Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway

Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway Xuchen Qi, Xiaobing Zhang, Xian Shao, Qingquan Bao, Lingyan He This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4116136/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Oct, 2024 Read the published version in Cancer Gene Therapy → Version 1 posted 10 You are reading this latest preprint version Abstract Patients with glioblastoma (GBM) have poor prognoses and limited therapeutic options. LGR4 was reported to overexpressed in GBM and involved in tumorigenesis of many cancers, Baicalein (BAI) is a kind of flavonoid that exhibited anti-tumor effects in various tumors. However, the function and association of BAI and LGR4 in GBM are still unclear. In thisi study, firstly, GEPIA and HPA databas was used to perform expression and survival analysis of LGR4 in GBM patients. Then, the significance of LGR4-EGFR in GBM cells (HS683 and KNS89) and GBM animal models was explored by RNA interference and subcutaneous transplantation. Additionally, GBM cells were treated with BAI to explore the role and mechanism of BAI involved in GBM. The results showed that LGR4 was highly expressed in GBM and related to bad prognosis. LGR4 knockdown obviously repressed the proliferation and EGFR expression but induced apoptosis in GBM cells, however, the situations were reserved by EGFR overexpression and CBL knockdown. In contrast, both in vitro and in vivo experiments revealed LGR4 overexpression facilitated GBM cellular biological activities and promoted tumor development, but the effects were rescued by BAI and EGFR inhibitor. In addition, si-LGR4 accelerated EGFR protein degradation while oe-LGR4 exhibit opposite effect. Without affecting normal cellular viability, BAI inhibited malignant behaviour, interacted with LGR4 and blocked the LGR4-EGFR pathway in both GBM cells. Taken together, our data suggested that BAI could inhibit GBM cell proliferation and induce apoptosis via downregulation of the LGR4-EGFR pathway, and the LGR4-EGFR pathway may be an underlying target for GBM therapy of BAI. Health sciences/Diseases/Cancer/Cancer therapy/Drug development Health sciences/Diseases/Cancer/Cancer genetics Baicalein glioblastoma LGR4-EGFR pathway cell proliferation apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Glioblastoma (GBM) is the most common intracranial tumor with high mortality[ 1 ]. In spite of intensive efforts, the therapeutic options for GBM are still limited, and the mean survival time for patients is less than 2 years following diagnosis[ 2 ]. Similar to the majority of cancers, the high death rate of GBM results from GBM cells possessing the features of indefinite proliferation, dysregulated apoptosis, and infiltration into adjacent tissues frequently[ 3 ]. GBM remains fatal, even though GBM patients were treated with aggressive management of surgery, radio and chemotherapy[ 4 ]. Therefore, other potential methods for treating GBM are desperately needed. LGR4, also known as GPR48, has been found to be highly expressed in many cancer tissues, including glioma tissues[ 5 ]. EGFR expression level always contributes to cancer development and worse prognosis[ 6 ]. Many functions of cancer stem cell (CSC) rely on EGFR, for example, stemness, metabolism, immunomodulatory activity, dormancy, and resistance to therapy[ 7 ]. Mechanistically, LGR4 can interact with EGFR, block the degradation and ubiquitination of EGFR, thereby leading to the persistent activating of EGFR[ 8 ]. A published study suggested that LGR4/EGFR pathway in hepatocellular carcinoma (HCC) facilitates tumor development and contributes to maintaining the features of stem cells[ 7 ]. In addition, evidence exhibited by previous research suggested that the LGR4-EGFR pathway can be used for a novel therapeutic target for breast cancer (BC), and deactivating the LGR4-EGFR pathway can inhibit the metastasis of BC cells[ 8 ]. Nevertheless, there is still no clear evidence for the role of LGR4 on GBM via regulating EGFR. Baicalein (BAI) is the principal flavonoid isolated from S.baicalensis , which possesses numerous beneficial properties and is always utilized for treating multiple ailments[ 9 ]. Recent research has revealed that BAI exerts its anticancer activity by facilitating apoptosis, blocking cell growth, activating autophagy and regulating some molecular pathways, such as EGFR/ERK/NF-κβ pathway[ 10 ] or EGFR/ERK/Akt pathway[ 11 ]. Moreover, scholars overlapped BAI targets with oral squamous cell carcinoma-associated genes, EGFR belongs to the top 10 genes with high centrality measures[ 12 ]. However, the specific role and mechanism of BAI on GBM are still not clear. Therefore, in this research, we conducted in vitro and in vivo experiments to explore whether BAI can exert its protective role against GBM by downregulating the LGR4-EGFR pathway, thus providing a novel strategy for treating GBM. 2. Materials and methods 2.1 LGR4 expression analysis Gene Expression Profiling Interactive Analysis (GEPIA) and Human Protein Atlas (HPA) database were applied for public data analysis (the website of GEPIA is http://gepia.cancer-pku.cn/ and the website of HPA is https://www.proteinatlas.org/ ). LGR4 expression in the tumor tissues of brain lower grade glioma was compared to that in TCGA and GTEx. In addition, GEPIA was also used to calculate the overall survival of brain lower grade glioma patients based on LGR4 expression. Furthermore, HPA exhibited the expression of LGR4 in the brain tissues of patients with or without GBM. 2.2 Cell culture and transfection GBM cell lines (U-251 MG, A172, HS683, KNS89, U-87 MG, U-118 MG) were supplied by Sai Baikang Biotechnology (China), and human astrocytes (SVGP12) were obtained from ATCC (USA). In addition, mouse astrocytes used in the study were extracted from the mouse as described previously[ 13 ]. All cells were cultured in dulbecco's modified eagle medium medium containing 10% fetal bovine serum (FBS) at 37℃ in a CO 2 - and humidity-controlled incubator. For cell transfection, small interfering RNA (siRNA) targeting human LGR4 and CBL (si-LGR4 and si-CBL), overexpression vector of LGR4 and EGFR (oe-LGR4 and oe-EGFR) as well as respective negative controls (si-NC and vector) were synthesized by Shanghai Jima Pharmaceutical Technology Company Limited (China). All cells were transfected with Lipofectamine 3000, and harvested 48 h after transfection. 2.3 CCK-8 assay Cellular viability was evaluated with CCK-8 Assay Kit (C0039, Biyuntian, China). In short, cells were seeded and cultured with or without BAI in 96-well plates. Upon incubation for a predetermined time, CCK-8 solution (10 µL) was added into each well and culture for another 4 h. Thereafter, absorbance at 450 nm was tested using a microplate reader (CMaxPlus, MD, USA). 2.4 Counting the number of cells The cells were grown in medium with 0, 20, 40 and 80 µM of BAI at 37℃ in a CO 2 - and humidity-controlled incubator. After 48 h, the medium was removed and photographed by a light microscope to count the number of cells. In addition, clone formation assay were conducted to evaluated proliferation ability of the cells. In short, cells were seeded in 6-well plates containing or not containing BAI. Every 3 days, the media was replaced. Following 2 weeks of culture, cells were rinsed by phosphate buffer saline (PBS), fixed with paraformaldehyde, and stained by crystal violet. Then, the images of the wells were scanned and the number of colonies was calculated to assess the ability of cellular proliferation. Colonies containing 50 or more cells were considered a clone. 2.5 5-ethynyl-20-deoxyuridine (EdU) assay Cell proliferation was detected by adopting EdU cell proliferation kit (C0078s, Biyuntian, China). Briefly, cells were seeded into a 12-well plate. Following treatment, EdU was applied to incubate the cells for 4 h. Then, cells were fixed by 95% ethanol and infiltrated in 0.3% TritonX-100. Subsequently, the cells reacted with 0.5 mL of Click reaction mixture and 1 mL of 4',6-diamidino-2-phenylindole (DAPI), both reactions were conducted under a light-shielding environment. Finally, the staining results were visualized with a fluorescence microscope. 2.6 Apoptosis detection Cells were seeded in 6-well plates, and cultured with or without BAI for suitable times. Then, cells were collected, rinsed using ice-cold PBS twice and centrifuged to obtain cell suspension. Thereafter, cells were stained with 5 µL Annexin V-FITC and 10 µL PI at room temperature (RT) in darkness (556547, BD, Singapore). In the end, the apoptosis rate of the cell was determined with the help of flow cytometry (NovoCyte, Agilent, China) within 1 h. 2.7 Transwell assay Cell invasion as well as migration were assessed by Transwell assay. For invasion assay, cells in serum-free media were added to the upper chamber pre-coated with matrigel (356234, BD, USA) after treatment. Medium containing 10% FBS was loaded into the bottom chamber. After incubation for 24 h, the cells invading to the bottom chamber were fixed by formaldehyde, dyed with crystal violet and calculated under the microscope. For the migration assay, all the steps were the same as those conducted in the invasion assay except that matrigel was not used in the upper chamber. 2.8 RNA extraction and quantitative PCR (qPCR) After treatment, the total RNA of the cell lines was extracted using EZ-10 Total RNA Miniprep Kit (B618583-0100, Sangon Biotech, China), and transcribed to cDNA reversely by Reverse Transcription Kit (CW2569, CWBio Co., Ltd., China). To quantify the expression of target genes, quantitative PCR was carried out with a SYBR Green qPCR kit (11201ES08, Yeasen, China) and specific primers. All the primer sequences used in the research were presented in Table 1 . Table 1 quantitative PCR primers Gene Forward Primer Reverse Primer Human LGR4 ACTCAAAGTTCTAACGCTCCAG AAAGCACTCAGCCCTCGAATG Human AXIN2 CAACACCAGGCGGAACGAA GCCCAATAAGGAGTGTAAGGACT Human CD44 CTGCCGCTTTGCAGGTGTA CATTGTGGGCAAGGTGCTATT Human SOX2 GCCGAGTGGAAACTTTTGTCG GGCAGCGTGTACTTATCCTTCT Human OCT4 CTGGGTTGATCCTCGGACCT CCATCGGAGTTGCTCTCCA Human β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT 2.9 Western blotting The total proteins of the cells and tissues were isolated with RIPA buffer (P0013B, Biyuntian, China), loaded and run on a 10% sodium dodecyl sulfate-PolyacrylamideGel Electrophoresis, and transferred to Polyvinylidene difluoride membranes (IPVH00010, millipore, USA). After blocking with 5% non-fat milk, the membranes were probed by the primary antibodies overnight at 4℃. On the second day, the membrane reacted with secondary antibodies. Thereafter, the protein blots were developed and β-actin was served as a control. The information on the primary antibodies applied in the study were exhibited in Table 2 . Table 2 Antibody information Antibody Source Cat No. Dilutions LGR4 BIOSS bs-22163R 1:1000 Bax Affinity AF0120 1:1000 Bcl-2 Affinity AF6139 1:1000 Caspase-3 abcam ab13847 1:500 β-catenin Affinity AF6266 1:1000 E-cadherin proteintech 20874-1-AP 1:5000 Vimentin abcam ab20346 1:1000 p-EGFR Affinity AF3044 1:1000 EGFR abcam bs-22163R 1:1000 β-actin Affinity AF7018 1:10000 Bax CST 2774S 1:1000 Bcl-2 CST 15071S 1:1000 Caspase-3 CST 9662S 1:1000 CTNNB1 CST 9562S 1:1000 E-cadherin CST 14472S 1:1000 Vimentin CST 5741S 1:1000 EGFR CST 54359S 1:1000 β-actin Antibody Abcam ab6276 1:5000 2.10 Ubiquitination assay Ubiquitination assay was conducted with MG132. In short, after finishing transfection, cells were split into 4 groups according the transfected siRNA as following, MG132 groups was treated with MG132, while the other groups were treated with the same volume of dimethyl sulfoxide (DMSO). 8 h later, the cells were collected and analyzed by western blotting. 2.11 Protein turnover assay After transfection with specific plasmids, 100 µg/m of cycloheximide (CHX) was added to the cells. After incubation for the indicated time, the cells were collected and western blotting was conducted. 2.12 Biophysical Techniques The binding affinity between LGR4 and BAI was quantified by microscale thermophoresis (MST), which was conducted using Monolith NT.115 instrument. LGR4 was labeled by Monolith Protein Labeling Kit RED-NHS 2nd Generation Kit. Then, the affinity was measured under MST buffer. In short, the sample were immersed in NT.115 standard treated capillaries. Then, we performed the measurements at 40% IR power, a fixed concentration of labeled LGR4 as well as constantly increasing concentration of BAI. Finally, MO. Affinity Analysis software was applied for data analysis. 2.13 Cellular thermal shift assay (CETSA) Cells were treated with BAI (80 µM) or DMSO (0.1% v/v) for 1 h. Then, the cells were harvested and distributed into 7 tubes equally. Each tube was heated for 3 min at the following temperature: 41℃, 43℃, 47℃, 50℃, 53℃, 56℃, and 61℃, then the tubes were cooled for 3 min at RT. Then, the samples underwent freeze-thaw cycles for 3 times with liquid nitrogen to lyse the cells. After the reaction, the lysates were centrifuged, and the supernatants were collected for western blotting analysis. 2.14 In vivo experiments All animal experiments were approved by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (Certificate No. SYXK (Zhe) 2021-0033) and followed up with the guidelines of the Institutional Animal Care and Use Committee. Male BALB/c nude mice (5–6 weeks old, 17–20 g) in SPF condition were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All mice were kept in controlled light (12 h light/dark period), temperature (20℃-24℃) and humidity (50%-60%) room with free access to food and water. The transfected HS683 cells in the logarithmic phase were harvested to prepare a cell suspension, and the density of the suspension was adjusted to 2.5×10 7 /mL with saline. In order to create GBM model, 200 µL cell suspension was injected into the right axilla of the mice subcutaneously[ 14 ]. When the average tumor size reached 150 mm 3 , mice injected with HS683 cells transfected with vector were randomized into Vector and Vector + erlotinib groups, and mice injected with HS683 cells transfected with oe-LGR4 were randomized into oe-LGR4, oe-LGR4 + BAI and oe-LGR4 + erlotinib groups (n = 6). The mice in the Vector + erlotinib and oe-LGR4 + erlotinib were intraperitoneally injected with 10 mg/kg erlotinib (ERL, EGFR inhibitor) once a day[ 15 ], and the mice in the oe-LGR4 + BAI were administrated with 40 mg/kg BAI once a day[ 16 ]. In parallel, the mice in the Vector and oe-LGR4 groups received saline in the same way, all the treatments were last for 30 days. During the experiment, the tumor volume of the mice was recorded every 5 days. After finishing the last injection, the animals were euthanized, the tumor tissues were removed and weighed immediately. After that, tumor tissues were immersed in paraformaldehyde, embedded in paraffin and cut into slices for Immunohistochemistry, Terminal-deoxynucleotidyl transferase mediated nick end labeling (TUNEL) and western blot assays. 2.15 Statistical analysis The study was analyzed with SPSS 16.0, and the data was displayed as mean ± SD. Student’s t-test was used to compare the differences between two groups, and Multiple group comparisms were made by one-way ANOVA and Tukey tests. The Kruskal-Wallis H test was applied when variances were not homogeneous. p < 0.05 was considered statistically significant. 3. Results 3.1 LGR4 was highly expressed in GBM and related to poor prognosis Firstly, the expression of LGR4 in GBM was analyzed by the GEPIA database, and the results revealed that the expression of LGR4 in 518 GBM tissues was higher than that in 207 normal tissues, meanwhile, high LGR4 expression in GBM predicted poor outcome (Fig. 1 A-B). In addition, HPA also demonstrated LGR4 was highly expressed in the brain tissues of GBM patients (Fig. 1 C). Next, in order to further confirm LGR4 expression in GBM, qPCR and western blotting were conducted to measure LGR4 expression in human astrocytes (SVGP12) and GBM cells. The results showed both at the mRNA level and protein level, LGR4 expression was higher in GBM cells than in astrocytes, especially in HS683 and KNS89 cells(Fig. 1 D-E). Therefore, HS683 and KNS89 cells were chosen for the following experiments. 3.2 Knockdown of LGR4 suppressed the malignant behaviour and EGFR phosphorylation of GBM cells In order to explore the role of LGR4 in cellular behaviour, three siRNAs targeting human LGR4 were designed to knock down LGR4 expression in HS683 and KNS89 cells. LGR4 knock-down efficiency was verified by qPCR and western blotting. si-LGR4-3 was selected for subsequent experiments for its higher knockdown efficiency (Fig. 2 A-B). Based on results obtained from GEPIA and HPA databases, we conjectured that LGR4 may facilitate GBM cellular malignant behaviour. Hence, CCK-8, colony formation, EdU, apoptosis as well as Transwell assay were utilized to detect the effect of LGR4 knockdown on GBM. As expected, LGR4 knockdown significantly inhibited the viability (Fig. 2 C), proliferation (Fig. 2 D-E), migration and invasion (Fig. 2 G) of GBM cells, but upregulated the apoptosis rate of GBM cells (Fig. 2 F). Furthermore, western blotting was conducted to further demonstrated the role of LGR4 knockdown on GBM cellular apoptosis as well as migration and invasion (Fig. 3 ). Of note, western blot also demonstrated that LGR4 knockdown decreased the phosphorylation of EGFR in GBM cells. 3.3 BAI inhibited cellular malignant behaviour, blocked the LGR4-EGFR pathway and interacted with LGR4 in GBM cells Then, HS683 and KNS89 cells were treated with increasing doses of BAI for 24, 48 and 72 h and applied CCK-8 assay to measure cellular viability; the results revealed that BAI effectively reduced the viability of GBM cells in a dose- and time-dependent fashion (Fig. 4 A). When the concentration of BAI above or equal to 20 µM, BAI significantly affect GBM cellular viability, no matter the treatment time was 24 h, 48 h or 72 h. However, after treatment for 48 h, 0-160 µM of BAI did not affect the viability of astrocytes (Fig. 4 B). Therefore, 20 µM, 40 µM, 80 µM and 48 h were selected for the following experiments. Additionally, we also observed that relative to the controls, BAI decreased the number (Fig. 4 C), colony-formation ability (Fig. 4 D), proliferation (Fig. 4 E), migration and invasion of GBM cells (Fig. 5 A), but enhanced the apoptosis of GBM cells (Fig. 4 F). qPCR also found that BAI could blockade the expression of LGR4, AXIN2, CD44, SOX2 and OCT4 mRNA (Fig. 5 B). All the effects were presented in a dose-dependent manner. Furthermore, western blotting results further suggested the function of BAI on GBM cellular malignant behaviour (Fig. 5 C). More importantly, western blot found that LGR4/EGFR pathway were blocked in BAI treatment groups (Fig. 5 D). Upon binding to different ligands, LGR4 can activate the EGFR, thereby contributing to the development of tumor progression, invasion and metastasis[ 17 ]. Thus, we speculated the role of BAI on GBM was related to LRG4. MST data demonstrated there was a relatively high affinity between BAI and LGR4 in GBM cells, the Kd values between BAI and LGR4 in HS683 cells and KNS89 cells were about 4.56 M and 4.68 M, respectively (Fig. 5 E). Apart from that, CETSA was performed to further verify the binding of BAI to LGR4 in GBM cells; the results showed that the thermal stability of LGR4 in the GBM cells was increased with the upregulated temperature, indicating there was a direct interaction between BAI and LGR4 (Fig. 5 F). 3.4 LGR4-induced malignant behaviour in GBM cells was rescued by BAI and EGFR inhibitor To explore the potential molecular mechanism of BAI on GBM, we treated the cell transfected with oe-LGR4 with 2 µM of EGFR inhibitor (ERL) or 80 µM of BAI. First, we measured the viability of GBM cells using CCK-8 assay. As illustrated in Fig. 6 A, GBM cells transfected with oe-LGR4 exhibited raised cell viability, however, after treatment with BAI, the viability of GBM cells transfected with oe-LGR4 were significantly decreased, which was similar to that of the oe-LGR4 + ERL group. Furthermore, colony formation analysis (Fig. 6 B) as well as apoptosis detection (Fig. 6 C) were carried out to check the mechanism of BAI on GBM. As expected, oe-LGR4 induced the proliferation but inhibited the apoptosis of GBM cells, however, the situation was reversed by BAI, similar to ERL. Thus, we hypothesized that EGFR may be a key gene for the over-expression LGR4 caused GBM. To test the relationship between LGR4 and EGFR, western blot was performed. The results shown in Fig. 6 D revealed that interference of LGR4 expression could also efficiently interfere with EGFR expression. Then, si-LRG4 and oe-LGR4 transfected GBM cells were treated with 20 µM of MG132 (proteasome inhibitor) for 8 h and 100 µg/mL of CHX (protein synthesis inhibitor) to measure the level of LGR4 and EGFR. The results found that si-LGR4 accelerated EGFR protein degradation and oe-LGR4 inhibited EGRE protein degradation (Fig. 6 E-F). 3.5 The inhibition of GBM cell growth by LGR4 knockdown was reversed by EGFR overexpression and CBL knockdown To reveal the underlying molecular mechanism of LGR4 knockdown regulation of cell malignant behaviour in GBM cells, si-LGR4 and oe-EGFR were co-transfected into HS683 and KNS89 cells. First, LGR4 knockdown downregulated EGFR protein expression, nevertheless, after transfection with oe-EGFR, this downregulation was reserved (Fig. 7 A). Next, the function of oe-EGFR on si-LGR4 induced cell proliferation and hampered cell apoptosis were detected. The colony formation assay showed that oe-EGFR could rescue LGR4 knockdown impaired cell proliferation ability (Fig. 7 B). The apoptosis detection indicated that LGR4 knockdown accelerated the apoptosis of GBM cells, but the effect was abolished by oe-EGFR (Fig. 7 C). CBL is an E3 ubiquitin-protein ligase that drives EGFR proteasomal degradation. Accumulating evidence has reported that CBL protein can serve as a tumor suppressor in numerous cancer, including GBM[ 18 ]. Accordingly, we further verified the mechanism of LGR4 knockdown on GBM. As displayed in Fig. 8 A, si-LGR4 blocked LGR4 protein expression but increased CBL protein expression. In addition, Fig. 8 B-D found that LGR4 knockdown effectively decreased EGFR protein expression, inhibited cell proliferation and facilitated cell apoptosis, in HS683 and KNS89 cells. However, those situations were all rescued by si-CBL. 3.6 BAI inhibited LGR4 induced GBM development by suppressing EGFR in vivo For confirming the role and mechanism of BAI on GBM, HS683 cells were used to generate an in vivo xenograft model. According to our results, compared to the oe-LGR4 group, the tumor volume of oe-LGR4 + BAI group was significantly decreased from day 10, and the weight of the tumor was also reduced obviously after completing the treatment (Fig. 9 A). Additionally, compared to the oe-LGR4 group, the expression of Ki67 was decreased while the apoptosis was increased in the tumor tissues of the oe-LGR4 + BAI group (Fig. 9 B-C). Interestingly, those trends were also observed in the oe-LGR4 + ERL group. What is more, oe-LGR4 increased the protein expressions of LGR4 and EGFR, but decreased the protein expression of CBL, those changes were reversed by treating BAI as well as ERL, especially for BAI (Fig. 9 D). 4. Discussion GBM is the deadliest brain tumor for adults, with still no cure with a short median survival (about 15 months)[ 19 ]. Despite some developments in GBM therapies, the prognosis of GBM patients is still dismal[ 20 ]. At present, there are only a few drugs have gained Food and Drug Administration approval for treating GBM in the clinic, however, since the high malignancy as well as intensive invasion of GBM cells, those drugs are not generally effective[ 21 ]. Thus, further investigating the mechanism and finding new therapeutic methods for GBM are urgent. In this study, we reported the therapeutic effect and the possible action mechanism of BAI on GBM in vitro and in vivo. Cancer is featured by uncontrolled cell proliferation and apoptosis, thus, repressing cell proliferation and inducing cell apoptosis have been regarded as an effective approach to treat the majority of cancer, including GBM[ 22 ]. Increasing studies have revealed that various plant-derived compounds can be used for treating cancers, due to their function on the regulation of cell growth and death[ 23 ]. Flavonoids are ubiquitously spread in plants, and have been proposed as an important source of new chemotherapeutic drugs to treat cancer due to their various cellular mechanisms of action and low adverse effects[ 24 ]. BAI is a kind of flavonoid isolated from dry roots of S.baicalensis , has been reported to induce autophagy and apoptosis in BC cells by inhibiting PI3K/AKT pathway in vivo and in vitro [ 25 ]. In addition, BAI also has been found to repress the proliferation and block the cell cycle of colorectal cancer cells through decreasing Ezrin and activating P53 pathway-associated proteins[ 26 ]. However, virtually no research assessed the role of BAI on GBM. In this study, our data showed after treatment with BAI, the malignant behaviour of GBM cells was repressed, indicating that BAI may alleviate GBM by inhibiting proliferation and inducing apoptosis of GBM cells. LGR4 is broadly expressed in many tissues, and the importance of LGR4 has been gradually acknowledged by scholars in cancer development[ 27 ]. On the one hand, LGR4 itself is a key gene for controlling oncogenesis, metastasis and CSC maintenance in BC, high LGR4 expression implied a poor prognosis in patients with BC[ 28 ]. On the other hand, LGR4 promotes cancer occurrence and development via activating multiple pathways, such as EGFR transactivation. For example, LGR4 promoted the migration and proliferation of keratinocyte cells, and the effect was related to the activation of the EGFR/ERK/STAT3 pathway[ 29 ]. Zhang et al. also have demonstrated that by targeting LGR4, miR-137 inhibits the migration and epithelial-mesenchymal transition (EMT) of prostate cancer cells via EGFR/ERK pathway[ 30 ]. In agreement with previous research, in the present study, we found LGR4 was highly expressed in GBM patients and GBM cells, patients with higher LGR4 expression have worse survival, thus, we speculated that LGR4 repression may act as an effective approach to improve GBM via inactivating EGFR. In order to verify our hypothesis, RNA interference technology was applied to control LGR4 expression, and found that reducing LGR4 expression inhibited cellular malignant behaviour and downregulated EGFR phosphorylation in GBM cells, consistent with published research that EGFR was lowly expressed in the tissues of LGR4 knockout animals[ 31 ]. Further investigation revealed that LGR4 overexpression facilitated cell proliferation and blocked apoptosis for GBM cells, but the trends were reserved by EGFR inhibitor. These results provided compelling evidence that EGFR is essential for LGR4 to facilitate the progression of GBM. BAI has been reported to have the potential to treat HCC or BC by negatively regulating EGFR/ERK/NF-κβ pathway[ 10 ] or EGFR/ERK/Akt pathway[ 11 ]. Consistently, in vitro experiments revealed that after treatment with BAI, the expressions of LGR4 and EGFR were decreased and BAI interacted with LGR4 directly. Collectively, those data implied BAI may inhibit proliferation and induce apoptosis of GBM cells by downregulating the LGR4-EGFR pathway. However, what is the specific mechanism of LGR4 on EGFR? CBL is a member of the CBL family, closely associated to tumor occurrence and progression[ 32 ]. As a ubiquitin ligase, CBL is able to directly or indirectly bind to activated EGFR and promote its ubiquitination, thereby regulating the targeted degradation of the receptor in the lysosome[ 33 ]. More simply put, EGFR signaling is negatively regulated by CBL ubiquitylation[ 34 ]. In triple-negative breast cancer (TNBC), CBL phosphorylation and inactivation mediated by UBASH3B leads to the upregulation of EGFR, which in turn promotes proliferation, invasion and metastasis of TNBC cells[ 35 ]. In addition, miR-675 and its precursor H19 enhance the stability and activity of EGFR and c-Met through direct binding of CBL mRNA, thereby promoting the growth and metastasis of BC[ 36 ]. In the study, we examined how LGR4 loss affects EGFR-CBL interaction, and found that LGR4 loss elevated CBL expression but decreased EGFR expression, in addition, si-LGR4 repressed cell growth and induced apoptosis was reserved by CBL knockdown, which indicated LGR4 loss augmented CBL binding to EGFR, and confirms the mechanism of BAI on GBM. In conclusion, our data demonstrated that BAI exerted anti-cancerous functions in GBM by inhibiting cell proliferation and inducing apoptosis via downregulation of the LGR4-EGFR pathway. These findings strengthened our experimental results and the clinical application of BAI in GBM, and suggested that the LGR4-EGFR pathway is a novel therapeutic target in GBM treatment. Declarations Data Availability Statement: The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Acknowledgements: Not applicable. Author Contributions: XZ conceived and designed the work, acquired data; XS conceived and designed the work, played an important role in interpreting the results; QB conceived and designed the work, acquired data; LH drafted or revised the manuscript; XQ, drafted or revised the manuscript and approved the final version. Funding: This work was supported by the Shaoxing Municipal Science and Technology Plan Project of China [grant number 2022A14022]; and the Shaoxing Health Science and Technology Project of China [grant number 2022KY003]. Ethical Approval: All animal experiments were approved by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (Certificate No. SYXK (Zhe) 2021-0033). Competing Interests: The authors declare no competing interests References Wang, H., et al., Additional Diagnostic Value of Unenhanced Computed Tomography plus Diffusion-Weighted Imaging Combined with Routine Magnetic Resonance Imaging Findings of Early-Stage Gliblastoma. Biomed Res Int, 2020. 2020: p. 1672736. Hong, J., et al., PulsatillaSB365, Saponin D Induces Caspase-Independent Cell Death and Augments the Anticancer Effect of Temozolomide in Glioblastoma Multiforme Cells . Molecules, 2019. 24(18): p. 3230. Zhang, Y., et al., β-Arrestin 1 has an essential role in neurokinin-1 receptor-mediated glioblastoma cell proliferation and G/M phase transition. J Biol Chem, 2017. 292(21): p. 8933–8947. Frisch, A., et al., Apelin Controls Angiogenesis-Dependent Glioblastoma Growth . Int J Mol Sci 2020. 21(11): p. 4179. Yu, C., et al., Lgr4 promotes glioma cell proliferation through activation of Wnt signaling . Asian Pac J Cancer Prev, 2013. 14(8): p. 4907–4911. Kashyap, M. and O. Abdel-Rahman, Expression, regulation and targeting of receptor tyrosine kinases in esophageal squamous cell carcinoma . Mol Cancer, 2018. 17(1): p. 54. Liu, Y., et al., Effect of LGR4/EGFR signaling on cell growth and cancer stem cell-like characteristics in liver cancer . Cytokine, 2023. 165: p. 156185. Yue, F., et al., A Wnt-Independent LGR4-EGFR Signaling Axis in Cancer Metastasis . Cancer Res, 2021. 81(17): p. 4441–4454. Cai, P., et al., Baicalein ameliorates osteoporosis via AKT/FOXO1 signaling. 34198266, 2021. 13(13): p. 17370–17379. Tian, J., et al., MiR-3663-3p participates in the anti-hepatocellular carcinoma proliferation activity of baicalein by targeting SH3GL1 and negatively regulating EGFR/ERK/NF-κB signaling . Toxicol Appl Pharmacol, 2021. 420: p. 115522. Shang, D., et al., Baicalein suppresses 17-β-estradiol-induced migration, adhesion and invasion of breast cancer cells via the G protein-coupled receptor 30 signaling pathway . Oncol Rep, 2015. 33(4): p. 2077–2085. Tang, B. and Y. Dong, Network pharmacology and bioinformatics analysis on the underlying mechanisms of baicalein against oral squamous cell carcinoma . J Gene Med, 2023: p. e3490. Yu, H., et al., Targeting connexin 43 provides anti-inflammatory effects after intracerebral hemorrhage injury by regulating YAP signaling . J Neuroinflammation, 2020. 17(1): p. 322. Le Mercier, M., et al., Evidence of galectin-1 involvement in glioma chemoresistance . Toxicol Appl Pharmacol 2008. 229(2): p. 172–183. Yang, K., et al., Ursolic acid promotes apoptosis and mediates transcriptional suppression of CT45A2 gene expression in non-small-cell lung carcinoma harbouring EGFR T790M mutations . Br J Pharmacol 2019. 176(24): p. 4609–4624. Liu, C., et al., Baicalein Restores the Balance of Th17/Treg Cells via Aryl Hydrocarbon Receptor to Attenuate Colitis. Mediators Inflamm, 2020. 2020: p. 5918587. Ordaz-Ramos, A., et al., The Role of LGR4 (GPR48) in Normal and Cancer Processes . Int J Mol Sci, 2021. 22(9): p. 4690. Rojas-Ríos, P., et al., CblAubergine and piRNAs promote germline stem cell self-renewal by repressing the proto-oncogene . EMBO J, 2017. 36(21): p. 3194–3211. Nadeem Abbas, M., et al., Advances in Targeting the Epidermal Growth Factor Receptor Pathway by Synthetic Products and Its Regulation by Epigenetic Modulators As a Therapy for Glioblastoma . Cells, 2019. 8(4): p. 350. Wang, K., et al., Molecular and clinical characterization of TMEM71 expression at the transcriptional level in glioma . CNS Neurosci Ther, 2019. 25(9): p. 965–975. Huang, R., et al., RGS16 promotes glioma progression and serves as a prognostic factor . CNS Neurosci Ther, 2020. 26(8): p. 791–803. Faghfoori, Z., et al., Anticancer effects of bifidobacteria on colon cancer cell lines . Cancer Cell Int, 2021. 21(1): p. 258. Nagesh, P., et al., Tannic acid inhibits lipid metabolism and induce ROS in prostate cancer cells . Sci Rep, 2020. 10(1): p. 980. Garcia-Oliveira, P., et al., Status and Challenges of Plant-Anticancer Compounds in Cancer Treatment . Pharmaceuticals (Basel), 2021. 14(2): p. 157. Yan, W., et al., Baicalein induces apoptosis and autophagy of breast cancer cells via inhibiting PI3K/AKT pathway in vivo and vitro . Drug Des Devel Ther, 2018. 12: p. 3961–3972. Chen, Z., et al., Baicalein Inhibits Proliferation Activity of Human Colorectal Cancer Cells HCT116 Through Downregulation of Ezrin . Cell Physiol Biochem, 2018. 49(5): p. 2035–2046. Luo, W., et al., Leucine-rich repeat-containing G protein-coupled receptor 4 (Lgr4) is necessary for prostate cancer metastasis via epithelial-mesenchymal transition . J Biol Chem, 2017. 292(37): p. 15525–15537. Yue, Z., et al., LGR4 modulates breast cancer initiation, metastasis, and cancer stem cells . FASEB J, 2018. 32(5): p. 2422–2437. Wang, Z., et al., GPR48-Induced keratinocyte proliferation occurs through HB-EGF mediated EGFR transactivation . FEBS Lett, 2010. 584(18): p. 4057–4062. Zhang, H., et al., MicroRNA–137 regulates hypoxia–mediated migration and epithelial–mesenchymal transition in prostate cancer by targeting LGR4 via the EGFR/ERK signaling pathway . Int J Oncol, 2020. 57(2): p. 540–549. Stevens, P. and B. Williams, LGR4: Not Just for Wnt Anymore? Cancer Res, 2021. 81(17): p. 4397–4398. Daniels, S., et al., Loss of function Cbl-c mutations in solid tumors. 2019. 14(7): p. e0219143. Wee, P. and Z. Wang, Regulation of EGFR Endocytosis by CBL During Mitosis . Cells, 2018. 7(12): p. 257. Oliveira-Cunha, M., W. Newman, and A. Siriwardena, Epidermal growth factor receptor in pancreatic cancer . Cancers (Basel), 2011. 3(2): p. 1513–1526. Lee, S., et al., Protein tyrosine phosphatase UBASH3B is overexpressed in triple-negative breast cancer and promotes invasion and metastasis . Proc Natl Acad Sci USA, 2013. 110(27): p. 11121–11126. Vennin, C., et al., H19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b . Oncotarget, 2015. 6(30): p. 29209–29223. Additional Declarations There is NO conflict of interest to disclose. Cite Share Download PDF Status: Published Journal Publication published 28 Oct, 2024 Read the published version in Cancer Gene Therapy → Version 1 posted Editorial decision: revise 05 Jun, 2024 Review # 2 received at journal 04 Jun, 2024 Review # 1 received at journal 29 May, 2024 Reviewer # 2 agreed at journal 14 May, 2024 Reviewer # 1 agreed at journal 13 May, 2024 Reviewers invited by journal 28 Mar, 2024 Submission checks completed at journal 28 Mar, 2024 First submitted to journal 27 Mar, 2024 Unknown event 19 Mar, 2024 Editor assigned by journal 17 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4116136","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":285047908,"identity":"d02672c2-7aa9-485c-a599-b5cd20619b7d","order_by":0,"name":"Xuchen Qi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYDACZiBmbGBg4GdgSIByidUi2UC0FgaoFoMDcBMIAL7jPGYSP3fY5BmfP/BMgqHCOrGB/ewBvFokD7OlSfaeSSs2O3AgTYLhTHpiA09eAl4tBoeZj0kzth1O3HawIU0CxGiQ4DEgoIWxDajlf+LmZgagln9EaQHbciBxAxtISwMRWoB+SbbsbUtOnHGGIdki4Vi6cRtPDn4tfOfPGN742WaX2N9/JvHGhxpr2X72M/i1MByAs3gSwJHJhl89ihb2AzgVjYJRMApGwcgGAEvVRH81tLfcAAAAAElFTkSuQmCC","orcid":"","institution":"Shaoxing People’s Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xuchen","middleName":"","lastName":"Qi","suffix":""},{"id":285047909,"identity":"f9e44e9b-1f86-4cb4-8c61-5d39af826a48","order_by":1,"name":"Xiaobing Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiaobing","middleName":"","lastName":"Zhang","suffix":""},{"id":285047910,"identity":"d1d0f972-a9c4-4640-889b-f4971dd495f7","order_by":2,"name":"Xian Shao","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xian","middleName":"","lastName":"Shao","suffix":""},{"id":285047911,"identity":"fd11f36a-c144-472c-91af-d7aaab163764","order_by":3,"name":"Qingquan Bao","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Qingquan","middleName":"","lastName":"Bao","suffix":""},{"id":285047912,"identity":"06872611-4a76-442b-85e8-62e3758bedb6","order_by":4,"name":"Lingyan He","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Lingyan","middleName":"","lastName":"He","suffix":""}],"badges":[],"createdAt":"2024-03-17 08:50:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4116136/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4116136/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41417-024-00825-0","type":"published","date":"2024-10-28T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":53968599,"identity":"2d86cb0c-d5e0-4b13-9e2f-d2228c68dd1b","added_by":"auto","created_at":"2024-04-02 20:20:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":798090,"visible":true,"origin":"","legend":"\u003cp\u003eLGR4 expression was elevated in GBM and associated with poor prognosis. (A-B) Using GEPIA database, LGR4 expression in GBM tumor tissues and normal tissues were obtained, and survival curves based on LGR4 expression was also analyzed. (C) Representative immunohistochemistry staining of LGR4 expression level in brain tissues of patients with or without GBM. (D-E) LGR4 mRNA and protein expression in human astrocytes (SVGP12) and GBM cells (U-251 MG, A172, HS683, KNS89, U-87 MG, U-118 MG) were measured by qPCR and western blotting. \u003csup\u003e@\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e@@\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.SVGP12. Results were presented as mean±SD. n=3. Note: GBM, glioblastoma; GEPIA, Gene Expression Profiling Interactive Analysis; qPCR, quantitative PCR.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/2c0236917446b72bf710aa4a.png"},{"id":53968601,"identity":"4a943224-a57d-4a45-a1d1-9fc059ccd5c0","added_by":"auto","created_at":"2024-04-02 20:20:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1918082,"visible":true,"origin":"","legend":"\u003cp\u003eLGR4 knockdown suppressed the proliferation but promoted apoptosis in GBM cells. (A-B) LGR4 knockdown was proved by qPCR and western blotting. (C-G) After transfection, the cellular viability, colony number, proliferation, apoptosis, migration and invasion of GBM cells were assessed by CCK-8, colony formation, EdU, apoptosis and Transwell assays. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.si-LGR4-NC. Results were presented as mean±SD. n=3. Note: EdU, 5-ethynyl-20-deoxyuridine.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/966785b746428b7fad4780ba.png"},{"id":53969229,"identity":"b6be4e20-cc07-420d-a786-efe6908f7800","added_by":"auto","created_at":"2024-04-02 20:28:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":758830,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLGR4 knockdown facilitated apoptosis, but inhibited migration, invasion and EGFR phosphorylation in GBM cells. \u003c/strong\u003eThe protein expressions of LGR4, apoptosis-related biomarkers (Bax, Bcl-2 and Caspase-3), EMT-associated biomarkers (β-catenin, E-cadherin and Vimentin) as well as EGFR phosphorylation were detected in LGR4-knockdown cells by western blotting. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.si-LGR4-NC. Results were presented as mean±SD. n=3. Note: EMT, epithelial-mesenchymal transition.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/3beb0fc4399d7273363501dd.png"},{"id":53968600,"identity":"d71a4105-ebbf-4868-8a1b-d0d797bd3457","added_by":"auto","created_at":"2024-04-02 20:20:43","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2592413,"visible":true,"origin":"","legend":"\u003cp\u003eBAI inhibited cellular malignant behaviour of GBM cells without affecting normal cellular viability. (A) GBM cells were incubated with BAI at different concentrations for 24, 48 and 72 h. Then, cell viability was detected by CCK-8 assay. (B) After treatment with various doses of BAI for 48 h, CCK-8 was employed to measure the viability of mice’s normal astrocytes. (C-F) After treating BAI for 48 h, the number of cells and colonies were counted under a microscope, cell proliferation and apoptosis were tested by EdU, apoptosis detection. \u003csup\u003e▲\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e▲▲\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.0 μM. Results were presented as mean±SD. n=3. Note: BAI, Baicalein.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/5445737d7980062a0b937d67.png"},{"id":53968604,"identity":"bbca439a-a7d2-4619-bbe8-ad9c272dfeb7","added_by":"auto","created_at":"2024-04-02 20:20:43","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2181387,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBAI suppressed the migration and invasion, blocked the LGR4-EGFR pathway and interacted with LGR4 in GBM cells.\u003c/strong\u003e (A) After culturing with BAI for 48 h, the migration and invasion ability of GBM cells were detected by Transwell. (B) The mRNA expression levels of LGR4, AXIN2, CD44, SOX2 and OCT4 in BAI-treated GBM cells were tested by qPCR. (C-D) The expression of proteins related to apoptosis (Bax, Bcl-2 and Caspase-3), EMT (E-cadherin and Vimentin), PI3K/AKT pathway as well as LGR4-EGFR pathway in BAI-treated GBM cells were assessed by western blot. (E) MST was conducted to demonstrate whether there was a relatively high affinity between BAI and LGR4 in GBM cells. (F) CETSA was performed at 41℃, 43℃, 47℃, 50℃, 53℃, 56℃ to further verified the thermal stability of BAI to LGR4 in GBM cells.\u003csup\u003e▲\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e▲▲\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.Control. Results were presented as mean±SD. n=3. Note: MST, microscale thermophoresis; CETSA, cellular thermal shift assay.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/cdb761becc7092481d81dac7.png"},{"id":53968607,"identity":"42cc1d32-29cf-40d3-8905-524e30d0a706","added_by":"auto","created_at":"2024-04-02 20:20:43","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1822978,"visible":true,"origin":"","legend":"\u003cp\u003eLGR4-induced malignant behaviour in GBM cells was rescued by BAI and EGFR inhibitor. (A) After completing the transfection, CCK-8 was conducted to measure the viability of GBM cells at 24, 48 and 72 h. (B-C) Then, clone formation and apoptotic assays were conducted to evaluate the role of BAI and ERL (EGFR inhibitor) on cellular clonogenic ability, and apoptosis of LGR4-overpressed GBM cells. (D) The expression of LGR4 as well as EGFR in GBM cells was assessed by western blotting. (E) GBM cells were treated with si-LGR4 and MG-132 (protestasome inhibitor) for 8 h before harvesting to detect EGFR protein. (F) CHX (protein synthesis inhibitor, 100 μg/mL) was used to treat GBM cells transfected with oe-LGR4 and Vector for 0, 2, 4 and 8 h, thereby determining whether LGR4 could stabilize EGFR. \u003csup\u003e+\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e++\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.Vector; \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.oe-LGR4. Results were presented as mean±SD. n=3. Note: ERL, erlotinib; CHX, cycloheximide.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/9088c0b0cc4b7c72d21157db.png"},{"id":53969230,"identity":"37addb09-e79f-4e9c-b974-bdb089b8e574","added_by":"auto","created_at":"2024-04-02 20:28:43","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1595688,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLGR4 knockdown suppressed GBM cell growth by downregulating EGFR. \u003c/strong\u003e(A) Upon finishing the transfection, the expression levels of LGR4 and EGFR proteins in indicated cells were measured using western blotting. (B) The number of the clone were counted from the clone formation assay in indicated cells. (C) In addition, the apoptotic rate of indicated cells was also determined by apoptotic assay. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.si-LGR4-NC+Vector; \u003csup\u003e\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.si-LGR4+Vector. Results were presented as mean±SD. n=3. \u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/c1504226a504ccb23ad7de29.png"},{"id":53968608,"identity":"4297e655-6efc-4c0c-aeb4-af9302aa7282","added_by":"auto","created_at":"2024-04-02 20:20:44","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1965815,"visible":true,"origin":"","legend":"\u003cp\u003eLGR4 knockdown suppressed GBM cell growth by upregulating CBL. (A) Western blot was performed to evaluate the expressions of LGR4, CLB, PARK2 and STUB1 proteins after GBM cell transfected with si-LGR4. (B) Western blotting was used to measure the effect of CBL knockdown on LGR4, CBL and EGFR protein expressions in LGR4-knockdown cells. (C-D) Clone formation assay and apoptosis detection were carried out to examine the effects of CBL knockdown on cell proliferation and apoptosis of LGR4-knockdown cells. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.si-LGR4-NC;\u003csup\u003e+\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e++\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.si-LGR4. Results were presented as mean±SD. n=3.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/6d811c975f64bfc51e9f2d56.png"},{"id":53968603,"identity":"17ca148e-47e1-4a69-aeda-f26a0218e1af","added_by":"auto","created_at":"2024-04-02 20:20:43","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":2193812,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLGR4 overexpression promoted tumor growth in mice, but the effect was reversed by BAI and EGFR inhibitor. (A) \u003c/strong\u003eThe mice were injected with transfected HS683 cells to create GBM animal models, tumor volume was recorded every 3 days and the tumor weight was detected at the end of the study. (B) Immunohistochemical staining was conducted to measure Ki67 expression in the tumor tissues. (C) The apoptosis of tumor tissues was measured by TUNEL. Furthermore, the expressions of Bax, Bcl-2, Caspase-3, LGR4, CBL as well as EGFR proteins in the tumor tissues were detected using western blotting. \u003csup\u003e+\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e++\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.Vector; \u003csup\u003e-\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e--\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026lt;0.01 vs.oe-LGR4. Results were presented as mean±SD. n=6.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/2ead92dbeb5d6f5280c06f05.png"},{"id":67730896,"identity":"6f66e262-ce4d-44ea-97a0-3640365ba382","added_by":"auto","created_at":"2024-10-29 07:11:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":17531192,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4116136/v1/0d4acc43-3cd9-48d1-ae61-b650268f4ef6.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eGlioblastoma (GBM) is the most common intracranial tumor with high mortality[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In spite of intensive efforts, the therapeutic options for GBM are still limited, and the mean survival time for patients is less than 2 years following diagnosis[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Similar to the majority of cancers, the high death rate of GBM results from GBM cells possessing the features of indefinite proliferation, dysregulated apoptosis, and infiltration into adjacent tissues frequently[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. GBM remains fatal, even though GBM patients were treated with aggressive management of surgery, radio and chemotherapy[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Therefore, other potential methods for treating GBM are desperately needed.\u003c/p\u003e \u003cp\u003eLGR4, also known as GPR48, has been found to be highly expressed in many cancer tissues, including glioma tissues[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. EGFR expression level always contributes to cancer development and worse prognosis[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Many functions of cancer stem cell (CSC) rely on EGFR, for example, stemness, metabolism, immunomodulatory activity, dormancy, and resistance to therapy[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Mechanistically, LGR4 can interact with EGFR, block the degradation and ubiquitination of EGFR, thereby leading to the persistent activating of EGFR[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. A published study suggested that LGR4/EGFR pathway in hepatocellular carcinoma (HCC) facilitates tumor development and contributes to maintaining the features of stem cells[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In addition, evidence exhibited by previous research suggested that the LGR4-EGFR pathway can be used for a novel therapeutic target for breast cancer (BC), and deactivating the LGR4-EGFR pathway can inhibit the metastasis of BC cells[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Nevertheless, there is still no clear evidence for the role of LGR4 on GBM via regulating EGFR.\u003c/p\u003e \u003cp\u003eBaicalein (BAI) is the principal flavonoid isolated from \u003cem\u003eS.baicalensis\u003c/em\u003e, which possesses numerous beneficial properties and is always utilized for treating multiple ailments[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Recent research has revealed that BAI exerts its anticancer activity by facilitating apoptosis, blocking cell growth, activating autophagy and regulating some molecular pathways, such as EGFR/ERK/NF-κβ pathway[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] or EGFR/ERK/Akt pathway[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Moreover, scholars overlapped BAI targets with oral squamous cell carcinoma-associated genes, EGFR belongs to the top 10 genes with high centrality measures[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, the specific role and mechanism of BAI on GBM are still not clear.\u003c/p\u003e \u003cp\u003eTherefore, in this research, we conducted \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments to explore whether BAI can exert its protective role against GBM by downregulating the LGR4-EGFR pathway, thus providing a novel strategy for treating GBM.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1 LGR4 expression analysis\u003c/h2\u003e\n \u003cp\u003eGene Expression Profiling Interactive Analysis (GEPIA) and Human Protein Atlas (HPA) database were applied for public data analysis (the website of GEPIA is \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia.cancer-pku.cn/\u003c/span\u003e\u003c/span\u003e and the website of HPA is\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.proteinatlas.org/\u003c/span\u003e\u003c/span\u003e). LGR4 expression in the tumor tissues of brain lower grade glioma was compared to that in TCGA and GTEx. In addition, GEPIA was also used to calculate the overall survival of brain lower grade glioma patients based on LGR4 expression. Furthermore, HPA exhibited the expression of LGR4 in the brain tissues of patients with or without GBM.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2 Cell culture and transfection\u003c/h2\u003e\n \u003cp\u003eGBM cell lines (U-251 MG, A172, HS683, KNS89, U-87 MG, U-118 MG) were supplied by Sai Baikang Biotechnology (China), and human astrocytes (SVGP12) were obtained from ATCC (USA). In addition, mouse astrocytes used in the study were extracted from the mouse as described previously[\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e]. All cells were cultured in dulbecco\u0026apos;s modified eagle medium medium containing 10% fetal bovine serum (FBS) at 37℃ in a CO\u003csub\u003e2\u003c/sub\u003e- and humidity-controlled incubator.\u003c/p\u003e\n \u003cp\u003eFor cell transfection, small interfering RNA (siRNA) targeting human LGR4 and CBL (si-LGR4 and si-CBL), overexpression vector of LGR4 and EGFR (oe-LGR4 and oe-EGFR) as well as respective negative controls (si-NC and vector) were synthesized by Shanghai Jima Pharmaceutical Technology Company Limited (China). All cells were transfected with Lipofectamine 3000, and harvested 48 h after transfection.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3 CCK-8 assay\u003c/h2\u003e\n \u003cp\u003eCellular viability was evaluated with CCK-8 Assay Kit (C0039, Biyuntian, China). In short, cells were seeded and cultured with or without BAI in 96-well plates. Upon incubation for a predetermined time, CCK-8 solution (10 \u0026micro;L) was added into each well and culture for another 4 h. Thereafter, absorbance at 450 nm was tested using a microplate reader (CMaxPlus, MD, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4 Counting the number of cells\u003c/h2\u003e\n \u003cp\u003eThe cells were grown in medium with 0, 20, 40 and 80 \u0026micro;M of BAI at 37℃ in a CO\u003csub\u003e2\u003c/sub\u003e- and humidity-controlled incubator. After 48 h, the medium was removed and photographed by a light microscope to count the number of cells.\u003c/p\u003e\n \u003cp\u003eIn addition, clone formation assay were conducted to evaluated proliferation ability of the cells. In short, cells were seeded in 6-well plates containing or not containing BAI. Every 3 days, the media was replaced. Following 2 weeks of culture, cells were rinsed by phosphate buffer saline (PBS), fixed with paraformaldehyde, and stained by crystal violet. Then, the images of the wells were scanned and the number of colonies was calculated to assess the ability of cellular proliferation. Colonies containing 50 or more cells were considered a clone.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5 5-ethynyl-20-deoxyuridine (EdU) assay\u003c/h2\u003e\n \u003cp\u003eCell proliferation was detected by adopting EdU cell proliferation kit (C0078s, Biyuntian, China). Briefly, cells were seeded into a 12-well plate. Following treatment, EdU was applied to incubate the cells for 4 h. Then, cells were fixed by 95% ethanol and infiltrated in 0.3% TritonX-100. Subsequently, the cells reacted with 0.5 mL of Click reaction mixture and 1 mL of 4\u0026apos;,6-diamidino-2-phenylindole (DAPI), both reactions were conducted under a light-shielding environment. Finally, the staining results were visualized with a fluorescence microscope.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e2.6 Apoptosis detection\u003c/h2\u003e\n \u003cp\u003eCells were seeded in 6-well plates, and cultured with or without BAI for suitable times. Then, cells were collected, rinsed using ice-cold PBS twice and centrifuged to obtain cell suspension. Thereafter, cells were stained with 5 \u0026micro;L Annexin V-FITC and 10 \u0026micro;L PI at room temperature (RT) in darkness (556547, BD, Singapore). In the end, the apoptosis rate of the cell was determined with the help of flow cytometry (NovoCyte, Agilent, China) within 1 h.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e2.7 Transwell assay\u003c/h2\u003e\n \u003cp\u003eCell invasion as well as migration were assessed by Transwell assay. For invasion assay, cells in serum-free media were added to the upper chamber pre-coated with matrigel (356234, BD, USA) after treatment. Medium containing 10% FBS was loaded into the bottom chamber. After incubation for 24 h, the cells invading to the bottom chamber were fixed by formaldehyde, dyed with crystal violet and calculated under the microscope. For the migration assay, all the steps were the same as those conducted in the invasion assay except that matrigel was not used in the upper chamber.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e2.8 RNA extraction and quantitative PCR (qPCR)\u003c/h2\u003e\n \u003cp\u003eAfter treatment, the total RNA of the cell lines was extracted using EZ-10 Total RNA Miniprep Kit (B618583-0100, Sangon Biotech, China), and transcribed to cDNA reversely by Reverse Transcription Kit (CW2569, CWBio Co., Ltd., China). To quantify the expression of target genes, quantitative PCR was carried out with a SYBR Green qPCR kit (11201ES08, Yeasen, China) and specific primers. All the primer sequences used in the research were presented in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003equantitative PCR primers\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward Primer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse Primer\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman LGR4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACTCAAAGTTCTAACGCTCCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAAGCACTCAGCCCTCGAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman AXIN2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAACACCAGGCGGAACGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCCAATAAGGAGTGTAAGGACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman CD44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGCCGCTTTGCAGGTGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATTGTGGGCAAGGTGCTATT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman SOX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCGAGTGGAAACTTTTGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCAGCGTGTACTTATCCTTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman OCT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTGGGTTGATCCTCGGACCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCATCGGAGTTGCTCTCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman \u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATGTACGTTGCTATCCAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTCCTTAATGTCACGCACGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e2.9 Western blotting\u003c/h2\u003e\n \u003cp\u003eThe total proteins of the cells and tissues were isolated with RIPA buffer (P0013B, Biyuntian, China), loaded and run on a 10% sodium dodecyl sulfate-PolyacrylamideGel Electrophoresis, and transferred to Polyvinylidene difluoride membranes (IPVH00010, millipore, USA). After blocking with 5% non-fat milk, the membranes were probed by the primary antibodies overnight at 4℃. On the second day, the membrane reacted with secondary antibodies. Thereafter, the protein blots were developed and \u0026beta;-actin was served as a control. The information on the primary antibodies applied in the study were exhibited in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAntibody information\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAntibody\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSource\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCat No.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDilutions\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLGR4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBIOSS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ebs-22163R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBax\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAffinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF0120\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBcl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAffinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF6139\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCaspase-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eabcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eab13847\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:500\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026beta;-catenin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAffinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF6266\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eE-cadherin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eproteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e20874-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVimentin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eabcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eab20346\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ep-EGFR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAffinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF3044\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEGFR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eabcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ebs-22163R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026beta;-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAffinity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF7018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:10000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBax\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2774S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBcl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e15071S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCaspase-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9662S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTNNB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9562S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eE-cadherin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14472S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVimentin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5741S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEGFR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e54359S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026beta;-actin Antibody\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eab6276\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e2.10 Ubiquitination assay\u003c/h2\u003e\n \u003cp\u003eUbiquitination assay was conducted with MG132. In short, after finishing transfection, cells were split into 4 groups according the transfected siRNA as following, MG132 groups was treated with MG132, while the other groups were treated with the same volume of dimethyl sulfoxide (DMSO). 8 h later, the cells were collected and analyzed by western blotting.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e2.11 Protein turnover assay\u003c/h2\u003e\n \u003cp\u003eAfter transfection with specific plasmids, 100 \u0026micro;g/m of cycloheximide (CHX) was added to the cells. After incubation for the indicated time, the cells were collected and western blotting was conducted.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e2.12 Biophysical Techniques\u003c/h2\u003e\n \u003cp\u003eThe binding affinity between LGR4 and BAI was quantified by microscale thermophoresis (MST), which was conducted using Monolith NT.115 instrument. LGR4 was labeled by Monolith Protein Labeling Kit RED-NHS 2nd Generation Kit. Then, the affinity was measured under MST buffer. In short, the sample were immersed in NT.115 standard treated capillaries. Then, we performed the measurements at 40% IR power, a fixed concentration of labeled LGR4 as well as constantly increasing concentration of BAI. Finally, MO. Affinity Analysis software was applied for data analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003e2.13 Cellular thermal shift assay (CETSA)\u003c/h2\u003e\n \u003cp\u003eCells were treated with BAI (80 \u0026micro;M) or DMSO (0.1% v/v) for 1 h. Then, the cells were harvested and distributed into 7 tubes equally. Each tube was heated for 3 min at the following temperature: 41℃, 43℃, 47℃, 50℃, 53℃, 56℃, and 61℃, then the tubes were cooled for 3 min at RT. Then, the samples underwent freeze-thaw cycles for 3 times with liquid nitrogen to lyse the cells. After the reaction, the lysates were centrifuged, and the supernatants were collected for western blotting analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e2.14 \u003cem\u003eIn vivo\u003c/em\u003e experiments\u003c/h2\u003e\n \u003cp\u003eAll animal experiments were approved by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (Certificate No. SYXK (Zhe) 2021-0033) and followed up with the guidelines of the Institutional Animal Care and Use Committee. Male BALB/c nude mice (5\u0026ndash;6 weeks old, 17\u0026ndash;20 g) in SPF condition were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. All mice were kept in controlled light (12 h light/dark period), temperature (20℃-24℃) and humidity (50%-60%) room with free access to food and water. The transfected HS683 cells in the logarithmic phase were harvested to prepare a cell suspension, and the density of the suspension was adjusted to 2.5\u0026times;10\u003csup\u003e7\u003c/sup\u003e/mL with saline. In order to create GBM model, 200 \u0026micro;L cell suspension was injected into the right axilla of the mice subcutaneously[\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e]. When the average tumor size reached 150 mm\u003csup\u003e3\u003c/sup\u003e, mice injected with HS683 cells transfected with vector were randomized into Vector and Vector\u0026thinsp;+\u0026thinsp;erlotinib groups, and mice injected with HS683 cells transfected with oe-LGR4 were randomized into oe-LGR4, oe-LGR4\u0026thinsp;+\u0026thinsp;BAI and oe-LGR4\u0026thinsp;+\u0026thinsp;erlotinib groups (n\u0026thinsp;=\u0026thinsp;6). The mice in the Vector\u0026thinsp;+\u0026thinsp;erlotinib and oe-LGR4\u0026thinsp;+\u0026thinsp;erlotinib were intraperitoneally injected with 10 mg/kg erlotinib (ERL, EGFR inhibitor) once a day[\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e], and the mice in the oe-LGR4\u0026thinsp;+\u0026thinsp;BAI were administrated with 40 mg/kg BAI once a day[\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e]. In parallel, the mice in the Vector and oe-LGR4 groups received saline in the same way, all the treatments were last for 30 days. During the experiment, the tumor volume of the mice was recorded every 5 days. After finishing the last injection, the animals were euthanized, the tumor tissues were removed and weighed immediately. After that, tumor tissues were immersed in paraformaldehyde, embedded in paraffin and cut into slices for Immunohistochemistry, Terminal-deoxynucleotidyl transferase mediated nick end labeling (TUNEL) and western blot assays.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003e2.15 Statistical analysis\u003c/h2\u003e\n \u003cp\u003eThe study was analyzed with SPSS 16.0, and the data was displayed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Student\u0026rsquo;s t-test was used to compare the differences between two groups, and Multiple group comparisms were made by one-way ANOVA and Tukey tests. The Kruskal-Wallis H test was applied when variances were not homogeneous. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 LGR4 was highly expressed in GBM and related to poor prognosis\u003c/h2\u003e\n \u003cp\u003eFirstly, the expression of LGR4 in GBM was analyzed by the GEPIA database, and the results revealed that the expression of LGR4 in 518 GBM tissues was higher than that in 207 normal tissues, meanwhile, high LGR4 expression in GBM predicted poor outcome (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA-B). In addition, HPA also demonstrated LGR4 was highly expressed in the brain tissues of GBM patients (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). Next, in order to further confirm LGR4 expression in GBM, qPCR and western blotting were conducted to measure LGR4 expression in human astrocytes (SVGP12) and GBM cells. The results showed both at the mRNA level and protein level, LGR4 expression was higher in GBM cells than in astrocytes, especially in HS683 and KNS89 cells(Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). Therefore, HS683 and KNS89 cells were chosen for the following experiments.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Knockdown of LGR4 suppressed the malignant behaviour and EGFR phosphorylation of GBM cells\u003c/h2\u003e\n \u003cp\u003eIn order to explore the role of LGR4 in cellular behaviour, three siRNAs targeting human LGR4 were designed to knock down LGR4 expression in HS683 and KNS89 cells. LGR4 knock-down efficiency was verified by qPCR and western blotting. si-LGR4-3 was selected for subsequent experiments for its higher knockdown efficiency (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA-B).\u003c/p\u003e\n \u003cp\u003eBased on results obtained from GEPIA and HPA databases, we conjectured that LGR4 may facilitate GBM cellular malignant behaviour. Hence, CCK-8, colony formation, EdU, apoptosis as well as Transwell assay were utilized to detect the effect of LGR4 knockdown on GBM. As expected, LGR4 knockdown significantly inhibited the viability (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC), proliferation (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD-E), migration and invasion (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eG) of GBM cells, but upregulated the apoptosis rate of GBM cells (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF). Furthermore, western blotting was conducted to further demonstrated the role of LGR4 knockdown on GBM cellular apoptosis as well as migration and invasion (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). Of note, western blot also demonstrated that LGR4 knockdown decreased the phosphorylation of EGFR in GBM cells.\u003c/p\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e3.3 BAI inhibited cellular malignant behaviour, blocked the LGR4-EGFR pathway and interacted with LGR4 in GBM cells\u003c/strong\u003e\u003c/p\u003e\n \u003c/span\u003e\n \u003cp\u003eThen, HS683 and KNS89 cells were treated with increasing doses of BAI for 24, 48 and 72 h and applied CCK-8 assay to measure cellular viability; the results revealed that BAI effectively reduced the viability of GBM cells in a dose- and time-dependent fashion (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). When the concentration of BAI above or equal to 20 \u0026micro;M, BAI significantly affect GBM cellular viability, no matter the treatment time was 24 h, 48 h or 72 h. However, after treatment for 48 h, 0-160 \u0026micro;M of BAI did not affect the viability of astrocytes (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB). Therefore, 20 \u0026micro;M, 40 \u0026micro;M, 80 \u0026micro;M and 48 h were selected for the following experiments.\u003c/p\u003e\n \u003cp\u003eAdditionally, we also observed that relative to the controls, BAI decreased the number (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC), colony-formation ability (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD), proliferation (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eE), migration and invasion of GBM cells (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA), but enhanced the apoptosis of GBM cells (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eF). qPCR also found that BAI could blockade the expression of LGR4, AXIN2, CD44, SOX2 and OCT4 mRNA (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB). All the effects were presented in a dose-dependent manner. Furthermore, western blotting results further suggested the function of BAI on GBM cellular malignant behaviour (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC). More importantly, western blot found that LGR4/EGFR pathway were blocked in BAI treatment groups (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e\n \u003cp\u003eUpon binding to different ligands, LGR4 can activate the EGFR, thereby contributing to the development of tumor progression, invasion and metastasis[\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e]. Thus, we speculated the role of BAI on GBM was related to LRG4. MST data demonstrated there was a relatively high affinity between BAI and LGR4 in GBM cells, the Kd values between BAI and LGR4 in HS683 cells and KNS89 cells were about 4.56 M and 4.68 M, respectively (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE). Apart from that, CETSA was performed to further verify the binding of BAI to LGR4 in GBM cells; the results showed that the thermal stability of LGR4 in the GBM cells was increased with the upregulated temperature, indicating there was a direct interaction between BAI and LGR4 (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4 LGR4-induced malignant behaviour in GBM cells was rescued by BAI and EGFR inhibitor\u003c/h2\u003e\n \u003cp\u003eTo explore the potential molecular mechanism of BAI on GBM, we treated the cell transfected with oe-LGR4 with 2 \u0026micro;M of EGFR inhibitor (ERL) or 80 \u0026micro;M of BAI. First, we measured the viability of GBM cells using CCK-8 assay. As illustrated in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA, GBM cells transfected with oe-LGR4 exhibited raised cell viability, however, after treatment with BAI, the viability of GBM cells transfected with oe-LGR4 were significantly decreased, which was similar to that of the oe-LGR4\u0026thinsp;+\u0026thinsp;ERL group. Furthermore, colony formation analysis (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB) as well as apoptosis detection (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC) were carried out to check the mechanism of BAI on GBM. As expected, oe-LGR4 induced the proliferation but inhibited the apoptosis of GBM cells, however, the situation was reversed by BAI, similar to ERL. Thus, we hypothesized that EGFR may be a key gene for the over-expression LGR4 caused GBM. To test the relationship between LGR4 and EGFR, western blot was performed. The results shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD revealed that interference of LGR4 expression could also efficiently interfere with EGFR expression. Then, si-LRG4 and oe-LGR4 transfected GBM cells were treated with 20 \u0026micro;M of MG132 (proteasome inhibitor) for 8 h and 100 \u0026micro;g/mL of CHX (protein synthesis inhibitor) to measure the level of LGR4 and EGFR. The results found that si-LGR4 accelerated EGFR protein degradation and oe-LGR4 inhibited EGRE protein degradation (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eE-F).\u003c/p\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e3.5 The inhibition of GBM cell growth by LGR4 knockdown was reversed by EGFR overexpression and CBL knockdown\u003c/strong\u003e\u003c/p\u003e\n \u003c/span\u003e\n \u003cp\u003eTo reveal the underlying molecular mechanism of LGR4 knockdown regulation of cell malignant behaviour in GBM cells, si-LGR4 and oe-EGFR were co-transfected into HS683 and KNS89 cells. First, LGR4 knockdown downregulated EGFR protein expression, nevertheless, after transfection with oe-EGFR, this downregulation was reserved (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA). Next, the function of oe-EGFR on si-LGR4 induced cell proliferation and hampered cell apoptosis were detected. The colony formation assay showed that oe-EGFR could rescue LGR4 knockdown impaired cell proliferation ability (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB). The apoptosis detection indicated that LGR4 knockdown accelerated the apoptosis of GBM cells, but the effect was abolished by oe-EGFR (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC).\u003c/p\u003e\n \u003cp\u003eCBL is an E3 ubiquitin-protein ligase that drives EGFR proteasomal degradation. Accumulating evidence has reported that CBL protein can serve as a tumor suppressor in numerous cancer, including GBM[\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e]. Accordingly, we further verified the mechanism of LGR4 knockdown on GBM. As displayed in Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eA, si-LGR4 blocked LGR4 protein expression but increased CBL protein expression. In addition, Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003eB-D found that LGR4 knockdown effectively decreased EGFR protein expression, inhibited cell proliferation and facilitated cell apoptosis, in HS683 and KNS89 cells. However, those situations were all rescued by si-CBL.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003e3.6 BAI inhibited LGR4 induced GBM development by suppressing EGFR \u003cem\u003ein vivo\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eFor confirming the role and mechanism of BAI on GBM, HS683 cells were used to generate an \u003cem\u003ein vivo\u003c/em\u003e xenograft model. According to our results, compared to the oe-LGR4 group, the tumor volume of oe-LGR4\u0026thinsp;+\u0026thinsp;BAI group was significantly decreased from day 10, and the weight of the tumor was also reduced obviously after completing the treatment (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eA). Additionally, compared to the oe-LGR4 group, the expression of Ki67 was decreased while the apoptosis was increased in the tumor tissues of the oe-LGR4\u0026thinsp;+\u0026thinsp;BAI group (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eB-C). Interestingly, those trends were also observed in the oe-LGR4\u0026thinsp;+\u0026thinsp;ERL group. What is more, oe-LGR4 increased the protein expressions of LGR4 and EGFR, but decreased the protein expression of CBL, those changes were reversed by treating BAI as well as ERL, especially for BAI (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003eD).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eGBM is the deadliest brain tumor for adults, with still no cure with a short median survival (about 15 months)[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Despite some developments in GBM therapies, the prognosis of GBM patients is still dismal[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. At present, there are only a few drugs have gained Food and Drug Administration approval for treating GBM in the clinic, however, since the high malignancy as well as intensive invasion of GBM cells, those drugs are not generally effective[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Thus, further investigating the mechanism and finding new therapeutic methods for GBM are urgent. In this study, we reported the therapeutic effect and the possible action mechanism of BAI on GBM \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo.\u003c/em\u003e\u003c/p\u003e \u003cp\u003eCancer is featured by uncontrolled cell proliferation and apoptosis, thus, repressing cell proliferation and inducing cell apoptosis have been regarded as an effective approach to treat the majority of cancer, including GBM[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Increasing studies have revealed that various plant-derived compounds can be used for treating cancers, due to their function on the regulation of cell growth and death[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Flavonoids are ubiquitously spread in plants, and have been proposed as an important source of new chemotherapeutic drugs to treat cancer due to their various cellular mechanisms of action and low adverse effects[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. BAI is a kind of flavonoid isolated from dry roots of \u003cem\u003eS.baicalensis\u003c/em\u003e, has been reported to induce autophagy and apoptosis in BC cells by inhibiting PI3K/AKT pathway \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In addition, BAI also has been found to repress the proliferation and block the cell cycle of colorectal cancer cells through decreasing Ezrin and activating P53 pathway-associated proteins[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. However, virtually no research assessed the role of BAI on GBM. In this study, our data showed after treatment with BAI, the malignant behaviour of GBM cells was repressed, indicating that BAI may alleviate GBM by inhibiting proliferation and inducing apoptosis of GBM cells.\u003c/p\u003e \u003cp\u003eLGR4 is broadly expressed in many tissues, and the importance of LGR4 has been gradually acknowledged by scholars in cancer development[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. On the one hand, LGR4 itself is a key gene for controlling oncogenesis, metastasis and CSC maintenance in BC, high LGR4 expression implied a poor prognosis in patients with BC[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. On the other hand, LGR4 promotes cancer occurrence and development via activating multiple pathways, such as EGFR transactivation. For example, LGR4 promoted the migration and proliferation of keratinocyte cells, and the effect was related to the activation of the EGFR/ERK/STAT3 pathway[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Zhang et al. also have demonstrated that by targeting LGR4, miR-137 inhibits the migration and epithelial-mesenchymal transition (EMT) of prostate cancer cells via EGFR/ERK pathway[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In agreement with previous research, in the present study, we found LGR4 was highly expressed in GBM patients and GBM cells, patients with higher LGR4 expression have worse survival, thus, we speculated that LGR4 repression may act as an effective approach to improve GBM via inactivating EGFR.\u003c/p\u003e \u003cp\u003eIn order to verify our hypothesis, RNA interference technology was applied to control LGR4 expression, and found that reducing LGR4 expression inhibited cellular malignant behaviour and downregulated EGFR phosphorylation in GBM cells, consistent with published research that EGFR was lowly expressed in the tissues of LGR4 knockout animals[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Further investigation revealed that LGR4 overexpression facilitated cell proliferation and blocked apoptosis for GBM cells, but the trends were reserved by EGFR inhibitor. These results provided compelling evidence that EGFR is essential for LGR4 to facilitate the progression of GBM. BAI has been reported to have the potential to treat HCC or BC by negatively regulating EGFR/ERK/NF-κβ pathway[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] or EGFR/ERK/Akt pathway[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Consistently, \u003cem\u003ein vitro\u003c/em\u003e experiments revealed that after treatment with BAI, the expressions of LGR4 and EGFR were decreased and BAI interacted with LGR4 directly. Collectively, those data implied BAI may inhibit proliferation and induce apoptosis of GBM cells by downregulating the LGR4-EGFR pathway. However, what is the specific mechanism of LGR4 on EGFR?\u003c/p\u003e \u003cp\u003eCBL is a member of the CBL family, closely associated to tumor occurrence and progression[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. As a ubiquitin ligase, CBL is able to directly or indirectly bind to activated EGFR and promote its ubiquitination, thereby regulating the targeted degradation of the receptor in the lysosome[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. More simply put, EGFR signaling is negatively regulated by CBL ubiquitylation[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In triple-negative breast cancer (TNBC), CBL phosphorylation and inactivation mediated by UBASH3B leads to the upregulation of EGFR, which in turn promotes proliferation, invasion and metastasis of TNBC cells[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In addition, miR-675 and its precursor H19 enhance the stability and activity of EGFR and c-Met through direct binding of CBL mRNA, thereby promoting the growth and metastasis of BC[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In the study, we examined how LGR4 loss affects EGFR-CBL interaction, and found that LGR4 loss elevated CBL expression but decreased EGFR expression, in addition, si-LGR4 repressed cell growth and induced apoptosis was reserved by CBL knockdown, which indicated LGR4 loss augmented CBL binding to EGFR, and confirms the mechanism of BAI on GBM.\u003c/p\u003e \u003cp\u003eIn conclusion, our data demonstrated that BAI exerted anti-cancerous functions in GBM by inhibiting cell proliferation and inducing apoptosis via downregulation of the LGR4-EGFR pathway. These findings strengthened our experimental results and the clinical application of BAI in GBM, and suggested that the LGR4-EGFR pathway is a novel therapeutic target in GBM treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u003c/strong\u003e The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003eAcknowledgements: Not applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003eXZ conceived and designed the work, acquired data; XS conceived and designed the work, played an important role in interpreting the results; QB conceived and designed the work, acquired data; LH drafted or revised the manuscript; XQ, drafted or revised the manuscript and approved the final version.\u003c/p\u003e\n\u003cp\u003eFunding: This work was supported by the Shaoxing Municipal Science and Technology Plan Project of China [grant number 2022A14022]; and the Shaoxing Health Science and Technology Project of China [grant number 2022KY003].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval:\u003c/strong\u003e All animal experiments were approved by the Animal Experimentation Ethics Committee of Zhejiang Eyong Pharmaceutical Research and Development Center (Certificate No. SYXK (Zhe) 2021-0033).\u003c/p\u003e\n\u003cp\u003eCompeting Interests: The authors declare no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWang, H., et al., \u003cem\u003eAdditional Diagnostic Value of Unenhanced Computed Tomography plus Diffusion-Weighted Imaging Combined with Routine Magnetic Resonance Imaging Findings of Early-Stage Gliblastoma.\u003c/em\u003e Biomed Res Int, 2020. 2020: p. 1672736.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong, J., et al., \u003cem\u003ePulsatillaSB365, Saponin D Induces Caspase-Independent Cell Death and Augments the Anticancer Effect of Temozolomide in Glioblastoma Multiforme Cells\u003c/em\u003e. Molecules, 2019. 24(18): p. 3230.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y., et al., \u003cem\u003eβ-Arrestin 1 has an essential role in neurokinin-1 receptor-mediated glioblastoma cell proliferation and G/M phase transition.\u003c/em\u003e J Biol Chem, 2017. 292(21): p. 8933\u0026ndash;8947.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrisch, A., et al., \u003cem\u003eApelin Controls Angiogenesis-Dependent Glioblastoma Growth\u003c/em\u003e. Int J Mol Sci 2020. 21(11): p. 4179.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu, C., et al., \u003cem\u003eLgr4 promotes glioma cell proliferation through activation of Wnt signaling\u003c/em\u003e. Asian Pac J Cancer Prev, 2013. 14(8): p. 4907\u0026ndash;4911.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKashyap, M. and O. Abdel-Rahman, \u003cem\u003eExpression, regulation and targeting of receptor tyrosine kinases in esophageal squamous cell carcinoma\u003c/em\u003e. Mol Cancer, 2018. 17(1): p. 54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, Y., et al., \u003cem\u003eEffect of LGR4/EGFR signaling on cell growth and cancer stem cell-like characteristics in liver cancer\u003c/em\u003e. Cytokine, 2023. 165: p. 156185.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYue, F., et al., \u003cem\u003eA Wnt-Independent LGR4-EGFR Signaling Axis in Cancer Metastasis\u003c/em\u003e. Cancer Res, 2021. 81(17): p. 4441\u0026ndash;4454.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai, P., et al., \u003cem\u003eBaicalein ameliorates osteoporosis via AKT/FOXO1 signaling.\u003c/em\u003e 34198266, 2021. 13(13): p. 17370\u0026ndash;17379.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, J., et al., \u003cem\u003eMiR-3663-3p participates in the anti-hepatocellular carcinoma proliferation activity of baicalein by targeting SH3GL1 and negatively regulating EGFR/ERK/NF-κB signaling\u003c/em\u003e. Toxicol Appl Pharmacol, 2021. 420: p. 115522.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShang, D., et al., \u003cem\u003eBaicalein suppresses 17-β-estradiol-induced migration, adhesion and invasion of breast cancer cells via the G protein-coupled receptor 30 signaling pathway\u003c/em\u003e. Oncol Rep, 2015. 33(4): p. 2077\u0026ndash;2085.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang, B. and Y. Dong, \u003cem\u003eNetwork pharmacology and bioinformatics analysis on the underlying mechanisms of baicalein against oral squamous cell carcinoma\u003c/em\u003e. J Gene Med, 2023: p. e3490.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu, H., et al., \u003cem\u003eTargeting connexin 43 provides anti-inflammatory effects after intracerebral hemorrhage injury by regulating YAP signaling\u003c/em\u003e. J Neuroinflammation, 2020. 17(1): p. 322.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Mercier, M., et al., \u003cem\u003eEvidence of galectin-1 involvement in glioma chemoresistance\u003c/em\u003e. Toxicol Appl Pharmacol 2008. 229(2): p. 172\u0026ndash;183.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, K., et al., \u003cem\u003eUrsolic acid promotes apoptosis and mediates transcriptional suppression of CT45A2 gene expression in non-small-cell lung carcinoma harbouring EGFR T790M mutations\u003c/em\u003e. Br J Pharmacol 2019. 176(24): p. 4609\u0026ndash;4624.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, C., et al., \u003cem\u003eBaicalein Restores the Balance of Th17/Treg Cells via Aryl Hydrocarbon Receptor to Attenuate Colitis.\u003c/em\u003e Mediators Inflamm, 2020. 2020: p. 5918587.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOrdaz-Ramos, A., et al., \u003cem\u003eThe Role of LGR4 (GPR48) in Normal and Cancer Processes\u003c/em\u003e. Int J Mol Sci, 2021. 22(9): p. 4690.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRojas-R\u0026iacute;os, P., et al., \u003cem\u003eCblAubergine and piRNAs promote germline stem cell self-renewal by repressing the proto-oncogene\u003c/em\u003e. EMBO J, 2017. 36(21): p. 3194\u0026ndash;3211.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNadeem Abbas, M., et al., \u003cem\u003eAdvances in Targeting the Epidermal Growth Factor Receptor Pathway by Synthetic Products and Its Regulation by Epigenetic Modulators As a Therapy for Glioblastoma\u003c/em\u003e. Cells, 2019. 8(4): p. 350.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, K., et al., \u003cem\u003eMolecular and clinical characterization of TMEM71 expression at the transcriptional level in glioma\u003c/em\u003e. CNS Neurosci Ther, 2019. 25(9): p. 965\u0026ndash;975.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang, R., et al., \u003cem\u003eRGS16 promotes glioma progression and serves as a prognostic factor\u003c/em\u003e. CNS Neurosci Ther, 2020. 26(8): p. 791\u0026ndash;803.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFaghfoori, Z., et al., \u003cem\u003eAnticancer effects of bifidobacteria on colon cancer cell lines\u003c/em\u003e. Cancer Cell Int, 2021. 21(1): p. 258.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagesh, P., et al., \u003cem\u003eTannic acid inhibits lipid metabolism and induce ROS in prostate cancer cells\u003c/em\u003e. Sci Rep, 2020. 10(1): p. 980.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia-Oliveira, P., et al., \u003cem\u003eStatus and Challenges of Plant-Anticancer Compounds in Cancer Treatment\u003c/em\u003e. Pharmaceuticals (Basel), 2021. 14(2): p. 157.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan, W., et al., \u003cem\u003eBaicalein induces apoptosis and autophagy of breast cancer cells via inhibiting PI3K/AKT pathway in vivo and vitro\u003c/em\u003e. Drug Des Devel Ther, 2018. 12: p. 3961\u0026ndash;3972.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, Z., et al., \u003cem\u003eBaicalein Inhibits Proliferation Activity of Human Colorectal Cancer Cells HCT116 Through Downregulation of Ezrin\u003c/em\u003e. Cell Physiol Biochem, 2018. 49(5): p. 2035\u0026ndash;2046.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo, W., et al., \u003cem\u003eLeucine-rich repeat-containing G protein-coupled receptor 4 (Lgr4) is necessary for prostate cancer metastasis via epithelial-mesenchymal transition\u003c/em\u003e. J Biol Chem, 2017. 292(37): p. 15525\u0026ndash;15537.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYue, Z., et al., \u003cem\u003eLGR4 modulates breast cancer initiation, metastasis, and cancer stem cells\u003c/em\u003e. FASEB J, 2018. 32(5): p. 2422\u0026ndash;2437.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z., et al., \u003cem\u003eGPR48-Induced keratinocyte proliferation occurs through HB-EGF mediated EGFR transactivation\u003c/em\u003e. FEBS Lett, 2010. 584(18): p. 4057\u0026ndash;4062.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, H., et al., \u003cem\u003eMicroRNA\u0026ndash;137 regulates hypoxia\u0026ndash;mediated migration and epithelial\u0026ndash;mesenchymal transition in prostate cancer by targeting LGR4 via the EGFR/ERK signaling pathway\u003c/em\u003e. Int J Oncol, 2020. 57(2): p. 540\u0026ndash;549.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStevens, P. and B. Williams, \u003cem\u003eLGR4: Not Just for Wnt Anymore?\u003c/em\u003e Cancer Res, 2021. 81(17): p. 4397\u0026ndash;4398.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDaniels, S., et al., Loss of function Cbl-c mutations in solid tumors. 2019. 14(7): p. e0219143.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWee, P. and Z. Wang, \u003cem\u003eRegulation of EGFR Endocytosis by CBL During Mitosis\u003c/em\u003e. Cells, 2018. 7(12): p. 257.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOliveira-Cunha, M., W. Newman, and A. Siriwardena, \u003cem\u003eEpidermal growth factor receptor in pancreatic cancer\u003c/em\u003e. Cancers (Basel), 2011. 3(2): p. 1513\u0026ndash;1526.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee, S., et al., \u003cem\u003eProtein tyrosine phosphatase UBASH3B is overexpressed in triple-negative breast cancer and promotes invasion and metastasis\u003c/em\u003e. Proc Natl Acad Sci USA, 2013. 110(27): p. 11121\u0026ndash;11126.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVennin, C., et al., \u003cem\u003eH19 non coding RNA-derived miR-675 enhances tumorigenesis and metastasis of breast cancer cells by downregulating c-Cbl and Cbl-b\u003c/em\u003e. Oncotarget, 2015. 6(30): p. 29209\u0026ndash;29223.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cancer-gene-therapy","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cgt","sideBox":"Learn more about [Cancer Gene Therapy](http://www.nature.com/cgt/)","snPcode":"41417","submissionUrl":"https://mts-cgt.nature.com/cgi-bin/main.plex","title":"Cancer Gene Therapy","twitterHandle":"@cgtnature","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Baicalein, glioblastoma, LGR4-EGFR pathway, cell proliferation, apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-4116136/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4116136/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePatients with glioblastoma (GBM) have poor prognoses and limited therapeutic options. LGR4 was reported to overexpressed in GBM and involved in tumorigenesis of many cancers, Baicalein (BAI) is a kind of flavonoid that exhibited anti-tumor effects in various tumors. However, the function and association of BAI and LGR4 in GBM are still unclear. In thisi study, firstly, GEPIA and HPA databas was used to perform expression and survival analysis of LGR4 in GBM patients. Then, the significance of LGR4-EGFR in GBM cells (HS683 and KNS89) and GBM animal models was explored by RNA interference and subcutaneous transplantation. Additionally, GBM cells were treated with BAI to explore the role and mechanism of BAI involved in GBM. The results showed that LGR4 was highly expressed in GBM and related to bad prognosis. LGR4 knockdown obviously repressed the proliferation and EGFR expression but induced apoptosis in GBM cells, however, the situations were reserved by EGFR overexpression and CBL knockdown. In contrast, both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments revealed LGR4 overexpression facilitated GBM cellular biological activities and promoted tumor development, but the effects were rescued by BAI and EGFR inhibitor. In addition, si-LGR4 accelerated EGFR protein degradation while oe-LGR4 exhibit opposite effect. Without affecting normal cellular viability, BAI inhibited malignant behaviour, interacted with LGR4 and blocked the LGR4-EGFR pathway in both GBM cells. Taken together, our data suggested that BAI could inhibit GBM cell proliferation and induce apoptosis via downregulation of the LGR4-EGFR pathway, and the LGR4-EGFR pathway may be an underlying target for GBM therapy of BAI.\u003c/p\u003e","manuscriptTitle":"Baicalein inhibits cell proliferation and induces apoptosis in glioblastoma by downregulating LGR4-EGFR pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-02 20:20:38","doi":"10.21203/rs.3.rs-4116136/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-06-05T10:46:46+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-06-04T07:35:29+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-05-29T12:21:19+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-05-14T04:40:12+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-05-13T05:35:49+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-03-28T15:09:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-28T10:29:56+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cancer Gene Therapy","date":"2024-03-28T02:37:55+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2024-03-19T10:53:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-17T08:45:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cancer-gene-therapy","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cgt","sideBox":"Learn more about [Cancer Gene Therapy](http://www.nature.com/cgt/)","snPcode":"41417","submissionUrl":"https://mts-cgt.nature.com/cgi-bin/main.plex","title":"Cancer Gene Therapy","twitterHandle":"@cgtnature","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"34ca3deb-7adb-479a-a4ad-3bf5b15fefa6","owner":[],"postedDate":"April 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":30009922,"name":"Health sciences/Diseases/Cancer/Cancer therapy/Drug development"},{"id":30009923,"name":"Health sciences/Diseases/Cancer/Cancer genetics"}],"tags":[],"updatedAt":"2024-10-29T07:10:51+00:00","versionOfRecord":{"articleIdentity":"rs-4116136","link":"https://doi.org/10.1038/s41417-024-00825-0","journal":{"identity":"cancer-gene-therapy","isVorOnly":false,"title":"Cancer Gene Therapy"},"publishedOn":"2024-10-28 04:00:00","publishedOnDateReadable":"October 28th, 2024"},"versionCreatedAt":"2024-04-02 20:20:38","video":"","vorDoi":"10.1038/s41417-024-00825-0","vorDoiUrl":"https://doi.org/10.1038/s41417-024-00825-0","workflowStages":[]},"version":"v1","identity":"rs-4116136","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4116136","identity":"rs-4116136","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}