TNF-α 238 Alleles Polymorphism and its Association with TNF-α Levels in the Severe Malaria Anemia among Sudanese Children

TNF-α 238 Alleles Polymorphism and its Association with TNF-α Levels in the Severe Malaria Anemia among Sudanese Children | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article TNF-α 238 Alleles Polymorphism and its Association with TNF-α Levels in the Severe Malaria Anemia among Sudanese Children Khalid Abdelsamea Mohamedahmed, Bakri Yousif Mohammed Nour, Roa Osman Elsumani Koko, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6158689/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background TNF-α levels overproduction and promoter polymorphisms at TNF-α 238 alleles may play central role in reduced red cell production and malaria-related anemia through suppression of bone marrow erythropoiesis and Dyserythropoiesis. This study aimed to evaluate the TNF-α 238 alleles polymorphism and its association with TNF-α levels in the children with falciparum malaria. Methods A longitudinal hospital-based study was conducted among 100 children with severe falciparum malaria (mean age 8.63 ± 3.40 years) and 100 children with uncomplicated falciparum malaria (mean age 8.83 ± 4.20 years). TNF-α level was measured using Human TNF-α ELISA MAX™ Deluxe Sets. PCR was used for detecting TNF-α 238 alleles polymorphism. Obtained data were analyzed by SPSS (V 20.0) and Stat disk (V 13.0). Results TNF-α 238A allele was a common allele (66.8%). Falciparum malaria-related anemia accounted for 32%, commonly in SM (55%) compared to UM (9%) ( P value 0.000). Otherwise, The average of TNF-α levels strongly positively correlated with the severity of anemia (r + 0.309; P value 0.000). The TNF-α 238 A allele accounts for 83.6% of malaria anemia ( P value 0.000) and 100% severe anemia ( P value 0.000). Conclusion Overproduction of TNF-α is essential for the elimination and clearance of falciparum parasite but may be associated with severity of malaria and malaria anemia. Overproduction of TNF-α in children with TNF-α 238 A allele may result in falciparum malaria-related anemia among children. These findings will assist clinicians in better managing severe malaria-related anemia cases. Immunology Infectious Diseases Hematology Falciparum malaria anemia TNF-α levels TNF-α 238 alleles RBCs parameters Sudanese children Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Malaria is a human intracellular protozoan parasitic disease caused by female anopheline mosquitoes inoculated genus Plasmodium parasite ( P. falciparum, P. vivax, P. malariae , P. ovale , and P. knowlesi ) (Recker et al., 2018). Falciparum malaria is still a major health problem in Sudan accounts for up to 80% of malaria cases globally (World Health Organization (WHO), 2018 ) and about 87.6% of malaria cases in Sudan (Mohamedahmed et al., 2019b, Mohamedahmed et al., 2020b). The disease is becoming more prevalent due to poor sanitation and a lack of strong preventive factors. Children suffer more malaria episodes and are more prone to severe malaria compared to adults and accounted for 61% (266 000) of all malaria deaths. In fact, about 285,000 children died before their fifth birthdays in 2016 in Africa (World Health Organization (WHO), 2018 ). Falciparum malaria may result in variable clinical symptoms, ranging from very mild symptoms to severe disease and even death (Mohamedahmed et al., 2020b). Falciparum Malaria can be categorized in two groups: uncomplicated or complicated (severe) (Mohamedahmed and Abakar, 2020 ). The classical uncomplicated malaria (UM) has three stages (cold stage, a hot stage, and a sweating stage) (Mawson, 2013 ). If falciparum malaria is not treated properly may occur the following complications: cerebral malaria, severe anemia, hemoglobinuria, pulmonary edema, thrombocytopenia, cardiovascular collapse, shock, kidney failure, hyperparasitemia, metabolic acidosis and hypoglycemia (Mawson, 2013 ). Falciparum malaria is linked to a number of hematological abnormalities involving the major blood cell types, including red blood cells, white blood cells, and platelets (Antwi-Baffour et al., 2018 , Mohamedahmed et al., 2020a ), all of which play factors in the disease's severity Mohamedahmed, Ahmed et al. 2020). Malaria-related anemia can result in death, especially among vulnerable populations such as children. WHO defines mild anemia as a Hb of between 10 g/dL and 10.9 g/dL, moderate anemia as between 7 g/dL and 9.9 g/dL, and severe anemia as below 7 g/dL; A surveys conducted in 16 African countries between 2015 and 2017 showed that the prevalence among young children with positive for malaria showed anemia was 79%, mild anemia 21%, moderate anemia 50% and severe anemia 8% (World Health Organization (WHO), 2018 ). The first-line defense against malaria is innate immune cells and their cytokines (TNF-α, IL-12, IFN-γ, and NO), and second line is adaptive immune response primarily depends on the actions of the α/β T cells (CD + 4, CD + 8) and the B cells (Urban et al., 2001 ). Tumor necrosis factor (TNF-α) is a common proinflammatory cytokine. TNF-α is plays a central role in malaria pathogenicity either in the cure or complication of malaria. Their high level and is associated with severe falciparum malaria and is equivocal. Polymorphisms in the TNF-α gene have been associated with increased susceptibility to severe malaria (Mohamedahmed et al., 2019a , Flori et al., 2005 , Mohamedahmed, 2023 ). Many studies have detected the TNF SNPs at TNF-α 238 exhibit differential associations to malaria and TNF-α production in different populations (McGuire et al., 1999 , Aidoo et al., 2001 , Cabantous et al., 2006 , Ubalee et al., 2001 , Mcguire et al., 1994 ). TNF-α levels overproduction and promoter polymorphisms at TNF-α 238 alleles may play a central role in reduced red cell production and malaria-related anemia through suppression of bone marrow erythropoiesis and dyserythropoiesis (Abdalla and Pasvol, 2004 ). The purpose of this study was to compare and correlate TNF-α levels and TNF-α 238 alleles polymorphism (A allele/ G allele) between falciparum malaria severity and malaria anemia severity among Sudanese children with falciparum malaria. Material and Methods Study design, area, and population: A longitudinal hospital-based study was conducted among 200 Sudanese children at Wad Medani Pediatric Hospital, Gezira State, Sudan from November 2016 to June 2019. 100 children were previously diagnosed with severe falciparum malaria by blood film and WHO criteria, and 100 children were previously diagnosed with uncomplicated falciparum malaria by blood film or ICT (World Health Organization (WHO), 2015 ). Inclusion criteria: The study included sick children with falciparum malaria aging 1 month to 18 years old, from both genders, and residing in Gezira state who were admitted to Wad Medani Pediatric Teaching Hospital. Exclusion criteria: Sick children with mixed malaria or vivax malaria were excluded from this study. Those aging ≥ 18 years old, those residing outside Gezira State and those suffering from a recent infection, malignancy, and thrombosis, and those on anticoagulant and anti-inflammatory medication were also excluded. Ethical consideration: The ethical clearance was obtained from both Research and Ethics Committees in the Ministry of Health in Gezira State and Faculty of Medical Laboratory Sciences, University of Gezira. The ethical permission was obtained from Wad Medani Pediatric Teaching Hospital. Informed consent was written from each participant's parents. Define uncomplicated and severe falciparum malaria: Falciparum Malaria can be categorized in two groups: uncomplicated or complicated (severe) (Mohamedahmed and Abakar, 2020 ). The classical uncomplicated malaria (UM) has three stages (cold stage, a hot stage, and a sweating stage) diagnosed by blood film or ICT and clinical findings (Mawson, 2013 ) (World Health Organization (WHO), 2015 ). Severe falciparum malaria diagnosed by blood film and WHO criteria (presence of 2 or more the following complications: cerebral malaria, severe anemia, hemoglobinuria, pulmonary edema, thrombocytopenia, cardiovascular collapse, shock, kidney failure, hyperparasitemia, metabolic acidosis and hypoglycemia) (Mawson, 2013 ) (World Health Organization (WHO), 2015 ). Sample collection and preparation: 4 ml venous blood sample was collected by clean venipuncture for all patients. 2 ml in a plain container and 2 ml in EDTA container. Thin and thick films were prepared immediately. Serum was obtained immediately after blood collection by blood centrifugation of plain container at 1200 rpm for 10 min (Bain et al., 2011 ). RBCs parameters measurement and DNA extraction were done from the EDTA container. RBCs parameters measurement: RBCs parameters (RBCs count, Hb g/dl, PCV %, MCV fl, MCH pg, MCHC g/l) were determined using the Sysmex XP 300 N automated hematology analyzer (Sysmex, Kobe, Japan). Define anemia and the severity of the anemia: Anemia was defined as hemoglobin of less than 12 g/dl (World Health Organization (WHO), 2015 ). WHO defines mild anemia as a Hb of between 10 g/dL and 10.9 g/dL, moderate anemia as between 7 g/dL and 9.9 g/dL, and severe anemia as below 7 g/dL (World Health Organization (WHO), 2018 )]. TNF-α level measurement: ELISA was further processed for TNF-α level from serum sample using Human TNF-α ELISA MAX™ Deluxe Sets (BioLegend, Inc). DNA extraction: DNA extraction was done using G-DEX™IIb Genomic DNA Extraction Kit. The extracted DNA concentration was measured by reading the absorbance at 260 nm using a nanosystem. An absorbance ratio of 260 nm and 280 nm gives an estimate of the purity of the solution (DNA product concentration: 5 µg/l; DNA product purity: 1.68). All samples were store at -20°C till PCR amplification. TNF-α 238 alleles polymorphism analysis: PCR and gel running system were used for detecting TNF-α 238 Alleles polymorphism (A allele/ G allele). PCR was done to detect TNF-α 238 alleles polymorphism using conserved primer pairs (Macrogen, Korea) (Common TNF '' CCGGATCATGCTTTCAGTGC''; TNF 238A allele ''AGACCCCCCTCGGAATCG''; and TNF 238G allele ''AAGACCCCCCTCGGAATC'') to generate 459- and 460-bp products (McGuire et al., 1999 ). Common TNF-α primer was prepared by adding 300 µl deionized sterile water, TNF-α 238A allele and 238G allele primers were prepared by adding 320 µl D.W. Each of the primers was prepared as follows: 10µl of each stock primer (100 µM) were added to 90 µl PCR water (Deionized sterile water) and aliquoted in 0.5 ml PCR polypropylene tube to yield a concentration of 10µM, and the solution was mixed. PCR reaction contains PCR master mix (aPSLaBS, India), Common TNF-α primer, TNF-α 238A allele/238G allele primers, DNA, then the volume was completed to 20 µL by Deionized sterile water. PCR reaction was done using a PCR system (9700 thermocycler, Singapore). The mixture was incubated at 95°C for 10 min, followed by 5 cycles of 95°C for 1 min, 60°C for 1 min, 72°C for 1 min, then 25 cycles of 95°C for 1 min, 56°C for 1 min, 72°C for 1 min, and then a final 10 min at 72°C (McGuire et al., 1999 ). The products were resolved in 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light. Statistical analysis: Data were presented as means with their standard deviations. The SPSS (V 20.0) and Stat disk (V 13.0) were used for data analysis. T-test, correlation test, and One Way ANOVA were used to compare the results, at a 95% confidence interval, P value < 0.05 was considered as significant. Results The study was conducted on 100 children with severe falciparum malaria (SM) (mean age 8.63 ± 3.40 years; 61% boys; 49% girls), and 100 children with uncomplicated falciparum malaria (UM) (mean age 8.83 ± 4.20 years; 45% boys; 55% girls) from Gezira State, Sudan. Falciparum malaria-related anemia accounted for 32%, commonly in SM (55%) compared to UM (9%). Severe malaria anemia is most common in SM (3%). Fever was the most clinical finding account for 89% in SM and 81% in UM (Table 1 ). Table 1 Demographic and clinical characteristics of study participants. Factors Uncomplicated malaria (UM) – N = 100 Severe malaria (SM) – N = 100 All malaria cases N = 200 Age (years) (Mean ± SD) 8.83 ± 4.20 8.63 ± 3.40 8.43 ± 3.80 Age group (years) Less than 5 years 6–10 years 11–15 years More than 15 years 24 (24%) 41 (41%) 29 (29%) 6 (6%) 19 (19%) 47 (47%) 33 (33%) 1 (1%) 43 (21.5%) 88 (44%) 62 (31%) 7 (3.5%) Gender Boys Girls 45 (45%) 55 (55%) 61 (61%) 39 (39%) 106 (53%) 94 (47%) Residence Rural Urban 70 (70%) 30 (30%) 49 (49%) 51 (51%) 119 (59.5) 81 (40.5%) Clinical findings Fever Chills Fatigue 89 (89%) 40 (40%) 43 (43%) 81 (81%) 27 (27%) 59 (59%) 170 (85%) 67 (33.5%) 102 (51%) Anemia Anemic Non-anemic 55 (55%) 45 (45%) 9 (9%) 91 (91%) 64 (32%) 136 (68%) Severity of the anemia Mild Moderate Severe 23 (23%) 29 (29%) 3 (3%) 8 (8%) 1 (1%) - 31 (15.5%) 30 (15%) 3 (1.5%) TNF-α pg/ml Mean ± SD 112.42 ± 35.52 200.98 ± 92.77 156.70 ± 64.15 TNF-α 238 alleles polymorphism represent (130 [65%] for UM, 137 [68.5%] for SM) for (TNF-α 238A), (70 [35%] for UM, 63 [31.5%] for SM) for (TNF-α 238G) (Fig. 2 , 3 ). TNF-α 238 GA, AA, and GG account for (58, 36, and 6% respectively) in UM; while (51, 43, and 6% respectively) in SM (Figure: 4). The average of TNF-α levels in severe malaria and uncomplicated malaria were (200.98 ± 92.77 and 112.42 ± 35.52 pg/ml respectively) ( P value 0.000). The average TNF-α levels in anemic patients (196.34 ± 94.11 pg/ml) was higher than in non-anemic patients (122.97 ± 49.45 pg/ml) ( P value 0.000). The average of TNF-α levels in mild anemia, moderate anemia, and severe anemia was (190.75 ± 102.55, 189.70 ± 80.35 and 299.75 ± 82.27 pg/ml respectively) giving highly significant differences between them ( P value 0.000) and strong significant positive correlation ( r + 0.309; P value 0.000) (Table: 2). Table 2 Comparison of TNF-α levels between Severe (SM) and Uncomplicated falciparum malaria (UM): Factors TNF-α pg/ml Mean ± SD P value * Groups Severe malaria (SM) Uncomplicated malaria (UM) 200.98 ± 92.77 112.42 ± 35.52 0.000 Anemia Anemic Non-anemic 196.34 ± 94.11 122.97 ± 49.45 0.000 Clinical anemia Mild anemia Moderate anemia Severe anemia 190.75 ± 102.55 189.70 ± 80.35 299.75 ± 82.27 0.000 TNF-α 238 GA, AA and GG genotypes account for (58, 36 and 6% respectively) in UM; while (51, 43 and 6% respectively) in UM ( P value 0.586) (Table: 5). Table 3 Association between TNF-α 238 genotypes polymorphism and malaria severity. Polymorphism Uncomplicated malaria Severe malaria P value * TNF-α 238 GA 58 51 0.586 TNF-α 238 AA 36 43 TNF-α 238 GG 6 6 * P value > 0.05 TNF-α 238 AA account for 47 (73.4%) in anemic patients (70.9% in SM, 88.9% in UM), giving highly significant association between TNF-α 238 AA and malaria anemia ( P value 0.000); in both SM ( P value 0.000) and UM ( P value 0.015) (Table: 4). Table 4 Association between TNF-α 238 genotypes polymorphism & malaria anemia. Polymorphism Malaria patients = 200 SM = 100 UM = 100 Anemic Non anemic P value Anemic Non Anemic P value Anemic Non anemic P value 238 GA 13 96 0.000 12 39 0.000 1 57 0.015 238 AA 47 32 39 4 8 28 238 GG 4 8 4 2 0 6 * P value > 0.05 TNF-α 238 AA account for (21 [67.7%], 24 [80%] and 2 [66.7%] respectively) in mild, moderate and severe anemia, giving a highly significant association between TNF-α 238 AA and clinical types of malaria anemia ( P value 0.000), and also in SM ( P value 0.000) (Table: 5). Table 5 Association between TNF-α 238 genotypes polymorphism and clinical types of anemia. Polymorphism Malaria patients = 200 SM = 100 Mild Anemia Moderate Anemia Severe anemia P value * Mild anemia Moderate anemia Severe anemia P value * 238 GA 7 5 1 0.000 6 5 1 0.000 238 AA 21 24 2 14 23 2 238 GG 3 1 0 3 1 0 * P value > 0.05 The Risk difference (RD) of TNF-α 238 A allele for SM and malaria anemia (7.5 and 24.8% respectively); while The Risk ratio (RR) of TNF-α 238 A allele for SM and malaria anemia were (1.10 and 1.42 times respectively). The Risk difference (RD) of TNF-α 238 AA for SM and malaria anemia were (7.5 and 53.3% respectively); while The Risk ratio (RR) of TNF-α 238 AA for SM and malaria anemia were (1.20 and 3.13 times respectively) (Table: 6). Table 6 Risk difference (RD) and Risk ratio (RR) for TNF-α 238 A allele and AA genotype in SM and malaria anemia. Factors Severe malaria Malaria anemia RD for TNF-α 238 A allele 3.5% 24.8% RR for TNF-α 238 A allele 1.10 1.42 RD for TNF-α 238 AA genotype 7.5% 53.3% RR for TNF-α 238 AA genotype 1.20 3.13 Discussion Falciparum malaria is still a major health problem in Sudan accounts for up to 80% of malaria cases globally (World Health Organization (WHO), 2018 ) and about 87.6% of malaria cases in Sudan (Mohamedahmed et al., 2019b, Mohammed et al., 2020, Roll Back Malaria in Sudan, 2017). Poor sanitation and the absence of major protection are significantly leading to increased prevalence of the disease. Children suffer more malaria episodes and are more prone to severe malaria compared to adults and accounted for 61% (266 000) of all malaria deaths. In fact, about 285,000 children died before their fifth birthdays in 2016 in Africa According to the World Health Organization (World Health Organization (WHO), 2018 , Mohamedahmed and Abakar, 2020 ). therefore malaria remains the largest cause of childhood deaths in Africa (Roberts and Matthews, 2016 ). Tumor necrosis factor (TNF-α) is a common proinflammatory cytokine. TNF-α is playing a central role in malaria pathogenicity either in the cure or complication of malaria. Their high level and is associated with severe falciparum malaria and is equivocal. The current research aimed to light the association between TNF-α levels and TNF-α 238 alleles polymorphism with malaria severity and malaria anemia because thought TNF-α levels and their promoter is one of children predispose factor than others lead to malaria anemia. Polymorphisms in the TNF-α gene have been associated with increased susceptibility to severe malaria. The TNF-α promoter polymorphism at TNF-α 238 alleles have been associated with differential activity and production of TNF-α in addition associated with severe clinical outcome of malaria (Flori et al., 2005 , Ubalee et al., 2001 ). The present study was conducted on 200 Sudanese children from Gezira State. Samples were collected from 100 subjects (with mean age 8.63 ± 3.40 years; 61% boys) previously diagnosed as severe falciparum malaria (SM) by blood film and WHO criteria (World Health Organization (WHO), 2015 ); 100 subjects (with mean age 8.83 ± 4.20 years; 45% boys) previously diagnosed as uncomplicated falciparum malaria (UM) by blood film or ICT and 100 normal healthy controls. Similar studies were reported from different countries like Nigeria (Madukaku et al., 2015), Ethiopia (Birhanu et al., 2017 ), and Ghana (Frimpong et al., 2018 ). In the present study boys more than girls. Similarly, a survey was done in Sudan in 21,988 individuals to show the prevalence of malaria and results showed the infection was higher in males more than females (National Malaria Control Programme, 2010 ). The classical clinical finding was fever (81% for UM, 89% for SM). A study done by Rathod et al . showed that fever account for 97% of falciparum malaria (Rathod et al., 2012 ). TNF-α 238A allele was a common allele (66.8%) among Sudanese children with falciparum malaria (35.5% for boys and 31.3% for girls), and the G allele was rare (33.2%) (17.5% for boys and 15.7% for girls) (P value 0.132). While TNF-α 238 GA, AA, and GG account for (54.5, 39.5, and 6% respectively) among Sudanese children with falciparum. TNFA-α 238G was the common allele (0.95), and TNFA-α 238A was rare in Malian children (Cabantous et al., 2006 ), and The allele frequencies were 97.8% and 2.2% for TNF-α 238G and TNF-α 238A in Burkina Faso children (Flori et al., 2003 ). Falciparum malaria-related anemia accounted for 32%, commonly in SM (55%) compared to UM (9%). Mild malaria anemia, moderate malaria anemia and severe malaria anemia were accounts for 31%, 30%, and 3% respectively. A previous study reported malaria-related anemia prevalent among children was 19.8% in Cameron and prevalence of mild, moderate, and severe malaria anemia were 88.1, 5.6, and 5.6% respectively (Sumbele et al., 2015 ). The study done by Rathod et al . showed the malaria anemia account for 24.6% of falciparum malaria (Rathod et al., 2012 ). A similar study done in Sudan showed that malaria anemia account for 21.8% of falciparum malaria (Abdelnassir et al., 2019 ). The average of TNF-α levels in anemic (196.34 ± 94.11 pg/ml) was higher than the non-anemic patients (122.97 ± 49.45 pg/ml) giving highly significant differences between them (P value 0.000 and 0.004 respectively). Elevated plasma TNF-α levels promote the development of malaria-related in children (Thuma et al., 2011 , Daffa Alla and Sukkar, 2015 , Mandala et al., 2017 ). In contrast, McGuire et al . reported no association between TNF levels and malaria anemia (McGuire et al., 1999 ). The TNF-α overproduction in malaria can contribute to reduced red cell production and anemia through suppression of bone marrow erythropoiesis and dyserythropoiesis. TNF-α has been shown to suppress erythropoiesis through inhibition of BFU-E and CFU-E through decreasing their responsiveness to erythropoietin (Abdalla and Pasvol, 2004 , McGuire et al., 1999 , Ekvall, 2003 , Robson and Weatherall, 2009 , Mohamedahmed, 2023 ). Also, the suppressive effect of macrophages from patients on human BFU-E and CFU-E was shown to be mediated by TNF-α (Abdalla and Pasvol, 2004 ). Furthermore, TNF-α synergizes with hemozoin and nitric oxide in the inhibition of erythropoiesis (Mandala et al., 2017 , Awandare et al., 2011 ). On the other hand, Elevated TNF-α level and GM-CSF synergistically increase FcγR and CR expression on human neutrophils and monocytes thereby stimulated opsonin-dependent phagocytosis and thereby enhanced clearance of parasitized erythrocytes but the prolonged response was seen to contribute to adverse disease and thus was associated with severe disease syndromes (Thuma et al., 2011 , Deroost et al., 2016 ). Also, TNF-α overproduction in malaria may result from the upregulation of the expression of endothelial adhesion molecules such as ICAM-1 or other adhesion molecules, leading to enhanced sequestration of parasitized red cells and anemia through macrophage activation (Abdalla and Pasvol, 2004 , Lamikanra et al., 2015 ). More ever Reduced prostaglandin E2 production by hemozoin is reported to lead to overproduction of TNF-α and anemia (Keller et al., 2006 , Daffa Alla and Sukkar, 2015 ). In addition, TNF-α contributes to the anemia of chronic disease by the suppression of erythropoiesis and reduced erythroblast iron incorporation (Abdalla and Pasvol, 2004 , Spottiswoode et al., 2014). The average of TNF-α levels in mild, moderate and severe anemia were (190.75 ± 102.55, 189.70 ± 80.35 and 299.75 ± 82.27 pg/ml respectively) giving highly significant differences between them (P value 0.000) and strong significant positive correlation (r + 0.309; P value 0.000), and significant negative correlation with hemoglobin (r – 0.419; P value 0.000). Similar study showed mild, moderate and severe anemia were (108.9, 132.2 and 193.9 pg/ml respectively), giving highly significant differences between them and strong significant positive correlation with anemia severity and negative correlation with hemoglobin (Khan and Malik, 1996 ). Direct associations between severe malarial anemia was found for higher TNF-α concentration in children in Zambia (Thuma et al., 2011 ), Kenya (Othoro et al., 1999 ), Ghana (Kurtzhals et al., 1998 ) and Pakistani (Khan and Malik, 1996 ). In contrast other study have found no association between or high TNF-α and malarial anemia (Helleberg et al., 2005 ). In P. falciparum infected children, the TNF level was negative correlated with Hb levels (Deroost et al., 2016 , Ogonda et al., 2010 ). Continuous TNF-α overproduction increase suppression of bone marrow erythropoiesis and dyserythropoiesis and accelerated destruction of infected red blood cells result in enhancing severity of malaria anemia (Thuma et al., 2011 , Robson and Weatherall, 2009 , Ekvall, 2003 , Abdalla and Pasvol, 2004 , Deroost et al., 2016 ). In P. falciparum infected children, the TNF-α level was negatively correlated with hemoglobin levels (Deroost et al., 2016 , Ogonda et al., 2010 , Nussenblatt et al., 2001 ). TNF-α 238 A account for 53.5 (83.6%) from 64 anemic patients, giving highly significant association between TNF-α 238 A alleles (especially TNF-α 238 AA genotype [73.4%]) with malaria anemia compared to G alleles (P value 0.000), in both SM (P value 0.000) and UM (P value 0.015) within TNF-α 238 A allele to be associated with susceptibility to 3.13 fold risk for developing anemia. Furthermore, TNF-α 238 AA represent (67.7%, 80% and 66.7% respectively) in mild, moderate and severe anemia; giving highly significant association between TNF-α 238 A alleles and clinical types of malaria anemia (P value 0.000), and also in SM (P value 0.000). This finding consistence with study done in Gambia that found TNF-α 238 A allele to be associated with susceptibility to malarial anemia especially severe malaria anemia with a 2.5 fold risk of developing SMA (P < 0.001) (McGuire et al., 1999 ). May et al . reported TNF-α 238 alleles were associated with severe malaria anemia (May et al., 2000 ). In contrast, study done in Mali reported lack of association between TNF-α 238 alleles and severe malaria anemia (Cabantous et al., 2006 ). This suggest that the location of the TNF-α 238 A allele in the TNF-α promoter region to be associated with susceptibility to influence constitutive TNF-α production directly compared to G allele in malaria anemia. SNPs at many positions as 238 in the proximal enhancer of the TNF gene exhibit differential associations to malaria and TNF production in different populations (Ubalee et al., 2001 , Cabantous et al., 2006 , McGuire et al., 1999 , Mcguire et al., 1994 , Aidoo et al., 2001 , Sinha et al., 2008 ). The confounders of other baseline factors were not addressed here;. We suggest a More details on baseline characteristics like socioeconomic status, nutritional status and co-infection could help rule out potential confounders. Conclusion The significance of TNF-α level and TNF-α 238 A allele in children with severe falciparum anemia will assist clinicians in diagnosing and better managing severe malaria cases. Declarations Ethical approval and consent to participate: Ethical approval was obtained from the both Researches and Ethics Committees (REC) of Ministry of Health, Gezira State (No: 4-11-2017). Informed consent was written from each participant. Consent of publication: All authors agree for publication. Written informed consent was obtained from the patient for publication of this article. Availability of data and materials: Data are presented within the manuscript and can be provided by the corresponding author upon reasonable request. Funding: This research received no specific grant from any funding agency in the public, commercial or not-for-profit sectors. Acknowledgements (optional): The authors would like to thank all participants recruited for the study. We also thank the medical staff of the Wad Medani Pediatric Hospital for their help during the study. References ABDALLA, S. H. & PASVOL, G. 2004. Malaria: A Hematological Perspective, Tropical Medicine Science and Practice, London, Imperial College Press. ABDELNASSIR, M. A., HAFIZ, A. H., GAD ALLAH, M. & MOHAMMED, S. E. 2019. Hematological Changes in Sudanese Patients with Falciparum Malaria Attending Elnihoud Teaching Hospital. Sudan Journal of Medical Sciences, 14, 24-30. AIDOO, M., MCELROY, P. D., KOLCZAK, M. S., TERLOUW, D. J., TER KUILE, F. O. & AL, E. 2001. Tumor Necrosis Factor-a Promoter variant 2 (TNF2) is associated with pre-term delivery, infant mortality, and malaria morbidity in Western Kenya: Asembo Bay cohort project IX. Genet Epidem, 21, 201-211. ANTWI-BAFFOUR, S., KYEREMEH, R., BUABENG, D., ADJEI, J. K., ARYEH, C., KPENTEY, G. & SEIDU, M. A. 2018. Correlation of malaria parasitaemia with peripheral blood monocyte to lymphocyte ratio as indicator of susceptibility to severe malaria in Ghanaian children. Malaria journal, 17, 1-9. AWANDARE, G. A., KEMPAIAH, P., OCHIEL, D. O., PIAZZA, P., KELLER, C. C. & PERKINS, D. J. 2011. Mechanisms of erythropoiesis inhibition by malarial pigment and malaria-induced proinflammatory mediators in an in vitro model. Am J Hematol, 86, 155-162. BAIN, B. J., BATES, I., LAFFAN, M. & LEWIS, M. 2011. British, Elsevier Ltd. BIRHANU, M., ASRES, Y., ADISSU, W., YEMANE, T., ZEMENE, E. & GEDEFAW, L. 2017. Hematological Parameters and Hemozoin-Containing Leukocytes and Their Association with Disease Severity among Malaria Infected Children: A Cross-Sectional Study at Pawe General Hospital, Northwest Ethiopia. Interdisciplinary Perspectives on Infectious Diseases, 7. CABANTOUS, S., DOUMBO, O., RANQUE, S., POUDIOUGOU, B., TRAORE, A., HOU, X. & AL, E. 2006. Alleles 308A and 238A in the Tumor Necrosis Factor Alpha gene promoter do not increase the risk of severe malaria in children with Plasmodium falciparum infection in Mali. Infect Immun, 74, 7040-7042. DAFFA ALLA, N. & SUKKAR, M. Y. 2015. IFN-γ, TNF-α and IL-10 responses in children infected with malaria parasite. Khartoum Medical Journal, 8, 1143-1152. DEROOST, K., PHAM, T. T., OPDENAKKER, G. & VAN DEN STEEN, P. E. 2016. The immunological balance between host and parasite in malaria. FEMS Microbiology Reviews, 40, 208-257. EKVALL, H. 2003. Malaria and anemia. Curr Opin Hematol, 10, 108-114. FLORI, L., DELAHAYE, N. F., IRAQI, F. A., HERNANDEZ-VALLADARES, M., FUMOUX, F. & RIHET, P. 2005. TNF as a malaria candidate gene: polymorphism-screening and familybased association analysis of mild malaria attack and parasitemia in Burkina Faso. Genes and Immunity, 6, 472-480. FLORI, L., SAWADOGO, S., ESNAULT, C., DELAHAYE, N. F., FUMOUX, F. & RIHET, P. 2003. Linkage of mild malaria to the major histocompatibility complex in families living in Burkina Faso. Human Molecular Genetics, 12, 375-378. FRIMPONG, A., KUSI, K. A., TORNYIGAH, B., OFORI, M. F. & NDIFON, W. 2018. Characterization of T cell activation and regulation in children with asymptomatic Plasmodium falciparum infection. Malaria journal, 17, 263. HELLEBERG, M., GOKA, B. Q., AKANMORI, B. D., OBENG-ADJEI, G., RODRIQUES, O. & KURTZHALS, J. A. 2005. Bone marrow suppression and severe anaemia associated with persistent Plasmodium falciparum infection in African children with microscopically undetectable parasitaemia. Malaria journal, 4, 56. KELLER, C. C., DAVENPORT, G. C. & DICKMAN, K. R. 2006. Suppression of prostaglandin E2 by malaria parasite products and antipyretics promotes overproduction of tumor necrosis factor-alpha: association with the pathogenesis of childhood malarial anemia. J Infect Dis, 193, 1384-1393. KHAN, A. S. & MALIK, S. A. 1996. Tumor Necrosis Factor in Falciparum Malaria. Ann Saudi Med, 16, 609-614. KURTZHALS, J. A., ADABAYERI, V., GOKA, B. Q., AKANMORI, B. D., OLIVER-COMMEY, J. O., NKRUMAH, F. K. & AL, E. 1998. Low plasma concentrations of interleukin 10 in severe malarial anaemia compared with cerebral uncomplicated malaria. Lancet, 351, 1768-1772. LAMIKANRA, A. A., MERRYWEATHER-CLARKE, A. T., TIPPING, A. J. & ROBERTS, D. J. 2015. Distinct mechanisms of inadequate erythropoiesis induced by tumor necrosis factor alpha or malarial pigment. PLoS One, 10, e0119836. MADUKAKU, C. U., CHIMEZIE, O. M., CHIMA, N. G., HOPE, O. & SIMPLICIUS, D. I. N. 2015. Assessment of the haematological profile of children with malaria parasitaemia treated with three different artemisinin-based combination therapies. Asian Pac J Trop Dis, 5, 448-453. MANDALA, W. L., MSEFULA, C. L., GONDWE, E. N., DRAYSON, M. T., MOLYNEUX, M. E. & MACLENNAN, C. A. 2017. Cytokine profiles in Malawian children presenting with uncomplicated malaria, severe malarial anemia, and cerebral malaria. Clin Vaccine Immunol, 24, e00533-16. MAWSON, A. R. 2013. The Pathogenesis of Malaria: a new perspective. Pathogens and Global Health, 107, 122-129. MAY, J., LELL, B., LUTY, A. J., MEYER, C. G. & KREMSNER, P. G. 2000. Plasma interleukin-10: tumor necrosis factor (TNF-α) ratio is associated with TNF promoter variants and predicts malarial complications. Infect. Dis 182, 1570-1573. MCGUIRE, W., HILL, A. V., ALLSOPP, C. E., GREENWOOD, B. M. & KWIATKOWSKI, D. 1994. Variation in the TNF-alpha promoter region associated with susceptibility to cerebral malaria. Nature, 371, 508-5010. MCGUIRE, W., KNIGHT, J. C., HILL, A. V., ALLSOPP, C. E., GREENWOOD, B. M. & KWIATKOWSKI, D. 1999. Severe malarial anemia and cerebral malaria are associated with different tumor necrosis factor promoter alleles. J Infect Dis, 179, 287-290. MOHAMEDAHMED, K. A. 2023. Association between Elevated TNF-α Levels and Severe Malaria. Galen Medical Journal, 12, e2927. MOHAMEDAHMED, K. A. & ABAKAR, A. D. 2020. Severe Falciparum Malaria: An Overview. . Int J Med Parasitol Epidemiol Sci, 1, 105-106. MOHAMEDAHMED, K. A., ABAKAR, A. D., AHMED, M. O., MUKHTAR, M. M. & NOUR, B. Y. M. 2019a. The Role of TNF-α Levels as Predictive Diagnostic Biomarker Among Children with Severe Falciparum Malaria in Endemic Area in Sudan. IJAHMR, 3, 1-6. MOHAMEDAHMED, K. A., AHMED, Z. A., NOUR, B. Y. M., ABAKAR, A. D. & BABKER, A. M. 2020a. Impact of Severe Plasmodium Falciparum Infection on Platelets Parameters Among Sudanese Children Living in Al-Jazira State. Int. j. clin. biomed. res, 6, 5-9. MOHAMEDAHMED, K. A., MUSTAFA, R. E., ABAKAR, A. D. & NOUR, B. Y. M. 2019b. Evaluation of Neutrophil Lymphocyte Ratio (NLR) in Sudanese Children with Falciparum Malaria. IJAHMR, 3, 1-6. MOHAMEDAHMED, K. A., NOUR, B. Y. M., ABAKAR, A. D. & BABKER, A. M. 2020b. Diagnostic and prognostic value of thrombocytopenia severity in Sudanese children with Falciparum malaria. World J Adv Res Rev, 6, 197-204. MOHAMMED, Z. O., GABERALLAH, K. M., MOHAMMED, M. S. & MOHAMEDAHMED, K. A. 2020. Evaluation of Coagulation Profiles (PT, INR, and APTT) among Sudanese Patients with Falciparum Malaria Infection. IJAHMR, 4, 15-21. NATIONAL MALARIA CONTROL PROGRAMME 2010. Five Years Strategies Plan for the National Malaria Control Programme, Sudan 2011–2015. Federal Ministry of Health. NUSSENBLATT, V., MUKASA, G., METZGER, A., NDEEZI, G., GARRETT, E. & SEMBA, R. D. 2001. Anemia and interleukin-10, tumor necrosis factor a, and erythropoietin levels among children with acute, uncomplicated Plasmodium falciparum malaria. clin Diagn Lab Immunol, 8, 1164-1170. OGONDA, L. A., ORAGO, A. S., OTIENO, M. F., ADHIAMBO, C., OTIENO, W. & STOUTE, J. A. 2010. The levels of CD16/Fc gamma receptor IIIA on CD14+ CD16+ monocytes are higher in children with severe Plasmodium falciparum anemia than in children with cerebral or uncomplicated malaria. Infect Immun, 78, 2173-2181. OTHORO, C., LAL, A. A., NAHLEN, B., KOECH, D., ORAGO, A. S. & UDHAYAKUMAR, V. 1999. A low interleukin-10 tumor necrosis factor-alpha ratio is associated with malaria anemia in children residing in a holoendemic malaria region in Western Kenya. J Infect Dis, 179, 279-282. RATHOD, C. C., DESHPANDE, S. V., RANA, H. M., GODBOLE, V. Y., PATEL, V., PATEL, A. & AL, E. 2012. Plasmodium Falciparum Versus Plasmodium Vivax: Which is a Lesser Evil? Natl J Community Med, 3, :541-547. RECKER, M., BULL, P. C. & BUCKEE, C. O. 2018. Recent advances in the molecular epidemiology of clinical malaria. F1000Res. ROBERTS, D. & MATTHEWS, G. 2016. Risk factors of malaria in children under the age of five years old in Uganda. Malaria journal, 15, 246. ROBSON, K. J. & WEATHERALL, D. J. 2009. Malarial anemia STAT6. Haematologica, 94, 157-159. ROLL BACK MALARIA IN SUDAN 2017. Sudan Malaria Treatment Protocol 2017. Federal Ministry of Health. SINHA, S., MISHRA, S. K., SHARMA, S., PATIBANDLA, P. K., MALLICK, P. K., SHARMA, S. K. & AL, E. 2008. Polymorphisms of TNF-enhancer and gene for FcγRIIa correlate with the severity of falciparum malaria in the ethnically diverse Indian population. Malaria journal, 7, 13. SPOTTISWOODE, N., DUFFY, P. E. & DRAKESMITH, H. 2014. Iron, anemia and hepcidin in malaria. Front Pharmacol, 5, 125. SUMBELE, I. U. N., KIMBI, H. K., NDAMUKONG-NYANGA, J. L. N., M, ANCHANG-KIMBI, J. K., LUM, E. & AL, E. 2015. Malarial Anaemia and Anaemia Severity in Apparently Healthy Primary School Children in Urban and Rural Settings in the Mount Cameroon Area: Cross Sectional Survey. PLoS One, 10, e0123549. THUMA, P. E., VAN DIJK, J., BUCALA, R., DEBEBE, Z., NEKHAI, S., KUDDO, T. & AL, E. 2011. Distinct clinical and immunologic profiles in severe malarial anemia and cerebral malaria in Zambia. J Infect Dis, 203, 211-219. UBALEE, R., SUZUKI, F., KIKUCHI, M., TASANOR, O., WATTANAGOON, Y., RUANGWEERAYUT, R. & AL, E. 2001. Strong association of a tumor necrosis factor-alpha promoter allele with cerebral malaria in Myanmar. Tissue Antigens, 58, 407-410. URBAN, B. C., WILLCOX, N. & ROBERTS, D. 2001. A role for CD36 in the regulation of dendritic cell function. Proc Natl Acad Sci USA, 98, 8750-8755. WORLD HEALTH ORGANIZATION (WHO) 2015. Guidelines for the Treatment of Malaria. 3rd ed. Geneva: WHO. WORLD HEALTH ORGANIZATION (WHO) 2018. World Malaria Report 2018, 11th ed. Geneva: WHO. 11 ed. Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6158689","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":424269542,"identity":"6c9f31e7-2299-4f60-967e-c25608ab0f2b","order_by":0,"name":"Khalid Abdelsamea Mohamedahmed","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIiWNgGAWjYBACCQkGxgMJbEAWewOQMLAgSgsDRAvPAZAWCSK1MIC0SCSA+YS1SM5ufnDgQRmD3Yabz69u+FEgwcDf3p2AV4u0zDGDAwnnGJI33M4pu9kDdJjEmbMb8GqRk0gwOJDYxpBscDsn7QYPUIuBRC4hLekfIFpunkm7+YcYLdISOWBb7AxusB+7TZQtkjNyCoB+kUiQPJPDdlvGQIKHoF8kbqRvfPijzMae7/jxZzff/LGR42/vxa8FpjOxgYHHAMTiIUY5GNgDU8wDolWPglEwCkbByAIADJdK3/YOWesAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-7084-6106","institution":"Faculty of Medical Laboratory Sciences, University of Gezira; Faculty of Applied Medical Sciences, Jerash University","correspondingAuthor":true,"prefix":"","firstName":"Khalid","middleName":"Abdelsamea","lastName":"Mohamedahmed","suffix":""},{"id":424269543,"identity":"30947613-c9ed-4a27-9e7a-230a0917de40","order_by":1,"name":"Bakri Yousif Mohammed Nour","email":"","orcid":"","institution":"Faculty of Medical Laboratory Sciences, University of Gezira","correspondingAuthor":false,"prefix":"","firstName":"Bakri","middleName":"Yousif Mohammed","lastName":"Nour","suffix":""},{"id":424269544,"identity":"f149c926-1c7e-4d25-bfdd-be5f4af60179","order_by":2,"name":"Roa Osman Elsumani Koko","email":"","orcid":"","institution":"Faculty of Medical laboratory Sciences, University of Gezira","correspondingAuthor":false,"prefix":"","firstName":"Roa","middleName":"Osman Elsumani","lastName":"Koko","suffix":""},{"id":424269545,"identity":"8126e0fb-6226-4074-b11d-fd5f64302fee","order_by":3,"name":"Mohamed Youisf Mohamed Elshiekh","email":"","orcid":"","institution":"Faculty of Medical laboratory Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Youisf Mohamed","lastName":"Elshiekh","suffix":""},{"id":424269546,"identity":"3c5dafce-d7cf-4252-a71a-b79f6d6e0d13","order_by":4,"name":"Salah Eldin G. Elzaki","email":"","orcid":"","institution":"Tropical Medicine Research Institute, National Centre for Research","correspondingAuthor":false,"prefix":"","firstName":"Salah","middleName":"Eldin G.","lastName":"Elzaki","suffix":""},{"id":424269547,"identity":"8f88d1be-0f6d-4f08-8340-ae860b5eacf7","order_by":5,"name":"Adam Dawoud Abakar","email":"","orcid":"","institution":"Faculty of Medical laboratory Sciences, University of Gezira","correspondingAuthor":false,"prefix":"","firstName":"Adam","middleName":"Dawoud","lastName":"Abakar","suffix":""}],"badges":[],"createdAt":"2025-03-05 04:24:26","currentVersionCode":1,"declarations":{"humanSubjects":true,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":true,"humanSubjectConsent":true,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-6158689/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6158689/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":78240815,"identity":"5d7b3ea3-9f4a-4420-9595-5fab035c34a2","added_by":"auto","created_at":"2025-03-11 09:00:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":432715,"visible":true,"origin":"","legend":"\u003cp\u003eLocation of Wad Medani city, Gezira State, Sudan (World Atlas, 2015)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6158689/v1/954e1fe3a335ad1f34049861.png"},{"id":78239218,"identity":"781a53af-dff1-48d3-a55f-1c1382c5adfe","added_by":"auto","created_at":"2025-03-11 08:52:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":17775,"visible":true,"origin":"","legend":"\u003cp\u003eFrequency of TNF-α 238 alleles polymorphism among UM and SM.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6158689/v1/77e7a13b3acc4e2913c74729.png"},{"id":78242314,"identity":"344a9f53-23cf-4142-8f48-373c1aa6eac5","added_by":"auto","created_at":"2025-03-11 09:08:48","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":51829,"visible":true,"origin":"","legend":"\u003cp\u003ePCR amplification of TNF-α 238 alleles DNA on 1.5% agarose gel electrophoresis. Lane 1 DNA ladder: MW 500-1500bp. Lane 2 showing band size of (460 bp) for G allele, Lane 3 showing band size of (459 bp) for A allele.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6158689/v1/74b927361fb02edff67904f7.png"},{"id":78240814,"identity":"07e7e3f3-2381-48c4-91a2-dff5ed313270","added_by":"auto","created_at":"2025-03-11 09:00:48","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":23001,"visible":true,"origin":"","legend":"\u003cp\u003eFrequency of TNF-α 238 genotypes polymorphism among UM and SM.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6158689/v1/c4e3a228f353d2df44a4673e.png"},{"id":78244121,"identity":"c57961c6-4719-4a86-90de-08d49cc34d82","added_by":"auto","created_at":"2025-03-11 09:16:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1603973,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6158689/v1/f6114381-ffad-4003-8bd8-c8400c196266.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eTNF-α 238 Alleles Polymorphism and its Association with TNF-α Levels in the Severe Malaria Anemia among Sudanese Children\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMalaria is a human intracellular protozoan parasitic disease caused by female anopheline mosquitoes inoculated genus \u003cem\u003ePlasmodium\u003c/em\u003e parasite (\u003cem\u003eP. falciparum, P.\u003c/em\u003e vivax, \u003cem\u003eP. malariae\u003c/em\u003e, \u003cem\u003eP. ovale\u003c/em\u003e, and \u003cem\u003eP. knowlesi\u003c/em\u003e) (Recker et al., 2018). Falciparum malaria is still a major health problem in Sudan accounts for up to 80% of malaria cases globally (World Health Organization (WHO), \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) and about 87.6% of malaria cases in Sudan (Mohamedahmed et al., 2019b, Mohamedahmed et al., 2020b). The disease is becoming more prevalent due to poor sanitation and a lack of strong preventive factors. Children suffer more malaria episodes and are more prone to severe malaria compared to adults and accounted for 61% (266 000) of all malaria deaths. In fact, about 285,000 children died before their fifth birthdays in 2016 in Africa (World Health Organization (WHO), \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Falciparum malaria may result in variable clinical symptoms, ranging from very mild symptoms to severe disease and even death (Mohamedahmed et al., 2020b). Falciparum Malaria can be categorized in two groups: uncomplicated or complicated (severe) (Mohamedahmed and Abakar, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The classical uncomplicated malaria (UM) has three stages (cold stage, a hot stage, and a sweating stage) (Mawson, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). If falciparum malaria is not treated properly may occur the following complications: cerebral malaria, severe anemia, hemoglobinuria, pulmonary edema, thrombocytopenia, cardiovascular collapse, shock, kidney failure, hyperparasitemia, metabolic acidosis and hypoglycemia (Mawson, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Falciparum malaria is linked to a number of hematological abnormalities involving the major blood cell types, including red blood cells, white blood cells, and platelets (Antwi-Baffour et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Mohamedahmed et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e), all of which play factors in the disease's severity Mohamedahmed, Ahmed et al. 2020). Malaria-related anemia can result in death, especially among vulnerable populations such as children. WHO defines mild anemia as a Hb of between 10 g/dL and 10.9 g/dL, moderate anemia as between 7 g/dL and 9.9 g/dL, and severe anemia as below 7 g/dL; A surveys conducted in 16 African countries between 2015 and 2017 showed that the prevalence among young children with positive for malaria showed anemia was 79%, mild anemia 21%, moderate anemia 50% and severe anemia 8% (World Health Organization (WHO), \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The first-line defense against malaria is innate immune cells and their cytokines (TNF-α, IL-12, IFN-γ, and NO), and second line is adaptive immune response primarily depends on the actions of the α/β T cells (CD\u0026thinsp;+\u0026thinsp;4, CD\u0026thinsp;+\u0026thinsp;8) and the B cells (Urban et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Tumor necrosis factor (TNF-α) is a common proinflammatory cytokine. TNF-α is plays a central role in malaria pathogenicity either in the cure or complication of malaria. Their high level and is associated with severe falciparum malaria and is equivocal. Polymorphisms in the TNF-α gene have been associated with increased susceptibility to severe malaria (Mohamedahmed et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e, Flori et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, Mohamedahmed, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Many studies have detected the TNF SNPs at TNF-α 238 exhibit differential associations to malaria and TNF-α production in different populations (McGuire et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1999\u003c/span\u003e, Aidoo et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2001\u003c/span\u003e, Cabantous et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, Ubalee et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2001\u003c/span\u003e, Mcguire et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). TNF-α levels overproduction and promoter polymorphisms at TNF-α 238 alleles may play a central role in reduced red cell production and malaria-related anemia through suppression of bone marrow erythropoiesis and dyserythropoiesis (Abdalla and Pasvol, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The purpose of this study was to compare and correlate TNF-α levels and TNF-α 238 alleles polymorphism (A allele/ G allele) between falciparum malaria severity and malaria anemia severity among Sudanese children with falciparum malaria.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy design, area, and population:\u003c/h2\u003e \u003cp\u003eA longitudinal hospital-based study was conducted among 200 Sudanese children at Wad Medani Pediatric Hospital, Gezira State, Sudan from November 2016 to June 2019. 100 children were previously diagnosed with severe falciparum malaria by blood film and WHO criteria, and 100 children were previously diagnosed with uncomplicated falciparum malaria by blood film or ICT (World Health Organization (WHO), \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eInclusion criteria:\u003c/h3\u003e\n\u003cp\u003eThe study included sick children with falciparum malaria aging 1 month to 18 years old, from both genders, and residing in Gezira state who were admitted to Wad Medani Pediatric Teaching Hospital.\u003c/p\u003e\n\u003ch3\u003eExclusion criteria:\u003c/h3\u003e\n\u003cp\u003eSick children with mixed malaria or vivax malaria were excluded from this study. Those aging\u0026thinsp;\u0026ge;\u0026thinsp;18 years old, those residing outside Gezira State and those suffering from a recent infection, malignancy, and thrombosis, and those on anticoagulant and anti-inflammatory medication were also excluded.\u003c/p\u003e\n\u003ch3\u003eEthical consideration:\u003c/h3\u003e\n\u003cp\u003e The ethical clearance was obtained from both Research and Ethics Committees in the Ministry of Health in Gezira State and Faculty of Medical Laboratory Sciences, University of Gezira. The ethical permission was obtained from Wad Medani Pediatric Teaching Hospital. Informed consent was written from each participant's parents.\u003c/p\u003e\n\u003ch3\u003eDefine uncomplicated and severe falciparum malaria:\u003c/h3\u003e\n\u003cp\u003eFalciparum Malaria can be categorized in two groups: uncomplicated or complicated (severe) (Mohamedahmed and Abakar, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe classical uncomplicated malaria (UM) has three stages (cold stage, a hot stage, and a sweating stage) diagnosed by blood film or ICT and clinical findings (Mawson, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) (World Health Organization (WHO), \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSevere falciparum malaria diagnosed by blood film and WHO criteria (presence of 2 or more the following complications: cerebral malaria, severe anemia, hemoglobinuria, pulmonary edema, thrombocytopenia, cardiovascular collapse, shock, kidney failure, hyperparasitemia, metabolic acidosis and hypoglycemia) (Mawson, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) (World Health Organization (WHO), \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSample collection and preparation:\u003c/h2\u003e \u003cp\u003e4 ml venous blood sample was collected by clean venipuncture for all patients. 2 ml in a plain container and 2 ml in EDTA container. Thin and thick films were prepared immediately. Serum was obtained immediately after blood collection by blood centrifugation of plain container at 1200 rpm for 10 min (Bain et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). RBCs parameters measurement and DNA extraction were done from the EDTA container.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eRBCs parameters measurement:\u003c/h3\u003e\n\u003cp\u003eRBCs parameters (RBCs count, Hb g/dl, PCV %, MCV fl, MCH pg, MCHC g/l) were determined using the Sysmex XP 300 N automated hematology analyzer (Sysmex, Kobe, Japan).\u003c/p\u003e\n\u003ch3\u003eDefine anemia and the severity of the anemia:\u003c/h3\u003e\n\u003cp\u003eAnemia was defined as hemoglobin of less than 12 g/dl (World Health Organization (WHO), \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). WHO defines mild anemia as a Hb of between 10 g/dL and 10.9 g/dL, moderate anemia as between 7 g/dL and 9.9 g/dL, and severe anemia as below 7 g/dL (World Health Organization (WHO), \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e)].\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTNF-α level measurement:\u003c/h2\u003e \u003cp\u003eELISA was further processed for TNF-α level from serum sample using Human TNF-α ELISA MAX\u0026trade; Deluxe Sets (BioLegend, Inc).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction:\u003c/h2\u003e \u003cp\u003eDNA extraction was done using G-DEX\u0026trade;IIb Genomic DNA Extraction Kit. The extracted DNA concentration was measured by reading the absorbance at 260 nm using a nanosystem. An absorbance ratio of 260 nm and 280 nm gives an estimate of the purity of the solution (DNA product concentration: 5 \u0026micro;g/l; DNA product purity: 1.68). All samples were store at -20\u0026deg;C till PCR amplification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTNF-α 238 alleles polymorphism analysis:\u003c/h2\u003e \u003cp\u003ePCR and gel running system were used for detecting TNF-α 238 Alleles polymorphism (A allele/ G allele). PCR was done to detect TNF-α 238 alleles polymorphism using conserved primer pairs (Macrogen, Korea) (Common TNF '' CCGGATCATGCTTTCAGTGC''; TNF 238A allele ''AGACCCCCCTCGGAATCG''; and TNF 238G allele ''AAGACCCCCCTCGGAATC'') to generate 459- and 460-bp products (McGuire et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Common TNF-α primer was prepared by adding 300 \u0026micro;l deionized sterile water, TNF-α 238A allele and 238G allele primers were prepared by adding 320 \u0026micro;l D.W. Each of the primers was prepared as follows: 10\u0026micro;l of each stock primer (100 \u0026micro;M) were added to 90 \u0026micro;l PCR water (Deionized sterile water) and aliquoted in 0.5 ml PCR polypropylene tube to yield a concentration of 10\u0026micro;M, and the solution was mixed.\u003c/p\u003e \u003cp\u003ePCR reaction contains PCR master mix (aPSLaBS, India), Common TNF-α primer, TNF-α 238A allele/238G allele primers, DNA, then the volume was completed to 20 \u0026micro;L by Deionized sterile water.\u003c/p\u003e \u003cp\u003ePCR reaction was done using a PCR system (9700 thermocycler, Singapore). The mixture was incubated at 95\u0026deg;C for 10 min, followed by 5 cycles of 95\u0026deg;C for 1 min, 60\u0026deg;C for 1 min, 72\u0026deg;C for 1 min, then 25 cycles of 95\u0026deg;C for 1 min, 56\u0026deg;C for 1 min, 72\u0026deg;C for 1 min, and then a final 10 min at 72\u0026deg;C (McGuire et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). The products were resolved in 1.5% agarose gel, stained with ethidium bromide, and visualized under UV light.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis:\u003c/h2\u003e \u003cp\u003eData were presented as means with their standard deviations. The SPSS (V 20.0) and Stat disk (V 13.0) were used for data analysis. T-test, correlation test, and One Way ANOVA were used to compare the results, at a 95% confidence interval, \u003cem\u003eP value\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered as significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe study was conducted on 100 children with severe falciparum malaria (SM) (mean age 8.63\u0026thinsp;\u0026plusmn;\u0026thinsp;3.40 years; 61% boys; 49% girls), and 100 children with uncomplicated falciparum malaria (UM) (mean age 8.83\u0026thinsp;\u0026plusmn;\u0026thinsp;4.20 years; 45% boys; 55% girls) from Gezira State, Sudan. Falciparum malaria-related anemia accounted for 32%, commonly in SM (55%) compared to UM (9%). Severe malaria anemia is most common in SM (3%). Fever was the most clinical finding account for 89% in SM and 81% in UM (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eDemographic and clinical characteristics of study participants.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003eFactors\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003eUncomplicated malaria\u003c/p\u003e\n \u003cp\u003e(UM) \u0026ndash; N\u0026thinsp;=\u0026thinsp;100\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003eSevere malaria\u003c/p\u003e\n \u003cp\u003e(SM) \u0026ndash; N\u0026thinsp;=\u0026thinsp;100\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003eAll malaria cases\u003c/p\u003e\n \u003cp\u003eN\u0026thinsp;=\u0026thinsp;200\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge (years)\u003c/strong\u003e (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e8.83\u0026thinsp;\u0026plusmn;\u0026thinsp;4.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e8.63\u0026thinsp;\u0026plusmn;\u0026thinsp;3.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e8.43\u0026thinsp;\u0026plusmn;\u0026thinsp;3.80\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge group (years)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eLess than 5 years\u003c/p\u003e\n \u003cp\u003e6\u0026ndash;10 years\u003c/p\u003e\n \u003cp\u003e11\u0026ndash;15 years\u003c/p\u003e\n \u003cp\u003eMore than 15 years\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e24 (24%)\u003c/p\u003e\n \u003cp\u003e41 (41%)\u003c/p\u003e\n \u003cp\u003e29 (29%)\u003c/p\u003e\n \u003cp\u003e6 (6%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e19 (19%)\u003c/p\u003e\n \u003cp\u003e47 (47%)\u003c/p\u003e\n \u003cp\u003e33 (33%)\u003c/p\u003e\n \u003cp\u003e1 (1%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e43 (21.5%)\u003c/p\u003e\n \u003cp\u003e88 (44%)\u003c/p\u003e\n \u003cp\u003e62 (31%)\u003c/p\u003e\n \u003cp\u003e7 (3.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eBoys\u003c/p\u003e\n \u003cp\u003eGirls\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e45 (45%)\u003c/p\u003e\n \u003cp\u003e55 (55%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e61 (61%)\u003c/p\u003e\n \u003cp\u003e39 (39%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e106 (53%)\u003c/p\u003e\n \u003cp\u003e94 (47%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eResidence\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eRural\u003c/p\u003e\n \u003cp\u003eUrban\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e70 (70%)\u003c/p\u003e\n \u003cp\u003e30 (30%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e49 (49%)\u003c/p\u003e\n \u003cp\u003e51 (51%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e119 (59.5)\u003c/p\u003e\n \u003cp\u003e81 (40.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical findings\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eFever\u003c/p\u003e\n \u003cp\u003eChills\u003c/p\u003e\n \u003cp\u003eFatigue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e89 (89%)\u003c/p\u003e\n \u003cp\u003e40 (40%)\u003c/p\u003e\n \u003cp\u003e43 (43%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e81 (81%)\u003c/p\u003e\n \u003cp\u003e27 (27%)\u003c/p\u003e\n \u003cp\u003e59 (59%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e170 (85%)\u003c/p\u003e\n \u003cp\u003e67 (33.5%)\u003c/p\u003e\n \u003cp\u003e102 (51%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAnemia\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eAnemic\u003c/p\u003e\n \u003cp\u003eNon-anemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e55 (55%)\u003c/p\u003e\n \u003cp\u003e45 (45%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e9 (9%)\u003c/p\u003e\n \u003cp\u003e91 (91%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e64 (32%)\u003c/p\u003e\n \u003cp\u003e136 (68%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSeverity of the anemia\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eMild\u003c/p\u003e\n \u003cp\u003eModerate\u003c/p\u003e\n \u003cp\u003eSevere\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e23 (23%)\u003c/p\u003e\n \u003cp\u003e29 (29%)\u003c/p\u003e\n \u003cp\u003e3 (3%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e8 (8%)\u003c/p\u003e\n \u003cp\u003e1 (1%)\u003c/p\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e31 (15.5%)\u003c/p\u003e\n \u003cp\u003e30 (15%)\u003c/p\u003e\n \u003cp\u003e3 (1.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 30.5903%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u0026alpha; pg/ml Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" style=\"width: 29.0552%;\"\u003e\n \u003cp\u003e112.42\u0026thinsp;\u0026plusmn;\u0026thinsp;35.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" style=\"width: 18.9188%;\"\u003e\n \u003cp\u003e200.98\u0026thinsp;\u0026plusmn;\u0026thinsp;92.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" style=\"width: 21.4009%;\"\u003e\n \u003cp\u003e156.70\u0026thinsp;\u0026plusmn;\u0026thinsp;64.15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha; 238 alleles polymorphism represent (130 [65%] for UM, 137 [68.5%] for SM) for (TNF-\u0026alpha; 238A), (70 [35%] for UM, 63 [31.5%] for SM) for (TNF-\u0026alpha; 238G) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha; 238 GA, AA, and GG account for (58, 36, and 6% respectively) in UM; while (51, 43, and 6% respectively) in SM (Figure: 4).\u003c/p\u003e\n\u003cp\u003eThe average of TNF-\u0026alpha; levels in severe malaria and uncomplicated malaria were (200.98\u0026thinsp;\u0026plusmn;\u0026thinsp;92.77 and 112.42\u0026thinsp;\u0026plusmn;\u0026thinsp;35.52 pg/ml respectively) (\u003cem\u003eP value\u003c/em\u003e 0.000). The average TNF-\u0026alpha; levels in anemic patients (196.34\u0026thinsp;\u0026plusmn;\u0026thinsp;94.11 pg/ml) was higher than in non-anemic patients (122.97\u0026thinsp;\u0026plusmn;\u0026thinsp;49.45 pg/ml) (\u003cem\u003eP value\u003c/em\u003e 0.000). The average of TNF-\u0026alpha; levels in mild anemia, moderate anemia, and severe anemia was (190.75\u0026thinsp;\u0026plusmn;\u0026thinsp;102.55, 189.70\u0026thinsp;\u0026plusmn;\u0026thinsp;80.35 and 299.75\u0026thinsp;\u0026plusmn;\u0026thinsp;82.27 pg/ml respectively) giving highly significant differences between them (\u003cem\u003eP value\u003c/em\u003e 0.000) and strong significant positive correlation (\u003cem\u003er\u0026thinsp;+\u003c/em\u003e\u0026thinsp;0.309; \u003cem\u003eP value\u003c/em\u003e 0.000) (Table: 2).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eComparison of TNF-\u0026alpha; levels between Severe (SM) and Uncomplicated falciparum malaria (UM):\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" style=\"width: 46.5908%;\"\u003e\n \u003cp\u003eFactors\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 38.8637%;\"\u003e\n \u003cp\u003eTNF-\u0026alpha; pg/ml Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e *\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" style=\"width: 46.5908%;\"\u003e\n \u003cp\u003eGroups\u003c/p\u003e\n \u003cp\u003eSevere malaria (SM)\u003c/p\u003e\n \u003cp\u003eUncomplicated malaria (UM)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 38.8637%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e200.98\u0026thinsp;\u0026plusmn;\u0026thinsp;92.77\u003c/p\u003e\n \u003cp\u003e112.42\u0026thinsp;\u0026plusmn;\u0026thinsp;35.52\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" style=\"width: 46.5908%;\"\u003e\n \u003cp\u003eAnemia\u003c/p\u003e\n \u003cp\u003eAnemic\u003c/p\u003e\n \u003cp\u003eNon-anemic\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" style=\"width: 38.8637%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e196.34\u0026thinsp;\u0026plusmn;\u0026thinsp;94.11\u003c/p\u003e\n \u003cp\u003e122.97\u0026thinsp;\u0026plusmn;\u0026thinsp;49.45\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e0.000\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" style=\"width: 46.5908%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eClinical anemia\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eMild anemia\u003c/p\u003e\n \u003cp\u003eModerate anemia\u003c/p\u003e\n \u003cp\u003eSevere anemia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" style=\"width: 38.8637%;\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e190.75\u0026thinsp;\u0026plusmn;\u0026thinsp;102.55\u003c/p\u003e\n \u003cp\u003e189.70\u0026thinsp;\u0026plusmn;\u0026thinsp;80.35\u003c/p\u003e\n \u003cp\u003e299.75\u0026thinsp;\u0026plusmn;\u0026thinsp;82.27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e0.000\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eTNF-\u0026alpha; 238 GA, AA and GG genotypes account for (58, 36 and 6% respectively) in UM; while (51, 43 and 6% respectively) in UM (\u003cem\u003eP value\u003c/em\u003e 0.586) (Table: 5).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAssociation between TNF-\u0026alpha; 238 genotypes polymorphism and malaria severity.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePolymorphism\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eUncomplicated malaria\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSevere malaria\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e *\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u0026alpha; 238 GA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e0.586\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u0026alpha; 238 AA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTNF-\u0026alpha; 238 GG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003e* \u003cem\u003eP value\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eTNF-\u0026alpha; 238 AA account for 47 (73.4%) in anemic patients (70.9% in SM, 88.9% in UM), giving highly significant association between TNF-\u0026alpha; 238 AA and malaria anemia (\u003cem\u003eP value\u003c/em\u003e 0.000); in both SM (\u003cem\u003eP value\u003c/em\u003e 0.000) and UM (\u003cem\u003eP value\u003c/em\u003e 0.015) (Table: 4).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab4\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAssociation between TNF-\u0026alpha; 238 genotypes polymorphism \u0026amp; malaria anemia.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePolymorphism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eMalaria patients\u0026thinsp;=\u0026thinsp;200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eSM\u0026thinsp;=\u0026thinsp;100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eUM\u0026thinsp;=\u0026thinsp;100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNon\u003c/p\u003e\n \u003cp\u003eanemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNon\u003c/p\u003e\n \u003cp\u003eAnemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAnemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNon\u003c/p\u003e\n \u003cp\u003eanemic\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e238 GA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.000\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.000\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.015\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e238 AA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e39\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e238 GG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"10\"\u003e* \u003cem\u003eP value\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eTNF-\u0026alpha; 238 AA account for (21 [67.7%], 24 [80%] and 2 [66.7%] respectively) in mild, moderate and severe anemia, giving a highly significant association between TNF-\u0026alpha; 238 AA and clinical types of malaria anemia (\u003cem\u003eP value\u003c/em\u003e 0.000), and also in SM (\u003cem\u003eP value\u003c/em\u003e 0.000) (Table: 5).\u0026nbsp;\u003c/p\u003e\n\u003ctable id=\"Tab5\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eAssociation between TNF-\u0026alpha; 238 genotypes polymorphism and clinical types of anemia.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003ePolymorphism\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"4\"\u003e\n \u003cp\u003eMalaria patients\u0026thinsp;=\u0026thinsp;200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"4\"\u003e\n \u003cp\u003eSM\u0026thinsp;=\u0026thinsp;100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMild\u003c/p\u003e\n \u003cp\u003eAnemia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eModerate\u003c/p\u003e\n \u003cp\u003eAnemia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSevere\u003c/p\u003e\n \u003cp\u003eanemia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e *\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMild\u003c/p\u003e\n \u003cp\u003eanemia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eModerate\u003c/p\u003e\n \u003cp\u003eanemia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSevere\u003c/p\u003e\n \u003cp\u003eanemia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP value\u003c/em\u003e *\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e238 GA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.000\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003e0.000\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e238 AA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e238 GG\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"9\"\u003e* \u003cem\u003eP value\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003eThe Risk difference (RD) of TNF-\u0026alpha; 238 A allele for SM and malaria anemia (7.5 and 24.8% respectively); while The Risk ratio (RR) of TNF-\u0026alpha; 238 A allele for SM and malaria anemia were (1.10 and 1.42 times respectively). The Risk difference (RD) of TNF-\u0026alpha; 238 AA for SM and malaria anemia were (7.5 and 53.3% respectively); while The Risk ratio (RR) of TNF-\u0026alpha; 238 AA for SM and malaria anemia were (1.20 and 3.13 times respectively) (Table: 6).\u0026nbsp;\u003c/p\u003e\n\u003ctable id=\"Tab6\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eRisk difference (RD) and Risk ratio (RR) for TNF-\u0026alpha; 238 A allele and AA genotype in SM and malaria anemia.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFactors\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSevere malaria\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eMalaria anemia\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eRD for TNF-\u0026alpha; 238 A allele\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e24.8%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eRR for TNF-\u0026alpha; 238 A allele\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eRD for TNF-\u0026alpha; 238 AA genotype\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.5%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e53.3%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eRR for TNF-\u0026alpha; 238 AA genotype\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFalciparum malaria is still a major health problem in Sudan accounts for up to 80% of malaria cases globally (World Health Organization (WHO), \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) and about 87.6% of malaria cases in Sudan (Mohamedahmed et al., 2019b, Mohammed et al., 2020, Roll Back Malaria in Sudan, 2017). Poor sanitation and the absence of major protection are significantly leading to increased prevalence of the disease. Children suffer more malaria episodes and are more prone to severe malaria compared to adults and accounted for 61% (266 000) of all malaria deaths. In fact, about 285,000 children died before their fifth birthdays in 2016 in Africa According to the World Health Organization (World Health Organization (WHO), \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Mohamedahmed and Abakar, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). therefore malaria remains the largest cause of childhood deaths in Africa (Roberts and Matthews, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTumor necrosis factor (TNF-α) is a common proinflammatory cytokine. TNF-α is playing a central role in malaria pathogenicity either in the cure or complication of malaria. Their high level and is associated with severe falciparum malaria and is equivocal.\u003c/p\u003e \u003cp\u003eThe current research aimed to light the association between TNF-α levels and TNF-α 238 alleles polymorphism with malaria severity and malaria anemia because thought TNF-α levels and their promoter is one of children predispose factor than others lead to malaria anemia.\u003c/p\u003e \u003cp\u003ePolymorphisms in the TNF-α gene have been associated with increased susceptibility to severe malaria. The TNF-α promoter polymorphism at TNF-α 238 alleles have been associated with differential activity and production of TNF-α in addition associated with severe clinical outcome of malaria (Flori et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, Ubalee et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe present study was conducted on 200 Sudanese children from Gezira State. Samples were collected from 100 subjects (with mean age 8.63\u0026thinsp;\u0026plusmn;\u0026thinsp;3.40 years; 61% boys) previously diagnosed as severe \u003cem\u003efalciparum\u003c/em\u003e malaria (SM) by blood film and WHO criteria (World Health Organization (WHO), \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e); 100 subjects (with mean age 8.83\u0026thinsp;\u0026plusmn;\u0026thinsp;4.20 years; 45% boys) previously diagnosed as uncomplicated \u003cem\u003efalciparum\u003c/em\u003e malaria (UM) by blood film or ICT and 100 normal healthy controls. Similar studies were reported from different countries like Nigeria (Madukaku et al., 2015), Ethiopia (Birhanu et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and Ghana (Frimpong et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In the present study boys more than girls. Similarly, a survey was done in Sudan in 21,988 individuals to show the prevalence of malaria and results showed the infection was higher in males more than females (National Malaria Control Programme, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe classical clinical finding was fever (81% for UM, 89% for SM). A study done by Rathod \u003cem\u003eet al\u003c/em\u003e. showed that fever account for 97% of falciparum malaria (Rathod et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTNF-α 238A allele was a common allele (66.8%) among Sudanese children with falciparum malaria (35.5% for boys and 31.3% for girls), and the G allele was rare (33.2%) (17.5% for boys and 15.7% for girls) (P value 0.132). While TNF-α 238 GA, AA, and GG account for (54.5, 39.5, and 6% respectively) among Sudanese children with falciparum. TNFA-α 238G was the common allele (0.95), and TNFA-α 238A was rare in Malian children (Cabantous et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), and The allele frequencies were 97.8% and 2.2% for TNF-α 238G and TNF-α 238A in Burkina Faso children (Flori et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFalciparum malaria-related anemia accounted for 32%, commonly in SM (55%) compared to UM (9%). Mild malaria anemia, moderate malaria anemia and severe malaria anemia were accounts for 31%, 30%, and 3% respectively. A previous study reported malaria-related anemia prevalent among children was 19.8% in Cameron and prevalence of mild, moderate, and severe malaria anemia were 88.1, 5.6, and 5.6% respectively (Sumbele et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The study done by Rathod \u003cem\u003eet al\u003c/em\u003e. showed the malaria anemia account for 24.6% of falciparum malaria (Rathod et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). A similar study done in Sudan showed that malaria anemia account for 21.8% of falciparum malaria (Abdelnassir et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe average of TNF-α levels in anemic (196.34\u0026thinsp;\u0026plusmn;\u0026thinsp;94.11 pg/ml) was higher than the non-anemic patients (122.97\u0026thinsp;\u0026plusmn;\u0026thinsp;49.45 pg/ml) giving highly significant differences between them (P value 0.000 and 0.004 respectively). Elevated plasma TNF-α levels promote the development of malaria-related in children (Thuma et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Daffa Alla and Sukkar, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Mandala et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In contrast, McGuire \u003cem\u003eet al\u003c/em\u003e. reported no association between TNF levels and malaria anemia (McGuire et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). The TNF-α overproduction in malaria can contribute to reduced red cell production and anemia through suppression of bone marrow erythropoiesis and dyserythropoiesis. TNF-α has been shown to suppress erythropoiesis through inhibition of BFU-E and CFU-E through decreasing their responsiveness to erythropoietin (Abdalla and Pasvol, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, McGuire et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1999\u003c/span\u003e, Ekvall, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2003\u003c/span\u003e, Robson and Weatherall, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2009\u003c/span\u003e, Mohamedahmed, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Also, the suppressive effect of macrophages from patients on human BFU-E and CFU-E was shown to be mediated by TNF-α (Abdalla and Pasvol, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Furthermore, TNF-α synergizes with hemozoin and nitric oxide in the inhibition of erythropoiesis (Mandala et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Awandare et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). On the other hand, Elevated TNF-α level and GM-CSF synergistically increase FcγR and CR expression on human neutrophils and monocytes thereby stimulated opsonin-dependent phagocytosis and thereby enhanced clearance of parasitized erythrocytes but the prolonged response was seen to contribute to adverse disease and thus was associated with severe disease syndromes (Thuma et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Deroost et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Also, TNF-α overproduction in malaria may result from the upregulation of the expression of endothelial adhesion molecules such as ICAM-1 or other adhesion molecules, leading to enhanced sequestration of parasitized red cells and anemia through macrophage activation (Abdalla and Pasvol, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Lamikanra et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). More ever Reduced prostaglandin E2 production by hemozoin is reported to lead to overproduction of TNF-α and anemia (Keller et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, Daffa Alla and Sukkar, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In addition, TNF-α contributes to the anemia of chronic disease by the suppression of erythropoiesis and reduced erythroblast iron incorporation (Abdalla and Pasvol, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Spottiswoode et al., 2014).\u003c/p\u003e \u003cp\u003eThe average of TNF-α levels in mild, moderate and severe anemia were (190.75\u0026thinsp;\u0026plusmn;\u0026thinsp;102.55, 189.70\u0026thinsp;\u0026plusmn;\u0026thinsp;80.35 and 299.75\u0026thinsp;\u0026plusmn;\u0026thinsp;82.27 pg/ml respectively) giving highly significant differences between them (P value 0.000) and strong significant positive correlation (r\u0026thinsp;+\u0026thinsp;0.309; P value 0.000), and significant negative correlation with hemoglobin (r \u0026ndash; 0.419; P value 0.000). Similar study showed mild, moderate and severe anemia were (108.9, 132.2 and 193.9 pg/ml respectively), giving highly significant differences between them and strong significant positive correlation with anemia severity and negative correlation with hemoglobin (Khan and Malik, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Direct associations between severe malarial anemia was found for higher TNF-α concentration in children in Zambia (Thuma et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), Kenya (Othoro et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1999\u003c/span\u003e), Ghana (Kurtzhals et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1998\u003c/span\u003e) and Pakistani (Khan and Malik, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). In contrast other study have found no association between or high TNF-α and malarial anemia (Helleberg et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). In \u003cem\u003eP. falciparum\u003c/em\u003e infected children, the TNF level was negative correlated with Hb levels (Deroost et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Ogonda et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Continuous TNF-α overproduction increase suppression of bone marrow erythropoiesis and dyserythropoiesis and accelerated destruction of infected red blood cells result in enhancing severity of malaria anemia (Thuma et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Robson and Weatherall, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2009\u003c/span\u003e, Ekvall, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2003\u003c/span\u003e, Abdalla and Pasvol, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Deroost et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In \u003cem\u003eP. falciparum\u003c/em\u003e infected children, the TNF-α level was negatively correlated with hemoglobin levels (Deroost et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Ogonda et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, Nussenblatt et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTNF-α 238 A account for 53.5 (83.6%) from 64 anemic patients, giving highly significant association between TNF-α 238 A alleles (especially TNF-α 238 AA genotype [73.4%]) with malaria anemia compared to G alleles (P value 0.000), in both SM (P value 0.000) and UM (P value 0.015) within TNF-α 238 A allele to be associated with susceptibility to 3.13 fold risk for developing anemia. Furthermore, TNF-α 238 AA represent (67.7%, 80% and 66.7% respectively) in mild, moderate and severe anemia; giving highly significant association between TNF-α 238 A alleles and clinical types of malaria anemia (P value 0.000), and also in SM (P value 0.000). This finding consistence with study done in Gambia that found TNF-α 238 A allele to be associated with susceptibility to malarial anemia especially severe malaria anemia with a 2.5 fold risk of developing SMA (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (McGuire et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). May \u003cem\u003eet al\u003c/em\u003e. reported TNF-α 238 alleles were associated with severe malaria anemia (May et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). In contrast, study done in Mali reported lack of association between TNF-α 238 alleles and severe malaria anemia (Cabantous et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). This suggest that the location of the TNF-α 238 A allele in the TNF-α promoter region to be associated with susceptibility to influence constitutive TNF-α production directly compared to G allele in malaria anemia. SNPs at many positions as 238 in the proximal enhancer of the TNF gene exhibit differential associations to malaria and TNF production in different populations (Ubalee et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2001\u003c/span\u003e, Cabantous et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, McGuire et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1999\u003c/span\u003e, Mcguire et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e1994\u003c/span\u003e, Aidoo et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2001\u003c/span\u003e, Sinha et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe confounders of other baseline factors were not addressed here;. We suggest a More details on baseline characteristics like socioeconomic status, nutritional status and co-infection could help rule out potential confounders.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe significance of TNF-α level and TNF-α 238 A allele in children with severe falciparum anemia will assist clinicians in diagnosing and better managing severe malaria cases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval and consent to participate:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthical approval was obtained from the both Researches and Ethics Committees (REC) of Ministry of Health, Gezira State (No: 4-11-2017). Informed consent was written from each participant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent of publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors agree for publication. Written informed consent was obtained from the patient for publication of this article. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData are presented within the manuscript and can be provided by the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research received no specific grant from any funding agency in the public, commercial or not-for-profit sectors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements (optional):\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank all participants recruited for the study. We also thank the medical staff of the Wad Medani Pediatric Hospital for their help during the study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eABDALLA, S. H. \u0026amp; PASVOL, G. 2004. Malaria: A Hematological Perspective, Tropical Medicine Science and Practice, London, Imperial College Press.\u003c/li\u003e\n\u003cli\u003eABDELNASSIR, M. A., HAFIZ, A. H., GAD ALLAH, M. \u0026amp; MOHAMMED, S. E. 2019. Hematological Changes in Sudanese Patients with Falciparum Malaria Attending Elnihoud Teaching Hospital. Sudan Journal of Medical Sciences, 14, 24-30.\u003c/li\u003e\n\u003cli\u003eAIDOO, M., MCELROY, P. D., KOLCZAK, M. S., TERLOUW, D. J., TER KUILE, F. O. \u0026amp; AL, E. 2001. Tumor Necrosis Factor-a Promoter variant 2 (TNF2) is associated with pre-term delivery, infant mortality, and malaria morbidity in Western Kenya: Asembo Bay cohort project IX. Genet Epidem, 21, 201-211.\u003c/li\u003e\n\u003cli\u003eANTWI-BAFFOUR, S., KYEREMEH, R., BUABENG, D., ADJEI, J. K., ARYEH, C., KPENTEY, G. \u0026amp; SEIDU, M. A. 2018. Correlation of malaria parasitaemia with peripheral blood monocyte to lymphocyte ratio as indicator of susceptibility to severe malaria in Ghanaian children. Malaria journal, 17, 1-9.\u003c/li\u003e\n\u003cli\u003eAWANDARE, G. A., KEMPAIAH, P., OCHIEL, D. O., PIAZZA, P., KELLER, C. C. \u0026amp; PERKINS, D. J. 2011. Mechanisms of erythropoiesis inhibition by malarial pigment and malaria-induced proinflammatory mediators in an in vitro model. Am J Hematol, 86, 155-162.\u003c/li\u003e\n\u003cli\u003eBAIN, B. J., BATES, I., LAFFAN, M. \u0026amp; LEWIS, M. 2011. British, Elsevier Ltd.\u003c/li\u003e\n\u003cli\u003eBIRHANU, M., ASRES, Y., ADISSU, W., YEMANE, T., ZEMENE, E. \u0026amp; GEDEFAW, L. 2017. Hematological Parameters and Hemozoin-Containing Leukocytes and Their Association with Disease Severity among Malaria Infected Children: A Cross-Sectional Study at Pawe General Hospital, Northwest Ethiopia. Interdisciplinary Perspectives on Infectious Diseases, 7.\u003c/li\u003e\n\u003cli\u003eCABANTOUS, S., DOUMBO, O., RANQUE, S., POUDIOUGOU, B., TRAORE, A., HOU, X. \u0026amp; AL, E. 2006. Alleles 308A and 238A in the Tumor Necrosis Factor Alpha gene promoter do not increase the risk of severe malaria in children with Plasmodium falciparum infection in Mali. Infect Immun, 74, 7040-7042.\u003c/li\u003e\n\u003cli\u003eDAFFA ALLA, N. \u0026amp; SUKKAR, M. Y. 2015. IFN-\u0026gamma;, TNF-\u0026alpha; and IL-10 responses in children infected with malaria parasite. Khartoum Medical Journal, 8, 1143-1152.\u003c/li\u003e\n\u003cli\u003eDEROOST, K., PHAM, T. T., OPDENAKKER, G. \u0026amp; VAN DEN STEEN, P. E. 2016. The immunological balance between host and parasite in malaria. FEMS Microbiology Reviews, 40, 208-257.\u003c/li\u003e\n\u003cli\u003eEKVALL, H. 2003. Malaria and anemia. Curr Opin Hematol, 10, 108-114.\u003c/li\u003e\n\u003cli\u003eFLORI, L., DELAHAYE, N. F., IRAQI, F. A., HERNANDEZ-VALLADARES, M., FUMOUX, F. \u0026amp; RIHET, P. 2005. TNF as a malaria candidate gene: polymorphism-screening and familybased association analysis of mild malaria attack and parasitemia in Burkina Faso. Genes and Immunity, 6, 472-480.\u003c/li\u003e\n\u003cli\u003eFLORI, L., SAWADOGO, S., ESNAULT, C., DELAHAYE, N. F., FUMOUX, F. \u0026amp; RIHET, P. 2003. Linkage of mild malaria to the major histocompatibility complex in families living in Burkina Faso. Human Molecular Genetics, 12, 375-378.\u003c/li\u003e\n\u003cli\u003eFRIMPONG, A., KUSI, K. A., TORNYIGAH, B., OFORI, M. F. \u0026amp; NDIFON, W. 2018. Characterization of T cell activation and regulation in children with asymptomatic Plasmodium falciparum infection. Malaria journal, 17, 263.\u003c/li\u003e\n\u003cli\u003eHELLEBERG, M., GOKA, B. Q., AKANMORI, B. D., OBENG-ADJEI, G., RODRIQUES, O. \u0026amp; KURTZHALS, J. A. 2005. Bone marrow suppression and severe anaemia associated with persistent Plasmodium falciparum infection in African children with microscopically undetectable parasitaemia. Malaria journal, 4, 56.\u003c/li\u003e\n\u003cli\u003eKELLER, C. C., DAVENPORT, G. C. \u0026amp; DICKMAN, K. R. 2006. Suppression of prostaglandin E2 by malaria parasite products and antipyretics promotes overproduction of tumor necrosis factor-alpha: association with the pathogenesis of childhood malarial anemia. J Infect Dis, 193, 1384-1393.\u003c/li\u003e\n\u003cli\u003eKHAN, A. S. \u0026amp; MALIK, S. A. 1996. Tumor Necrosis Factor in Falciparum Malaria. Ann Saudi Med, 16, 609-614.\u003c/li\u003e\n\u003cli\u003eKURTZHALS, J. A., ADABAYERI, V., GOKA, B. Q., AKANMORI, B. D., OLIVER-COMMEY, J. O., NKRUMAH, F. K. \u0026amp; AL, E. 1998. Low plasma concentrations of interleukin 10 in severe malarial anaemia compared with cerebral uncomplicated malaria. Lancet, 351, 1768-1772.\u003c/li\u003e\n\u003cli\u003eLAMIKANRA, A. A., MERRYWEATHER-CLARKE, A. T., TIPPING, A. J. \u0026amp; ROBERTS, D. J. 2015. Distinct mechanisms of inadequate erythropoiesis induced by tumor necrosis factor alpha or malarial pigment. PLoS One, 10, e0119836.\u003c/li\u003e\n\u003cli\u003eMADUKAKU, C. U., CHIMEZIE, O. M., CHIMA, N. G., HOPE, O. \u0026amp; SIMPLICIUS, D. I. N. 2015. Assessment of the haematological profile of children with malaria parasitaemia treated with three different artemisinin-based combination therapies. Asian Pac J Trop Dis, 5, 448-453.\u003c/li\u003e\n\u003cli\u003eMANDALA, W. L., MSEFULA, C. L., GONDWE, E. N., DRAYSON, M. T., MOLYNEUX, M. E. \u0026amp; MACLENNAN, C. A. 2017. Cytokine profiles in Malawian children presenting with uncomplicated malaria, severe malarial anemia, and cerebral malaria. Clin Vaccine Immunol, 24, e00533-16.\u003c/li\u003e\n\u003cli\u003eMAWSON, A. R. 2013. The Pathogenesis of Malaria: a new perspective. Pathogens and Global Health, 107, 122-129.\u003c/li\u003e\n\u003cli\u003eMAY, J., LELL, B., LUTY, A. J., MEYER, C. G. \u0026amp; KREMSNER, P. G. 2000. Plasma interleukin-10: tumor necrosis factor (TNF-\u0026alpha;) ratio is associated with TNF promoter variants and predicts malarial complications. Infect. Dis 182, 1570-1573.\u003c/li\u003e\n\u003cli\u003eMCGUIRE, W., HILL, A. V., ALLSOPP, C. E., GREENWOOD, B. M. \u0026amp; KWIATKOWSKI, D. 1994. Variation in the TNF-alpha promoter region associated with susceptibility to cerebral malaria. Nature, 371, 508-5010.\u003c/li\u003e\n\u003cli\u003eMCGUIRE, W., KNIGHT, J. C., HILL, A. V., ALLSOPP, C. E., GREENWOOD, B. M. \u0026amp; KWIATKOWSKI, D. 1999. Severe malarial anemia and cerebral malaria are associated with different tumor necrosis factor promoter alleles. J Infect Dis, 179, 287-290.\u003c/li\u003e\n\u003cli\u003eMOHAMEDAHMED, K. A. 2023. Association between Elevated TNF-\u0026alpha; Levels and Severe Malaria. Galen Medical Journal, 12, e2927.\u003c/li\u003e\n\u003cli\u003eMOHAMEDAHMED, K. A. \u0026amp; ABAKAR, A. D. 2020. Severe Falciparum Malaria: An Overview. . Int J Med Parasitol Epidemiol Sci, 1, 105-106.\u003c/li\u003e\n\u003cli\u003eMOHAMEDAHMED, K. A., ABAKAR, A. D., AHMED, M. O., MUKHTAR, M. M. \u0026amp; NOUR, B. Y. M. 2019a. The Role of TNF-\u0026alpha; Levels as Predictive Diagnostic Biomarker Among Children with Severe Falciparum Malaria in Endemic Area in Sudan. IJAHMR, 3, 1-6.\u003c/li\u003e\n\u003cli\u003eMOHAMEDAHMED, K. A., AHMED, Z. A., NOUR, B. Y. M., ABAKAR, A. D. \u0026amp; BABKER, A. M. 2020a. Impact of Severe Plasmodium Falciparum Infection on Platelets Parameters Among Sudanese Children Living in Al-Jazira State. Int. j. clin. biomed. res, 6, 5-9.\u003c/li\u003e\n\u003cli\u003eMOHAMEDAHMED, K. A., MUSTAFA, R. E., ABAKAR, A. D. \u0026amp; NOUR, B. Y. M. 2019b. Evaluation of Neutrophil Lymphocyte Ratio (NLR) in Sudanese Children with Falciparum Malaria. IJAHMR, 3, 1-6.\u003c/li\u003e\n\u003cli\u003eMOHAMEDAHMED, K. A., NOUR, B. Y. M., ABAKAR, A. D. \u0026amp; BABKER, A. M. 2020b. Diagnostic and prognostic value of thrombocytopenia severity in Sudanese children with Falciparum malaria. World J Adv Res Rev, 6, 197-204.\u003c/li\u003e\n\u003cli\u003eMOHAMMED, Z. O., GABERALLAH, K. M., MOHAMMED, M. S. \u0026amp; MOHAMEDAHMED, K. A. 2020. Evaluation of Coagulation Profiles (PT, INR, and APTT) among Sudanese Patients with Falciparum Malaria Infection. IJAHMR, 4, 15-21.\u003c/li\u003e\n\u003cli\u003eNATIONAL MALARIA CONTROL PROGRAMME 2010. Five Years Strategies Plan for the National Malaria Control Programme, Sudan 2011\u0026ndash;2015. Federal Ministry of Health.\u003c/li\u003e\n\u003cli\u003eNUSSENBLATT, V., MUKASA, G., METZGER, A., NDEEZI, G., GARRETT, E. \u0026amp; SEMBA, R. D. 2001. Anemia and interleukin-10, tumor necrosis factor a, and erythropoietin levels among children with acute, uncomplicated Plasmodium falciparum malaria. clin Diagn Lab Immunol, 8, 1164-1170.\u003c/li\u003e\n\u003cli\u003eOGONDA, L. A., ORAGO, A. S., OTIENO, M. F., ADHIAMBO, C., OTIENO, W. \u0026amp; STOUTE, J. A. 2010. The levels of CD16/Fc gamma receptor IIIA on CD14+ CD16+ monocytes are higher in children with severe Plasmodium falciparum anemia than in children with cerebral or uncomplicated malaria. Infect Immun, 78, 2173-2181.\u003c/li\u003e\n\u003cli\u003eOTHORO, C., LAL, A. A., NAHLEN, B., KOECH, D., ORAGO, A. S. \u0026amp; UDHAYAKUMAR, V. 1999. A low interleukin-10 tumor necrosis factor-alpha ratio is associated with malaria anemia in children residing in a holoendemic malaria region in Western Kenya. J Infect Dis, 179, 279-282.\u003c/li\u003e\n\u003cli\u003eRATHOD, C. C., DESHPANDE, S. V., RANA, H. M., GODBOLE, V. Y., PATEL, V., PATEL, A. \u0026amp; AL, E. 2012. Plasmodium Falciparum Versus Plasmodium Vivax: Which is a Lesser Evil? Natl J Community Med, 3, :541-547.\u003c/li\u003e\n\u003cli\u003eRECKER, M., BULL, P. C. \u0026amp; BUCKEE, C. O. 2018. Recent advances in the molecular epidemiology of clinical malaria. F1000Res.\u003c/li\u003e\n\u003cli\u003eROBERTS, D. \u0026amp; MATTHEWS, G. 2016. Risk factors of malaria in children under the age of five years old in Uganda. Malaria journal, 15, 246.\u003c/li\u003e\n\u003cli\u003eROBSON, K. J. \u0026amp; WEATHERALL, D. J. 2009. Malarial anemia STAT6. Haematologica, 94, 157-159.\u003c/li\u003e\n\u003cli\u003eROLL BACK MALARIA IN SUDAN 2017. Sudan Malaria Treatment Protocol 2017. Federal Ministry of Health.\u003c/li\u003e\n\u003cli\u003eSINHA, S., MISHRA, S. K., SHARMA, S., PATIBANDLA, P. K., MALLICK, P. K., SHARMA, S. K. \u0026amp; AL, E. 2008. Polymorphisms of TNF-enhancer and gene for Fc\u0026gamma;RIIa correlate with the severity of falciparum malaria in the ethnically diverse Indian population. Malaria journal, 7, 13.\u003c/li\u003e\n\u003cli\u003eSPOTTISWOODE, N., DUFFY, P. E. \u0026amp; DRAKESMITH, H. 2014. Iron, anemia and hepcidin in malaria. Front Pharmacol, 5, 125.\u003c/li\u003e\n\u003cli\u003eSUMBELE, I. U. N., KIMBI, H. K., NDAMUKONG-NYANGA, J. L. N., M, ANCHANG-KIMBI, J. K., LUM, E. \u0026amp; AL, E. 2015. Malarial Anaemia and Anaemia Severity in Apparently Healthy Primary School Children in Urban and Rural Settings in the Mount Cameroon Area: Cross Sectional Survey. PLoS One, 10, e0123549.\u003c/li\u003e\n\u003cli\u003eTHUMA, P. E., VAN DIJK, J., BUCALA, R., DEBEBE, Z., NEKHAI, S., KUDDO, T. \u0026amp; AL, E. 2011. Distinct clinical and immunologic profiles in severe malarial anemia and cerebral malaria in Zambia. J Infect Dis, 203, 211-219.\u003c/li\u003e\n\u003cli\u003eUBALEE, R., SUZUKI, F., KIKUCHI, M., TASANOR, O., WATTANAGOON, Y., RUANGWEERAYUT, R. \u0026amp; AL, E. 2001. Strong association of a tumor necrosis factor-alpha promoter allele with cerebral malaria in Myanmar. Tissue Antigens, 58, 407-410.\u003c/li\u003e\n\u003cli\u003eURBAN, B. C., WILLCOX, N. \u0026amp; ROBERTS, D. 2001. A role for CD36 in the regulation of dendritic cell function. Proc Natl Acad Sci USA, 98, 8750-8755.\u003c/li\u003e\n\u003cli\u003eWORLD HEALTH ORGANIZATION (WHO) 2015. Guidelines for the Treatment of Malaria. 3rd ed. Geneva: WHO.\u003c/li\u003e\n\u003cli\u003eWORLD HEALTH ORGANIZATION (WHO) 2018. World Malaria Report 2018, 11th ed. Geneva: WHO. 11 ed.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"University of Gezira","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Falciparum malaria anemia, TNF-α levels, TNF-α 238 alleles, RBCs parameters, Sudanese children","lastPublishedDoi":"10.21203/rs.3.rs-6158689/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6158689/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eTNF-α levels overproduction and promoter polymorphisms at TNF-α 238 alleles may play central role in reduced red cell production and malaria-related anemia through suppression of bone marrow erythropoiesis and Dyserythropoiesis. This study aimed to evaluate the TNF-α 238 alleles polymorphism and its association with TNF-α levels in the children with falciparum malaria.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eA longitudinal hospital-based study was conducted among 100 children with severe falciparum malaria (mean age 8.63\u0026thinsp;\u0026plusmn;\u0026thinsp;3.40 years) and 100 children with uncomplicated falciparum malaria (mean age 8.83\u0026thinsp;\u0026plusmn;\u0026thinsp;4.20 years). TNF-α level was measured using Human TNF-α ELISA MAX\u0026trade; Deluxe Sets. PCR was used for detecting TNF-α 238 alleles polymorphism. Obtained data were analyzed by SPSS (V 20.0) and Stat disk (V 13.0).\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eTNF-α 238A allele was a common allele (66.8%). Falciparum malaria-related anemia accounted for 32%, commonly in SM (55%) compared to UM (9%) (\u003cem\u003eP value\u003c/em\u003e 0.000). Otherwise, The average of TNF-α levels strongly positively correlated with the severity of anemia (r\u0026thinsp;+\u0026thinsp;0.309; \u003cem\u003eP value\u003c/em\u003e 0.000). The TNF-α 238 A allele accounts for 83.6% of malaria anemia (\u003cem\u003eP value\u003c/em\u003e 0.000) and 100% severe anemia (\u003cem\u003eP value\u003c/em\u003e 0.000).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOverproduction of TNF-α is essential for the elimination and clearance of falciparum parasite but may be associated with severity of malaria and malaria anemia. Overproduction of TNF-α in children with TNF-α 238 A allele may result in falciparum malaria-related anemia among children. These findings will assist clinicians in better managing severe malaria-related anemia cases.\u003c/p\u003e","manuscriptTitle":"TNF-α 238 Alleles Polymorphism and its Association with TNF-α Levels in the Severe Malaria Anemia among Sudanese Children","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-11 08:52:43","doi":"10.21203/rs.3.rs-6158689/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"be7caea5-508e-41c1-bb80-2835f86355c7","owner":[],"postedDate":"March 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":45211472,"name":"Immunology"},{"id":45211473,"name":"Infectious Diseases"},{"id":45211474,"name":"Hematology"}],"tags":[],"updatedAt":"2025-03-11T08:52:44+00:00","versionOfRecord":[],"versionCreatedAt":"2025-03-11 08:52:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6158689","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6158689","identity":"rs-6158689","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}