Characterization of an efficient waste fat hydrolysing and detergent compactible lipase from newly isolated Pseudomonas mosselii | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Characterization of an efficient waste fat hydrolysing and detergent compactible lipase from newly isolated Pseudomonas mosselii Mohana Priya Srinivasan, Dayanandan Anandan, Ajith Chandrasekar, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3972296/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Lipase enzyme plays a major role in several industrial processes. The effective production of lipase enzyme from microorganism in a cost-effective manner is in great demand in the current scenario. This study has aimed in producing an effective and high active stable lipase enzyme from Pseudomonas mosselii isolated from the highly polluted cooum river bed soil, Chennai, Tamil Nadu, India. The enzyme showed the high specific activity of 157.94 U/mg. Further optimization studies which include, pH (6.5-7) 110.298 U/ml, temperature (35°C – 40°C) 112.388 U/ml, incubation time (36 hrs) 119.79 U/ml, effective substrate olive oil (1%) 118.05 U/ml and nitrogen source (Peptone 1.5% (w/v)), 150.74 U/ml enhanced the parameters to be considered for the high production of lipase enzyme. The purification process carried out in this study was ammonium sulphate precipitation, dialysis and column chromatography using Sephadex G-100 as a stationary phase. The characterization studies of partially purified lipase enzymes with parameters enhanced the stability study as follows: pH (6–8), temperature (30°C to 50°C), metal ions (Ca 2+ ) and detergent (Tween 80). The hydrolysis of the waste tallow using the produced lipase showed highest reaction ratio of 83.7% after 72 hrs at 50°C, 82.6% at 40°C and 81.2% at 30°C. The detergent compatible test confirmed that the lipase was compactible with the detergent and the stains were removed efficiently. Thus, this lipase may effectively serve as the feedstock for biodiesel production and as a detergent compactible application. Pseudomonas mosselii stable lipase optimization characterization hydrolysis detergent Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction The hydrolases known as lipases (Triacyclglycerol acyl hydrolases, EC3.1.1.3) are specialised for the hydrolysis of fats into fatty acids and glycerol at the water-lipid interface. They are abounding in nature and have the ability to reverse the reaction in non-aqueous medium (van Schie et al. 2021). Clade Bernad was the first to identify lipase in pancreatic juice in 1856 as an enzyme that degraded insoluble oil droplets and transformed them into soluble compounds (Jamilu, Ibrahim, and Abdullahi 2022). There have been claims that various types of fungus, yeast, bacteria, animals, and plants are effective sources of lipase (Faryad, Ataa and Joyia, 2020). However, microbially produced lipases have become the focus of interest due to their multiple advantages, including ease of handling culture, ease of manufacturing scale-up, ease of genetic manipulation, seasonal changes, and safety and stability (Nema et al. 2019 ). According to Prem et al. (2020), most bacterial species are known to produce their highest levels of enzyme activity at neutral and alkaline pH levels. Excellent thermostability and other stress-tolerant traits are displayed by certain animals (Chandran et al., 2020). Some species exhibit great thermostability and other stress tolerant parameters. Wide-temperature-window enzymes, particularly those that exhibit activity at lower temperatures, are necessary for several bioprocesses in the detergent, fermentation, and biomass conversion industries. These processes conserve energy conversion and prevent the growth of mesophilic bacteria (Atalah et al., 2019 ; Mrudula Vasudevan et al., 2019 ; Ramani et al. , 2010; Kumar and Thakur, 2020). Enzymatic hydrolysis is a beneficial method, because it may be carried out at a lower temperature to conserve energy and because it has excellent selectivity, resulting in products with high purity and fewer byproducts (Ramani et al. 2010). It has been reported that lipase has thermostability and reacts to cold, which is useful for industrial application (Kumar and Thakur 2020). To produce commercial lipases, Bacillus species, Pseudomonas species, Staphylococcus species, and Burkholderia species are the most common bacterial sources (Bharathi and Rajalakshmi, 2019; Priyanka, Kinsella, et al. , 2019) The three-dimensional structures of lipases originating from diverse microbiological sources differ significantly in terms of sequence variety (Gupta et al. 2015). These characteristics make these enzymes distinct and particular to the kinds of bioconversion processes they catalyse, making them useful in a variety of industrial processes (Mehta, Bodh, and Gupta 2017). It has been discovered that they are helpful in catalysing a variety of reactions related to the food, pharmaceutical, dairy, fatty acid, leather, cosmetic, detergent, beverage, and paper sectors. (Sharma et al. 2017) Eight families of bacterial lipases have been identified, and each family has unique characteristics that differ in terms of ideal pH and temperature, among other factors. (Rios et al. 2018 ). Except for a few acid ideal lipases made by cultures of Pseudomonas cepacia and Pseudomonas fluorescens , lipases from Pseudomonas sp usually have neutral or alkaline optimal pH (Liu, Li, and Yan 2017). The optimal pH activity spans from 4 to 9, the ideal temperature ranges from 25 to 70°C, and the enzyme molecular weight ranges from 16 to 96 kDa, depending on the species and genus of the microorganism from which lipases have been purified (Rios et al. 2018 ), however, very few exhibit catalytic properties over a wider temperature range. Lipases extract an acyl group from glycerides during hydrolysis to create a lipase–acyl complex, which subsequently transfers the acyl group to the O–H group in water. The hydrolysis of oils to produce fatty acids is the primary use of lipase in the oleochemical industry. Because free fatty acids are widely used in surfactants, soap production, the food sector, and biomedical applications, they are considered value-added goods. Traditionally, oil hydrolysis is accomplished by applying high pressure and temperature to a chemical catalyst. The majority of organic chemists and pharmacologists prefer to use bacteria from the genera Pseudomonas and Burkholderia as catalysts due to their distinct characteristics, which include temperature stability, high enantio-selectivity, and activity in a wider pH range (Gurkok and Ozdal 2021). Because of this, a great deal of study has been done on the synthesis of lipase utilising Pseudomonas sp. from lipid substrates that are discarded as waste products from numerous industrial operations. Therefore, the synthesis of lipolytic enzymes from solid waste materials containing lipids can result in the creation of environmentally friendly technologies (Ramani et al. 2010). Global production and improper handling of millions of tonnes of these waste lipids is currently occurring, which has a negative impact on the economy, the environment, and human health in addition to decreasing the materials' value as oleochemical resources (Lahiri et al. 2023 ). For instance, the incorrect disposal of used cooking oils, tallow waste, and grease traps in sewage causes accumulation and obstruction, which causes overflows, flooding during rainy seasons, the spread of viruses and rodents, pollution of water supplies, and damage to ecosystems. This study focuses on the development of the lipase enzyme from bacterial species and produces feedstock for biodiesel production by hydrolysis of waste tallow using lipase to test the usefulness of the lipase activity in varied applications for beneficial results. The hydrolysed product may be effectively used as the feedstock for biodiesel production. The strains were identified by whole genome sequencing. 2. Materials and Methods 2.1. Materials: Tributyrin, Peptone, Yeast, agar, NaOH, CaCl 2 , Beef extract, NH 4 H 2 PO 4 , NaCl, MgSO 4 .7H 2 O, CaCl 2 .2H 2 O, Tween 80, Ethanol, p-nitrophenol palmitate (p-NPP) as substrate, gum Arabic, triton X-100, isopropanol, phenolphthalein, pH indicator, ammonium sulphate, dialysis membrane, Sephadex G-100, Na 2 HPO 4 .2H 2 O, NaH 2 PO 4 .H 2 O, Tris free base, HCl, Sodium Dodecyl Sulphate (SDS), Acrylamide-Bis acrylamide, glycine, glycerol, β-mercaptoethanol, PEG (Polyethylene glycol), EDTA, bromophenol blue, TEMED, APS, Coomassie brilliant blue, distilled water. The chemicals purchased are from Sigma Aldrich and Hi-Media. Olive oil and waste tallow was purchased from the local market, Chennai. All the chemicals purchased were in analytical grades. 2.2. Isolation of bacteria from collected sample: The sample were collected from highly polluted cooum river bed soil, Chennai, Tamil Nadu, India. Without the influence of any contaminants, the samples were transported to the laboratory in a sterilized container. Serial dilution (10 − 1 − 10- 10 ) of the soil sample was performed to isolate the pure cultures. 10 − 5 , 10 − 6 , and 10 − 7 was spread plated to obtain individual colonies. All the materials utilised, including the petri dish, L-rod, distilled water, agar medium etc., were autoclaved for 20 minutes at 15 psi, 121°C. The sterile L-Rod was used to disseminate the 100 µl of serial diluted sample onto the solidified agar plate. The plates were incubated for 24 hours at 37°C. Following the production of several subcultures, the pure bacterial culture was kept at 4°C in a sterile container. 2.3. Lipase screening of the isolated cultures using tributyrin agar: The production of extracellular lipase enzyme from the bacterial pure culture was examined using tributyrin agar. The media's ingredients were as follows. The following ingredients were combined in the sterilised distilled water and autoclaved at 15 psi, 121°C for 20 minutes: Peptone (5 g/L), Yeast (3 g/L), Agar (15 g/L), and Tributyrin (10 ml/L). To solidify, the medium was poured into the sterilised petri plate. A loop full of an isolated bacterial culture was progressively streaked. After streaking, the plates were incubated at 37°C for 24 hours. The clear zone was observed around the colonies which indicated the hydrolysis of tributyrin and the efficient release of the lipase from the isolated bacteria. The molecular identification of the positive stain was carried out. 2.4. Identification of the lipase producing organism: The genomic DNA was isolated from a culture that produced lipase enzymes efficiently. Using the universal 16s forward primer 27F (5′ AGAGTTTGATCMTGGCTCAG 3′) and reverse primer 1492R (5′ CGGTTACCTTGTTACGACTT 3′), the 16s rRNA gene amplification was conducted using PCR, or polymerase chain reaction techniques. The identification was done at Biokart Pvt Ltd, Bangalore. Using BLAST (Basic Local Alignment Sequencing tool), the 16S rRNA sequence was compared, aligned to identify the organism. The phylogenetic tree was generated for the nucleotide sequence using Mega X software. The evolutionary relationship was developed using neighbor-joining tree and the bootstrap value replications of 1000. 2.5. Media composition for lipase production from the isolated bacterial strain: The 250ml Erlenmeyer flask was used to cultivate the isolated colonies with the best enzymatic activity. The lipase media were made up of the following ingredients. Peptone 2%, NH 4 H 2 PO 4 1%, NaCl 0.25%, MgSO 4 .7H 2 O 0.04%, CaCl 2 .2H 2 O 0.04%, and olive oil 2% (w/v) with tween 80 as an emulsifier for effective mixing of oil with the media. The pH was adjusted 7. A loop full of isolated pure culture was inoculated into the media to effectively lipase. The flask was incubated for 24 hours at 37°C. After incubation, the culture medium was centrifuged for 15 minutes at 10,000 rpm at 4°C. The cell free supernatant (Crude enzyme) was further analysed and characterized. 2.6. Optimization of the lipase enzyme production from bacterial source: 2.6.1. Effect of pH: Varied range of pH was used to understand the effect of pH on lipase production. The pH range of 4–12 was analysed in the nutrient broth with the isolated organism. The medium was incubated at 37°C for 36 hrs at 130 rpm and the enzyme activity was calibrated. The optimized parameters were kept unaltered to improve better lipase production. 2.6.2. Effect of temperature: Thermostability of the lipase enzyme was determined by subjecting the enzyme to range of temperature from 20°C to 60°C. The incubation was carried out at pH 7 with 37°C for 36 hrs at 130 rpm by inoculating the culture in different flasks. Effective activity at the range of temperature was carried out and set as parameter for the rest of the studies. 2.6.3. Effect of inoculum Size: The inoculum size was optimized for the effective production of lipase from the isolate. The inoculum size ranging from 0.5 to 10% was considered. The incubation was carried out at 7 pH, 37°C for 36 hrs. The enzyme activity was calculated. 2.6.4. Effect of incubation time on lipase activity: The incubation time plays a major role in obtaining the better production of enzyme with high stability and activity. The organism was cultured with incubation time ranging from 12 hrs to 60 hrs. The basal media was incubated at 37°C at 130 rpm. The media was fixed with the other optimized parameters and the activity upon time was calculated. 2.6.5. Effect of substrate on lipase activity: Various substrate like olive oil, corn oil, gingelly oil, castor oil, almond oil, and coconut oil at 1% concentration was analysed with isolated culture in each flask and the effective substrate for the lipase activity was optimized for the effective production of the enzyme. The constant parameters maintained was 37°C for 36 hrs at 130 rpm. 2.6.6. Effect of nitrogen source on lipase activity: Various nitrogen sources like peptone, yeast extract, tryptone, urea, sodium nitrite, potassium nitrite and ammonium nitrate by 1.5%(w/v) was analysed for efficient lipase activity and stable by maintaining the other parameters unchanged. The bacterial culture was inoculated at pH 7, 37°C for 36 hrs at 130 rpm. 2.7. Protein estimation: The protein concentration of the supernatant and the purified samples were determined by nanodrop spectrophotometer 2000. The total protein concentration of the crude lipase enzyme and the purified samples were applied in calculating the activity. 2.8. Determination of lipase activity using spectrophotometric method: To enhance the accurate determination of lipase enzyme activity, spectrophotometric method was used. P-nitrophenyl palmitate (p-NPP) was used as a substrate. The procedure was adopted from Salgado and their colleagues (Salgado, Baglinière, and Vanetti 2020) with slight modifications. The p-nitrophenyl palmitate (p-NPP) reaction substrate was made up of solutions A and B. In solution A, 40 mg of p-nitrophenyl palmitate was dissolved in 12 ml of isopropanol, while in solution B, 0.1 g of gum Arabic and 0.4 ml of triton are added in 90ml of distilled water. 1 ml of solution A and 19ml of solution B were added to make up the complete substrate solution. 1 ml of prepared substrate, 0.5 ml of buffer, 0.1 ml of produced lipase enzyme and was added and final volume was made up to 3 ml with distilled water. After incubation, isopropanol was used to terminate the reaction. The absorbance at 410nm was calibrated. The activity was intended using Eq. 1. The definition of an enzyme is 1 mol of P-nitrophenol emitted from the enzyme per minute of substrate. One lipase enzyme = 1mol of p-nitrophenol enzyme released from substrate/Minute (1) 2.9. Purification of the optimized lipase: The purification of the isolated enzyme not only removes the salt and other components but also facilitates effective activity of the enzyme. In this study, ammonium sulphate precipitation, dialysis and column chromatography were performed to purify the produced crude enzyme. 2.9.1. Ammonium sulphate precipitation: A salt with a strong ionic charge, ammonium sulphate, promotes the precipitation of proteins at increasing quantities. To partially purify lipase, saturated ammonium sulphate with concentration of 70% were added to 5 mL of crude extract obtained under ideal circumstances. Each test tube was kept at 4°C overnight, and the following day, they were centrifuged for 10 minutes at a speed of 10,000 rpm. After suspending the pellet in phosphate buffer, lipase activity was estimated using spectrophotometric method. 2.9.2. Dialysis: The precipitated sample was proceeded with dialysis step in a dialysis membrane immersed in 0.1 M of sodium phosphate buffer. The membrane preparation was followed according to the standard procedure. The apparatus was kept overnight at 4°C with moderate shaking. The sample was checked for enzyme activity after 24 hrs. 2.9.3. Column Chromatography: A Sephadex G-100 column previously equilibrated with sodium phosphate buffer was loaded carefully without air bubble. The buffer was maintained carefully to avoid the column dryness. 1 ml of the sample was loaded without disturbing the column bed. The elution was slowly started at the flow rate 1ml/min. The fractions were collected and enzyme activity was checked with spectrophotometric method. The elusions with the highest activity were pooled together and the enzyme activity was calculated. The purified enzyme was stored at 4°C to maintain its stability and activity. 2.10. SDS-PAGE Analysis: The SDS PAGE analysis was carried out to obtain the molecular weight of the obtained enzymes. Standard protocol of SDS-PAGE was followed. The apparatus was set and checked for leakage. The reagents were prepared from the standard protocol. The concentration of the separating and the stacking gel was 12% and 4% respectively. The gel set up was made without any air bubble. After solidification, the comb was slowly removed and the apparatus was set with the 1X running buffer. The crude lipase sample and the purified sample was mixed with the sample loading dye at the preferred ratio of 2:1. The samples were kept in the water bath for 5 mins. After boiling, the samples were centrifuged and the supernatant was loaded in the lane carefully. The prestained protein marker (IRIS11 Bio helix) was loaded to determine the molecular weight of the samples. The gel was run at 60V for 3 hours. The results were observed after staining the gel carefully with Coomassie brilliant blue (0.1%), methanol (20%) and acetic acid (10%) for 1 hour. The gel was rinsed thrice with distilled water and further destained with methanol (50%), acetic acid (10%) and distilled water overnight. 2.11. Characterization of the purified lipase from bacterial strain : The purified lipase after column chromatography was further characterized using several parameters like pH, temperature, effect of detergents and metal ions. 2.11.1. Effect of pH and temperature on the purified enzyme: Assaying the activity in many buffers at varying pH values allowed better understanding in investigating the ideal pH value for lipase activity and stability. The pH values (3.0–12.0) were incubated at 40°C. Sodium acetate, pH = 50 mM (3.0–5.0), 50 mM sodium phosphate monobasic (pH 6.0–7.0), 50 mM phosphate buffer (8.0–9.0), and 50 mM glycine/NaOH buffer (10.0–12.0) were employed. The purified lipase was pre-incubated for 1 hours in several buffers ranging in pH from 3.0 to 12.0 to verify its pH stability. The purified enzyme was incubated at temperatures ranging from 20°C to 55°C while Under conventional assay conditions, the relative lipase activity and specific activity were ascertained. The thermostability of the purified enzyme was monitored with 1 hr incubation. The relative activity (%) was calculated. 2.11.2. Effect of metal ions and detergents: The lipase solution was pre-incubated with each to determine the relative activity. Every reagent was kept ready in sodium phosphate buffer, and every metal ion (Na + , Ba 2+ , Ca 2+ and Mn 2+ ) at 1mM and10-mM final concentration. Two reaction mixtures with 0.1 (w/v) of well-known commercial. Additionally, detergents such as SDS (Sodium dodecyl sulphate), Tween 20, Tween 80 and Triton x-100 were incubated for 1 hr at room temperature. Without detergents, the lipase activity was 100%, which was kept as control. The relative activity was calculated by comparing the lipase activity to the control. The above-described experiments were carried out using p-NPP serving as the substrate. Every test was run in three duplicates. 2.12. Hydrolysis of waste tallow using the lipase enzyme: 1 g of tallow, 15 ml of 0.1 M phosphate buffer (pH 7.0), and 0.75 ml (5%, v/v) of hexane were placed in 100 ml Erlenmeyer flasks. The reaction mixture was homogenised for 10 minutes at 22,000 rpm using a homogenizer, and the tallow hydrolysis process was run for 74 hours at 30°C, 40°C and 50°C with purified lipase (lipase activity of 100 U/g of tallow) at different concentrations (0.5–2.0%). The reaction was stopped by adding 20 ml of acetone, and samples were obtained every 24 hours. The free fatty acids were then titrated with 0.1 M KOH using phenolphthalein as an indicator. An identical procedure was performed without the enzyme as a control. The acid value was computed by deducting the control value from the experimental value using Eq. (2). $$Hydrolysis ratio of the waste tallow\left(\%\right)=\left(\frac{Acid value of the released fatty acid}{Saponification}\right)*100$$ ---- (2) 2.13. Wash performance of the purified lipase: The purified lipase was tested for its effect on the stained clothes. The cotton fabrics ( 6 cm x 6 cm) was stained with different samples (Coconut oil, Chocolate and cream cheese). The stained fabric was air dried for 20 mins. The following compositions were analysed to understand the enzyme performance with detergent. Stained fabric, distilled water (100 ml) (a), Stained fabric, distilled water (100 ml), detergent (100 mg/ml) (b), Stained fabric, distilled water (100 ml), detergent (100 mg/ml), purified lipase solution (1 ml) (c). All the compositions were incubated in the incubator shakor for 30 mins at 50°C. After incubation, the fabrics were washed and dried at room temperature. The stain removal efficiency of different compositions were observed visually. 3. Results 3.1. Lipase screening of the isolated culture: The clear zone of hydrolysis was observed around the colony using tributyrin agar screening. The zone of clearance confirmed the presence of the lipase activity due to the extracellular production of the lipase from the bacteria. The highest zone clearance of 5mm was observed for the sample S13D. The best strain was proceeded for the further studies. Isolates Lipase Test Zone of Clearance (mm) S15D + 2 mm S13B + 1 mm S15F + 1 mm S13D + 5 mm S11B + 0.5 mm S1C + 2.5 mm S3D + 1.5 mm S3C + 1 mm S5A + 2 mm S18B + 0.5 mm S13E - 0 S17D - 0 S15A - 0 S15G - 0 S18A - 0 S13C - 0 S8A - 0 S8B - 0 S8C - 0 S7B - 0 S17A - 0 S15B - 0 S17B - 0 ‘+’ positive for the test ‘-’ Negative for the test Table 1: Lipase activity screening against tributyrin agar From table 1, we can observe the hydrolysis of lipid which indicates that the isolates show effective extracellular lipase production. The positive and negative zone of clearance for individual bacterial strains are shown in Fig. 1 . From which, bacterial isolate S13D had highest zone clearance of 5 mm. The highest zone of clearance of isolate S13D is shown in Fig. 2. Thus, the study was focused on the S13D isolates in the view that this strain would be stable and active. Further optimization, enables the highest production of lipase enzyme. The molecular identification of the sample S13D was carried out. Fig:2 Zone clearance of the best bacterial strain indicating the presence of lipase. 3.2. Molecular Identification: The molecular identification carried out using the BLAST tool confirmed that the sample would relatively be pseudomonas species. We can conclude that the unknown sequence was highly identical to the Pseudomonas mosselii strain with 97.95% similarity range. Pseudomonas mosselii bacteria is a Gram-negative, rod-shaped bacteria. P. mosselii has been assigned to the P. putida group according to 16S rRNA study. A member of the P. putida group, Pseudomonas mosselii , has demonstrated tremendous promise in the fields of medicine, plant growth stimulation, and environmental preservation. Recently, P. mosselii's has effective antibacterial and anticancer properties and a compound pseudopyronine as potent anticancer drug was discovered (Yang et al. 2023 ). The isolate was highly like Pseudomonas mosselii strain CFML (NR 024924.1). 3.3. Optimization for the lipase enzyme production from Pseudomonas mosselii : 3.3.1. Effect of pH: The gradual increase of pH from 4 to 12 has varied result on the effective production of the lipase from the isolate. Comparatively, pH range of 6.5 to 7 (Fig. 4 a) had the highest lipase activity of 110.298 U/ml whereas the pH below and above the range decreased the lipase activity. The acidic nature of the media adversely affected the lipase activity. Meanwhile the high basic nature of the culture media decreased the activity of the lipase. The high basic nature caused the enzyme to denature and lose its stability decreasing its activity gradually. Thus, pH around 6.5-7 is effectively favourable for the better activity. 3.3.2. Effect of Temperature: The lipase enrichment media were incubated in the range of temperature from 20°C to 95°C with optimized pH range. After incubation the lipase activity was calibrated. The increase activity of 112.388 U/ml from the range of 35° C to 40°C was observed (Fig. 4 b). Further increase in temperature gradually decreased the enzyme activity. This would be mainly due to the denaturation of the enzyme. Lack of available temperature may be the reason for low activity at the low temperature. Thus, temperature plays a crucial role in the stable production and activity of the enzyme. The optimized temperature for better production was around 35° C to 40°C. 3.3.3. Effect of Inoculum Size: The maximum lipase production from Pseudomonas mosselii was obtained at 2% (118.5 U/ml) inoculum size (Fig. 4 c). The increase in inoculum size decreased the lipase production. The excessive presence of inoculum would have consumed the nutrient much faster and no sufficient time interval was there for lipase production to occur. The inoculum size lower than 2%, showed reduced lipase production since the log phase was comparatively slower. Thus, the highest production of the lipase enzyme can be obtained at 2% of the inoculum size. 3.3.4. Effect of Incubation time: Efficient activity of lipase with 119.701 U/ml was observed at the incubation time of 36 hrs as shown in Fig. 4 d. The enzyme activity gradually decreased upon increase in time which may be due to the stationary phase of the bacterial strain. Thus, 36 hrs of incubation time would be the optimized time for better lipase production with high activity and stability. Prior incubation time did not show much activity as compared to the incubation period of 36 hrs. 3.3.5. Effect of substrate: The media for lipase production was substituted with various substrate with the concentration of 1%. The other parameters optimized before was kept unaltered. The lipase enzyme activity was calibrated after 36 hrs of incubation. The lipase activity was comparatively high (118.059 U/ml) when olive oil was used as the substrate. Meanwhile, corn oil also showed better activity whereas gingelly oil and coconut oil were not much effective (Fig. 4 e). Thus, for higher production range, olive oil may be used as an effective substrate. 3.3.6. Effect of nitrogen source: The nitrogen source influence on the lipase activity was examined using peptone, yeast extract, tryptone, urea and ammonium nitrate. The other optimized parameters were kept unchanged such as pH, temperature, carbon source. The lipase activity incubated with peptone was found to have highest activity of 150.746 U/ml when compared to other source. The results of other sources were not that depleting when compared to peptone (Fig. 4 f). Meanwhile tryptone also showed relatively effective activity. Thus, peptone can be considered as the effective nitrogen source for this strain. 3.4. Protein concentration of the produced lipase enzyme: The protein concentration of the crude was analysed using nanodrop spectrophotometer 2000 at 260/280 nm. The protein concentration of the crude was around 12,544 mg/ml. The ammonium sulphate precipitated sample was 0.695 mg/ml whereas the acetone precipitated sample was 0.401. Thus, the ammonium sulphate precipitation was much more effective in concentrating overall protein. 3.5. Lipase activity using spectrophotometric method: The enzyme activity of the crude sample, ammonium sulphate precipitated sample, dialysis sample and chromatography sample were calibrated as shown in Table 2 . The enzyme activity was based on the substrate p-nitrophenyl laurate as the substrate. The substrate used in the study was favourably effective in standardizing the enzyme activity of the produced lipase from the Pseudomonas mosselii strain. Table 2 Purification steps with lipase enzyme activity of Pseudomonas mosselii strain Sample Enzyme Volume (ml) Unit Activity (U/ml) Total Activity (U) Protein content (mg/ml) Specific Activity (U/mg) Supernatant 100 156.41 15641.79 12.544 12.46 Precipitate 5 116.71 583.58 0.695 167.93 Dialysis 5 102.08 510.44 1.171 87.18 Sephadex G-100 1 97.61 97.611 0.618 157.94 The unit activity of the partially purified lipase enzyme after column chromatography was found to be 97.61 U/ml. The specific activity was around 157.94 U/mg. The crude supernatant after the growth in media with supplements for effective growth was estimated for activity. The unit activity was found to be 156.41 U/ml whereas the specific activity was 12.46 U/mg. The precipitation with ammonium sulphate and dialysis of the same did not enhance the purification effectively, whereas the column chromatography with Sephadex G-100 enhance the purification and activity of the lipase enzyme with better stability. The specific activity increased after the purification with the Sephadex G-100 column when compared to the results of the dialysed lipase enzyme. The stability and activity after chromatography was also found to be effective and favourable. 3.5.1. Column Chromatography: The absorbance and the elution fraction of the lipase enzyme is shown in Fig. 5 . Based on the observation, the elution fraction 12, 13 and 14 showed highest absorbance. The three fractions were pooled together and the specific activity was found to be 157.96 U/mg. Gradual decrease of activity after the further elution were observed. Comparing to the dialysed enzyme, the purification method using column chromatography with Sephadex G-100 as the stationary phase was effective in purifying the lipase enzyme with high activity and stability. 3.6. SDS Analysis: The SDS results are depicted in Fig. 6 . The molecular weight of the partially Purified sample after chromatography was found to be around 55–60 kDa. The crude sample had varied range of bands whereas the purified lipase enzyme of the present study had a molecular weight of around 55 kDa. The similar report of molecular weight of the purified lipase from Pseudomonas putida around 48 kDa was reported by (Song et al. 2017 ). The molecular weight of purified lipase isolated from Pseudomonas reinekei was 50kDa (Priyanka, Kinsella, et al. 2019). 3.7. Characterization of the lipase enzyme: 3.7.1. Effect of pH and temperature on purified enzyme: The effective stability of the purified lipase was found to be around pH 6 to 8 range as shown in Fig. 7 (a). Thus, the produced lipase from Pseudomonas mosselii was highly stable around the pH 6 to 8. There was a significant loss of stability between pH 3 to 5 and loss after pH 8.5. The relative activity of the lipase was stable between 6 to 8 with the relative activity of 99%. The relative activity and stabilty reduced after 8 pH. The 1 hr incubation at different pH shows that the purified enzyme activity is affected at acidic and extreme basic pH. The stability of the enzyme remained highly stable between 6–8. In general, the lipase enzyme are said to be stable around alkaline nature. The enzyme was highly stable between the temperature range of 20°C to 55°C as shown in Fig. 7 (b). The enzyme was highly stable throughout the incubation period The stability was affected after 50°C. This may confirm that the produced lipase enzyme might not be thermotolerant. Effective stability was observed around 30°C to 40°C during the time interval but comparatively was highly stable at 35°C. There was a mild reduce upon the increase in time at 30°C, however the stability of the enzyme was observed in the temperature range of 30°C-35°C. 3.7.2. Effect of Metal ions and detergent on purified lipase: It has been observed that a number of metal ions cause the fatty acids to create their corresponding metal salts at the oil–water interface, which frees up lipase to work on oil molecules. This results in the hydrolysis of oil by lipase. The presence of Ca 2+ greatly supported the lipase activity and stability at both the concentration (1mM and 10mM) as shown in the Fig. 7 (c). It has been observed that Ca 2+ is crucial for the enzyme's conformational stability. The Pseudomonas sp are greatly activated using Ca 2+ compared to other metals (Joseph, Ramteke, and Thomas 2008). The metal ion binds to the lipase forming a salt bridge and changing its conformational structure which provides higher stability to the enzyme. Surfactants are vital for the multifunctionality and diverse characteristics of enzymes, and they can trigger lipases in molecular bioimprinting. Lipase typically has a greater beneficial effect when non-ionic surfactants are present than when anionic or cationic surfactants are present (Holmberg 2017).Tween 80 should higher stability compared to other detergents as shown in Fig. 7 (d). In contrast, to the study reported by Priyanka et al., (Priyanka, Kinsella, et al. 2019), SDS affected the stability of the purified lipase. Triton X 100 showed better stability next to Tween 80. 3.8. Hydrolysis of tallow using lipase enzyme: The release of fatty acid from tallow upon hydrolysis using lipase enzyme was evaluated by titration method and the results are shown in Table 3 in terms of the hydrolysis reaction ratio. Table 3 Reaction ratio(%) of hydrolysis of the tallow using lipase enzyme with different concentration Sample Temperature 30°C 40°C 50°C Lipase enzyme (%) Time 24 48 72 24 48 72 24 48 72 0.5 65 72 80.3 68 75 80.3 71 79 83 1.0 75 75.4 75.9 76.8 76.4 76.0 78.1 78.5 79.2 1.5 2.0 79 79.2 80.5 80.1 81.2 81.5 82 81.9 82.6 82.6 83.1 83 83.2 83.1 83.2 83.3 83.7 83.6 Initial hydrolysis of the tallow at 30°C to 50°C ranging from 24 to 72 hrs was carried out at different lipase concentration. The highest reaction ratio was found to be 83.7% with 1.5% lipase at 72 hrs. At 40°C the highest ratio was about 83.1% and at 50°C, the ratio was found to be 81.9% after 72 hrs of hydrolysis at 30°C. The lipase concentration of 0.5% did not show much hydrolysis ratio compared to 1.5%. The other concentration rate of the lipase also showed effective results comparatively. The hydrolysis of tallow with 2% lipase concentration did not show much diiference in the hydrolysis ratio related to the concentration of 1.5% lipase. The enzyme remained stable throughout the process.The reaction mixture contained 1 g of tallow, 20 ml of 0.1 M phosphate buffer (pH 7.0), 1% (w/v) of PEG 9000, 1 ml of 5% v/v hexane, and 150 U of lipase. 3.9. Wash performance of the purified lipase: The treated fabrics were visually observed for the results. The commercial detergent along with the purified lipase on the stained fabric showed effective result compared with the fabric treated with commercial detergent alone as shown Fig. 8 . Upon obeservation, the complete removal of stain was observed in the fabric stained with the cream cheese. The other stains like chocolate and olive oil was also efficiently removed. The purified lipase has made better compactiblity with the commercial detergent and the activity of the lipase was not disturbed. The commercial detergent alone was not as effective as compared with the detergent with lipase. Further increase in the concentration of the lipase along with detergent formulation would improve the washing efficiency better. Thus, upon further optimization and enhancement, the lipase enzyme isolated from Pseudomonas mosselii would show better performance as a detergent additive. 4. Discussion The isolation of the bacterial strain upon screening with tributyrin, the effective positive strain was proceeded for further analysis. The media composition played major role in the higher production of the lipase. The optimization of the media further improved the lipase activity. The pH favourable to produce lipase was found to be 6.5-7.0. Similar study with pH range 6.5 with highest lipase activity was reported by Sugihara and his colleagues (Sugihara et al. 1992 ). Thus, 6.5 pH would be effective on lipase production. Optimized temperature was found to be around 35°C- 40°C. Accordance report supported similar temperature range for better lipase activity in Pseudomonas sp. Strain KB700A (Rashid et al. 2001 ). A study on Pseudomonas chlororaphis PA23 showed effective temperature for lipase production to be around 38°C to 50°C and pH of 8 and 9 (Mohanan et al. 2022). The olive oil as a substate enabled better production of the lipase enzyme from the selected bacterial strain (Putri et al. 2020 ). Better nitrogen source for highest lipase production was peptone. Similar report was supported by (Priyanka, Tan, et al. 2019) stating, for Pseudomonas gessardii to produce lipase, the optimal nitrogen source was determined to be a 1% (w/v) peptone supplement. The study reported on cold adapted Pseudomonas sp LSK25 isolated from Antarctic region showed effective lipase activity at pH around 7 to 8 and peptone as the preferable nitrogen source (Salwoom et al. 2019 ). The ammonium sulphate precipitation carried out effectively precipitated the desired enzyme at 80%. Further purification by dialysis method with sodium phosphate buffer enhanced the purification. Final purification was achieved using column chromatography with Sephadex G-100 as stationary phase. Enzyme activity for all the collected crude and purified sample was measured using spectrophotometric method. p-nitrophenyl palmitate as a substrate enabled stable results. The unit activity for crude was 156.41 U/ml. A study carried out by (Priyanka, Tan, et al. 2019) showed highest activity of lipase as 0.91 IU/mL Whereas the purified lipase of the present study showed effective activity of 97.61 U/ml. The characterization of the enzyme revealed that the enzyme was efficient at pH (6–8), temperature (30°C to 50°C). Results for Pseudomonas species were reported to be with pH at around (6–9) and temperature around 50°C (Phukon et al. 2020 ). The present study report stable temperature of 30°C to 50°C which shows the lipase to be thermotolerant. The metal ions (Ca 2+ ) and detergent (Tween 80) showed better characterization of the lipase enzyme. The metal ion, Ca 2+ showed effective lipase stability and activity in the cold adaptive pseudomonas as well (Salwoom et al. 2019 ). The molecular weight of the purified lipase was around 55kDa. The hydrolysis of waste tallow using the enzyme at different temperature, concentration and time gave broad range to understand the efficiency of the enzyme to hydrolyse the tallow. The highest reaction ratio was around 91.7% after 72 hrs. The study on Pseudomonas helmanticensis exhibited optimal activity at 50°C, pH (6–9) and suggested to be highly suitable for detergent industry (Phukon et al. 2020 ). The lipase enzyme isolated from Pseudomonas gessardii showed acidic lipase tolerance (pH 5.0). The enzyme was stable at 30°C and Ca 2+ showed stimulating effect on the lipase stability and activity (Ramani et al. 2010). The thermally stable lipase enzyme from Pseudomonas putida showed maximum activity at 50°C and maintained the relative activity ranged between 40 to 60°C and pH range of 6 to 8 (Song et al. 2017 ). The results were favourable to the present study upon the effective production of the lipase. Furthermore, while using our lipase, the reported hydrolytic ratio was much greater than when using lipases from Rhizomucor miehei (73%) (Rodrigues and Fernandez-Lafuente 2010 ) to hydrolyze beef tallow. These fatty acids are primarily involved in the methyl esters manufacturing process. Thus, the lipase enzyme produced from Pseudomonas mosselii was effective in the hydrolysis of tallow from which the fatty acid would serve as the feedstock for the biodiesel production. Thus, the production from pseudomonas mosselii species would be highly effective choice for the commercial production of lipase and its application towards the hydrolysis of the waste tallow. The produced fatty acid composition would be used as a cost-effective feedstock for biodiesel production. The application of the purified lipase on the stained fabrics produced effective results on the removal of the stain at 50°C for 30 mins. A similar report on C. albicans and A. sclerotigenum derived lipase showed efficient removal of stained cotton fabrics at 40°C for 15 mins (Safdar, Ismail, and Imran 2023). The lipase from G. stearothermophilus FMR12 was effective in the removal of chocolate and lipstick stain. At 70°C for 30 mins (Abol-Fotouh, AlHagar, and Hassan 2021). Thus, the production from Pseudomonas mosselii species would be highly effective choice for the commercial production of lipase and its application towards the fat hydrolysis and detergent formulation. Conclusion The study revealed effective lipase production with modified media composition and purification methods. Olive oil as a substrate would be highly supportive for effective lipase production. The specific activity achieved after partial purification was around 157.94 U/mg without further loss of activity. The production of lipase from Pseudomonas mosselii was achieved with high activity optimization and characterization studies of the enzyme enhanced the activity and supported stability. The hydrolysis of the tallow using enzyme would effectively serve as the feedstock for biodiesel production. Thus, this study supports economically cost-effective approach. Further enhancement of the methodologies would further involve the enzyme in industrial application at low-cost production and with consistent, effective stability and activity. Abbreviations p-NPP : p-Nitrophenol Palmitate EDTA : Ethylenediaminetetraacetic acid TEMED : Tetramethyl ethylenediamine APS : Ammonium Per Sulphate Rpm : Revolutions Per Minute SDS-PAGE : Sodium Dodecyl Sulphate – Polyacrylamide Gel Electrophoresis U : Unit KOH : Potassium hydroxide ml : millilitre mg : milligram Declarations Acknowledgement: We are thankful to Department of Science and Technology for funding the proposed study under 1819 scheme (DST/SEED/SCSP/STI/2021/882). Funding: The project was funded by Department of Science and Technology for funding the proposed study under 1819 scheme ( DST/SEED/SCSP/STI/2021/882). Competing Interest: The authors have no relevant financial or non-financial interests to disclose. Author Contribution: All authors contributed to the study conception and design. Experiment, methodology, original draft- writing [Mohana Priya Srinivasan]. The first draft of the manuscript was written by [Mohana Priya Srinivasan], Supervision, visualization, and original draft reviewing [Dayanandan Anandan], Software and original draft reviewing [Ajith Chandrasekar], original draft reviewing [Nandha Kumar Suresh]. All authors read and approved the final manuscript. Data Availability : This manuscript does not report data generation or analysis. References Abol-Fotouh, Deyaa, Ola E.A. AlHagar, Mohamed A. Hassan. 2021. Optimization, Purification, and Biochemical Characterization of Thermoalkaliphilic Lipase from a Novel Geobacillus Stearothermophilus FMR12 for Detergent Formulations. J. Biol. Macromol. 125–35. https://doi.org/10.1016/j.ijbiomac.2021.03.111. Atalah, Joaquín, Paulina Cáceres-Moreno, Giannina Espina, Jenny M. Blamey. 2019. “Thermophiles and the Applications of Their Enzymes as New Biocatalysts.” Bioresour. Technol. 478–88. https://doi.org/10.1016/j.biortech.2019.02.008. Bharathi, Devaraj, G. Rajalakshmi. 2019. Microbial Lipases: An Overview of Screening, Production and Purification. Biocatal. Agric. Biotechnol. 22: 101368. https://doi.org/10.1016/j.bcab.2019.101368. Prem Chandra, Ranjan Singh, Pankaj Kumar Arora. 2020. Microbial Lipases and Their Industrial Applications : A Comprehensive Review. Microb. Cell Factories https://doi.org/10.1186/s12934-020-01428-8. Faryad Amna, Asia Ataa, Faiz Ahmad Joyia 2021 Microbial Lipase Production : A Deep Insight into the Recent Advances of Lipase Production and purification techniques . Biotechnol. Appl. Biochem. 1–14. 10.1002/bab.2019 Gupta Rani, Arti Kumari, Poonam Syal, Yogesh Singh. 2015. Molecular and Functional Diversity of Yeast and Fungal Lipases: Their Role in Biotechnology and Cellular Physiology. Prog. Lipid Res. 40–54. http://dx.doi.org/10.1016/j.plipres.2014.12.001. Gurkok, Sumeyra, Murat Ozdal. 2021. Purification and Characterization of a Novel Extrcellular, Alkaline, Thermoactive, and Detergent-Compatible Lipase from Aeromonas Caviae LipT51 for Application in Detergent Industry. Protein Expr. Purif. 105819. https://doi.org/10.1016/j.pep.2021.105819. Holmberg, K. 2018. Interactions between surfactants and hydrolytic enzymes. Colloids Surf B Biointerfaces, 168, 169–177. doi:10.1016/j.colsurfb.2017.12.002 Jamilu, Hadiza, Aliyu Hassan Ibrahim, Suleiman Zubair Abdullahi. 2022. Isolation, Optimization and Characterization of Lipase Producing Bacteria from Abbatoir Soil. Int. j. sci. adv . 3(1). Joseph Babu, Pramod W. Ramteke, George Thomas. 2008. Cold Active Microbial Lipases: Some Hot Issues and Recent Developments. Biotechnol. Adv . 26(5): 457–70. Kumar, Vineet, Indu Shekhar Thakur. 2020. Biodiesel Production from Transesterification of Serratia Sp. ISTD04 Lipids Using Immobilised Lipase on Biocomposite Materials of Biomineralized Products of Carbon Dioxide Sequestrating Bacterium. Bioresour. Technol. 123193. https://doi.org/10.1016/j.biortech.2020.123193. Lahiri, Aparajita et al. 2023. Journal of Hazardous Materials Advances A Critical Review on Food Waste Management for the Production of Materials and Biofuel. J. Hazard. Mater. 100266. https://doi.org/10.1016/j.hazadv.2023.100266. Liu Wu, Menggang Li, Yunjun Yan. 2017. Heterologous Expression and Characterization of a New Lipase from Pseudomonas fluorescens Pf0-1 and Used for Biodiesel Production. Sci. Rep . 1–11. http://dx.doi.org/10.1038/s41598-017-16036-7. Mehta Akshita, Urgyn Bodh, Reena Gupta. 2017. Fungal Lipases: A Review. J. Biotech Res. 8(1): 58–77. Mohanan Nisha, Chun Hin Wong, Nediljko Budisa, David B. Levin. 2022. Characterization of Polymer Degrading Lipases, LIP1 and LIP2 From Pseudomonas chlororaphis PA23. Front. bioeng. biotechnol. 10, 1–15. Mrudula Vasudevan, Ushasree, Amit K. Jaiswal, Shyam Krishna, Ashok Pandey. 2019. Thermostable Phytase in Feed and Fuel Industries. Bioresour. Technol 400–407. https://doi.org/10.1016/j.biortech.2019.01.065. Nema, Ashutosh et al. 2019. Production and Optimization of Lipase Using Aspergillus niger MTCC 872 by Solid-State Fermentation. Bull Natl Res Cent 43(1). Phukon, Loreni Chiring et al. 2020. Production and Characterisation of Lipase for Application in Detergent Industry from a Novel Pseudomonas helmanticensis HS6. Bioresour. Technol. 123352. https://doi.org/10.1016/j.biortech.2020.123352. Priyanka, Priyanka, Yeqi Tan, et al. 2019. Solvent Stable Microbial Lipases: Current Understanding and Biotechnological Applications. Biotechnol. Lett . 41(2): 203–20. https://doi.org/10.1007/s10529-018-02633-7. Priyanka Priyanka, Gemma Kinsella, Gary T. Henehan, Barry J. Ryan. 2019. Isolation, Purification and Characterization of a Novel Solvent Stable Lipase from Pseudomonas reinekei . Protein Expr. Purif. 153: 121–30. https://doi.org/10.1016/j.pep.2018.08.007. Putri, Dwini Normayulisa et al. 2020. Optimization of Aspergillus niger Lipase Production by Solid State Fermentation of Agro-Industrial Waste. Energy Rep. 6: 331–35. https://doi.org/10.1016/j.egyr.2019.08.064. Ramani, John Kennedy, Ramakrishnan, Sekaran. 2010. Purification, Characterization and Application of Acidic Lipase from Pseudomonas essardii Using Beef Tallow as a Substrate for Fats and Oil Hydrolysis. Process Biochem. 45(10): 1683–91. http://dx.doi.org/10.1016/j.procbio.2010.06.023. Rashid, Naeem et al. 2001. Low-Temperature Lipase from Psychrotrophic Pseudomonas Sp. Strain KB700A. Appl. Environ. Microbiol. 67(9): 4064–69. Rios, Nathalia Saraiva et al. 2018. Biotechnological Potential of Lipases from Pseudomonas: Sources, Properties and Applications. Process Biochem. 75: 99–120. https://doi.org/10.1016/j.procbio.2018.09.003. Rodrigues, Rafael C., Roberto Fernandez-Lafuente. 2010. Lipase from Rhizomucor miehei as a Biocatalyst in Fats and Oils Modification. J. Mol. Catal. 66(1–2): 15–32. http://dx.doi.org/10.1016/j.molcatb.2010.03.008. Safdar Ayesha, Fatima Ismail, Muhammad Imran. 2023. Characterization of Detergent-Compatible Lipases from Candida albicans and Acremonium sclerotigenum under Solid-State Fermentation. ACS Omega 8(36): 32740–51. Salgado, Cleonice Aparecida, François Baglinière, Maria Cristina Dantas Vanetti. 2020. Spoilage Potential of a Heat-Stable Lipase Produced by Serratia liquefaciens Isolated from Cold Raw Milk. Food Sci. Technol. 126(September 2019): 109289. https://doi.org/10.1016/j.lwt.2020.109289. Salwoom, Leelatulasi et al. 2019. Isolation, Characterisation, and Lipase Production of a Cold-Adapted Bacterial Strain Pseudomonas Sp . LSK25 Isolated from Signy Island, Antarctica. mol. 24(4): 1–14. van Schie, Morten M.C.H. et al. 2021. Applied Biocatalysis beyond Just Buffers - From Aqueous to Unconventional Media. Options and Guidelines. Green Chem . 23(9): 3191–3206. Sharma Pushpinder, Nivedita Sharma, Shruti Pathania, Shweta Handa. 2017. Purification and Characterization of Lipase by Bacillus methylotrophicus PS3 under Submerged Fermentation and Its Application in Detergent Industry. J. Genet. Eng. & Biotechnol. 15(2): 369–77. https://doi.org/10.1016/j.jgeb.2017.06.007. Song, C. et al. 2017. Characterization of a Novel Thermo-Stable Lipase from Endophyte Pseudomonas putida in Pistacia Chinensis Bunge. Appl. Biochem. Microbiol . 53(5): 524–32. Sugihara, Akio et al. 1992. Purification and Characterization of a Novel Thermostable Lipase from Pseudomonas cepacia. J. Biochem. 112(5): 598–603. Yang, Ruihuan et al. 2023. The Natural Pyrazolotriazine Pseudoiodinine from Pseudomonas mosselii 923 Inhibits Plant Bacterial and Fungal Pathogens. Nat. Commun. 14(1): 1–16. Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3972296","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":276169534,"identity":"6ff1a6dc-35d1-4ea8-8acc-c691e46f07bd","order_by":0,"name":"Mohana Priya Srinivasan","email":"","orcid":"","institution":"Sathyabama Institute of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Mohana","middleName":"Priya","lastName":"Srinivasan","suffix":""},{"id":276169535,"identity":"fcb21e63-bf94-40d0-b73b-811b430ee171","order_by":1,"name":"Dayanandan Anandan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYHACAyCWqO8HMRMKiNdiwTizAaTFgHgtFYwbDsDYhAB//+GNn3lqJJiNz69O/PDAgEGeX+wAfi0SN9KKpXmOSbCZ3Xi7WQLoMMOZsxMIWHODx0Cah02Cx+zG2Q0gLQkGtwlokT9/xvg3zz8JCeMZZzf/IEqLwYEcM2neNgkDA/7ebcTZYngjrcxybp9EgsQN3m0WCQYShP0id/7w5htvvtUl8Pef3XzzR4WNPL80AS0gwMQDIiXAKiUIKwcBxh8gkv8AcapHwSgYBaNg5AEA4alDkT7A2uQAAAAASUVORK5CYII=","orcid":"","institution":"Sathyabama Institute of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Dayanandan","middleName":"","lastName":"Anandan","suffix":""},{"id":276169536,"identity":"6fe869a5-1d5a-428e-bcfa-102182a33bb5","order_by":2,"name":"Ajith Chandrasekar","email":"","orcid":"","institution":"Sathyabama Institute of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Ajith","middleName":"","lastName":"Chandrasekar","suffix":""},{"id":276169537,"identity":"8c69c732-3236-4d6c-9665-6486d9f834fc","order_by":3,"name":"Nandha Kumar Suresh","email":"","orcid":"","institution":"Sathyabama Institute of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Nandha","middleName":"Kumar","lastName":"Suresh","suffix":""}],"badges":[],"createdAt":"2024-02-20 09:06:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3972296/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3972296/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52075494,"identity":"9efbc422-0edc-45ff-8eee-8395c118b054","added_by":"auto","created_at":"2024-03-06 09:31:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":187372,"visible":true,"origin":"","legend":"\u003cp\u003eLipase Screening results of individual bacterial isolates\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/a2ea74e1d8545239fd8b4f25.png"},{"id":52075102,"identity":"2f3fedca-d095-4a97-b0a6-e23e2e0c09cb","added_by":"auto","created_at":"2024-03-06 09:23:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":363626,"visible":true,"origin":"","legend":"\u003cp\u003eZone clearance of the best bacterial strain indicating the presence of lipase.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/54cc38d17c05bcf6ae9d6f91.png"},{"id":52075098,"identity":"9f9a4959-9f6a-4449-9c73-8cd52faed40f","added_by":"auto","created_at":"2024-03-06 09:23:08","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":18782,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree: The evolutionary history was inferred using the neighbor-Joining method. The optimal tree is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown above the branches. There was a total of 994 positions in the final dataset. Evolutionary analyses were conducted in MEGA11\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/6c777508b3946514205feaf0.png"},{"id":52075104,"identity":"2ab863eb-3cac-4f48-b957-9d312c0021e0","added_by":"auto","created_at":"2024-03-06 09:23:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":319355,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of varied range of pH on lipase production (a), Effect of temperature on lipase production (b), Effect of inoculum size on lipase production (c), Effect of incubation time on lipase production (d), Effect of substrate on lipase activity (e), Effect of nitrogen source on lipase activity (f).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/5ddc77a54b1580406b896a83.png"},{"id":52075861,"identity":"b0a6f94c-0b8b-4835-bbcb-0144d1e4a63a","added_by":"auto","created_at":"2024-03-06 09:39:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":15045,"visible":true,"origin":"","legend":"\u003cp\u003eColumn chromatography absorbance range with elution fraction of the dialysed lipase enzyme.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/b1c9fe928af694b53b072161.png"},{"id":52075496,"identity":"b670e082-82f6-42f3-86ee-5eaa5852e56d","added_by":"auto","created_at":"2024-03-06 09:31:08","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":175302,"visible":true,"origin":"","legend":"\u003cp\u003eSDS-PAGE image of (A) protein ladder, (B) crude lipase sample and (C) Partially purified sample.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/21f3eeb102f8bb7e51bac74a.png"},{"id":52075103,"identity":"b7d74d80-d039-46a9-a703-0a5ba0368ab4","added_by":"auto","created_at":"2024-03-06 09:23:08","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":238956,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of pH on purified lipase activity (a), Effect of Temperature on purified lipase activity (b), Effect of metal ions on purified lipase activity (c), Effect of detergent on purified lipase acitivity (d)\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/7dea8506f8eca6f75681afd7.png"},{"id":52075106,"identity":"e2b45104-5c4c-4763-bde6-9ef1cf18963f","added_by":"auto","created_at":"2024-03-06 09:23:08","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2413785,"visible":true,"origin":"","legend":"\u003cp\u003eApplication of the purified lipase from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e on the stained cotton fabric with chocolate, cream cheese and olive oil.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/977d0cdd1472686ae7a2f11e.png"},{"id":55265539,"identity":"df9ce530-e2fe-45db-8167-da1b4f463b51","added_by":"auto","created_at":"2024-04-25 02:06:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4837805,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/b4efc170-9421-4e4e-952e-81629bbeec09.pdf"},{"id":52075101,"identity":"70947660-7b0e-44db-bdfa-304aac03c3b0","added_by":"auto","created_at":"2024-03-06 09:23:08","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":70763,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-3972296/v1/f2e25696dc4f59b366d6291f.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Characterization of an efficient waste fat hydrolysing and detergent compactible lipase from newly isolated Pseudomonas mosselii","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe hydrolases known as lipases (Triacyclglycerol acyl hydrolases, EC3.1.1.3) are specialised for the hydrolysis of fats into fatty acids and glycerol at the water-lipid interface. They are abounding in nature and have the ability to reverse the reaction in non-aqueous medium (van Schie et al. 2021). Clade Bernad was the first to identify lipase in pancreatic juice in 1856 as an enzyme that degraded insoluble oil droplets and transformed them into soluble compounds (Jamilu, Ibrahim, and Abdullahi 2022). There have been claims that various types of fungus, yeast, bacteria, animals, and plants are effective sources of lipase (Faryad, Ataa and Joyia, 2020). However, microbially produced lipases have become the focus of interest due to their multiple advantages, including ease of handling culture, ease of manufacturing scale-up, ease of genetic manipulation, seasonal changes, and safety and stability (Nema et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). According to Prem et al. (2020), most bacterial species are known to produce their highest levels of enzyme activity at neutral and alkaline pH levels. Excellent thermostability and other stress-tolerant traits are displayed by certain animals (Chandran et al., 2020). Some species exhibit great thermostability and other stress tolerant parameters.\u003c/p\u003e \u003cp\u003eWide-temperature-window enzymes, particularly those that exhibit activity at lower temperatures, are necessary for several bioprocesses in the detergent, fermentation, and biomass conversion industries. These processes conserve energy conversion and prevent the growth of mesophilic bacteria (Atalah et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Mrudula Vasudevan et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ramani \u003cem\u003eet al.\u003c/em\u003e, 2010; Kumar and Thakur, 2020). Enzymatic hydrolysis is a beneficial method, because it may be carried out at a lower temperature to conserve energy and because it has excellent selectivity, resulting in products with high purity and fewer byproducts (Ramani et al. 2010). It has been reported that lipase has thermostability and reacts to cold, which is useful for industrial application (Kumar and Thakur 2020). To produce commercial lipases, \u003cem\u003eBacillus\u003c/em\u003e species, \u003cem\u003ePseudomonas\u003c/em\u003e species, \u003cem\u003eStaphylococcus\u003c/em\u003e species, and \u003cem\u003eBurkholderia\u003c/em\u003e species are the most common bacterial sources (Bharathi and Rajalakshmi, 2019; Priyanka, Kinsella, \u003cem\u003eet al.\u003c/em\u003e, 2019)\u003c/p\u003e \u003cp\u003eThe three-dimensional structures of lipases originating from diverse microbiological sources differ significantly in terms of sequence variety (Gupta et al. 2015). These characteristics make these enzymes distinct and particular to the kinds of bioconversion processes they catalyse, making them useful in a variety of industrial processes (Mehta, Bodh, and Gupta 2017). It has been discovered that they are helpful in catalysing a variety of reactions related to the food, pharmaceutical, dairy, fatty acid, leather, cosmetic, detergent, beverage, and paper sectors. (Sharma et al. 2017)\u003c/p\u003e \u003cp\u003eEight families of bacterial lipases have been identified, and each family has unique characteristics that differ in terms of ideal pH and temperature, among other factors. (Rios et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Except for a few acid ideal lipases made by cultures of \u003cem\u003ePseudomonas cepacia\u003c/em\u003e and \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e, lipases from \u003cem\u003ePseudomonas sp\u003c/em\u003e usually have neutral or alkaline optimal pH (Liu, Li, and Yan 2017). The optimal pH activity spans from 4 to 9, the ideal temperature ranges from 25 to 70\u0026deg;C, and the enzyme molecular weight ranges from 16 to 96 kDa, depending on the species and genus of the microorganism from which lipases have been purified (Rios et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), however, very few exhibit catalytic properties over a wider temperature range. Lipases extract an acyl group from glycerides during hydrolysis to create a lipase\u0026ndash;acyl complex, which subsequently transfers the acyl group to the O\u0026ndash;H group in water. The hydrolysis of oils to produce fatty acids is the primary use of lipase in the oleochemical industry. Because free fatty acids are widely used in surfactants, soap production, the food sector, and biomedical applications, they are considered value-added goods. Traditionally, oil hydrolysis is accomplished by applying high pressure and temperature to a chemical catalyst.\u003c/p\u003e \u003cp\u003eThe majority of organic chemists and pharmacologists prefer to use bacteria from the genera \u003cem\u003ePseudomonas\u003c/em\u003e and \u003cem\u003eBurkholderia\u003c/em\u003e as catalysts due to their distinct characteristics, which include temperature stability, high enantio-selectivity, and activity in a wider pH range (Gurkok and Ozdal 2021). Because of this, a great deal of study has been done on the synthesis of lipase utilising \u003cem\u003ePseudomonas\u003c/em\u003e sp. from lipid substrates that are discarded as waste products from numerous industrial operations. Therefore, the synthesis of lipolytic enzymes from solid waste materials containing lipids can result in the creation of environmentally friendly technologies (Ramani et al. 2010).\u003c/p\u003e \u003cp\u003eGlobal production and improper handling of millions of tonnes of these waste lipids is currently occurring, which has a negative impact on the economy, the environment, and human health in addition to decreasing the materials' value as oleochemical resources (Lahiri et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). For instance, the incorrect disposal of used cooking oils, tallow waste, and grease traps in sewage causes accumulation and obstruction, which causes overflows, flooding during rainy seasons, the spread of viruses and rodents, pollution of water supplies, and damage to ecosystems.\u003c/p\u003e \u003cp\u003eThis study focuses on the development of the lipase enzyme from bacterial species and produces feedstock for biodiesel production by hydrolysis of waste tallow using lipase to test the usefulness of the lipase activity in varied applications for beneficial results. The hydrolysed product may be effectively used as the feedstock for biodiesel production. The strains were identified by whole genome sequencing.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials:\u003c/h2\u003e \u003cp\u003eTributyrin, Peptone, Yeast, agar, NaOH, CaCl\u003csub\u003e2\u003c/sub\u003e, Beef extract, NH\u003csub\u003e4\u003c/sub\u003eH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, NaCl, MgSO\u003csub\u003e4\u003c/sub\u003e.7H\u003csub\u003e2\u003c/sub\u003eO, CaCl\u003csub\u003e2\u003c/sub\u003e.2H\u003csub\u003e2\u003c/sub\u003eO, Tween 80, Ethanol, p-nitrophenol palmitate (p-NPP) as substrate, gum Arabic, triton X-100, isopropanol, phenolphthalein, pH indicator, ammonium sulphate, dialysis membrane, Sephadex G-100, Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e.2H\u003csub\u003e2\u003c/sub\u003eO, NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e.H\u003csub\u003e2\u003c/sub\u003eO, Tris free base, HCl, Sodium Dodecyl Sulphate (SDS), Acrylamide-Bis acrylamide, glycine, glycerol, β-mercaptoethanol, PEG (Polyethylene glycol), EDTA, bromophenol blue, TEMED, APS, Coomassie brilliant blue, distilled water. The chemicals purchased are from Sigma Aldrich and Hi-Media. Olive oil and waste tallow was purchased from the local market, Chennai. All the chemicals purchased were in analytical grades.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Isolation of bacteria from collected sample:\u003c/h2\u003e \u003cp\u003eThe sample were collected from highly polluted cooum river bed soil, Chennai, Tamil Nadu, India. Without the influence of any contaminants, the samples were transported to the laboratory in a sterilized container. Serial dilution (10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e \u0026minus;\u0026thinsp;10-\u003csup\u003e10\u003c/sup\u003e) of the soil sample was performed to isolate the pure cultures. 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e, 10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e, and 10\u003csup\u003e\u0026minus;\u0026thinsp;7\u003c/sup\u003e was spread plated to obtain individual colonies. All the materials utilised, including the petri dish, L-rod, distilled water, agar medium etc., were autoclaved for 20 minutes at 15 psi, 121\u0026deg;C. The sterile L-Rod was used to disseminate the 100 \u0026micro;l of serial diluted sample onto the solidified agar plate. The plates were incubated for 24 hours at 37\u0026deg;C. Following the production of several subcultures, the pure bacterial culture was kept at 4\u0026deg;C in a sterile container.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Lipase screening of the isolated cultures using tributyrin agar:\u003c/h2\u003e \u003cp\u003eThe production of extracellular lipase enzyme from the bacterial pure culture was examined using tributyrin agar. The media's ingredients were as follows. The following ingredients were combined in the sterilised distilled water and autoclaved at 15 psi, 121\u0026deg;C for 20 minutes: Peptone (5 g/L), Yeast (3 g/L), Agar (15 g/L), and Tributyrin (10 ml/L). To solidify, the medium was poured into the sterilised petri plate. A loop full of an isolated bacterial culture was progressively streaked. After streaking, the plates were incubated at 37\u0026deg;C for 24 hours. The clear zone was observed around the colonies which indicated the hydrolysis of tributyrin and the efficient release of the lipase from the isolated bacteria. The molecular identification of the positive stain was carried out.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Identification of the lipase producing organism:\u003c/h2\u003e \u003cp\u003eThe genomic DNA was isolated from a culture that produced lipase enzymes efficiently. Using the universal 16s forward primer 27F (5\u0026prime; AGAGTTTGATCMTGGCTCAG 3\u0026prime;) and reverse primer 1492R (5\u0026prime; CGGTTACCTTGTTACGACTT 3\u0026prime;), the 16s rRNA gene amplification was conducted using PCR, or polymerase chain reaction techniques. The identification was done at Biokart Pvt Ltd, Bangalore. Using BLAST (Basic Local Alignment Sequencing tool), the 16S rRNA sequence was compared, aligned to identify the organism. The phylogenetic tree was generated for the nucleotide sequence using Mega X software. The evolutionary relationship was developed using neighbor-joining tree and the bootstrap value replications of 1000.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Media composition for lipase production from the isolated bacterial strain:\u003c/h2\u003e \u003cp\u003eThe 250ml Erlenmeyer flask was used to cultivate the isolated colonies with the best enzymatic activity. The lipase media were made up of the following ingredients. Peptone 2%, NH\u003csub\u003e4\u003c/sub\u003eH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e 1%, NaCl 0.25%, MgSO\u003csub\u003e4\u003c/sub\u003e.7H\u003csub\u003e2\u003c/sub\u003eO 0.04%, CaCl\u003csub\u003e2\u003c/sub\u003e.2H\u003csub\u003e2\u003c/sub\u003eO 0.04%, and olive oil 2% (w/v) with tween 80 as an emulsifier for effective mixing of oil with the media. The pH was adjusted 7. A loop full of isolated pure culture was inoculated into the media to effectively lipase. The flask was incubated for 24 hours at 37\u0026deg;C. After incubation, the culture medium was centrifuged for 15 minutes at 10,000 rpm at 4\u0026deg;C. The cell free supernatant (Crude enzyme) was further analysed and characterized.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Optimization of the lipase enzyme production from bacterial source:\u003c/h2\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.6.1. Effect of pH:\u003c/h2\u003e \u003cp\u003eVaried range of pH was used to understand the effect of pH on lipase production. The pH range of 4\u0026ndash;12 was analysed in the nutrient broth with the isolated organism. The medium was incubated at 37\u0026deg;C for 36 hrs at 130 rpm and the enzyme activity was calibrated. The optimized parameters were kept unaltered to improve better lipase production.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.6.2. Effect of temperature:\u003c/h2\u003e \u003cp\u003eThermostability of the lipase enzyme was determined by subjecting the enzyme to range of temperature from 20\u0026deg;C to 60\u0026deg;C. The incubation was carried out at pH 7 with 37\u0026deg;C for 36 hrs at 130 rpm by inoculating the culture in different flasks. Effective activity at the range of temperature was carried out and set as parameter for the rest of the studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.6.3. Effect of inoculum Size:\u003c/h2\u003e \u003cp\u003eThe inoculum size was optimized for the effective production of lipase from the isolate. The inoculum size ranging from 0.5 to 10% was considered. The incubation was carried out at 7 pH, 37\u0026deg;C for 36 hrs. The enzyme activity was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.6.4. Effect of incubation time on lipase activity:\u003c/h2\u003e \u003cp\u003eThe incubation time plays a major role in obtaining the better production of enzyme with high stability and activity. The organism was cultured with incubation time ranging from 12 hrs to 60 hrs. The basal media was incubated at 37\u0026deg;C at 130 rpm. The media was fixed with the other optimized parameters and the activity upon time was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.6.5. Effect of substrate on lipase activity:\u003c/h2\u003e \u003cp\u003eVarious substrate like olive oil, corn oil, gingelly oil, castor oil, almond oil, and coconut oil at 1% concentration was analysed with isolated culture in each flask and the effective substrate for the lipase activity was optimized for the effective production of the enzyme. The constant parameters maintained was 37\u0026deg;C for 36 hrs at 130 rpm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.6.6. Effect of nitrogen source on lipase activity:\u003c/h2\u003e \u003cp\u003eVarious nitrogen sources like peptone, yeast extract, tryptone, urea, sodium nitrite, potassium nitrite and ammonium nitrate by 1.5%(w/v) was analysed for efficient lipase activity and stable by maintaining the other parameters unchanged. The bacterial culture was inoculated at pH 7, 37\u0026deg;C for 36 hrs at 130 rpm.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Protein estimation:\u003c/h2\u003e \u003cp\u003eThe protein concentration of the supernatant and the purified samples were determined by nanodrop spectrophotometer 2000. The total protein concentration of the crude lipase enzyme and the purified samples were applied in calculating the activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Determination of lipase activity using spectrophotometric method:\u003c/h2\u003e \u003cp\u003eTo enhance the accurate determination of lipase enzyme activity, spectrophotometric method was used. P-nitrophenyl palmitate (p-NPP) was used as a substrate. The procedure was adopted from Salgado and their colleagues (Salgado, Baglini\u0026egrave;re, and Vanetti 2020) with slight modifications. The p-nitrophenyl palmitate (p-NPP) reaction substrate was made up of solutions A and B. In solution A, 40 mg of p-nitrophenyl palmitate was dissolved in 12 ml of isopropanol, while in solution B, 0.1 g of gum Arabic and 0.4 ml of triton are added in 90ml of distilled water. 1 ml of solution A and 19ml of solution B were added to make up the complete substrate solution. 1 ml of prepared substrate, 0.5 ml of buffer, 0.1 ml of produced lipase enzyme and was added and final volume was made up to 3 ml with distilled water. After incubation, isopropanol was used to terminate the reaction. The absorbance at 410nm was calibrated. The activity was intended using Eq.\u0026nbsp;1. The definition of an enzyme is 1 mol of P-nitrophenol emitted from the enzyme per minute of substrate.\u003c/p\u003e \u003cp\u003e \u003cem\u003eOne lipase enzyme\u0026thinsp;=\u0026thinsp;1mol of p-nitrophenol enzyme released from substrate/Minute\u003c/em\u003e (1)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Purification of the optimized lipase:\u003c/h2\u003e \u003cp\u003eThe purification of the isolated enzyme not only removes the salt and other components but also facilitates effective activity of the enzyme. In this study, ammonium sulphate precipitation, dialysis and column chromatography were performed to purify the produced crude enzyme.\u003c/p\u003e \u003cdiv id=\"Sec18\" class=\"Section3\"\u003e \u003ch2\u003e2.9.1. Ammonium sulphate precipitation:\u003c/h2\u003e \u003cp\u003eA salt with a strong ionic charge, ammonium sulphate, promotes the precipitation of proteins at increasing quantities. To partially purify lipase, saturated ammonium sulphate with concentration of 70% were added to 5 mL of crude extract obtained under ideal circumstances. Each test tube was kept at 4\u0026deg;C overnight, and the following day, they were centrifuged for 10 minutes at a speed of 10,000 rpm. After suspending the pellet in phosphate buffer, lipase activity was estimated using spectrophotometric method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section3\"\u003e \u003ch2\u003e2.9.2. Dialysis:\u003c/h2\u003e \u003cp\u003eThe precipitated sample was proceeded with dialysis step in a dialysis membrane immersed in 0.1 M of sodium phosphate buffer. The membrane preparation was followed according to the standard procedure. The apparatus was kept overnight at 4\u0026deg;C with moderate shaking. The sample was checked for enzyme activity after 24 hrs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section3\"\u003e \u003ch2\u003e2.9.3. Column Chromatography:\u003c/h2\u003e \u003cp\u003eA Sephadex G-100 column previously equilibrated with sodium phosphate buffer was loaded carefully without air bubble. The buffer was maintained carefully to avoid the column dryness. 1 ml of the sample was loaded without disturbing the column bed. The elution was slowly started at the flow rate 1ml/min. The fractions were collected and enzyme activity was checked with spectrophotometric method. The elusions with the highest activity were pooled together and the enzyme activity was calculated. The purified enzyme was stored at 4\u0026deg;C to maintain its stability and activity.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e2.10. SDS-PAGE Analysis:\u003c/h2\u003e \u003cp\u003eThe SDS PAGE analysis was carried out to obtain the molecular weight of the obtained enzymes. Standard protocol of SDS-PAGE was followed. The apparatus was set and checked for leakage. The reagents were prepared from the standard protocol. The concentration of the separating and the stacking gel was 12% and 4% respectively. The gel set up was made without any air bubble. After solidification, the comb was slowly removed and the apparatus was set with the 1X running buffer. The crude lipase sample and the purified sample was mixed with the sample loading dye at the preferred ratio of 2:1. The samples were kept in the water bath for 5 mins. After boiling, the samples were centrifuged and the supernatant was loaded in the lane carefully. The prestained protein marker (IRIS11 Bio helix) was loaded to determine the molecular weight of the samples. The gel was run at 60V for 3 hours. The results were observed after staining the gel carefully with Coomassie brilliant blue (0.1%), methanol (20%) and acetic acid (10%) for 1 hour. The gel was rinsed thrice with distilled water and further destained with methanol (50%), acetic acid (10%) and distilled water overnight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e2.11. \u003cb\u003eCharacterization of the purified lipase from bacterial strain\u003c/b\u003e:\u003c/h2\u003e \u003cp\u003eThe purified lipase after column chromatography was further characterized using several parameters like pH, temperature, effect of detergents and metal ions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e2.11.1. Effect of pH and temperature on the purified enzyme:\u003c/h2\u003e \u003cp\u003eAssaying the activity in many buffers at varying pH values allowed better understanding in investigating the ideal pH value for lipase activity and stability. The pH values (3.0\u0026ndash;12.0) were incubated at 40\u0026deg;C. Sodium acetate, pH\u0026thinsp;=\u0026thinsp;50 mM (3.0\u0026ndash;5.0), 50 mM sodium phosphate monobasic (pH 6.0\u0026ndash;7.0), 50 mM phosphate buffer (8.0\u0026ndash;9.0), and 50 mM glycine/NaOH buffer (10.0\u0026ndash;12.0) were employed. The purified lipase was pre-incubated for 1 hours in several buffers ranging in pH from 3.0 to 12.0 to verify its pH stability. The purified enzyme was incubated at temperatures ranging from 20\u0026deg;C to 55\u0026deg;C while Under conventional assay conditions, the relative lipase activity and specific activity were ascertained. The thermostability of the purified enzyme was monitored with 1 hr incubation. The relative activity (%) was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e2.11.2. Effect of metal ions and detergents:\u003c/h2\u003e \u003cp\u003eThe lipase solution was pre-incubated with each to determine the relative activity. Every reagent was kept ready in sodium phosphate buffer, and every metal ion (Na\u003csup\u003e+\u003c/sup\u003e, Ba\u003csup\u003e2+\u003c/sup\u003e, Ca\u003csup\u003e2+\u003c/sup\u003e and Mn\u003csup\u003e2+\u003c/sup\u003e) at 1mM and10-mM final concentration. Two reaction mixtures with 0.1 (w/v) of well-known commercial. Additionally, detergents such as SDS (Sodium dodecyl sulphate), Tween 20, Tween 80 and Triton x-100 were incubated for 1 hr at room temperature. Without detergents, the lipase activity was 100%, which was kept as control. The relative activity was calculated by comparing the lipase activity to the control. The above-described experiments were carried out using p-NPP serving as the substrate. Every test was run in three duplicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Hydrolysis of waste tallow using the lipase enzyme:\u003c/h2\u003e \u003cp\u003e1 g of tallow, 15 ml of 0.1 M phosphate buffer (pH 7.0), and 0.75 ml (5%, v/v) of hexane were placed in 100 ml Erlenmeyer flasks. The reaction mixture was homogenised for 10 minutes at 22,000 rpm using a homogenizer, and the tallow hydrolysis process was run for 74 hours at 30\u0026deg;C, 40\u0026deg;C and 50\u0026deg;C with purified lipase (lipase activity of 100 U/g of tallow) at different concentrations (0.5\u0026ndash;2.0%). The reaction was stopped by adding 20 ml of acetone, and samples were obtained every 24 hours. The free fatty acids were then titrated with 0.1 M KOH using phenolphthalein as an indicator. An identical procedure was performed without the enzyme as a control. The acid value was computed by deducting the control value from the experimental value using Eq.\u0026nbsp;(2).\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$Hydrolysis ratio of the waste tallow\\left(\\%\\right)=\\left(\\frac{Acid value of the released fatty acid}{Saponification}\\right)*100$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e---- (2)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Wash performance of the purified lipase:\u003c/h2\u003e \u003cp\u003eThe purified lipase was tested for its effect on the stained clothes. The cotton fabrics ( 6 cm x 6 cm) was stained with different samples (Coconut oil, Chocolate and cream cheese). The stained fabric was air dried for 20 mins. The following compositions were analysed to understand the enzyme performance with detergent. Stained fabric, distilled water (100 ml) (a), Stained fabric, distilled water (100 ml), detergent (100 mg/ml) (b), Stained fabric, distilled water (100 ml), detergent (100 mg/ml), purified lipase solution (1 ml) (c). All the compositions were incubated in the incubator shakor for 30 mins at 50\u0026deg;C. After incubation, the fabrics were washed and dried at room temperature. The stain removal efficiency of different compositions were observed visually.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Lipase screening of the isolated culture:\u003c/h2\u003e \u003cp\u003eThe clear zone of hydrolysis was observed around the colony using tributyrin agar screening. The zone of clearance confirmed the presence of the lipase activity due to the extracellular production of the lipase from the bacteria. The highest zone clearance of 5mm was observed for the sample S13D. The best strain was proceeded for the further studies.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIsolates\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLipase Test\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZone of Clearance (mm)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS15D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS13B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS15F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS13D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS11B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS1C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.5 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS3D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.5 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS3C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS5A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS18B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5 mm\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS13E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS17D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS15A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS15G\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS18A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS13C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS8A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS8B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS8C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS7B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS17A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS15B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS17B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e\u0026lsquo;+\u0026rsquo; positive for the test \u0026lsquo;-\u0026rsquo; Negative for the test\u003c/p\u003e \u003cp\u003eTable\u0026nbsp;1: Lipase activity screening against tributyrin agar\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFrom table 1, we can observe the hydrolysis of lipid which indicates that the isolates show effective extracellular lipase production. The positive and negative zone of clearance for individual bacterial strains are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. From which, bacterial isolate S13D had highest zone clearance of 5 mm. The highest zone of clearance of isolate S13D is shown in Fig.\u0026nbsp;2. Thus, the study was focused on the S13D isolates in the view that this strain would be stable and active. Further optimization, enables the highest production of lipase enzyme. The molecular identification of the sample S13D was carried out.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFig:2 Zone clearance of the best bacterial strain indicating the presence of lipase.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Molecular Identification:\u003c/h2\u003e \u003cp\u003eThe molecular identification carried out using the BLAST tool confirmed that the sample would relatively be \u003cem\u003epseudomonas\u003c/em\u003e species. We can conclude that the unknown sequence was highly identical to the \u003cem\u003ePseudomonas mosselii\u003c/em\u003e strain with 97.95% similarity range. \u003cem\u003ePseudomonas mosselii\u003c/em\u003e bacteria is a Gram-negative, rod-shaped bacteria. \u003cem\u003eP. mosselii\u003c/em\u003e has been assigned to the P. putida group according to 16S rRNA study. A member of the \u003cem\u003eP. putida group, Pseudomonas mosselii\u003c/em\u003e, has demonstrated tremendous promise in the fields of medicine, plant growth stimulation, and environmental preservation. Recently, \u003cem\u003eP. mosselii's\u003c/em\u003e has effective antibacterial and anticancer properties and a compound pseudopyronine as potent anticancer drug was discovered (Yang et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe isolate was highly like \u003cem\u003ePseudomonas mosselii\u003c/em\u003e strain CFML (NR 024924.1).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec30\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Optimization for the lipase enzyme production from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e:\u003c/h2\u003e \u003cdiv id=\"Sec31\" class=\"Section3\"\u003e \u003ch2\u003e3.3.1. Effect of pH:\u003c/h2\u003e \u003cp\u003eThe gradual increase of pH from 4 to 12 has varied result on the effective production of the lipase from the isolate. Comparatively, pH range of 6.5 to 7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ea) had the highest lipase activity of 110.298 U/ml whereas the pH below and above the range decreased the lipase activity. The acidic nature of the media adversely affected the lipase activity. Meanwhile the high basic nature of the culture media decreased the activity of the lipase. The high basic nature caused the enzyme to denature and lose its stability decreasing its activity gradually. Thus, pH around 6.5-7 is effectively favourable for the better activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section3\"\u003e \u003ch2\u003e3.3.2. Effect of Temperature:\u003c/h2\u003e \u003cp\u003eThe lipase enrichment media were incubated in the range of temperature from 20\u0026deg;C to 95\u0026deg;C with optimized pH range. After incubation the lipase activity was calibrated. The increase activity of 112.388 U/ml from the range of 35\u0026deg; C to 40\u0026deg;C was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Further increase in temperature gradually decreased the enzyme activity. This would be mainly due to the denaturation of the enzyme. Lack of available temperature may be the reason for low activity at the low temperature. Thus, temperature plays a crucial role in the stable production and activity of the enzyme. The optimized temperature for better production was around 35\u0026deg; C to 40\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec33\" class=\"Section3\"\u003e \u003ch2\u003e3.3.3. Effect of Inoculum Size:\u003c/h2\u003e \u003cp\u003eThe maximum lipase production from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e was obtained at 2% (118.5 U/ml) inoculum size (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). The increase in inoculum size decreased the lipase production. The excessive presence of inoculum would have consumed the nutrient much faster and no sufficient time interval was there for lipase production to occur. The inoculum size lower than 2%, showed reduced lipase production since the log phase was comparatively slower. Thus, the highest production of the lipase enzyme can be obtained at 2% of the inoculum size.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section3\"\u003e \u003ch2\u003e3.3.4. Effect of Incubation time:\u003c/h2\u003e \u003cp\u003eEfficient activity of lipase with 119.701 U/ml was observed at the incubation time of 36 hrs as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ed. The enzyme activity gradually decreased upon increase in time which may be due to the stationary phase of the bacterial strain. Thus, 36 hrs of incubation time would be the optimized time for better lipase production with high activity and stability. Prior incubation time did not show much activity as compared to the incubation period of 36 hrs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec35\" class=\"Section3\"\u003e \u003ch2\u003e3.3.5. Effect of substrate:\u003c/h2\u003e \u003cp\u003eThe media for lipase production was substituted with various substrate with the concentration of 1%. The other parameters optimized before was kept unaltered. The lipase enzyme activity was calibrated after 36 hrs of incubation. The lipase activity was comparatively high (118.059 U/ml) when olive oil was used as the substrate. Meanwhile, corn oil also showed better activity whereas gingelly oil and coconut oil were not much effective (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). Thus, for higher production range, olive oil may be used as an effective substrate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec36\" class=\"Section3\"\u003e \u003ch2\u003e3.3.6. Effect of nitrogen source:\u003c/h2\u003e \u003cp\u003eThe nitrogen source influence on the lipase activity was examined using peptone, yeast extract, tryptone, urea and ammonium nitrate. The other optimized parameters were kept unchanged such as pH, temperature, carbon source. The lipase activity incubated with peptone was found to have highest activity of 150.746 U/ml when compared to other source. The results of other sources were not that depleting when compared to peptone (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). Meanwhile tryptone also showed relatively effective activity. Thus, peptone can be considered as the effective nitrogen source for this strain.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec37\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Protein concentration of the produced lipase enzyme:\u003c/h2\u003e \u003cp\u003eThe protein concentration of the crude was analysed using nanodrop spectrophotometer 2000 at 260/280 nm. The protein concentration of the crude was around 12,544 mg/ml. The ammonium sulphate precipitated sample was 0.695 mg/ml whereas the acetone precipitated sample was 0.401. Thus, the ammonium sulphate precipitation was much more effective in concentrating overall protein.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec38\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Lipase activity using spectrophotometric method:\u003c/h2\u003e \u003cp\u003eThe enzyme activity of the crude sample, ammonium sulphate precipitated sample, dialysis sample and chromatography sample were calibrated as shown in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The enzyme activity was based on the substrate p-nitrophenyl laurate as the substrate. The substrate used in the study was favourably effective in standardizing the enzyme activity of the produced lipase from the \u003cem\u003ePseudomonas mosselii\u003c/em\u003e strain.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePurification steps with lipase enzyme activity of \u003cem\u003ePseudomonas mosselii\u003c/em\u003e strain\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEnzyme Volume\u003c/p\u003e \u003cp\u003e(ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUnit Activity\u003c/p\u003e \u003cp\u003e(U/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTotal Activity\u003c/p\u003e \u003cp\u003e(U)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eProtein content\u003c/p\u003e \u003cp\u003e(mg/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSpecific Activity\u003c/p\u003e \u003cp\u003e(U/mg)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSupernatant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e156.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15641.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12.544\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e12.46\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrecipitate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e116.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e583.58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.695\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e167.93\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDialysis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e102.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e510.44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e87.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSephadex G-100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e97.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e97.611\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.618\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e157.94\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe unit activity of the partially purified lipase enzyme after column chromatography was found to be 97.61 U/ml. The specific activity was around 157.94 U/mg. The crude supernatant after the growth in media with supplements for effective growth was estimated for activity. The unit activity was found to be 156.41 U/ml whereas the specific activity was 12.46 U/mg. The precipitation with ammonium sulphate and dialysis of the same did not enhance the purification effectively, whereas the column chromatography with Sephadex G-100 enhance the purification and activity of the lipase enzyme with better stability. The specific activity increased after the purification with the Sephadex G-100 column when compared to the results of the dialysed lipase enzyme. The stability and activity after chromatography was also found to be effective and favourable.\u003c/p\u003e \u003cdiv id=\"Sec39\" class=\"Section3\"\u003e \u003ch2\u003e3.5.1. Column Chromatography:\u003c/h2\u003e \u003cp\u003eThe absorbance and the elution fraction of the lipase enzyme is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e. Based on the observation, the elution fraction 12, 13 and 14 showed highest absorbance. The three fractions were pooled together and the specific activity was found to be 157.96 U/mg. Gradual decrease of activity after the further elution were observed. Comparing to the dialysed enzyme, the purification method using column chromatography with Sephadex G-100 as the stationary phase was effective in purifying the lipase enzyme with high activity and stability.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec40\" class=\"Section2\"\u003e \u003ch2\u003e3.6. SDS Analysis:\u003c/h2\u003e \u003cp\u003eThe SDS results are depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003e. The molecular weight of the partially Purified sample after chromatography was found to be around 55\u0026ndash;60 kDa. The crude sample had varied range of bands whereas the purified lipase enzyme of the present study had a molecular weight of around 55 kDa. The similar report of molecular weight of the purified lipase from \u003cem\u003ePseudomonas putida\u003c/em\u003e around 48 kDa was reported by (Song et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The molecular weight of purified lipase isolated from \u003cem\u003ePseudomonas reinekei\u003c/em\u003e was 50kDa (Priyanka, Kinsella, et al. 2019).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec41\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Characterization of the lipase enzyme:\u003c/h2\u003e \u003cdiv id=\"Sec42\" class=\"Section3\"\u003e \u003ch2\u003e3.7.1. Effect of pH and temperature on purified enzyme:\u003c/h2\u003e \u003cp\u003eThe effective stability of the purified lipase was found to be around pH 6 to 8 range as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003e(a). Thus, the produced lipase from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e was highly stable around the pH 6 to 8. There was a significant loss of stability between pH 3 to 5 and loss after pH 8.5. The relative activity of the lipase was stable between 6 to 8 with the relative activity of 99%. The relative activity and stabilty reduced after 8 pH. The 1 hr incubation at different pH shows that the purified enzyme activity is affected at acidic and extreme basic pH. The stability of the enzyme remained highly stable between 6\u0026ndash;8. In general, the lipase enzyme are said to be stable around alkaline nature.\u003c/p\u003e \u003cp\u003eThe enzyme was highly stable between the temperature range of 20\u0026deg;C to 55\u0026deg;C as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003e(b). The enzyme was highly stable throughout the incubation period The stability was affected after 50\u0026deg;C. This may confirm that the produced lipase enzyme might not be thermotolerant. Effective stability was observed around 30\u0026deg;C to 40\u0026deg;C during the time interval but comparatively was highly stable at 35\u0026deg;C. There was a mild reduce upon the increase in time at 30\u0026deg;C, however the stability of the enzyme was observed in the temperature range of 30\u0026deg;C-35\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec43\" class=\"Section3\"\u003e \u003ch2\u003e3.7.2. Effect of Metal ions and detergent on purified lipase:\u003c/h2\u003e \u003cp\u003eIt has been observed that a number of metal ions cause the fatty acids to create their corresponding metal salts at the oil\u0026ndash;water interface, which frees up lipase to work on oil molecules. This results in the hydrolysis of oil by lipase. The presence of Ca\u003csup\u003e2+\u003c/sup\u003e greatly supported the lipase activity and stability at both the concentration (1mM and 10mM) as shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003e (c). It has been observed that Ca\u003csup\u003e2+\u003c/sup\u003e is crucial for the enzyme's conformational stability. The \u003cem\u003ePseudomonas sp\u003c/em\u003e are greatly activated using Ca\u003csup\u003e2+\u003c/sup\u003e compared to other metals (Joseph, Ramteke, and Thomas 2008). The metal ion binds to the lipase forming a salt bridge and changing its conformational structure which provides higher stability to the enzyme.\u003c/p\u003e \u003cp\u003eSurfactants are vital for the multifunctionality and diverse characteristics of enzymes, and they can trigger lipases in molecular bioimprinting. Lipase typically has a greater beneficial effect when non-ionic surfactants are present than when anionic or cationic surfactants are present (Holmberg 2017).Tween 80 should higher stability compared to other detergents as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e7\u003c/span\u003e (d). In contrast, to the study reported by Priyanka et al., (Priyanka, Kinsella, et al. 2019), SDS affected the stability of the purified lipase. Triton X 100 showed better stability next to Tween 80.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec44\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Hydrolysis of tallow using lipase enzyme:\u003c/h2\u003e \u003cp\u003eThe release of fatty acid from tallow upon hydrolysis using lipase enzyme was evaluated by titration method and the results are shown in Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e in terms of the hydrolysis reaction ratio.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReaction ratio(%) of hydrolysis of the tallow using lipase enzyme with different concentration\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"11\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTemperature\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003e30\u0026deg;C\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003e40\u0026deg;C\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c11\" namest=\"c9\"\u003e \u003cp\u003e50\u0026deg;C\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLipase enzyme\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e80.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e80.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e83\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e75.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e75.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e76.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e76.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e76.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e78.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e78.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e79.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1.5\u003c/p\u003e \u003cp\u003e2.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e79\u003c/p\u003e \u003cp\u003e79.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80.5\u003c/p\u003e \u003cp\u003e80.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e81.2\u003c/p\u003e \u003cp\u003e81.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e82\u003c/p\u003e \u003cp\u003e81.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e82.6\u003c/p\u003e \u003cp\u003e82.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e83.1\u003c/p\u003e \u003cp\u003e83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e83.2\u003c/p\u003e \u003cp\u003e83.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e83.2\u003c/p\u003e \u003cp\u003e83.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e83.7\u003c/p\u003e \u003cp\u003e83.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eInitial hydrolysis of the tallow at 30\u0026deg;C to 50\u0026deg;C ranging from 24 to 72 hrs was carried out at different lipase concentration. The highest reaction ratio was found to be 83.7% with 1.5% lipase at 72 hrs. At 40\u0026deg;C the highest ratio was about 83.1% and at 50\u0026deg;C, the ratio was found to be 81.9% after 72 hrs of hydrolysis at 30\u0026deg;C. The lipase concentration of 0.5% did not show much hydrolysis ratio compared to 1.5%. The other concentration rate of the lipase also showed effective results comparatively. The hydrolysis of tallow with 2% lipase concentration did not show much diiference in the hydrolysis ratio related to the concentration of 1.5% lipase. The enzyme remained stable throughout the process.The reaction mixture contained 1 g of tallow, 20 ml of 0.1 M phosphate buffer (pH 7.0), 1% (w/v) of PEG 9000, 1 ml of 5% v/v hexane, and 150 U of lipase.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec45\" class=\"Section2\"\u003e \u003ch2\u003e3.9. Wash performance of the purified lipase:\u003c/h2\u003e \u003cp\u003eThe treated fabrics were visually observed for the results. The commercial detergent along with the purified lipase on the stained fabric showed effective result compared with the fabric treated with commercial detergent alone as shown Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e8\u003c/span\u003e. Upon obeservation, the complete removal of stain was observed in the fabric stained with the cream cheese. The other stains like chocolate and olive oil was also efficiently removed. The purified lipase has made better compactiblity with the commercial detergent and the activity of the lipase was not disturbed. The commercial detergent alone was not as effective as compared with the detergent with lipase. Further increase in the concentration of the lipase along with detergent formulation would improve the washing efficiency better. Thus, upon further optimization and enhancement, the lipase enzyme isolated from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e would show better performance as a detergent additive.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe isolation of the bacterial strain upon screening with tributyrin, the effective positive strain was proceeded for further analysis. The media composition played major role in the higher production of the lipase. The optimization of the media further improved the lipase activity. The pH favourable to produce lipase was found to be 6.5-7.0. Similar study with pH range 6.5 with highest lipase activity was reported by Sugihara and his colleagues (Sugihara et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). Thus, 6.5 pH would be effective on lipase production. Optimized temperature was found to be around 35\u0026deg;C- 40\u0026deg;C. Accordance report supported similar temperature range for better lipase activity in \u003cem\u003ePseudomonas\u003c/em\u003e sp. Strain KB700A (Rashid et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). A study on \u003cem\u003ePseudomonas chlororaphis\u003c/em\u003e PA23 showed effective temperature for lipase production to be around 38\u0026deg;C to 50\u0026deg;C and pH of 8 and 9 (Mohanan et al. 2022). The olive oil as a substate enabled better production of the lipase enzyme from the selected bacterial strain (Putri et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Better nitrogen source for highest lipase production was peptone. Similar report was supported by (Priyanka, Tan, et al. 2019) stating, for \u003cem\u003ePseudomonas gessardii\u003c/em\u003e to produce lipase, the optimal nitrogen source was determined to be a 1% (w/v) peptone supplement. The study reported on cold adapted \u003cem\u003ePseudomonas\u003c/em\u003e sp LSK25 isolated from Antarctic region showed effective lipase activity at pH around 7 to 8 and peptone as the preferable nitrogen source (Salwoom et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The ammonium sulphate precipitation carried out effectively precipitated the desired enzyme at 80%. Further purification by dialysis method with sodium phosphate buffer enhanced the purification. Final purification was achieved using column chromatography with Sephadex G-100 as stationary phase. Enzyme activity for all the collected crude and purified sample was measured using spectrophotometric method. p-nitrophenyl palmitate as a substrate enabled stable results. The unit activity for crude was 156.41 U/ml. A study carried out by (Priyanka, Tan, et al. 2019) showed highest activity of lipase as 0.91 IU/mL Whereas the purified lipase of the present study showed effective activity of 97.61 U/ml. The characterization of the enzyme revealed that the enzyme was efficient at pH (6\u0026ndash;8), temperature (30\u0026deg;C to 50\u0026deg;C). Results for \u003cem\u003ePseudomonas\u003c/em\u003e species were reported to be with pH at around (6\u0026ndash;9) and temperature around 50\u0026deg;C (Phukon et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The present study report stable temperature of 30\u0026deg;C to 50\u0026deg;C which shows the lipase to be thermotolerant. The metal ions (Ca\u003csup\u003e2+\u003c/sup\u003e) and detergent (Tween 80) showed better characterization of the lipase enzyme. The metal ion, Ca\u003csup\u003e2+\u003c/sup\u003e showed effective lipase stability and activity in the cold adaptive \u003cem\u003epseudomonas\u003c/em\u003e as well (Salwoom et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The molecular weight of the purified lipase was around 55kDa. The hydrolysis of waste tallow using the enzyme at different temperature, concentration and time gave broad range to understand the efficiency of the enzyme to hydrolyse the tallow. The highest reaction ratio was around 91.7% after 72 hrs. The study on \u003cem\u003ePseudomonas helmanticensis\u003c/em\u003e exhibited optimal activity at 50\u0026deg;C, pH (6\u0026ndash;9) and suggested to be highly suitable for detergent industry (Phukon et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The lipase enzyme isolated from \u003cem\u003ePseudomonas gessardii\u003c/em\u003e showed acidic lipase tolerance (pH 5.0). The enzyme was stable at 30\u0026deg;C and Ca\u003csup\u003e2+\u003c/sup\u003e showed stimulating effect on the lipase stability and activity (Ramani et al. 2010). The thermally stable lipase enzyme from \u003cem\u003ePseudomonas putida\u003c/em\u003e showed maximum activity at 50\u0026deg;C and maintained the relative activity ranged between 40 to 60\u0026deg;C and pH range of 6 to 8 (Song et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The results were favourable to the present study upon the effective production of the lipase. Furthermore, while using our lipase, the reported hydrolytic ratio was much greater than when using lipases from Rhizomucor miehei (73%) (Rodrigues and Fernandez-Lafuente \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) to hydrolyze beef tallow. These fatty acids are primarily involved in the methyl esters manufacturing process. Thus, the lipase enzyme produced from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e was effective in the hydrolysis of tallow from which the fatty acid would serve as the feedstock for the biodiesel production. Thus, the production from \u003cem\u003epseudomonas mosselii\u003c/em\u003e species would be highly effective choice for the commercial production of lipase and its application towards the hydrolysis of the waste tallow. The produced fatty acid composition would be used as a cost-effective feedstock for biodiesel production. The application of the purified lipase on the stained fabrics produced effective results on the removal of the stain at 50\u0026deg;C for 30 mins. A similar report on \u003cem\u003eC. albicans\u003c/em\u003e and \u003cem\u003eA. sclerotigenum\u003c/em\u003e derived lipase showed efficient removal of stained cotton fabrics at 40\u0026deg;C for 15 mins (Safdar, Ismail, and Imran 2023). The lipase from \u003cem\u003eG. stearothermophilus\u003c/em\u003e FMR12 was effective in the removal of chocolate and lipstick stain. At 70\u0026deg;C for 30 mins (Abol-Fotouh, AlHagar, and Hassan 2021). Thus, the production from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e species would be highly effective choice for the commercial production of lipase and its application towards the fat hydrolysis and detergent formulation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe study revealed effective lipase production with modified media composition and purification methods. Olive oil as a substrate would be highly supportive for effective lipase production. The specific activity achieved after partial purification was around 157.94 U/mg without further loss of activity. The production of lipase from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e was achieved with high activity optimization and characterization studies of the enzyme enhanced the activity and supported stability. The hydrolysis of the tallow using enzyme would effectively serve as the feedstock for biodiesel production. Thus, this study supports economically cost-effective approach. Further enhancement of the methodologies would further involve the enzyme in industrial application at low-cost production and with consistent, effective stability and activity.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003ep-NPP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003ep-Nitrophenol Palmitate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eEDTA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003eEthylenediaminetetraacetic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTEMED\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003eTetramethyl ethylenediamine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAPS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003eAmmonium Per Sulphate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRpm\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003eRevolutions Per Minute\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSDS-PAGE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003eSodium Dodecyl Sulphate \u0026ndash; Polyacrylamide Gel Electrophoresis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eU\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003eUnit\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eKOH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003ePotassium hydroxide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003eml\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003emillilitre\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.103896103896105%\"\u003e\n \u003cp\u003e\u003cstrong\u003emg\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"12.337662337662337%\"\u003e\n \u003cp\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"66.55844155844156%\"\u003e\n \u003cp\u003emilligram\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are thankful to Department of Science and Technology for funding the proposed study under 1819 scheme (DST/SEED/SCSP/STI/2021/882).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe project was funded by Department of Science and Technology for funding the proposed study under 1819 scheme (\u003cstrong\u003eDST/SEED/SCSP/STI/2021/882).\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Experiment, methodology, original draft- writing [Mohana Priya Srinivasan]. The first draft of the manuscript was written by [Mohana Priya Srinivasan], Supervision, visualization, and original draft reviewing [Dayanandan Anandan], Software and original draft reviewing [Ajith Chandrasekar], original draft reviewing [Nandha Kumar Suresh]. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eThis manuscript does not report data generation or analysis.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbol-Fotouh, Deyaa, Ola E.A. AlHagar, Mohamed A. Hassan. 2021. Optimization, Purification, and Biochemical Characterization of Thermoalkaliphilic Lipase from a Novel \u003cem\u003eGeobacillus Stearothermophilus\u003c/em\u003e FMR12 for Detergent Formulations. J. Biol. Macromol. 125\u0026ndash;35. https://doi.org/10.1016/j.ijbiomac.2021.03.111.\u003c/li\u003e\n\u003cli\u003eAtalah, Joaqu\u0026iacute;n, Paulina C\u0026aacute;ceres-Moreno, Giannina Espina, Jenny M. Blamey. 2019. \u0026ldquo;Thermophiles and the Applications of Their Enzymes as New Biocatalysts.\u0026rdquo; Bioresour. Technol.\u003cem\u003e \u003c/em\u003e478\u0026ndash;88. https://doi.org/10.1016/j.biortech.2019.02.008.\u003c/li\u003e\n\u003cli\u003eBharathi, Devaraj, G. Rajalakshmi. 2019. Microbial Lipases: An Overview of Screening, Production and Purification. Biocatal. Agric. Biotechnol. 22: 101368. https://doi.org/10.1016/j.bcab.2019.101368.\u003c/li\u003e\n\u003cli\u003ePrem Chandra, Ranjan Singh, Pankaj Kumar Arora. 2020. Microbial Lipases and Their Industrial Applications : A Comprehensive Review. Microb. Cell Factories https://doi.org/10.1186/s12934-020-01428-8.\u003c/li\u003e\n\u003cli\u003eFaryad Amna, Asia Ataa, Faiz Ahmad Joyia 2021 Microbial Lipase Production : A Deep Insight into the Recent Advances of Lipase Production and purification techniques . Biotechnol. Appl. Biochem. 1\u0026ndash;14. 10.1002/bab.2019\u003c/li\u003e\n\u003cli\u003eGupta Rani, Arti Kumari, Poonam Syal, Yogesh Singh. 2015. Molecular and Functional Diversity of Yeast and Fungal Lipases: Their Role in Biotechnology and Cellular Physiology. Prog. Lipid Res. 40\u0026ndash;54. http://dx.doi.org/10.1016/j.plipres.2014.12.001.\u003c/li\u003e\n\u003cli\u003eGurkok, Sumeyra, Murat Ozdal. 2021. Purification and Characterization of a Novel Extrcellular, Alkaline, Thermoactive, and Detergent-Compatible Lipase from \u003cem\u003eAeromonas Caviae\u003c/em\u003e LipT51 for Application in Detergent Industry. Protein Expr. Purif.\u003cem\u003e \u003c/em\u003e105819. https://doi.org/10.1016/j.pep.2021.105819.\u003c/li\u003e\n\u003cli\u003eHolmberg, K. 2018. Interactions between surfactants and hydrolytic enzymes. Colloids Surf B Biointerfaces, 168, 169\u0026ndash;177. doi:10.1016/j.colsurfb.2017.12.002\u003c/li\u003e\n\u003cli\u003eJamilu, Hadiza, Aliyu Hassan Ibrahim, Suleiman Zubair Abdullahi. 2022. Isolation, Optimization and Characterization of Lipase Producing Bacteria from Abbatoir Soil. Int. j. sci. adv\u003cem\u003e.\u003c/em\u003e 3(1).\u003c/li\u003e\n\u003cli\u003eJoseph Babu, Pramod W. Ramteke, George Thomas. 2008. Cold Active Microbial Lipases: Some Hot Issues and Recent Developments. Biotechnol. Adv\u003cem\u003e. \u003c/em\u003e26(5): 457\u0026ndash;70.\u003c/li\u003e\n\u003cli\u003eKumar, Vineet, Indu Shekhar Thakur. 2020. Biodiesel Production from Transesterification of \u003cem\u003eSerratia Sp.\u003c/em\u003e ISTD04 Lipids Using Immobilised Lipase on Biocomposite Materials of Biomineralized Products of Carbon Dioxide Sequestrating Bacterium. Bioresour. Technol. 123193. https://doi.org/10.1016/j.biortech.2020.123193.\u003c/li\u003e\n\u003cli\u003eLahiri, Aparajita et al. 2023. Journal of Hazardous Materials Advances A Critical Review on Food Waste Management for the Production of Materials and Biofuel. \u003cem\u003eJ. Hazard. Mater. \u003c/em\u003e 100266. https://doi.org/10.1016/j.hazadv.2023.100266.\u003c/li\u003e\n\u003cli\u003eLiu Wu, Menggang Li, Yunjun Yan. 2017. Heterologous Expression and Characterization of a New Lipase from \u003cem\u003ePseudomonas fluorescens \u003c/em\u003ePf0-1 and Used for Biodiesel Production. Sci. Rep\u003cem\u003e.\u003c/em\u003e 1\u0026ndash;11. http://dx.doi.org/10.1038/s41598-017-16036-7.\u003c/li\u003e\n\u003cli\u003eMehta Akshita, Urgyn Bodh, Reena Gupta. 2017. Fungal Lipases: A Review. J. Biotech Res. 8(1): 58\u0026ndash;77.\u003c/li\u003e\n\u003cli\u003eMohanan Nisha, Chun Hin Wong, Nediljko Budisa, David B. Levin. 2022. Characterization of Polymer Degrading Lipases, LIP1 and LIP2 From \u003cem\u003ePseudomonas chlororaphis \u003c/em\u003ePA23. Front. bioeng. biotechnol.\u003cem\u003e \u003c/em\u003e10, 1\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eMrudula Vasudevan, Ushasree, Amit K. Jaiswal, Shyam Krishna, Ashok Pandey. 2019. Thermostable Phytase in Feed and Fuel Industries. Bioresour. Technol 400\u0026ndash;407. https://doi.org/10.1016/j.biortech.2019.01.065.\u003c/li\u003e\n\u003cli\u003eNema, Ashutosh et al. 2019. Production and Optimization of Lipase Using \u003cem\u003eAspergillus niger \u003c/em\u003eMTCC 872 by Solid-State Fermentation. Bull Natl Res Cent 43(1).\u003c/li\u003e\n\u003cli\u003ePhukon, Loreni Chiring et al. 2020. Production and Characterisation of Lipase for Application in Detergent Industry from a Novel \u003cem\u003ePseudomonas helmanticensis\u003c/em\u003e HS6. Bioresour. Technol. 123352. https://doi.org/10.1016/j.biortech.2020.123352.\u003c/li\u003e\n\u003cli\u003ePriyanka, Priyanka, Yeqi Tan, et al. 2019. Solvent Stable Microbial Lipases: Current Understanding and Biotechnological Applications. Biotechnol. Lett\u003cem\u003e.\u003c/em\u003e 41(2): 203\u0026ndash;20. https://doi.org/10.1007/s10529-018-02633-7.\u003c/li\u003e\n\u003cli\u003ePriyanka Priyanka, Gemma Kinsella, Gary T. Henehan, Barry J. Ryan. 2019. Isolation, Purification and Characterization of a Novel Solvent Stable Lipase from \u003cem\u003ePseudomonas reinekei\u003c/em\u003e. Protein Expr. Purif. 153: 121\u0026ndash;30. https://doi.org/10.1016/j.pep.2018.08.007.\u003c/li\u003e\n\u003cli\u003ePutri, Dwini Normayulisa et al. 2020. Optimization of \u003cem\u003eAspergillus niger\u003c/em\u003e Lipase Production by Solid State Fermentation of Agro-Industrial Waste. Energy Rep. 6: 331\u0026ndash;35. https://doi.org/10.1016/j.egyr.2019.08.064.\u003c/li\u003e\n\u003cli\u003eRamani, John Kennedy, Ramakrishnan, Sekaran. 2010. Purification, Characterization and Application of Acidic Lipase from \u003cem\u003ePseudomonas essardii\u003c/em\u003e Using Beef Tallow as a Substrate for Fats and Oil Hydrolysis. Process Biochem. 45(10): 1683\u0026ndash;91. http://dx.doi.org/10.1016/j.procbio.2010.06.023.\u003c/li\u003e\n\u003cli\u003eRashid, Naeem et al. 2001. Low-Temperature Lipase from Psychrotrophic \u003cem\u003ePseudomonas Sp. \u003c/em\u003eStrain KB700A. Appl. Environ. Microbiol.\u003cem\u003e \u003c/em\u003e67(9): 4064\u0026ndash;69.\u003c/li\u003e\n\u003cli\u003eRios, Nathalia Saraiva et al. 2018. Biotechnological Potential of Lipases from \u003cem\u003ePseudomonas:\u003c/em\u003e Sources, Properties and Applications. Process Biochem. 75: 99\u0026ndash;120. https://doi.org/10.1016/j.procbio.2018.09.003.\u003c/li\u003e\n\u003cli\u003eRodrigues, Rafael C., Roberto Fernandez-Lafuente. 2010. Lipase from \u003cem\u003eRhizomucor miehei\u003c/em\u003e as a Biocatalyst in Fats and Oils Modification. J. Mol. Catal.\u003cem\u003e \u003c/em\u003e66(1\u0026ndash;2): 15\u0026ndash;32. http://dx.doi.org/10.1016/j.molcatb.2010.03.008.\u003c/li\u003e\n\u003cli\u003eSafdar Ayesha, Fatima Ismail, Muhammad Imran. 2023. Characterization of Detergent-Compatible Lipases from \u003cem\u003eCandida albicans\u003c/em\u003e and \u003cem\u003eAcremonium sclerotigenum\u003c/em\u003e under Solid-State Fermentation. ACS Omega 8(36): 32740\u0026ndash;51.\u003c/li\u003e\n\u003cli\u003eSalgado, Cleonice Aparecida, Fran\u0026ccedil;ois Baglini\u0026egrave;re, Maria Cristina Dantas Vanetti. 2020. Spoilage Potential of a Heat-Stable Lipase Produced by \u003cem\u003eSerratia liquefaciens \u003c/em\u003eIsolated from Cold Raw Milk. Food Sci. Technol. 126(September 2019): 109289. https://doi.org/10.1016/j.lwt.2020.109289.\u003c/li\u003e\n\u003cli\u003eSalwoom, Leelatulasi et al. 2019. Isolation, Characterisation, and Lipase Production of a Cold-Adapted Bacterial Strain \u003cem\u003ePseudomonas Sp\u003c/em\u003e. LSK25 Isolated from Signy Island, Antarctica. mol.\u003cem\u003e \u003c/em\u003e24(4): 1\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003evan Schie, Morten M.C.H. et al. 2021. Applied Biocatalysis beyond Just Buffers - From Aqueous to Unconventional Media. Options and Guidelines. Green Chem\u003cem\u003e.\u003c/em\u003e 23(9): 3191\u0026ndash;3206.\u003c/li\u003e\n\u003cli\u003eSharma Pushpinder, Nivedita Sharma, Shruti Pathania, Shweta Handa. 2017. Purification and Characterization of Lipase by \u003cem\u003eBacillus methylotrophicus\u003c/em\u003e PS3 under Submerged Fermentation and Its Application in Detergent Industry. J. Genet. Eng. \u0026amp; Biotechnol. 15(2): 369\u0026ndash;77. https://doi.org/10.1016/j.jgeb.2017.06.007.\u003c/li\u003e\n\u003cli\u003eSong, C. et al. 2017. Characterization of a Novel Thermo-Stable Lipase from Endophyte \u003cem\u003ePseudomonas putida \u003c/em\u003ein Pistacia Chinensis Bunge. Appl. Biochem. Microbiol\u003cem\u003e. \u003c/em\u003e53(5): 524\u0026ndash;32.\u003c/li\u003e\n\u003cli\u003eSugihara, Akio et al. 1992. Purification and Characterization of a Novel Thermostable Lipase from \u003cem\u003ePseudomonas cepacia. \u003c/em\u003eJ. Biochem. 112(5): 598\u0026ndash;603.\u003c/li\u003e\n\u003cli\u003eYang, Ruihuan et al. 2023. The Natural Pyrazolotriazine Pseudoiodinine from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e 923 Inhibits Plant Bacterial and Fungal Pathogens. Nat. Commun. 14(1): 1\u0026ndash;16.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Pseudomonas mosselii, stable lipase, optimization, characterization, hydrolysis, detergent","lastPublishedDoi":"10.21203/rs.3.rs-3972296/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3972296/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLipase enzyme plays a major role in several industrial processes. The effective production of lipase enzyme from microorganism in a cost-effective manner is in great demand in the current scenario. This study has aimed in producing an effective and high active stable lipase enzyme from \u003cem\u003ePseudomonas mosselii\u003c/em\u003e isolated from the highly polluted cooum river bed soil, Chennai, Tamil Nadu, India. The enzyme showed the high specific activity of 157.94 U/mg. Further optimization studies which include, pH (6.5-7) 110.298 U/ml, temperature (35\u0026deg;C \u0026ndash; 40\u0026deg;C) 112.388 U/ml, incubation time (36 hrs) 119.79 U/ml, effective substrate olive oil (1%) 118.05 U/ml and nitrogen source (Peptone 1.5% (w/v)), 150.74 U/ml enhanced the parameters to be considered for the high production of lipase enzyme. The purification process carried out in this study was ammonium sulphate precipitation, dialysis and column chromatography using Sephadex G-100 as a stationary phase. The characterization studies of partially purified lipase enzymes with parameters enhanced the stability study as follows: pH (6\u0026ndash;8), temperature (30\u0026deg;C to 50\u0026deg;C), metal ions (Ca\u003csup\u003e2+\u003c/sup\u003e) and detergent (Tween 80). The hydrolysis of the waste tallow using the produced lipase showed highest reaction ratio of 83.7% after 72 hrs at 50\u0026deg;C, 82.6% at 40\u0026deg;C and 81.2% at 30\u0026deg;C. The detergent compatible test confirmed that the lipase was compactible with the detergent and the stains were removed efficiently. Thus, this lipase may effectively serve as the feedstock for biodiesel production and as a detergent compactible application.\u003c/p\u003e","manuscriptTitle":"Characterization of an efficient waste fat hydrolysing and detergent compactible lipase from newly isolated Pseudomonas mosselii","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-06 09:23:03","doi":"10.21203/rs.3.rs-3972296/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"913b0221-0352-4278-8867-e3c21ceb604a","owner":[],"postedDate":"March 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-23T17:56:01+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-06 09:23:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3972296","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3972296","identity":"rs-3972296","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.