distance traveled, (C) Entries in the top and (D) Absolute turn angle. Data were expressed as mean ± SD and analyzed by unpaired t-test. Significant differences were considered when \u003cem\u003ep\u0026lt;0.05\u003c/em\u003e (n= 16-19 per group).\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-5783801/v1/0baf8cdd186b946799c64355.png"},{"id":75406439,"identity":"605f8094-14c3-4354-9aa3-1d6ad9729354","added_by":"auto","created_at":"2025-02-04 08:52:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":100724,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hyperglycemia on anxiety-like behavior performed by light dark test. (A) Latency to entry in the dark area, (B) Time in the light area, (C) Crossings and (D) Risk assessment episodes. Data were expressed as mean ± SD and analyzed by unpaired t-test. Significant differences were considered when \u003cem\u003ep\u0026lt;0.05\u003c/em\u003e (n= 7-18 per group).\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-5783801/v1/681dfbbbea54c58c4d6727bd.png"},{"id":75406451,"identity":"17698651-d960-4d0d-9526-ab8fa7a2ce41","added_by":"auto","created_at":"2025-02-04 08:52:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":101904,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hyperglycemia on relative expression of SARS-CoV-2 infection-related genes in zebrafish brain (A) \u003cem\u003eace\u003c/em\u003e, (B) \u003cem\u003eace2\u003c/em\u003e, (C) \u003cem\u003eadam17a\u003c/em\u003e and (D) \u003cem\u003eadam17b\u003c/em\u003e. Data were expressed as mean ± S.E.M and analyzed by unpaired t-test. Significant differences were considered when \u003cem\u003ep\u0026lt;0.05 \u003c/em\u003e(n= 6 – 18 per group).\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-5783801/v1/736005a0cd99dcda0d5c7451.png"},{"id":75406452,"identity":"42043070-1010-4f46-b7c3-e01ff77b5b9b","added_by":"auto","created_at":"2025-02-04 08:52:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":45341,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hyperglycemia on relative expression of inflammatory markers in zebrafish brain. (A) \u003cem\u003eil6\u003c/em\u003e, (B) \u003cem\u003eil6r\u003c/em\u003e, (C) \u003cem\u003eil10\u003c/em\u003e, (D) \u003cem\u003eil1b\u003c/em\u003e, (E) \u003cem\u003etnfa\u003c/em\u003eand (F) \u003cem\u003erela\u003c/em\u003e. Data were expressed as mean ± S.E.M and analyzed by unpaired t-test. Significant differences were considered when \u003cem\u003ep\u0026lt;0.05 \u003c/em\u003e(n= 7 – 18 per group).\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5783801/v1/825119a7ab81d8c883eb1a61.png"},{"id":75408558,"identity":"85c6143e-6008-44da-8f8c-afa5f8f71cf2","added_by":"auto","created_at":"2025-02-04 09:00:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":538123,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hyperglycemia on Telencephalon, Cerebellum and Optic tectum Histology of Zebrafish.\u003cstrong\u003e \u003c/strong\u003eTelencephalon Control Brain (A): Normal histological features with a well-organized structure. The neuronal and glial cell populations are appropriately distributed green and yellow arrow. There is high density of synaptic connection. Glucose Brain (B): Structural disorganization evident in pallium and sub pallium regions. The neuropil is less dense, reflecting a loss of synaptic connections and reduced synaptic activity. There is a noticeable reduction in neuronal density, with several areas showing signs of neuronal loss (yellow arrow). Also, there is a marked increase in the number of glial cells, particularly astrocytes, identifiable by their small, dense, basophilic nuclei (black arrow). Mag x 400. Optic Tectum Control Brain (C): Normal histology with a well-organized laminar structure. There is characteristic cellular compositions and staining patterns. Neurons and glial cells are appropriately distributed, with no signs of abnormal morphology or density changes. The neuropil in the superficial layers displays a high density of synaptic connections, indicating active neural processing (yellow and green arrow). Glucose Brain (D):\u003cstrong\u003e S\u003c/strong\u003etratum periventricular exhibits extensive necrosis and fibrosis (yellow arrow), indicating severe damage to the neural tissue. Spongiosis and degeneration of connective tissues are present throughout the optic tectum, suggesting widespread edema and tissue breakdown (Black arrow). Large neurons and ganglion cells in the strata fibrosum et griseum superficiales zone show clear signs of detachment and necrosis (Green arrows), further indicating extensive neuronal damage. Mag x 400. Cerebellum Control Brain (E): Cerebellum with distinctive laminar organization, including the molecular layer, Purkinje cell layer, and granule cell layer (yellow and green arrow). Glucose Brain (F): There is notable neuronal loss, particularly of Purkinje and granule cells (green and yellow arrow), along with extensive reactive gliosis. The molecular layer is less dense, and there is widespread vacuolation, indicating tissue edema and synaptic loss (white arrow). Mag x 400.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5783801/v1/92571fb4e39cfc5b29ef46cb.png"},{"id":81973543,"identity":"cba02113-c99a-41d2-b74d-01212c0bc30a","added_by":"auto","created_at":"2025-05-05 13:08:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2204576,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5783801/v1/746c7ec4-c6eb-4cc9-978a-82bd4ff26fb0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Hyperglycemia induces histological abnormalities and dysregulates angiotensin-converting enzymes and inflammatory signaling in zebrafish brain: Possible relationship with memory impairment","fulltext":[{"header":"1 INTRODUCTION","content":"\u003cp\u003eThe renin-angiotensin system (RAS) is a hormonal system that regulates various bodily processes, including blood pressure, electrolyte balance, and vascular resistance [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This regulation is achieved through the modulation of vasoactive peptides, such as angiotensin I, angiotensin II, angiotensin-(1\u0026ndash;9), and angiotensin-(1\u0026ndash;7). The enzymes angiotensin-converting enzyme I (ACE) and angiotensin-converting enzyme II (ACE2) play a key role in maintaining this balance. Specifically, ACE converts angiotensin I into angiotensin II, while ACE2 acts to convert angiotensin II into angiotensin-(1\u0026ndash;7), ensuring precise control over the peptide levels in the RAS. The balance between these peptide axes has significant implications for inflammatory responses. The ACE/Ang II/AT1 receptor axis is known to activate pro-inflammatory pathways, contributing to inflammation. Conversely, the ACE2/Ang (1\u0026ndash;7)/MAS receptor axis is associated with anti-inflammatory responses. Additionally, a disintegrin and metalloproteinase 17 (ADAM17) modulates the RAS by cleaving the extracellular domain of ACE2, which leads to an increase in soluble angiotensin-converting enzyme 2 (sACE2) levels in the circulation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This complex interplay highlights the intricate regulatory mechanisms underlying the RAS and its impact on inflammation. Of note, ADAM17 also functions processing other substrates, including the cleavage and release of soluble TNF-α from the membrane-bound precursor, which serve as a proinflammatory mediator [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Currently, RAS has come into the focus of coronavirus disease 2019 (COVID-19) studies, since ACE2 is the receptor for SARSCoV-2 entry into human lung cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Patients affected by COVID-19 have different clinical courses, developing mild, moderate or severe symptoms [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The cytokine storm and the consequent hyperinflammatory state have been intimately linked with severe COVID-19, and mortality [\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. There is also the so-called long COVID or post-COVID, where adverse symptoms appear and affect patients in the long term [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Memory impairment is one of the most common disabilities in patients who have had COVID-19, condition that affects approximately 17% individuals up to 12 weeks after infection and can persist for prolonged periods [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDiabetes mellitus (DM) is one of the biggest public health problems worldwide and one of the most important risk factors for the development of vascular, cardiovascular and cognitive disorders [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Currently, DM has also been considered a risk factor for a severe course of COVID-19 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Clinical evidence shows that diabetic patients have poorer outcomes during the infection, with a significant increase in progression, severity and mortality [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Several hypotheses have already been raised, but knowledge about the shared molecular markers between the two diseases is still elusive. In this context, our study was designed to identify molecular networks in DM that could help explain how the disorder intensifies the effects of COVID-19. For that, we investigated how hyperglycemia affects the transcript levels of \u003cem\u003eace2\u003c/em\u003e and inflammatory signaling-related genes, the main pathways targeted in COVID-19. As memory impairment is a symptom that has been reported in both diseases, we investigated the learning-memory retention and histological changes in brain. Herein, we used Zebrafish as an alternative model to replicate DM-phenotypes and conduct molecular, histological and behavioral assays. Our hypothesis is that hyperglycemia-induced modulation of the RAS and inflammatory signaling pathways may exacerbate brain infection and inflammation with COVID-19. Furthermore, the neuroinflammation resulting from this modulation could contribute to memory impairments observed in both conditions.\u003c/p\u003e"},{"header":"2 MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animals and Experimental design\u003c/h2\u003e \u003cp\u003eAdult zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e), of both sexes (approximately 50:50 male-to-female ratio), and 3\u0026ndash;6 months old, were purchased from a local supplier (Santa Maria, Brazil). A total of 40 animals were used in the experiment following the recommendations of the National Institute of Health Guide for the Care and Use of Laboratory Animals (2011) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The fish were maintained in 40 L aquariums (1 fish per liter) for 15-day acclimatization period before starting the experiments. The water was treated with a water conditioner Prime\u0026trade; (1drop/2L), with constant filtration and aeration, maintained at 26\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and pH adjusted to 7.0-7.2. Illumination was provided by a 14:10 light-dark artificial photoperiod cycle (lights on at 7:00). The fish were feed with a commercial flake food (Alcon Basic\u0026trade;, Alcon, Brazil) until satiety. For the experiments, 2 groups of 20 fish were allocated in 4 L aquariums (5 fish/L). To induce hyperglycemia, the fish were maintained in 111mM of glucose solution for 14 days [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The control group was kept under similar conditions but without glucose. All the experimental protocols were approved by the Ethics Commission on Animal Use of Federal University of Santa Maria (process number: 8468271022).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Behavioral Tasks\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 Novel tank test\u003c/h2\u003e \u003cp\u003eThe Novel tank test is used to evaluate both anxiety-like phenotypes and locomotor activity in zebrafish [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. After 14 days of treatment, the animals were placed in aquariums with dimensions of 25 cm length x 15 cm height x 6 cm width. The tank was filled with 3 L dechlorinated water at a temperature of 26\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and pH adjusted to 7.0-7.2. During test, animals\u0026rsquo; behavior was recorded for a period of 6 min with a webcam connected to a laptop and subsequently the records were analyzed using Any-Maze\u0026trade; (Stoelting, CO, USA). Areas of aquarium were virtually divided in top and bottom, and parameters of time spent in the top, transitions to the top area, total distance traveled, and absolute turn angle were analyzed. A total of 40 fish were utilized in the test (n\u0026thinsp;=\u0026thinsp;20 per group).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 Light/dark test\u003c/h2\u003e \u003cp\u003eThe light/dark test was performed as a complementary assay to analyze the anxiety-like phenotypes in zebrafish [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. After treatment, each fish was placed in a tank with a dimension of 30 cm length x 15 cm height x 10 cm width and divided into equals white and black compartments. The aquarium was filled with water to a height of 8 cm, under the same conditions as the previous test. The videos were recorded for 6 min and parameters such as latency to enter in the dark area, time spent in the lit area, shuttling, and number of risk assessment episodes were assessed [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. A total of 40 fish were utilized in the test (n\u0026thinsp;=\u0026thinsp;20 per group).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Passive avoidance test\u003c/h2\u003e \u003cp\u003eThe passive avoidance test was used to assess learning and memory parameters as previously described by [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] with some modifications. First, each fish was placed in a dark apparatus (20 cm long x 10 cm wide x 15 cm high), which was divided into two compartments, one 7 cm long and the other 13 cm long, separated by a screen made of dark acrylic (10 cm wide x 15 cm high) with a circular opening measuring 3 cm in diameter. After 3 min of acclimatization, a light was turned on through a transparent window on the side of one of the compartments and the door between them was opened from above for illumination by the light beam to occur. After the fish crossed the door and went into the illuminated compartment, a glass sphere (8.5 g in mass, 1.5 cm in diameter) was dropped in front of the fish as a noxious stimulus. Each fish was then gently led into the dark compartment with a net and the gate closed and the light turned off. During 3 min intervals the process was repeated three times. Each crossing was considered a training session, and the training session was complete when three training sessions were carried out. After each training session, the crossing time was measured to 300s. To evaluate memory retention capacity, after 2h of the training session, the animals were subjected to training that consisted of reintroducing the animal into the dark compartment and evaluating the crossing time in a period of 300s. Only one test was performed without the harmful stimulus occurring.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Fasting blood glucose measurement\u003c/h2\u003e \u003cp\u003eThe animals were fasted for 24 hours to measure blood glucose. The fish were euthanized by method of hypothermia previously described by [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] to reduce possible blood glucose variations induced by chemical anesthetics [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The tail of animals was cut in the anterior portion. The blood glucose level was measured by applying a droplet of blood from the tail to a portable glucometer (G-Tech Free 1) and expressed in mg/dL.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Sample collection and storage\u003c/h2\u003e \u003cp\u003eAfter the fasting blood glucose measurement, the animals were kept on the ice and subsequently dissected as previously described by [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Brain samples were pooled (n\u0026thinsp;=\u0026thinsp;3), and immediately transferred to RNAse-free microtubes (1.5mL) on ice, then stored at -80 \u0026ordm;C for subsequent quantitative reverse transcription polymerase chain reaction (q-RT-PCR) analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Gene expression assay by quantitative reverse transcription PCR (q-RT-PCR)\u003c/h2\u003e \u003cp\u003eThe brains were homogenized with 500 \u0026micro;L of Trizol reagent (Invitrogen\u0026reg;, Brazil). The RNA extraction was performed using the Trizol method according to the manufacturer\u0026rsquo;s protocol with some modifications. After extraction, RNA quantity and quality were analyzed using a NanoDrop\u0026trade; 2000/2000c (Thermo Scientific). After quantification, the total RNA was treated with TURBO DNase (Invitrogen), and the cDNA was synthesized with Platinum \u003cem\u003eTaq\u003c/em\u003e DNA Polymerase following the manufacturer's protocol (Invitrogen). The q-RT-PCRs were carried out in 20 \u0026micro;L reaction volumes in 96-well plates, with each reaction containing 10 \u0026micro;L of cDNA as the template, 3.52 \u0026micro;L of Milli-Q water, 2\u0026micro;L of 10x PCR buffer, 1.2 \u0026micro;L 50 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.4\u0026micro;L of 10 mM dNTPs Mix, 0.4 \u0026micro;L of 10 \u0026micro;M Forward Primer, 0.4 \u0026micro;L of 10 \u0026micro;M Reverse Primer, 2\u0026micro;L of SYBR Green, and 0.08 \u0026micro;L of 2U/rxm Taq DNA Polymerase. Threshold and baselines were manually determined using the StepOne Software v2.3 (Applied Biosystems, NY) and the cycle threshold (CT) value for each sample was calculated and recorded using the formula 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Each sample was analyzed in triplicate, and the ΔCT value was obtained by subtracting the β-actin CT value from the CT value of the gene of interest. Results were expressed as relative mRNA expression. All primer sequences used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers (5\u0026rsquo; \u0026ndash; 3\u0026rsquo;).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAcession NCBI\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATGATGAATTGCCGCACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCAACCATGACACCCTGATGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_131031.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eace\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCATCTCAAATGGACGGCTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCGTGCAGGTTTTGGTAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_689244.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eace2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAACAGAGTTCCTGGCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCGTTCCAGGTGTATGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001007297.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eadam17a\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTGGATCAGTGGTGGTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATCTCTCCGCTACTGGGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_199673.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eadam17b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGACGACGAGTACGACCATCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCACATCTCTCTTGCGAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_021468637.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etnfa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACAAGATGGAAGTGTGCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCCTTGGAAGTGAAATTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_212859.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eil6r\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGGTTAAAGTTCAGTCTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAACTCCAGAAGGAGGATCTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001330258.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eil6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGGTTAAAGTTCAGTCTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCGTTAGACATCTTTCCGTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001261449.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eil10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAACTCAAGCGGGATATGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCCCTTTTCCTTCATCTTTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001020785.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003erela\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTGAAGATCTGCCGTGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCACCTCAATGTCCTCTTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_001001839.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eil1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTCATTCAACACACACTTTCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGCATGCCATCATTTCAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNM_212844.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Brain Regions Histology\u003c/h2\u003e \u003cp\u003eWhole brains from zebrafish were preserved by immersion in 10% formalin for 48 hours, and then subjected to a dehydration process involving a series of ethanol (ETOH) concentrations. The dehydration protocol included treatment with 70% ETOH for 1 hour, followed by 95% ETOH for 1 hour, and then 100% ETOH for two sequential changes, each lasting 1 hour. After dehydration, the specimens were treated with xylene for 1 hour, and with fresh xylene for an additional hour. Subsequently, the specimens were embedded in paraffin heated to 60\u0026deg;C. Once embedding was complete, the paraffin blocks were sectioned into slices of 5 \u0026micro;m thickness using a microtome. These sections were floated on a warm water bath and then placed on glass slides. To deparaffinize, sections underwent a series of washes in xylene, with two changes of xylene for 5 minutes each. This was followed by two washes in 100% ETOH for 5 minutes each, 1X wash in 95% ETOH for 5 minutes, and finally 1x wash in 70% ETOH for 5 minutes. The sections were rehydrated by rinsing in water. For staining, sections were first incubated in hematoxylin solution for 5 minutes, then rinsed in running tap water until excess hematoxylin was removed. This was followed by incubation in eosin solution for 2 minutes and a brief rinse in 95% ETOH to remove excess eosin.\u003c/p\u003e \u003cp\u003eThe sections were then dehydrated again through a graded ETOH series: 70% ETOH for 1 minute, 95% ETOH for 1 minute, and 100% ETOH for two changes, each for 1 minute. After dehydration, the sections were cleared in xylene with two changes of xylene for 2 minutes each. Finally, the sections were mounted using Dibutylphthalate Polystyrene Xylene (DPX) mounting medium and covered with a coverslip. The prepared sections were examined and photographed using Olympus IX81 inverted microscope. A semi-quantitative scoring system was used, following an ordinal approach to evaluate multiple lesion parameters. The scoring criteria were adapted from Haridevamuthu et al. (2023) and categorized as follows: ++++ for very severe histopathological alteration, +++ for severe histopathological alteration, ++ for moderate alteration, + for mild alteration, and \u0026minus;\u0026thinsp;for no alteration [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e](Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGeneral Histological Alterations caused by glucose exposure in Zebrafish Brain.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHISTOLOGICAL ALTERATIONS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eTREATMENTS\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eControl\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eGlucose\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eImmune cell Infiltration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+++\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStructural degeneration\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+++\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVacuolation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e++\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNecrosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e++++\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePyknosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+++\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Statistical analysis\u003c/h2\u003e \u003cp\u003eResults were analyzed by unpaired t-test and the data were parametric. Behavioral data of the novel tank and light dark tests were expressed by mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD and all other data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. The data were analyzed using GraphPad Prism software (San Diego, CA, USA) version 8.0. \u003cem\u003ep-\u003c/em\u003evalues\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 RESULTS","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Glucose exposure induces hyperglycemia and learning/memory impairments in zebrafish\u003c/h2\u003e \u003cp\u003eExposure of fish to 111mM glucose for 14 days induced a hyperglycemic state, increasing the fasting blood glucose levels by approximately 3-fold compared to the control group (FIG. \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eFish from the control group did not show changes in learning/memory as assessed by the passive avoidance test, since the time to across the door in the test was significantly higher than the time spent during the training section (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). In contrast, the hyperglycemic state was associated with learning/memory decline since there was no difference between the time to across the door in the test and training sections in fish from glucose group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Hyperglycemia alters the exploratory and locomotor profile of zebrafish\u003c/h2\u003e \u003cp\u003eThe analysis of novel tank test revealed that fish from glucose group had a significant decrease in both time in the top and number of entries in the top when compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and C). No alteration was observed between control and glucose groups in the parameters of distance traveled and absolute turn angle (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Hyperglycemia induces anxiety-like phenotypes in zebrafish\u003c/h2\u003e \u003cp\u003eBy light-dark analysis, we found that the hyperglycemic fish spent less time in the lit area, exhibited more risk episodes and showed greater latency to enter the dark area than the controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B, and D). The number of crossings did not differ between control and glucose groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Hyperglycemia dysregulates \u003cem\u003eace/ace2\u003c/em\u003e and inflammatory signaling in zebrafish brain\u003c/h2\u003e \u003cp\u003eIn this set, we checked the brain transcript levels of \u003cem\u003eace\u003c/em\u003e, \u003cem\u003eace2\u003c/em\u003e, \u003cem\u003eadam17\u003c/em\u003e isoforms (\u003cem\u003eadam17a\u003c/em\u003e and \u003cem\u003eadam17b\u003c/em\u003e), and some inflammatory mediators (interleukin 6: \u003cem\u003eil6\u003c/em\u003e; interleukin 6 receptor: \u003cem\u003eil6r\u003c/em\u003e; interleukin 1 beta: \u003cem\u003eil1b\u003c/em\u003e; tumor necrosis factor alpha: \u003cem\u003etnfa\u003c/em\u003e; nuclear factor NF-kappa-B: \u003cem\u003erela\u003c/em\u003e and interleukin 10: \u003cem\u003eil10\u003c/em\u003e).\u003c/p\u003e \u003cp\u003eWe found that the hyperglycemic state was associated with an upregulation of \u003cem\u003eace\u003c/em\u003e and a downregulation of \u003cem\u003eace2\u003c/em\u003e transcripts when compared to the control fish (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). There was also a significant increase in the transcript levels of gene \u003cem\u003eadam17a\u003c/em\u003e when compared to the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). No alterations were observed on transcript levels of \u003cem\u003eadam17b\u003c/em\u003e between glucose and control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Among the inflammatory mediators, we found that hyperglycemia caused a significant increase in the \u003cem\u003eil6\u003c/em\u003e, \u003cem\u003eil10\u003c/em\u003e and \u003cem\u003eil1b\u003c/em\u003e transcript levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, C and D), concomitantly with a decrease in \u003cem\u003erela\u003c/em\u003e transcripts (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). The transcript levels of genes \u003cem\u003eil6r\u003c/em\u003e and \u003cem\u003etnfa\u003c/em\u003e did not differ between control and glucose groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Hyperglycemia induces histological abnormalities in Zebrafish brain regions\u003c/h2\u003e \u003cp\u003eHerein we analyzed the histology of some Zebrafish brain regions: Telencephalon, Cerebellum and Optic tectum. Conjunctly, these structures are involved in cognitive, motor and visual processing\u003c/p\u003e \u003cp\u003eIn telencephalon of hyperglycemic fish, we observed structural disorganization in the pallium and subpallium regions, reflecting a loss of synaptic connections and reduced synaptic activity (FIG. \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). There was also a noticeable reduction in neuronal density, and a marked increase in the number of glial cells, particularly astrocytes.\u003c/p\u003e \u003cp\u003eIn the optic Tectum, the stratum periventricular of hyperglycemic fish exhibited extensive necrosis and fibrosis when compared to the control. We also found signals of spongiosis, edema and degeneration of connective tissues throughout the optic tectum, suggesting widespread neuroinflammation and necrosis (6C and 6D).\u003c/p\u003e \u003cp\u003eIn cerebellum, hyperglycemia also caused a noticeable neuronal and synaptic loss, particularly of Purkinje and granule cells, along with extensive reactive gliosis and edema (FIG. \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF).\u003c/p\u003e "},{"header":"4. DISCUSSION","content":"\u003cp\u003eIn the present study, we demonstrated that hyperglycemia influences ACE/ACE2 and inflammatory signaling in the zebrafish brain, potentially leading to neuroinflammation and memory deficits. We hypothesize that this pro-inflammatory profile may contribute to the clinical worsening of diabetic patients with COVID-19.\u003c/p\u003e\u003cp\u003eHyperinflammation is a pathological process implicated in a diverse array of diseases, ranging from infectious condition such as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to non-communicable diseases like obesity, Alzheimer's, and notably, Type 2 Diabetes Mellitus (T2DM) [\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e–\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The molecular and cellular mechanisms underlying inflammation are complex, involving a network of inducers, mediators, and signaling pathways that can be disease-specifics.\u003c/p\u003e\u003cp\u003eIn T2DM, inflammation can occur as a result of dysfunction of the immune response, production of inflammatory mediators by adipocytes and macrophages in adipose tissue, and aberrant activation of the RAS [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Herein, we investigated the molecular expression of the RAS components: ACE and ACE2. ACE/ACE2 signaling is widely expressed in various tissues, including the lungs, cardiovascular system, intestine, kidneys, central nervous system, and adipose tissue [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. A recent study by Mkhize (2022) demonstrated that diet-induced diabetes can lead to an increase in the relative expression of \u003cem\u003eace\u003c/em\u003e, \u003cem\u003eangiotensin II\u003c/em\u003e, and \u003cem\u003eangiotensin II\u003c/em\u003e type 1 receptors (AT1Rs) across various tissues, including skeletal muscle, liver, and heart [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Consistent with these findings, our result show that hyperglycemia also increases the cerebral expression of \u003cem\u003eace\u003c/em\u003e and \u003cem\u003eadam17a\u003c/em\u003e, followed by a decrease in \u003cem\u003eace2\u003c/em\u003e transcripts. This modulation may result in elevated Ang II levels, potentially exerting an inflammatory effect on cerebral tissue. In fact, chronic activation of the RAS is known to be a significant contributor to diabetic complications, primarily through the elevation of tissue Ang II, which acts as an inflammatory mediator [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePrevious studies have shown that chronic activation of the RAS and the resulting increase in angiotensin II contribute to metabolic dysregulation. Hayashi (2010) and Steckelings (2009) showed that Ang II exerts an inhibitory effect on the insulin signaling pathway, contributing to glucose dysregulation, insulin resistance, and the development of oxidative stress, endothelial damage, and fibrosis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Our research extends this understanding by demonstrating an increase in inflammatory cytokines, specifically IL-6, IL-1β, and IL-10, which are indicative of neuroinflammation. This is consistent with the notion that Ang II not only disrupts insulin signaling but also triggers an inflammatory response that could exacerbate metabolic dysfunction.\u003c/p\u003e\u003cp\u003eClinical studies have supported that T2DM and related conditions have a profound impact on neuronal and glial physiology [\u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e–\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In accordance, our histological findings showed several changes in the telencephalon, cerebellum and optic tectum of hyperglycemic fish in relation to the controls. In general, the tissue abnormalities were accompanied by pathological processes including edema, spongiosis, gliosis and necrosis.\u003c/p\u003e\u003cp\u003eIn the pallium and sub-pallium regions of the telencephalon, we identified significant structural disorganization in hyperglycemic fish. The findings also revealed a notable reduction in neuronal density, suggesting the possibility of loss of synaptic connection and synaptic activity. This observation is consistent with previous research indicating that hyperglycemia can lead to neurodegenerative changes across various models. Baker et al. (2012) reported that chronic hyperglycemic conditions are associated with increased oxidative stress and inflammation, detrimental to synaptic integrity and neuronal viability [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Additionally, our study elucidates the detrimental effects of hyperglycemic environments on neuronal integrity, particularly highlighting notable neuronal loss in cerebellar Purkinje and granule cells. These findings align with Sonneville et al. (2012), who emphasized the vulnerability of cerebellar neurons to metabolic disturbances, reinforcing the idea that hyperglycemia significantly impacts neuronal health [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Furthermore, we observed extensive necrosis and fibrosis in the optic tectum, alongside indications of spongiosis, edema, and degeneration of connective tissues. These findings point to a significant neuroinflammatory response, which aligns with the results reported by Chen et al. (2018)[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Their study documented similar patterns of necrosis and gliosis under hyperglycemic conditions, suggesting that hyperglycemia disrupts neuronal architecture and induces a widespread inflammatory response. Moreover, the presence of necrosis and gliosis suggests that reactive glial cells respond to neuronal injury, potentially amplifying inflammatory signals and contributing to tissue degeneration. Collectively, our histological results reinforce the notion that hyperglycemia leads to significant neuroinflammation, which may have profound implications for the integrity and function of the nervous system. As telencephalon, cerebellum and optic tectum control a wide range of brain activities, hyperglycemia may affect visual processing, spatial navigation, sensorimotor integration, and motor and cognitive functions.\u003c/p\u003e\u003cp\u003eCognitive dysfunction is a common aggravating factor resulting from T2DM. Insulin resistance, along with alteration in glucose uptake and utilization are pathological features highlighted in clinical studies that have shown an increased risk of dementia among T2DM patients [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Additionally, diabetes has been linked to high incidence of mood disorders such as depression and anxiety [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. These phenotypes have also been replicated in animal models of experimental diabetes. In zebrafish, hyperglycemia disrupts brain insulin signaling, leading to anxiety-like behavior and memory impairment [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In agreement, our study demonstrated that the hyperglycemic state induced anxiety-like behavior and memory deficits in zebrafish. Notably, we observed cell changes and an imbalance in brain \u003cem\u003eace/ace2\u003c/em\u003e and cytokine transcripts. We hypothesize that these molecular and cellular disturbances contribute to memory loss through subsequent neuroinflammation. Supporting this hypothesis, evidence suggests that the excessive activation of the ACE/Ang II/AT-1R axis promotes neurodegeneration in several brain disorders by increasing apoptosis and neuroinflammation [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In addition, our findings contribute to the growing body of literature highlighting the role of the ACE/Ang II/AT1 axis in neurodegenerative processes associated with Alzheimer’s disease. The overactivation of this pathway has been identified as a key factor in amyloid-β (\u003cem\u003eAβ)\u003c/em\u003e-induced neurodegeneration and apoptosis [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] facilitating also the Aβ deposition in both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e settings. Additionally, chronic activation of this axis has been associated with upregulation of pro-inflammatory mediators, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and transforming growth factor (TGF)-β have been reported in brain tissue from patients with vascular dementia and animal models of vascular dementia [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eGiven the current global health crisis posed by COVID-19, our study's molecular endpoints also bear significant implications in this context. The recent identification of ACE2 as the primary receptor for SARS-CoV-2 infection suggests that alterations in the ACE/ACE2 balance may play a critical role in the severity of COVID-19 symptoms. The phenomenon of the “cytokine storm,” characterized by an exaggerated inflammatory response, is particularly relevant, as it has been associated with severe complications in COVID-19 patients. Based on our findings, we hypothesize that diabetes, an established risk factor for adverse COVID-19 outcomes, could interact with these mechanisms in several ways. First, the dysregulation of the ACE/ACE2 pathway and the subsequent increase in pro-inflammatory cytokines could exacerbate the inflammatory response, amplifying the cytokine storm that is critical in severe COVID-19 cases. Second, cognitive deficits associated with hyperglycemia may worsen the cognitive impairments reported in patients experiencing long COVID, suggesting a compounding effect on neurocognitive health.\u003c/p\u003e"},{"header":"5. CONCLUSION","content":"\u003cp\u003eOverall, this study provided a deeper understanding of how hyperglycemia induces significant alterations in the behavioral and cognitive functions of adult zebrafish. Furthermore, hyperglycemic conditions demonstrated a correlation with the dysregulation of important components of the RAS and with an increase in inflammatory markers, suggesting a potential neuroinflammatory pathway that may underlie the observed neurodegenerative effects in the brain. The results obtained in this study evidence that hyperglycemia induces behavioral deficits through the dysregulation of the signaling of angiotensin-converting enzymes, which play critical roles in the pathophysiology of COVID-19. Such dysregulation can exacerbate the inflammatory process and contribute to the neurological complications associated with the virus, concomitantly with the upregulation of pro-inflammatory genes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMariana Torri Claro:\u003c/strong\u003e Methodology, Validation, Formal analysis, Investigation, Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003eMatheus M\u0026uuml;lling dos Santos:\u0026nbsp;\u003c/strong\u003eValidation, Investigation, Methodology, Writing \u0026ndash; review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003eGabriel Teixeira de Macedo:\u0026nbsp;\u003c/strong\u003eValidation, Investigation, Methodology, Writing \u0026ndash; review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003eTalise Ellwanger M\u0026uuml;ller:\u0026nbsp;\u003c/strong\u003eValidation, Investigation, Methodology, Writing \u0026ndash; review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003eSabrina Antunes Ferreira:\u0026nbsp;\u003c/strong\u003eValidation, Investigation, Methodology, Writing \u0026ndash; review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003eBabajide Oluwaseun Ajayi:\u0026nbsp;\u003c/strong\u003eValidation, Investigation, Methodology, Writing \u0026ndash; review \u0026amp; editing.\u003cstrong\u003e\u0026nbsp;Jo\u0026atilde;o Batista Teixeira da Rocha\u003c/strong\u003e:\u0026nbsp;Validation, Investigation, Writing \u0026ndash; review \u0026amp; editing.\u003cstrong\u003e\u0026nbsp;Nilda Vargas Barbosa\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Validation, Investigation, Writing \u0026ndash; review \u0026amp; editing, Supervision, Project administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was financially supported by the Coordena\u0026ccedil;\u0026atilde;o de Aperfei\u0026ccedil;oamento de Pessoal de N\u0026iacute;vel Superior (CAPES), Conselho Nacional de Desenvolvimento Cient\u0026iacute;fico e Tecnol\u0026oacute;gico (CNPq).\u0026nbsp;N.V.B. and J.T.R. are the recipients of CNPq fellowships. CAPES (grant number: CAPES EPIDEMIAS 09 PROC.88887.505377/2020).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with Ethical Standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the experimental\u0026nbsp;protocols were approved by the Ethics Commission on Animal Use of Federal University of Santa Maria (process number: 8468271022).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode Availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eVerano-Braga T, Martins ALV, Motta-Santos D et al (2020) ACE2 in the renin-angiotensin system. Clin Sci (Lond). 2020;134(23):3063\u0026ndash;3078. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/CS20200478\u003c/span\u003e\u003cspan address=\"10.1042/CS20200478\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang S, Yang H, Sun Z et al (2023) The basis of complications in the context of SARS-CoV-2 infection: Pathological activation of ADAM17. Biochem Biophys Res Commun. 2023;679:37\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbrc.2023.08.063\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2023.08.063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZipeto D, Palmeira J, da Arga\u0026ntilde;araz F, Arga\u0026ntilde;araz GA (2020) ER ACE2/ADAM17/TMPRSS2 Interplay May Be the Main Risk Factor for COVID-19. Front Immunol. 2020;11:576745. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2020.576745\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2020.576745\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZlack\u0026aacute; J, Stebelov\u0026aacute; K, Zeman M, Herichov\u0026aacute; I (2021) Interactions of Renin-Angiotensin System and COVID-19: The Importance of Daily Rhythms in ACE2, ADAM17 and TMPRSS2 Expression. Physiol Res 70:S177\u0026ndash;S194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.33549/physiolres.934754\u003c/span\u003e\u003cspan address=\"10.33549/physiolres.934754\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGheblawi M, Wang K, Viveiros A et al (2020) Angiotensin-Converting Enzyme 2: SARS-CoV-2 Receptor and Regulator of the Renin-Angiotensin System: Celebrating the 20th Anniversary of the Discovery of ACE2. Circ Res. 2020;126(10):1456\u0026ndash;1474. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCRESAHA.120.317015\u003c/span\u003e\u003cspan address=\"10.1161/CIRCRESAHA.120.317015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Q, Xiang R, Huo S et al (2021) Molecular mechanism of interaction between SARS-CoV-2 and host cells and interventional therapy. Signal Transduct Target Ther. 2021;6(1):233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41392-021-00653-w\u003c/span\u003e\u003cspan address=\"10.1038/s41392-021-00653-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrook H, Raza S, Nowell J et al (2021) Long covid - Mechanisms, risk factors, and management. BMJ. 2021;374:n1648. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/bmj.n1648\u003c/span\u003e\u003cspan address=\"10.1136/bmj.n1648\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehandru S, Merad M (2022) Pathological sequelae of long-haul COVID. Nat Immunol. 2022;23(2):194\u0026ndash;202. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41590-021-01104-y\u003c/span\u003e\u003cspan address=\"10.1038/s41590-021-01104-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePignalosa FC, Desiderio A, Mirra P et al (2021) Diabetes and cognitive impairment: A role for glucotoxicity and dopaminergic dysfunction. Int J Mol Sci. 2021;22(22):12366. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms222212366\u003c/span\u003e\u003cspan address=\"10.3390/ijms222212366\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEhtewish H, Arredouani A, El-Agnaf O (2022) Diagnostic, Prognostic, and Mechanistic Biomarkers of Diabetes Mellitus-Associated Cognitive Decline. Int J Mol Sci. 2022;23(11):6144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms23116144\u003c/span\u003e\u003cspan address=\"10.3390/ijms23116144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarapan BN, Yoo HJ (2021) Neurological symptoms, manifestations, and complications associated with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and coronavirus disease 19 (COVID-19). J Neurol. 2021;268(9):3059\u0026ndash;3071. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00415-021-10406-y\u003c/span\u003e\u003cspan address=\"10.1007/s00415-021-10406-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahboubi Mehrabani M, Karvandi MS, Maafi P, Doroudian M (2022) Neurological complications associated with Covid-19; molecular mechanisms and therapeutic approaches. Rev Med Virol. 2022;32(6):e2334. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/rmv.2334\u003c/span\u003e\u003cspan address=\"10.1002/rmv.2334\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCeban F, Ling S, Lui LMW et al (2022) Fatigue and cognitive impairment in Post-COVID-19 Syndrome: A systematic review and meta-analysis. Brain Behav Immun. 2022;101:93\u0026ndash;135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbi.2021.12.020\u003c/span\u003e\u003cspan address=\"10.1016/j.bbi.2021.12.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGraham EL, Clark JR, Orban ZS et al (2021) Persistent neurologic symptoms and cognitive dysfunction in non-hospitalized Covid-19 long haulers. Ann Clin Transl Neurol. 2021;8(5):1073\u0026ndash;1085. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/acn3.51350\u003c/span\u003e\u003cspan address=\"10.1002/acn3.51350\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026ouml;ller M, Borg K, Janson C et al (2023) Cognitive dysfunction in post-COVID-19 condition: Mechanisms, management, and rehabilitation. J Intern Med. 2023;294(5):563\u0026ndash;581. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/joim.13720\u003c/span\u003e\u003cspan address=\"10.1111/joim.13720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Zhang Y, Wen Z et al (2023) Cognitive dysfunction in diabetes: abnormal glucose metabolic regulation in the brain. Front Endocrinol (Lausanne). 2023;14:1192602. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fendo.2023.1192602\u003c/span\u003e\u003cspan address=\"10.3389/fendo.2023.1192602\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiessels GJ, Strachan MWJ, Visseren FLJ et al (2014) Dementia and cognitive decline in type 2 diabetes and prediabetic stages: Towards targeted interventions. Lancet Diabetes Endocrinol. 2014;2(3):246\u0026thinsp;\u0026ndash;\u0026thinsp;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S2213-8587(13)70088-3\u003c/span\u003e\u003cspan address=\"10.1016/S2213-8587(13)70088-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChourasia P, Goyal L, Kansal D et al (2023) Risk of New-Onset Diabetes Mellitus as a Post-COVID-19 Condition and Possible Mechanisms: A Scoping Review. J Clin Med. 2023;12(3):1159. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jcm12031159\u003c/span\u003e\u003cspan address=\"10.3390/jcm12031159\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIlic I, Ilic M (2023) Diabetes Mellitus after SARS-CoV-2 Infection: An Epidemiological Review. Life (Basel). 2023;13(6):1233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/life13061233\u003c/span\u003e\u003cspan address=\"10.3390/life13061233\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKastora S, Patel M, Carter B et al (2022) Impact of diabetes on COVID-19 mortality and hospital outcomes from a global perspective: An umbrella systematic review and meta-analysis. Endocrinol Diabetes Metab. 2022;5(3):e00338. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/edm2.338\u003c/span\u003e\u003cspan address=\"10.1002/edm2.338\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHubrecht R, Use of Laboratory Animals (2011) Guide for the Care and Use of Laboratory Animals, Eighth Edition 2011 The Committee for the Update of the Guide for the Care and (2011). Published by the National Research Council of the National Academies, Washington DC, USA. Animal Welfare 20:455\u0026ndash;456. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0962728600003067\u003c/span\u003e\u003cspan address=\"10.1017/S0962728600003067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCapiotti KM, De Moraes DA, Menezes FP et al (2014) Hyperglycemia induces memory impairment linked to increased acetylcholinesterase activity in zebrafish (Danio rerio). Behav Brain Res Nov. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2014.08.033\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2014.08.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 1;274:319\u0026thinsp;\u0026ndash;\u0026thinsp;25\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003edos Santos MM, de Macedo GT, Prestes AS et al (2018) Hyperglycemia elicits anxiety-like behaviors in zebrafish: Protective role of dietary diphenyl diselenide. Prog Neuropsychopharmacol Biol Psychiatry Jul 1385:128\u0026ndash;135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pnpbp.2018.04.017\u003c/span\u003e\u003cspan address=\"10.1016/j.pnpbp.2018.04.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEgan RJ, Bergner CL, Hart PC et al (2009) Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav Brain Res. 2009;205(1):38\u0026ndash;44 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2009.06.022\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2009.06.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaximino C, de Brito TM, da Silva Batista AW et al (2010) Measuring anxiety in zebrafish: A critical review. Behav Brain Res. 2010;214(2):157\u0026thinsp;\u0026ndash;\u0026thinsp;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2010.05.031\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2010.05.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaximino C, de Brito TM, Colmanetti R et al (2010) Parametric analyses of anxiety in zebrafish scototaxis. Behav Brain Res. 2010;210(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2010.01.031\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2010.01.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaximino C, Araujo J, Le\u0026atilde;o LKR et al (2011) Possible role of serotoninergic system in the neurobehavioral impairment induced by acute methylmercury exposure in zebrafish (Danio rerio). Neurotoxicol Teratol. 2011 Nov-Dec;33(6):727\u0026thinsp;\u0026ndash;\u0026thinsp;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ntt.2011.08.006\u003c/span\u003e\u003cspan address=\"10.1016/j.ntt.2011.08.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee Y, Lee S, Park JW et al (2018) Hypoxia-Induced Neuroinflammation and Learning\u0026ndash;Memory Impairments in Adult Zebrafish Are Suppressed by Glucosamine. Mol Neurobiol. 2018;55(11):8738\u0026ndash;8753. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-018-1017-9\u003c/span\u003e\u003cspan address=\"10.1007/s12035-018-1017-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilson JM, Bunte RM, Carty AJ (2009) Evaluation of rapid cooling and tricaine methanesulfonate (MS222) as methods of euthanasia in zebrafish (Danio rerio). J Am Assoc Lab Anim Sci. 2009;48(6):785-9 PMID: 19930828\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEames SC, Philipson LH, Prince VE, Kinkel MD (2010) Blood Sugar Measurement in Zebrafish Reveals Dynamics of Glucose Homeostasis. Zebrafish. 2010;7(2):205\u0026thinsp;\u0026ndash;\u0026thinsp;13 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/zeb.2009.0640\u003c/span\u003e\u003cspan address=\"10.1089/zeb.2009.0640\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta T, Mullins MC (2010) Dissection of Organs from the Adult Zebrafish. 2010;(37):1717 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3791/1717\u003c/span\u003e\u003cspan address=\"10.3791/1717\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmittgen TD, Livak KJ (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaridevamuthu B, Raj D, Kesavan D et al (2023) Trihydroxy piperlongumine protects aluminium induced neurotoxicity in zebrafish: Behavioral and biochemical approach. Comp Biochem Physiol C Toxicol Pharmacol. 2023;268:109600 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cbpc.2023.109600\u003c/span\u003e\u003cspan address=\"10.1016/j.cbpc.2023.109600\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorris G, Bortolasci CC, Puri BK et al (2021) The cytokine storms of COVID-19, H1N1 influenza, CRS and MAS compared. Can one sized treatment fit all? Comp Biochem Physiol C Toxicol Pharmacol. 2023;268:109600 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cyto.2021.155593\u003c/span\u003e\u003cspan address=\"10.1016/j.cyto.2021.155593\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHotamisligil GS (2017) Inflammation, metaflammation and immunometabolic disorders. Nature. 2017;542(7640):177\u0026ndash;185 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature21363\u003c/span\u003e\u003cspan address=\"10.1038/nature21363\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDansokho C, Heneka MT (2018) Neuroinflammatory responses in Alzheimer\u0026rsquo;s disease 2018;125(5):771\u0026ndash;779 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00702-017-1831-7\u003c/span\u003e\u003cspan address=\"10.1007/s00702-017-1831-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZatterale F, Longo M, Naderi J et al (2020) Chronic Adipose Tissue Inflammation Linking Obesity to Insulin Resistance and Type 2 Diabetes. Front Physiol. 2020;10:1607 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2019.01607\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2019.01607\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee DK, Kim T, Byeon J et al (2022) REDD1 promotes obesity-induced metabolic dysfunction via atypical NF-κB activation. Nat Commun. 2022;13(1):6303 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-022-34110-1\u003c/span\u003e\u003cspan address=\"10.1038/s41467-022-34110-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBourgonje AR, Abdulle AE, Timens W et al (2020) Angiotensin-converting enzyme 2 (ACE2), SARS-CoV-2 and the pathophysiology of coronavirus disease 2019 (COVID-19). J Pathol. 2020;251(3):228\u0026ndash;248. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/path.5471\u003c/span\u003e\u003cspan address=\"10.1002/path.5471\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMkhize BC, Mosili P, Ngubane PS et al (2022) Diet-induced prediabetes: Effects on the activity of the renin\u0026ndash;angiotensin\u0026ndash;aldosterone system in selected organs. J Diabetes Investig. 2022;13(5):768\u0026ndash;780 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jdi.13690\u003c/span\u003e\u003cspan address=\"10.1111/jdi.13690\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCooper ME (2004) The role of the renin-angiotensin-aldosterone system in diabetes and its vascular complications. Am J Hypertens. 2004;17(11 Pt 2):16S-20S \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.amjhyper.2004.08.004\u003c/span\u003e\u003cspan address=\"10.1016/j.amjhyper.2004.08.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTikellis C, Thomas MC (2012) Angiotensin-converting enzyme 2 (ACE2) is a key modulator of the renin angiotensin system in health and disease. Int J Pept. 2012;2012:256294 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2012/256294\u003c/span\u003e\u003cspan address=\"10.1155/2012/256294\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayashi T, Takai S, Yamashita C (2010) Impact of the Renin-Angiotensin-Aldosterone-System on Cardiovascular and Renal Complications in Diabetes Mellitus. Curr Vasc Pharmacol. 2010;8(2):189\u0026thinsp;\u0026ndash;\u0026thinsp;97 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/157016110790886947\u003c/span\u003e\u003cspan address=\"10.2174/157016110790886947\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteckelings UM, Rompe F, Kaschina E, Unger T (2009) The evolving story of the RAAS in hypertension, diabetes and CV disease - Moving from macrovascular to microvascular targets. Fundam Clin Pharmacol. 2009;23(6):693\u0026ndash;703 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1472-8206.2009.00780.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1472-8206.2009.00780.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargas-Soria M, Garc\u0026iacute;a-Alloza M, Corraliza-G\u0026oacute;mez M (2023) Effects of diabetes on microglial physiology: a systematic review of in vitro, preclinical and clinical studies. J Neuroinflammation. 2023;20(1):57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12974-023-02740-x\u003c/span\u003e\u003cspan address=\"10.1186/s12974-023-02740-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSims-Robinson C, Kim B, Rosko A, Feldman EL (2010) How does diabetes accelerate Alzheimer disease pathology? Nat Rev Neurol. 2010;6(10):551-9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrneurol.2010.130\u003c/span\u003e\u003cspan address=\"10.1038/nrneurol.2010.130\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiessels GJ, Despa F (2018) Cognitive decline and dementia in diabetes mellitus: mechanisms and clinical implications. Nat Rev Endocrinol. 2018;14(10):591\u0026ndash;604. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41574-018-0048-7\u003c/span\u003e\u003cspan address=\"10.1038/s41574-018-0048-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaker SA, Kwok S, Berry GJ, Montine TJ (2021) Angiotensin-converting enzyme 2 (ACE2) expression increases with age in patients requiring mechanical ventilation. PLoS One. 2021;16(2):e0247060 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0247060\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0247060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSonneville R, Den Hertog HM, G\u0026uuml;iza F et al (2012) Impact of hyperglycemia on neuropathological alterations during critical illness. J Clin Endocrinol Metab. 2012;97(6):2113-23 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/jc.2011-2971\u003c/span\u003e\u003cspan address=\"10.1210/jc.2011-2971\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Deng H, Cui H et al (2018) Inflammatory responses and inflammation-associated diseases in organs. Oncotarget. 2017;9(6):7204\u0026ndash;7218. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/oncotarget.23208\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.23208\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePelle MC, Zaffina I, Giofr\u0026egrave; F et al (2023) Potential Role of Glucagon-like Peptide-1 Receptor Agonists in the Treatment of Cognitive Decline and Dementia in Diabetes Mellitus. Int J Mol Sci. 2023;24(14):11301 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms241411301\u003c/span\u003e\u003cspan address=\"10.3390/ijms241411301\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShinalieva K, Kasenova A, Akhmetzhanova Z et al (2023) Association of Insomnia with Anxiety and Depression in Type 2 Diabetic Patients: A Cross-Sectional Study. Iran J Med Sci Sep 48(5):448\u0026ndash;455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.30476/ijms.2023.96017.2755\u003c/span\u003e\u003cspan address=\"10.30476/ijms.2023.96017.2755\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLanz TV, Ding Z, Ho PP et al (2010) Angiotensin II sustains brain inflammation in mice via TGF-β. J Clin Invest. 2010;120(8):2782-94 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/JCI41709\u003c/span\u003e\u003cspan address=\"10.1172/JCI41709\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbiodun OA, Ola MS (2020) Role of brain renin angiotensin system in neurodegeneration: An update. Saudi J Biol Sci. 2020;27(3):905\u0026ndash;912. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.sjbs.2020.01.026\u003c/span\u003e\u003cspan address=\"10.1016/j.sjbs.2020.01.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGebre AK, Altaye BM, Atey TM et al (2018) Targeting Renin-Angiotensin System Against Alzheimer\u0026rsquo;s disease. 2018;9:440. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2018.00440\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2018.00440\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran S, Kuruppu S, Rajapakse NW (2022) Chronic Renin-Angiotensin System Activation Induced Neuroinflammation: Common Mechanisms Underlying Hypertension and Dementia? Journal of Alzheimers Dis. 2022;85(3):943\u0026ndash;955 \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3233/JAD-215231\u003c/span\u003e\u003cspan address=\"10.3233/JAD-215231\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hyperglycemia, Memory, Zebrafish, Neuroinflammation, Angiotensin-converting-enzymes","lastPublishedDoi":"10.21203/rs.3.rs-5783801/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5783801/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDysregulation of renin-angiotensin system (RAS), through the actions of angiotensin-converting enzymes significantly impacts inflammatory responses. Recent studies have demonstrated the relevance of RAS in Coronavirus Disease 2019 (COVID-19), where outcomes worsen in diabetic patients. We investigate the effects of hyperglycemia on RAS components and inflammatory gene expression in adult zebrafish brain. Hyperglycemia was induced by exposing zebrafish to a 111 mM glucose solution for 14 days. Behavioral tasks were conducted to evaluate learning/memory and anxiety-like behavior. After fasting, blood glucose levels were measured, and brain collected for histological and q-RT-PCR analyses. Exposure to glucose resulted in a significant hyperglycemic state, inducing anxiety-like phenotypes and impairing learning and memory. These alterations were followed by an upregulation of \u003cem\u003eace\u003c/em\u003e and a downregulation of \u003cem\u003eace2\u003c/em\u003e brain transcripts. Additionally, there was an increase in the transcript levels of the gene \u003cem\u003eadam17a.\u003c/em\u003e Furthermore, hyperglycemia increased the transcript levels of \u003cem\u003eil-6, il-10\u003c/em\u003e, and \u003cem\u003eil-1β\u003c/em\u003e, along with a decrease in \u003cem\u003erela\u003c/em\u003e transcripts. Several histological abnormalities were found in the telencephalon, cerebellum and optic tectum of hyperglycemic fish, including neuronal and synaptic loss, gliosis, edema and necrosis. Collectively, our results demonstrate that hyperglycemia significantly disrupts behavioral and cognitive functions in adult zebrafish. These conditions correlate with dysregulated expression of critical components of RAS and inflammatory markers, suggesting a potential neuroinflammatory pathway that may underlie the observed neurodegenerative effects in brain. The dysregulation of angiotensin-converting enzymes signaling, which play critical roles in the pathophysiology of COVID-19, may exacerbate inflammation and contribute to the neurological complications associated with the disease.\u003c/p\u003e","manuscriptTitle":"Hyperglycemia induces histological abnormalities and dysregulates angiotensin-converting enzymes and inflammatory signaling in zebrafish brain: Possible relationship with memory impairment","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-04 08:52:17","doi":"10.21203/rs.3.rs-5783801/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6620083c-c5c9-4886-829d-9cf5bb2020fb","owner":[],"postedDate":"February 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-05T13:08:17+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-04 08:52:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5783801","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5783801","identity":"rs-5783801","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}