Caerin 1.9-polycaprolactone-coated magnesium implants enhance antibacterial performance and reduce foreign body responses in Sprague-Dawley rats

Caerin 1.9-polycaprolactone-coated magnesium implants enhance antibacterial performance and reduce foreign body responses in Sprague-Dawley rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Caerin 1.9-polycaprolactone-coated magnesium implants enhance antibacterial performance and reduce foreign body responses in Sprague-Dawley rats Xiaosong Liu, Guoying Ni, Guoqiang Chen, Xiaohong He, Pingping Zhang, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4220574/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Magnesium (Mg) alloys show outstanding promise for development of degradable implants for hard tissue engineering. However, rapid corrosion and associated reductions in mechanical properties has limited their clinical application. Furthermore, bacterial infections remain an ongoing challenge for implants. Previously, we established that the magnesium alloy, AZ31(Mg-3%Al-1%Zn-0.4%Mn) in a fully annealed form, exhibits improved biocompatibility and corrosion resistance over both pure Mg and cold-extruded AZ31. Multi-omics analyses of tissues of Sprague-Dawley (SD) rats revealed that annealed AZ31 does not significantly activate inflammation and immune responses, while it enhanced signalling in tissue cell proliferation associated pathways. Furthermore, we employed coatings incorporating the host defence peptide (CHDP), caerin 1.9 (abbreviated as F3) into a biocompatible polymer, polycaprolactone (PCL), to develop functional 3-dimensional surface coating to improve biocompatibility and antibacterial performance of the Mg alloy materials. In this study, we have assessed the responses from MC3T3-E1 cells cultured with the Mg alloys to further understand cellular responses. The annealed AZ31 alloy stimulated proliferation of mice osteoblast precursor cells and caused upregulation in expression of Brpf1 protein and other signalling pathways related to bone mineralization and haemostasis, which promote bone tissue formation. The coated and annealed AZ31 alloy (F3-PCL-3A) demonstrated exceptional biocompatibility, causing no adverse effects on hepatic or renal function, and displaying no observable changes in vital organs three months after implantation in SD rats. F3-PCL-3A displayed long-lasting and stable antibacterial properties both in vitro and in vivo . Proteomics and metabolomics analyses of tissues in direct-contact with implants revealed that F3-PCL-3A did not activate inflammation or immune-associated signalling pathways in SD rats 3 months post-implantation. Meanwhile, it activated inflammatory responses, especially phagocytosis pathways up to 72 hours post implantation, indicating enhanced antibacterial capability during the acute stage after implantation. In summary, F3-PCL-3A shows outstanding promise for degradable implants with active antibacterial capabilities for internal fixation and fracture repair. Materials Engineering Biomedical Engineering Analytical Biochemistry Biocompatibility antibacterial behaviour mitochondrial membrane potential proteomics metabolomics foreign body reaction immune system response Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Globally, populations are aging, presenting significant challenges to healthcare systems worldwide. Among the pressing issues associated with aging are fractures resulting from accidents and osteoporosis, particularly affecting the elderly [ 1 ]. Studies reveal that around half of women and one-fifth of men aged fifty and above have encountered at least one fracture [ 2 – 5 ]. Conventional bone internal fixation materials, such as titanium and stainless-steel alloys, exhibit notable differences in mechanical and physical properties compared to human bone tissue with negative impacts on biocompatibility. Particularly, notable differences in elastic moduli causes 'stress shielding' around the implant leading to failure [ 6 , 7 ]. Additionally, local release of metal ions elevates pH levels and increases risk of infection or inflammatory reactions [ 8 , 9 ]. Conversely, polymer implant materials face limitations due to their inferior mechanical properties [ 10 ]. Whether used as used as permanent or temporary implants, these materials often necessitate multiple surgeries, leading to unfavourable hospital experiences and financial burdens for patients [ 3 ]. Thus, there is a growing demand for materials with better biocompatibility for internal fixation, repair, and replacement of bone tissue. Among them, degradable metals-based biomaterials with compositions based on nutritionally essential trace elements (Mg, Fe, and Zn) are receiving substantial attention as they can provide necessary mechanical support and then degrade naturally with outstanding biocompatibility [ 11 ]. Orthopaedic applications impose stringent requirements on implants, encompassing mechanical and corrosion properties. These criteria include excellent mechanical strength (elastic modulus: 10–20 GPa), osseointegration capability, and outstanding wear and corrosion resistance and/or degradation products which are well-tolerated in the human body. Magnesium (Mg) is emerging as a promising solution as it possesses a density and modulus akin to human bones [ 12 – 14 ]. Mg and its alloys provide high specific strength and the appropriate stiffness needed for hard tissue implants [ 15 ]. Moreover, Mg is essential for human health, playing a pivotal role in numerous physiological processes. Adults typically intake Mg 2+ daily in the range of 240–420 mg, significantly surpassing intakes of other beneficial elements such as Fe 3+ (8–18 mg) and Zn 2+ (8–11 mg) [ 16 , 17 ]. Over 60% of Mg in the human body is stored in the bones and muscles, totalling around 30g [ 18 , 19 ]. Mg participates in various metabolic processes, including protein synthesis, enzyme activation, regulation of the central nervous system, muscle function, and the operation of vital organs like the intestines and stomach. Additionally, Mg engages in physiological activities like calcium antagonism [ 20 ] and serves as a signal transmitter [ 21 ]. Despite its advantageous properties, the rapid degradation of Mg alloys in the human body has limited their clinical use. Consequently, various approaches have been employed to enhance the corrosion resistance of Mg alloys. These techniques encompass alloying [ 3 , 22 – 26 ], processing and surface modification [ 3 , 27 – 31 ], as well as the application of protective coatings [ 3 , 32 – 36 ]. Another significant issue adversely affecting the usage of metal-based implant materials is periprosthetic infection (PPI), resulting from bacterial accumulation, colonisation, and biofilm formation [ 3 , 33 , 37 , and 38 ]. Clinical treatments for PPI involve antimicrobial therapies, surgical interventions; implant removal and replacement, all of which necessitate periods of post-operative recovery. This often leads to physical and mental discomfort for patients, along with unexpected expenses [ 39 , 40 ]. Recent studies have revealed that pure Mg exhibits antibacterial behaviours in both in vitro and in vivo settings [ 14 ]. However, its rapid degradation can lead to adverse physiological effects, including alkalosis, local inflammation, and cell death [ 33 ]. Consequently, Mg alloys in conjunction with surface engineering which provides slower degradation rates and enhanced antibacterial properties is required for further development of degradable Mg alloy-based biomaterials. Previously, the authors have reported on polymer-based coatings to improve corrosion resistance and biocompatibility of Mg alloys, and through incorporation of a natural host-defence peptide within the coating, exhibit outstanding antibacterial behaviours [ 3 ]. Cationic host defence peptides (CHDP), also known as antimicrobial peptides, can play a crucial role in infection control through direct micro-biocidal effects and/or by modulating host immune responses, while exhibiting the capacity to the limit heightened inflammation [ 41 , 42 ]. Widely expressed across various species, ranging from microorganisms, plants and invertebrates to more complex amphibians and mammals, CHDP are typically amphipathic small peptides with no more than 50 amino acids and a net positive charge of + 2 to + 9 at physiological pH [ 41 ]. An example of CHDP is caerin 1.9 (F3), derived from the Australian tree frog of the genus Litoria [ 43 , 44 ]. In our previous study, we immobilised F3 on surfaces of differently treated Mg alloys through a chemical click reaction. The F3-coated fully annealed Mg AZ31 significantly improved corrosion resistance and demonstrated up to 120 hours of bacterial resistance in vitro [ 3 ]. The fully annealed microstructure of AZ31 seems to offer an optimised substrate for the immobilisation of the peptide and displayed enhanced corrosion resistance both in vitro and in vivo [ 3 , 4 ]. In addition, FA AZ31 activated signalling pathways that promote tissue repair, while reducing inflammation and immune responses [ 4 ]. In this study, aimed at enhancing antibacterial properties of Mg alloy biomaterials, we designed a three-dimensional (3D) coating utilising polycaprolactone (PCL) and F3 on the surfaces of three types of Mg specimens, including pure Mg (2P), cold-extruded AZ31 (1E) and FA AZ31 (3A). Our investigation delved into the in vitro and in vivo behaviours of these coated Mg specimens, involving the introduction of methicillin-resistant Staphylococcus aureus (MRSA) at the implantation sites in a rat model. The results revealed that all coated Mg specimens displayed improved corrosion resistance, significant antibacterial efficacy in both in vitro and in vivo contexts, and heightened biocompatibility concerning impacts on selected vital organs and foreign body reactions. Of particular note, was the outstanding in vivo performance observed with the PCL and F3-coated 3A condition which demonstrated enhanced activation of immune responses during the acute phase (within three days after implantation) of bacterial infection and optimal biocompatibility over the chronic phase (within three months after implantation) in a rat model. The findings indicate that the PCL-F3-coated 3A (referred to as 3A-PCL-F3) holds significant promise for application as a degradable biomaterial for medical implants. 2. Materials and methods 2.1 Mg alloys and specimen preparation Three different Mg alloys were used in this study, including 1E, 2P, and 3A. The 3A samples underwent a full recrystallisation annealing heat treatment, as described previously [ 3 , 4 ]. In brief, they were heated to 330–350 o C in argon, held for 3–5 h, and then furnace cooled. The specimens were fabricated as small pins with a thickness of 5mm and thickness of 2 mm. In addition, samples of conventional medical Ti and 316L stainless steel with a similar size were also included in the study for comparison to the Mg alloys. Before the in vitro and in vivo experiments, the alloy samples were polished. They were initially treated with 400-grit silicon carbide paper for 1–3 min to remove the original oxide layer. Then, they were polished by 800–2400 grit silicon carbide paper for 2–5 min to improve the sample surface qualities and achieve uniform roughness. After each step of polishing and grinding, the specimens were rotated by 90° to ensure that the subsequent procedures removed the scratches generated in the previous step. Finally, all samples were cleaned in 70% ethanol at room temperature for 5 min using ultrasonics. 2.2 Peptide synthesis Caerin 1.9 (F3) (GLFGVLGSIAKHVLPHVVPVIAEKL-NH 2 ) were synthesized by ChinaPeptides Co., LTD (Shanghai, China). The purity of the peptides exceeded 99% as determined by ChinaPeptides Co., LTD using reverse-phase HPLC [ 3 ]. 2.3 Cell lines and osteoblast adhesion test MC3T3-E1 cells were procured from the cell resource centre of Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences. MC3T3-E1 osteoblasts were seeded into a 6-well plate with 1.0×10 6 cells and 2 ml culture medium per well. All the specimens were divided into 4 groups: one group is untreated, three other groups are Ti, 316L, and 3A respectively. Three metal specimens were placed into six-well plates according to group-set and cultured together for 48 h. After 48 h, the supernatant was collected completely, then 300 µl of trypsin was added, and the solution was placed in a cell culture incubator to digest the metal-treated MC3T3-E1 cells for 2 min. After 2 min, the cells were taken out, then observed under a microscope for the analysis of cells’ digestion, and photos were taken. The undigested MC3T3-E1 cells were placed in the incubator to continue the digestion until the cells were fully digested. 2.4 EBSD mapping Electron backscatter diffraction (EBSD) mapping of the Mg alloy microstructures was performed at the Institute of Industrial Sciences of the University of Tokyo using a JOEL JSM-7100F field emission gun scanning electron microscope. The EBSD scanning was carried out with an accelerating voltage of 15 kV and a scanning step size of 0.5 µm. Further details on the EBSD sample preparation method can be found in references [ 4 , 45 ]. The EBSD mapping position were as follows: ED/RD refers to the extrusion/rolling direction, TD is the transverse direction, and ND is the normal direction. The analysis of the EBSD mapping results was conducted using orientation-imaging microscopy (OIM) V7.0. 2.5 Micro hardness test Micro hardness tests were performed on the round specimens (diameter is 5mm, and thickness is 2 mm) with a roughness of 800 using an HMV-G micro-Vickers hardness tester at the Institute of Industrial Sciences (IIS) of the University of Tokyo, applying a load of HV0.01 (98.07mN) [ 3 , 4 ]. 2.6 Uniaxial tensile test Uniaxial tensile tests were performed using a 100 KN Shimadzu universal material testing machine at the University of the Sunshine Coast. The Mg sample had the following dimensions: an engaged length of 30 mm, an overall length of 110 mm, and a rod diameter of 5 mm. 2.7 Physical 3D coating of PCL and caerin peptide F3 The samples prepared following section 2.1 were inactivated by exposing to UV light for 30 min prior to the coating process (Fig. 1 A). Biocompatible polycaprolactone (PCL) was chosen as the coating material for the metal surface. PCL pellets were dissolved in 10 ml pure chloroform to a ratio of 2% W/V, and then 45 mg F3 was added to the chloroform-PCL solution, followed by thorough vortex mixing at room temperature for approximately 2 h until a homogeneous solution was achieved. The metal samples were immersed in the solution and air-dried in a fume hood for 10 min. This step was repeated four more times. Figures 1 B and 1 C provide visual representations of the Mg alloy samples with F3 coating. 2.8 FTIR tests IR spectra was obtained on a Spectrum Two FT-IR spectrometer (Perkin-Elmer, Waltham, MA) at room temperature, with the scan wavelength 4000–5500 cm − 1 . As a comparison, the IR spectra of PCL-coating (without peptide immobilisation) and PCL-F3 coating were also measured. 2.9 Water contact angles test Water contact angle measurements were conducted using a drop shape analysing by dropping with pure water to evaluate the hydrophilicity of the different titanium surfaces [ 30 ]. 2.10 Mitochondrial membrane potential (ΔΨm) assay Two devices were employed to analyse the mitochondrial membrane potential, including laser scanning confocal microscope and flow cytometer. The related methods are described as follows: The analysis of mitochondrial membrane potential with a laser scanning confocal microscope ΔΨm was detected using the JC-1 MOMP detection kit (Biosharp). MC3T3-E1 cells, a MC3T3-E1 Subclone 14 cell line (Mouse cranial parietal pre-cell subclonal 14), were seeded in a 24-well plate (5.0×10 5 cells per well in 0.5 ml DMEM medium). Three groups of Mg specimens were selected: 1E, 2P, and 3A. The sizes of three groups of specimens are all the same: length is 2.15 mm; width is 0.6 mm, 3 specimens in each group. These three groups of Mg specimens were employed to stimulate cells at 37 °C overnight. After removing the Mg specimens and the culture medium, the cells with PBS were washed once, then 500 µl of cell culture medium (excluding double antibodies), and 500 µl of 1× JC-1 dyeing working solution were added and until the three solutions were mixed evenly. The evenly mixed solution was incubated at 37°C in a cell incubator for 30 minutes. After incubation, the supernatant was removed and 1× JC-1 staining buffer was used to wash twice, and the remaining solution was immediately analysed by using a Laser confocal microscope (Leica). Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as a positive control. The analysis of mitochondrial membrane potential with a flow cytometer MC3T3-E1 cells, a MC3T3-E1 Subclone 14 cell line (Mouse cranial parietal pre-cell subclonal 14), were seeded in a 24-well plate (5.0×10 5 cells per well in 0.5 ml DMEM medium). 1E, 2P, and 3A specimens were used, with a length of 2.15 mm and a width of 0.6 mm. They were co-cultured with the cells at 37 °C overnight and removed, and the cells were washed once with PBS. Then, 500 µl of cell culture medium (excluding double antibodies) and 500 µl of 1 × JC-1 dyeing working solution were added, and the mixture was incubated at 37 °C for 30 min. The supernatant was removed, and the cells were washed by using 1×JC-1 staining buffer, followed by the addition of 200 µl trypsin solution and incubation for 1.5 min. The digestion was terminated by using 400 µl of double antibody-free culture medium, with the cells transferred into Eppendorf tubes and centrifuged with 1,200 rpm for 5 min at 4 °C. The supernatant was discarded, and the cells were washed twice with 1×JC-1 staining buffer and resuspended in 300 µl of wash buffer. Quantitative analysis was conducted by a flow cytometry (BD FACSAria): FITC indicates green fluorescence, PI indicates red fluorescence, and PI/FITC is the level of MOMP depolarisation. 2.11 Invitro antibacterial tests The invitro antibacterial tests were conducted by following our previous method [ 3 ]. After 3–5 min ultrasonic cleaning in the distilled water, all F3 and PCL coated Mg alloys samples (1E-PCL-F3, 2P–PCL-F3 and 3A–PCL-F3) were put into a bacteriostatic petri dish to conduct a 100-hr bacteriostatic test on drug-resistant S. aureus in a 37°C temperature incubator. The methicillin-resistant S. aureus (MRSA, GDM1.1263) were cultured to a logarithmic phase and adjust the suspension concentration of MH (Mueller-Hinton) medium to 2.0 × 105 CFU/ml. A sterile cotton swab was used to dip the bacteria solution and squeeze the tube wall several times to remove the excess. The swab was used to smear the entire M-H drug-sensitive agar plate (Guangzhou Yuanming Bio Company). Aliquots of 30 µg of F1 and F3 peptides were added drug-sensitive papers (OXOID, UK) and the papers were pasted on M-H agar plates. The plates were inverted and incubated at 37°C overnight. A volume of 30 µg piperacillin sodium and tazobactam sodium with a weight ratio of 8:1 (Tazocin, Haikou Qili Pharmaceutical Co., Ltd, Haikou) and blank drug-sensitive tablets (BASD, Thermo Fisher Scientific, Shanghai) and two original AZ31 Mg alloys were used as controls. A Vernier calliper was used to measure the size of the zone of inhibition. 2.12 MTT tests MC3T3-E1 cells were seeded in 96-well plates (1.0×104 cells per well, 0.1 ml medium) overnight and divided into 4 groups, which were control group, 1E, 2P, and 3A metal material groups. On the second day, three kinds of metal materials, 1E, 2P and 3A, were added to the 96-well plates respectively, cultured in the incubator for 24 hours, and the metal materials were removed. 5 mg/mL of 20µl MTT was added to each well and incubated in a 5% CO2 incubator at 37℃ for 4 h. The culture medium was removed, 150 ul DMSO was added, and OD value of 490 nm absorbance was measured by Microplate Reader (Thermo). 2.13 Real time PCR tests 2.13.1 RNA Isolation After co-culturing osteoblasts with metals 3A, 316L, and Ti for 48 hours, the metals were removed. The cells were then treated with trypsin, followed by centrifugation at 1200 rpm for 5 minutes. RNA from the osteoblasts was extracted using the Trizol method. The quality and concentration of the isolated RNA samples were evaluated using a micro-UV-Vis spectrophotometer (AmoyDxNanoDrop 2000c, Xiamen, China). 2.13.2 Quantitative PCR (qPCR) The expression of BRF1, Ctnna1, and KAT6A genes in osteoblasts was detected using the qPCR method. A β-actin-specific primer was used as an internal control. The sequences of the gene primers used for amplification are listed in Table 1 . cDNA was synthesized from 1µg RNA using the PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time). qPCR was performed according to the instructions of the TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa RR820A). The instrument used was the Roche LC480 from Roche Diagnostics, Switzerland. The thermal cycling conditions were set as follows: initial denaturation at 95°C for 30 seconds, followed by 40 cycles of PCR reaction: 95°C for 5 seconds, 60°C for 20 seconds; and a dissociation curve analysis: 95°C for 5 seconds, 60°C for 1 minute, and 95°C for 0 seconds. Each qPCR was conducted in triplicate. Table 1 Nucleotide sequences of the primers used for quantitative PCR analysis Primer Primer sequence (5′−3′) β-actin Forward TATAAAACCCGGCGGCGCA Reverse GTCATCCATGGCGAACTGGTG BRF1_1 Forward CCACTCTTTCCCCAAGAGAAT Reverse GAGGAACAGAACTGTGTTTTGATGT BRF1_2 Forward ATGGTGGGACGAGGATACCTA Reverse GCTGCAAATTCTCTTGGGGAA Ctnna1 Forward CAGTTCGCTGCAGAAATGAC Reverse CCTGTGTAACAAGAGGCTCCA KAT6A Forward ATGGTAAAACTCGCTAACCCG Reverse CGTCCCGTCTTTGACGCTC 2.14 In vivo tests 2.14.1 Rats Six to eight weeks old Sprague Dawley (SD) rats were procured from the Animal Resource Centre of Guangdong Province. The rats were housed at the Animal Facility of the Foshan First People’s Hospital in Guangdong, China. All experimental procedures were approved and conducted in accordance with the guidelines of Animal Experimentation Ethics Committee (Ethics Approval Number: C202307-5) by the Foshan First People’s Hospital, the University of the Sunshine Coast’s Animal Ethics Committee (Ethics Approval Number: ANE23105). The rats were maintained in Specific-Pathogen-Free (SPF) conditions on a 12 h light/dark cycle at 22°C with 75% humidity. Each rat was individually housed in a cage and provided with sterilised standard mouse food and water. At the conclusion of each experiment, rats were euthanised by CO 2 inhalation, confirmed by the cessation of breath and heart function [ 4 , 37 ]. 2.14.2 Metal implants in rat femur The ultrasonically cleaned specimens were exposed to UV radiation for 30 min on each side for sterilisation [ 3 , 46 ]. The implantation was conducted in the animal house of Foshan First People’s Hospital. Twelve 8-week-old male SPF SD Rats were weighed at 266.646g. Rats were randomly divided into four groups, including control (no implants), 1E, 2P and 3A groups. Rats were anesthetised by intraperitoneal ( i.p.) injection of 1% sodium pentobarbital solution with a dose of 40 mg/kg. A sterile blade was used to cut about 1cm perpendicular to the femoral shaft, then the subcutaneous tissue and muscle were separated until the femoral condyle of the rats was exposed. A grinding drill was used to drill a hole located at the lateral condyle of the rats' femur perpendicular to the longitudinal axis of the femur [ 4 ]. The control group was not embedded with any implant after drilling. The incision was sutured layer by layer with 4 − 0 absorbable sutures. 2.14.3 Degradation and biocompatibility of implants After 9 days of implantation, the rats were anesthetised via intraperitoneal injection of 1% sodium pentobarbital at the dose of 40 mg/kg. Peripheral blood samples were collected by eye bleeding for the investigation of serum electrolyte, liver, and kidney function. Following the blood collection, the rats were euthanised. The implants were removed from the femoral condyle, cleaned, dried and disinfected. After complete removal of attached soft tissue was completely removed, the implants were photographed to evaluate the degree of degradation. The organ tissues (including heart, liver, spleen, lung, kidney, brain, ovary, etc.) were collected and fixed with 10% formalin for hematoxylin-eosin (HE) staining. Furthermore, other several groups’ tests last about 3 months. Post 3 months, the same tests including degradation and biocompatibility will be repeated. 2.14.4 SEM-EDS analysis Mg alloy specimens were removed from the SD rats after 9 days of implantation, then cleaned ultrasonically with 70% ethanol and rinsed in distilled water for 3–5 minutes. SEM-EDS analysis was conducted on Zeiss Sigma 300 Field Emission Electron Gun (FEG)-Scanning Electron Microscopy (SEM) with the following parameters: EHT is 3.00 KV, WD is 5.4 and Mag is 100×. 2.14.5 Computerised tomography imaging Three-dimensional computerised tomography (3D CT) scans were conducted at the First People’s Hospital of Foshan. A clinical 64 slices CT system, specifically the GE Discovery 64 model from GE Healthcare (Waukehsa, USA), was utilised. All 3D CT imaging was performed while the rats were under an anaesthesia [ 47 ]. For detailed CT methods, please refer to the Supplementary Methods. 2.14.6 Cytokine ELISA Cytokine ELISA for rat sera, targeting TNFα, IL-10, MCP-1 and IL-1β, was conducted using kits obtained from R&D system (Minneapolis, USA). The assays were performed following the manufacturer’s protocol provided. 2.15 Proteomics analysis Protein sample preparation Either MC3T3-E1 cells collected from the co-culture with Mg specimen or mouse tissue samples were homogenised in SDT buffer (4%SDS, 100mM Tris-HCl, 1mM DTT, pH7.6), and 200 µg of proteins for each sample were subjected to trypsin digestion according to the filter-aided sample preparation (FASP) procedure described elsewhere [ 48 , 49 ]. The protein suspensions were digested with trypsin (Promega) overnight at 37°C, and the resulting peptides were desalted on C18 Cartridges (Empore™ SPE Cartridges C18, bed I.D. 7 mm, volume 3 ml, Sigma), and lyophilised by vacuum centrifugation for TMT10plex labelling. A total of 100 µg peptide mixture of each sample was labelled using TMT reagent according to the manufacturer’s instructions (Thermo Scientific). Labelled peptides were fractionated by SCX chromatography using an AKTA Purifier system (GE Healthcare). The collected fractions were desalted on C18 Cartridges, lyophilised and resuspended for LC-MS/MS analysis (see Supplementary Methods for more details). nanoLC tandem Q-Exactive MS/MS analyses The peptide samples were analysed using a Q Exactive mass spectrometer coupled to Easy nLC (Thermo Scientific) following the method detailed previously. In brief, the peptides were loaded onto a reverse phase trap column (Thermo Scientific Acclaim PepMap100, 100 µm×2 cm, nanoViper C18) connected to the C18-reversed phase analytical column (Thermo Scientific Easy Column, 10 cm long, 75 µm inner diameter, 3µm resin) in buffer A (0.1% Formic acid) and separated with a linear gradient of buffer B (84% acetonitrile and 0.1% Formic acid) at a flow rate of 300 nl/min. The mass spectrometer was operated in positive ion mode. MS data was acquired using a data-dependent top10 method dynamically selecting the most abundant precursor ions from the survey scan (300–1800 m/z) for HCD fragmentation. Protein identification and quantitation The MS/MS data was searched against Ensembl_Rattus_29107_20200311 (76,417 sequences, downloaded on Dec 12, 2014) database for protein identification using Mascot2.2 (Matrix Science, London, UK) and Proteome Discoverer1.4 software (Thermo Fisher Scientific, Waltham, MA, USA) with the following search settings: enzyme trypsin; two missed cleavage sites; precursor mass tolerance 20 ppm; fragment mass tolerance 0.1 Da; fixed modifications: Carbamidomethyl (C), TMT 10plex (N-term), TMT10 plex (K); variable modifications: oxidation (M), TMT 10plex (Y). The results of the search were further submitted to generate the final report using a cut-off of 1% FDR on peptide levels and only unique peptides were used for protein quantitation. All peptide ratios were normalised by the median protein ratio, and the median protein ratio was 1 after the normalisation. The significance of protein contents was statistically analysed using the student’s t -test. The protein showing a fold change ≥ 1.2 compared to the control group and the P -value < 0.05 were considered significantly regulated. Gene ontology, domain and KEGG pathway analysis The protein sequences of differentially expressed proteins were locally searched using the NCBI BLAST + client software (Version. 2.2.28). Gene ontology (GO) terms were mapped, and sequences were annotated using OMICSBOX software ( https://www.biobam.com/omicsbox/ ). InterProScan software within OMICSBOX was used to identify protein domain signatures from the InterPro member database Pfam. Protein sequences were also compared with the online Kyoto Encyclopedia of Genes and Genomes (KEGG) database ( http://geneontology.org/ ) to retrieve their KEGG orthology identifications and map them to pathways in KEGG. Enrichment analysis was performed using the Fisher’s exact test, with the entire set of quantified proteins as background dataset. Benjamini-Hochberg correction for multiple testing was applied to adjust derived P -values. Only functional categories and pathways with P -value less than 0.05 were considered statistically significant. Protein-protein interaction analysis The protein–protein interaction (PPI) information for the studied proteins was obtained from IntAct molecular interaction database [ 50 ] ( http://www.ebi.ac.uk/intact/ ) using their gene symbols. Alternatively, STRING ( http://string-db.org/ ) was used for PPI retrieval. The obtained results were downloaded and visualised through Cytoscape software ( http://www.cytoscape.org/ , version 3.2.1). The statistical analysis of the PPI was conducted using the Network Analyser [ 51 , 52 ] in Cytoscape. 2.16 Metabolomics analysis Sample preparation and extraction The rat tissue samples stored at -80°C refrigerator was thawed on ice. The thawed sample was homogenised for 20 s using a grinder operating at 30 Hz. A 400 µl solution (methanol: water = 7:3, V/V) containing an internal standard was added in to 20 mg grinded sample, and shaken at 1,500 rpm for 5 min. After allowing it to on ice for 15 min, the sample was centrifuged at 12,000 rpm for 10 min at 4°C. A 300 µl portion of the supernatant was collected and placed in -20°C for 30 min. The sample was then centrifuged at 12,000 rpm for 3 min at 4°C. 200 µl aliquots of supernatant were transferred for LC-MS analysis. LC-ESI-MS/MS analysis The sample extracts were analysed using an LC-ESI-MS/MS system (UPLC, ExionLC AD; MS, QTRAP). The analytical conditions were as follows, UPLC: column, Waters ACQUITY UPLC HSS T3 C18 (1.8 µm, 2.1 mm × 100 mm); column temperature, 40°C; flow rate, 0.4 ml/min; injection volume, 2 µl; solvent system, water (0.1% formic acid): acetonitrile (0.1% formic acid); gradient program, 95:5 V/V at 0 min, 10:90 V/V at 11.0 min, 10:90 V/V at 12.0 min, 95:5 V/V at 12.1 min, 95:5 V/V at 14.0 min. LIT and triple quadrupole (QQQ) scans were acquired on a QTRAP® LC-MS/MS System, equipped with an ESI Turbo Ion-Spray interface, operating in positive and negative ion mode and controlled by Analyst 1.6.3 software. The ESI source operation parameters were as follows: source temperature 500°C; ion spray voltage (IS) 5500 V (positive), -4500 V (negative); ion source gas I (GSI), gas II (GSII), curtain gases (CUR) were set at 55, 60, and 25.0 psi, respectively; the collision gas (CAD) was high. Instrument tuning and mass calibration were performed with 10 and 100 µmol/L polypropylene glycol solutions in QQQ and LIT modes, respectively. A specific set of MRM transitions were monitored for each period according to the metabolites eluted within this period. Data analysis Unsupervised PCA (principal component analysis) was performed by statistics function “prcomp” within R ( www.r-project.org ). The data were scaled to unit variance before conducting unsupervised PCA. The results of HCA (hierarchical cluster analysis) for samples and metabolites were presented as heatmaps with dendrograms. Pearson correlation coefficients (PCC) between samples were calculated by the “cor” function in R and displayed as heatmaps. Both HCA and PCC calculations were carried out using the R package ComplexHeatmap. For HCA, normalised signal intensities of metabolites (unit variance scaling) are visualised as a colour spectrum. Significantly regulated metabolites between groups were determined based on the criteria of VIP ≥ 1 and an absolute Log2FC (fold change) ≥ 1. VIP values were extracted from OPLS-DA result, which also included score plots and permutation plot. The data was log-transform (log2) and mean-centred before OPLS-DA. To prevent overfitting, a permutation test (200 permutations) was performed. Identified metabolites were annotated using KEGG Compound database, and the annotated metabolites were subsequently mapped to KEGG Pathway database. Significantly, enriched pathways were identified using a hypergeometric test’s P -value for a given list of metabolites. 3. Results 3.1 Characteristics of Mg alloys The measured thicknesses of the three groups of specimens is presented in Fig. 2 A: 2P is thickest at 2.1mm; 2E and 3A have the similar thickness, with the values of 2.07mm and 2.05mm respectively. The microstructure and mechanical properties of 1E, 2P and 3A were firstly investigated. The average grain sizes were 22.2 µm for 2P, 9.2 µm for 1E and 15.9 µm for 3A (Fig. 2 B ) samples. The misorientation angles of 2P and 3A showed the same tendency, neighbouring grains exhibiting angles between 1 and 3 degrees, suggesting that the two annealed Mg alloy microstructures have similar characteristics (Fig. 2 C). Meanwhile the misorientation angle of 1E condition is significantly different from those of 2P and 3A with the misorientation angle exhibiting a value of one. Cold extrusion led to different textures and microstructure along the extrusion direction (extrusion axis), while 2P and 3A both have the homogenous textures and microstructures. 1E has the highest average micro hardness of 81.6 HV, 2P has the lowest average micro hardness with a value of 41.5 HV, while 3A has a micro hardness of 66.5 HV [ 3 , 4 ]. Uniaxial testing results for the different Mg samples are shown in Fig. 2 D. Among the three groups, 1E has the highest strength with a yield strength of 233.4 MPa, maximum ultimate uniaxial tensile strength of 316.1MPa, and breaking strength of 272.7MPa. 3A has the second highest strength with yield strength of 204.8MPa, maximum strength of 277.9MPa, and breaking strength of 245.2MPa. Finally, 2P has the lowest uniaxial tensile strength with yield strength of 136.2MPa, maximum strength of 185.7MPa, and breaking strength of 159.1MPa. Both 1E and 3A meet strength requirements compatible with human bone which typically has yield strengths of at least 130–180 MPa [ 52 ]. 3.2 Uncoated 3A stimulated proliferation of mouse osteoblast precursor cells In our previous study, we revealed that in a mouse model the 3A condition activated fewer inflammation-associated pathways compared to 1E and 2P. Additionally, 3A induced signalling for cell organization and development, suggesting potential benefits for the recovery of injured tissues. Here, we investigate the effects of these materials on mouse osteoblast precursor MC3T3-E1 cells to assess potential impacts on bone development and growth. Our proteomic analysis revealed that more differentially expressed proteins (DEPs) were present in the 2P group, followed by 3A (Fig. 3 A and Table S1 ). Seven upregulated DEPs were identified across all groups, including BRPF1 , NR2C1 , ACKR3 , SPP1 , PXDN , CEP131 , and TNFAIP8 (Fig. 3 B). Notably, BRPF1 (Bromodomain and PHD Finger Containing 1) showed significant upregulation with 70, 48, and 64-fold changes in the 1E, 2P, and 3A groups, respectively. Regarding canonical pathways associated with ‘cellular growth, proliferation and development’, ‘growth factor signalling’, and ‘organismal growth and development’, the highest number of these pathways was activated in the 3A group compared to the untreated group, while less than 50% of these pathways were activated in the 1E group (Fig. 3 C). Consequently, ‘binding of connective tissue cells’, ‘development of vasculature’ and ‘mineralization of bone’ were enhanced in 3A, while ‘bleeding’ was comparatively inhibited (Fig. 3 D). The proliferation of MC3T3-E1 cells was significantly enhanced, by approximately 16%, in the 3A condition relative to the untreated group, whereas no significant change was observed for 1E and 2P, nor in the medical Ti or 316L stainless steel groups (Fig. 3 E). Notably, 316L significantly inhibited growth of MC3T3-E1 cells. After 24 hours culture, a 2-minute trypsin digestion was not able to detach MC3T3-E1 cells from the plates in the 3A group, while a suspension of cells was observed in the other groups (Fig. 3 F). After 15 minutes of digestion, many cells remained attached to the culture plates in the 3A group, whereas no attachment was observed in the other groups. At the mRNA level, the expression of the two mouse Brpf1 isomers was significantly upregulated only in the 3A group, as was expression of Ctnna1 (Fig. 3 G). 3.3 Characterisation of coated Mg alloys The characteristics of Mg alloys with the F3 containing PCL coating were studied. All three coated metal sample groups had similar coating thickness averaging around 450 µm as shown in Fig. 4 A. However, the weights of the coatings were different among the three sample groups (Fig. 4 B ) . The 2P-PCL-F3 condition exhibited the highest coating weight with a value of 8.04 mg; 1E-PCL-F3 was next with a weight of about 6.53 mg and 3A-PCL-F3 had the lowest weight of 5.96 mg. The coatings changed the surface morphologies of the samples substantially. Before coating, 3A had a regular surface asperities and lower roughness as shown in Fig. 4 C. After coating, the surface of 3A in Fig. 4 D was significantly rougher, with Ra and Rq values increased from 22.8 nm to 42.4 nm and 31.1 nm to 66.7 nm, respectively. SEM analysis in Fig. 4 E showed that surface of the PCL-F3 coating developed in this work is as smooth as the PU-F3 coated surfaces in the prior study [ 3 ], but its distribution is uneven and exhibits a regular granular structure on the metal surface. Further, the EDX/S analyses in Fig. 4 F shows elemental distributions in the 3A-PCL-F3. The normal and transverse surfaces of coated samples had almost the same concentrations of nitrogen (4.98% and 4.96%, respectively), oxygen (19.36% and 19.67%, respectively) and carbon (62.2 and 60.17%, respectively). Therefore, it can be deduced that peptide distributions within the coatings were homogeneous and uniform across the surfaces. The results from FTIR analysis of the coated sample surfaces are shown in Figure S1 . At wavelengths around 1100 cm − 1 , the PCL signal is around 52%T, while for PCL-F3 it is more than 62%T. At a wavelength of 1150cm − 1 , the difference between the PCL and PC-F3 signals becomes more significant at around 28%T for PCL and 45%T for PCL-F3. At higher wavelengths (1750cm − 1 to 3300cm − 1 ) differences in the signals from PCL and PCL-F3 become less significant. Water contact angles were conducted before and after application of the coatings to assess hygroscopic properties. They revealed that 2P had the lowest water contact angle of around 55.6° before coating, while after application of the PCL + F3 coating this was reduced to 38.2° indicative of the highest hydrophilicity compared with the other alloy samples. Meanwhile 1E and 3A both had similar water contact angles before application of the coating of 76.1° and 77.5°, respectively, which were reduced after the coating to 58.5° and 55.3°, respectively. The results show that the coatings substantially enhance hydrophilicity of the Mg alloy on the metal surfaces (Fig. 4 G). 3.4 Coated Mg exhibited prolonged bactericidal effects, while in the acute phase the immune response was activated in all samples, except 3A The ability to counter MRSA related infection was assessed in vitro for both uncoated and coated Mg alloys, and the results were compared to those from the peptide, F3, which displayed bactericidal activity for up to 72 h. The uncoated alloys exhibited no discernible impacts on MRSA infection, while all three coated Mg alloys demonstrated prolonged bacterial resistance. Specifically, 1E-PCL-F3 exhibited bactericidal effects lasting up to 120 h, whereas 2P-PCL-F3 and 3A-PCL-F3 inhibited MRSA up to 168 h, with the latter showing a slower decline in efficacy over time. Figure 5 B shows the implantation sites, with 3A and 3A-PCL-F3 causing no significant inflammation during the acute stages. The numbers of MRSA isolated from tissues of similar weight collected during the acute phase were least in 3A-PCL-F3. Significant differences were observed between 3A-PCL-F3 and 1E-PCL-F3 consistent with the in vitro assay findings. Research has confirmed that F3 does not induce resistance to logarithmic P. aeruginosa and MRSA after 3 months culture, hence implantation of the PCL-F3 coated Mg samples is not expected to induce resistance to MRSA longer-term [ 27 ]. Compared to the non-infected control (NIC), 2P showed the highest number of upregulated DEPs, followed by 3A-PCL-F3 and 1E-PCL-F3, with a similar trend observed in comparison with the infected control (IC) ( Figure S2A and 5B , and Table S2 ). 2P and 3A-PCL-F3 shared higher numbers of mutual upregulated DEPs compared to the NIC and IC. In 3A-PCL-F3, a total of 756 proteins were significantly upregulated, and 138 proteins were down-regulated compared to 3A. Among them were many proteins associated with cell homeostasis and tissue growth including MTHFD1L , SPARC , ATL3 , TGFBI , and SEC61A1 (Fig. 5 C). Trend analyses identified four profiles with significance (P-value < 0.05). Profile 17 exhibited 646 proteins with similar quantitative features in the 1E, 1E-PCL-F3, 2P, and 3A-PCL-F3 ( Figure S2C ). This profile exhibited the enrichment of immune response-relevant biological processes with the lowest FDR values, such as 'response to stress,' 'defence response,' and 'immune system response' ( Figure S2D ). Several biological processes related to mitochondrial function were among the top GO terms enriched in 3A, while processes possibly supporting an antibacterial environment, such as 'phagocytosis' and 'receptor-mediated endocytosis,' were highly enriched in 3A-PCL-F3 (Fig. 5 D). The significant upregulation of AIF1 , TXNDC5 , MYO1G , ITGB2 , STXBP2 , VAMP8 , ITGAM , and ANXA1 supported the activation of 'phagocytosis' ( Figure S2E ) and 'cell activation involved in immune response' ( Figure S2F ), respectively. Assessment of activation of the signalling response pathways in all implant groups relative to the IC revealed a distinctive feature in 3A which showed significant suppression of pathways associated with T cell function. These included the signalling of IL-8, IL-15, IL-2, IL-4, CD28, and CCR3 (Fig. 5 E). Conversely, most of these showed increased activity in the other implant groups. Unique activation of the 'IL-12 signalling and production in macrophages' pathway was observed in 3A. Additionally, the upregulated DEPs supported significant activation of 'phagocytosis' specifically in 3A-PCL-F3 compared to the IC (Fig. 5 F). Furthermore, several other pathways potentially associated with bactericidal activity, such as 'immune response of myeloid cells', 'engulfment of myeloid cells', and 'migration of phagocytes', were also activated in 3A-PCL-F3 while 'bleeding' was significantly inhibited, suggesting potential favourable impacts on wound healing. 3.5 Uncoated and coated 3A showing better biocompatibility There were more significantly up- or down-regulated DEPs in 3A-PCL-F3 compared to 3A with respect to the NIC (Fig. 6 A and Table S3 ). However, the overlap of DEPs between these two groups was limited. Notably, the biological processes enriched in 3A-PCL-F3 encompassed a multitude of metabolic activities associated with mitochondrial function. These included processes such as the 'tricarboxylic acid cycle,' 'mitochondrial electron transport, cytochrome c to oxygen,' 'proton transmembrane transport,' and 'mitochondrial ATP synthesis coupled electron transport' ( Figure S4A ). In contrast, 3A exhibited enrichment in developmental processes, such as diaphragm, seminal vesical epithelium, and seminal vesicle development ( Figure S4B ). Many DEPs upregulated in 3A-PCL-F3 play pivotal roles in cell growth and tissue repair, such as FBLN2 , IGHM , CLEC3B , SUN1 , and COL5A2 ( Figure S4C ). Furthermore, upregulated DEPs exhibited extensive interactions. Notably, proteins like STAT3 , TUBB2B , ARF5 , SOD1 , and CANX displayed the highest connectivity. These proteins are mainly involved in regulating immune responses and cellular trafficking ( Figure S4D ). There were important differences in the cellular components associated with the proteins in the 3A and 3A-PCL-F3. Proteins identified in the former were primarily linked to mitochondrial components, whereas the latter displayed enrichment of proteins in the extracellular region (Fig. 6 B). The top six most significantly enriched biological processes in 3A-PCL-F3 were all closely tied to cell growth and development. These processes encompassed 'regulation of insulin-like growth factor transport', 'FAM20C phosphorylates FAM20C substrates', and 'haemostasis' (Fig. 6 C and Figure S4E ). Comparing immune response-relevant pathways at the chronic phase with those at the acute phase, a notable reduction in the degree of activation was observed in both 3A and 3A-PCL-F3, with respect to the NIC (Fig. 6 D). Only one pathway with a z-score > 2, granzyme A signalling, was activated in 3A-PCL-F3, while the 'neutrophil extracellular trap signalling pathway' was significantly and exceptionally suppressed. The extent of activation was substantially lower compared to the response at the acute phase when the implantation of 3A-PCL-F3 led to significant activation of immune responses. Blood samples from the 3A and 3A-PCL-F3 were used to evaluate IL10, TNFα, and IL-1β levels, which appeared similar and indicated no systemic inflammation in the various implant groups compared to the control (Fig. 6 E). Notably, no obvious pathological changes were detected in the tissues from the implantation sites, brain, heart, and ovaries, and tissues displayed normal morphological features (Fig. 6 F ) . 3.6 Muscle cell proliferation was induced in 3A in the acute phase of bacterial infection, while metabolism of cholesterol derivatives was enhanced during the chronic phase Extracted metabolites from tissues at the implant sites were subjected to LC-MS/MS analysis assessed with respect to the IC in the acute phase. Metabolites such as L-homocystine, Phe-Lys, and 2-hydroxy-2-(4-hydroxy-3-methoxyphenyl) acetic acid showed remarkable upregulation, while there was distinct downregulation of several prostaglandins associated with oxidative stress and inflammation was in 3A (Fig. 7 A). Significant regulation of multiple metabolic pathways was observed in the Mg alloy sample groups compared to the IC, with many more of them being suppressed than activated (Fig. 7 B). The pathway that saw the most deactivation across all implants was the 'salvage pathways of pyrimidine deoxyribonucleotides'. Likewise, the biosynthesis of uridine-5'-phosphate, catecholamine, citrulline, and 'histamine degradation'—essential pathways for DNA and RNA synthesis, neurotransmission, and the urea cycle—were also inhibited. Of note, the 3A-PCL-F3 group exhibited heightened activation of 'tRNA charging', 'cysteine biosynthesis', 'NAD biosynthesis II (from tryptophan)', and 'CMP-N-acetylneuraminate biosynthesis I', in comparison to the other implant groups. Particularly, the regulatory network supported the activation of 'proliferation of muscle cells', 'angiogenesis', while the suppression of 'toxicity of cells' and ‘nervous tissue cell death’ was only significantly identified in the 3A-PCL-F3 group (Fig. 7 C). Examining KEGG pathways, it was evident that 'steroid hormone biosynthesis', 'cortisol synthesis and secretion', and the aberrant production of glucocorticoids ('cushing syndrome') were enriched in 3A-PCL-F3 ( Figure S5A ). Four regulatory networks of significance were identified in 3A-PCL-F3 compared to the 3A group. Among these, the abnormal choline metabolism pathway was extensively regulated by six enzymes and two modules, interconnected by two differentially expressed metabolites (DEMs), namely cytidylic acid and citicoline ( Figure S5B ). The other three enriched networks involved conversion between [NAD(P)+] and NADPH, as well as C21-steroid hormone biosynthesis, utilizing the energy produced during the conversion of NADH to NAD+. We observed a more than ten-fold upregulation of 15 metabolites in 3A-PCL-F3 compared to 3A. Noteworthy among these were salicylaldehyde, 3-hydroxybenzoic acid, and methionine sulfoxide ( Figure S5C ). The upregulated differentially expressed metabolites (DEMs) from 12 classes displayed strong positive correlations, with many belonging to fatty acids and amino acid metabolites (Fig. 7 D). Conversely, downregulated DEMs exhibited significantly lower correlations with others and encompassed compounds like 4-carboxypyrazole, triethanolamine, cyclo (Tyr-Leu), and farnesylacetone. The biosynthesis of NAD, catecholamine, and arginine were activated in 3A-PCL-F3 compared to the control, surpassing regulation observed for 3A (Fig. 7 E). Important canonical pathways activated in 3A included 'histamine degradation,' 'purine nucleotides degradation II,' and 'CMP-N-acetylneuraminate biosynthesis I'. Interestingly, the sole immune response relevant signalling pathway activated in both 3A and 3A-PCL-F3 derived from the DEMs was the 'macrophage alternative activation signalling pathway' ( Table S4 ). An enrichment of KEGG pathways linked to cholesterol metabolism was identified in 3A-PCL-F3 relative to 3A such as 'steroid hormone biosynthesis,' 'cortisol synthesis,' and 'secretion and bile secretion' ( Figure S5D ), which accorded with activation of NAD biosynthesis. Consequently, this led to the identification of two closely regulated networks ( Figure S5E ). Six DEMs modulated ten enriched KEGG pathways relevant to steroid hormones and lipolysis, while eight DEMs were associated with amino acid and cholesterol metabolisms. 4. Discussion In this study, we characterised a series of Mg biomaterials (pure Mg, cold rolled AZ31, and fully annealed AZ31), both uncoated and coated with PCL incorporating Caerin F3 host-defence peptide. We investigated their in vitro and in vivo (in SD rats) antibacterial performance, as well as effects on tissues at the implantation sites, using proteomic and metabolomic analysis. Notably, among the different Mg alloy biomaterials investigated, 3A-PCL-F3 exhibited remarkable in vitro antibacterial effects which continued up to 144 h, potentially achieved through the activation of diverse inflammatory responses, especially phagocytosis activated in vivo during the acute phase. Furthermore, 3A-PCL-F3 also demonstrated superior biocompatibility, with limited immunoregulatory effects and enhanced NAD biosynthesis at 3 months post-implantation. Importantly, 3A promoted mouse osteoblast precursor cell MC3T3-E1 proliferation through upregulating expression of Brpf, a gene with the ability to promote bone formation. 4.1 3A effectively promoted proliferation of murine osteoblastic cells In previous research, quantitative proteomic analysis revealed that 3A activated pathways linked to wound healing and tissue development [ 4 ]. Building on this, our current study delves into the impacts of Mg alloy biomaterials on mouse osteoblast precursor MC3T3-E1 cells. Notably, BRPF1 was significantly upregulated in 3A, both in protein and mRNA levels, while medical grade Ti and 316L had no evident impact on transcription of this gene. BRPF1 is a crucial component of multiprotein complexes involved in histone acetylation, playing a pivotal role in gene expression regulation through chromatin remodelling [ 54 ]. It has been found that BRPF1 is important for murine neural stem cell development [ 55 , 56 ] and its deletion led to bone marrow failure [ 57 ]. Additionally, the inhibition of pan BRPF bromodomain suppresses transcriptional programs required for osteoclastogenesis, both in mice and humans, according to both experimental and bioinformatics based [ 58 ]. Thus, upregulation of BRPF1 suggests enhanced osteoclast differentiation was induced by 3A, which potentially supports bone tissue repair and remodelling in vivo . Upregulation of BRPF1 in 3A is reflected in the pronounced activation of signalling pathways related to 'binding of connective tissue cells,' 'development of vasculature,' and 'mineralization of bone,' alongside the deactivation of 'bleeding'. Compared to the other Mg alloys and commonly used metallic biomaterials (Ti and 316L), 3A significantly promoted MC3T3-E1 cell growth, as supported by MTT assay, and also promoted their adhesion properties, indicating potential alterations in expression of molecules related to adhesion and extracellular matrix (ECM) composition. The resistance to trypsin in MC3T3-E1 cells, capable of differentiating into osteoblasts [ 59 ], suggests that osteogenic differentiation was induced by 3A. In addition, osteoblasts interact closely with the ECM and can form multicellular structures [ 60 , 61 ], which may also hinder detachment. Moreover, two proteins, PDLIM4 and RINT1 , were present with relatively high abundance in 3A compared to 1E and 2P. PDLIM4 was suggested to play roles in the organisation of protein complexes and the regulation of cytoskeletal dynamics [ 62 ], while RINT1 is associated with DNA repair and genome maintenance [ 63 , 64 ]. Thus, 3A exhibits strong potential to promote osteocyte growth in vivo by orchestrating collective regulation of multiple proteins that support cell proliferation and tissue development. 4.2 3A did not stimulate inflammatory responses in the acute and chronic phases and coating with PCL-F3 did not significantly alter biocompatibility During the acute phase, after introduction of MRSA upon implantation, 3A demonstrated unique suppressive effects on signalling pathways associated with inflammatory responses. Proteomics revealed that only two immune response pathways were significantly activated, namely the 'neutrophil extracellular trap signalling pathway' and 'IL-12 signalling and production in macrophages'. This suggests distinctive immunomodulatory effects induced by 3A, leading to enhanced anti-inflammatory responses associated with immune tolerance and reduced tissue damage or foreign body reaction [ 65 , 66 ]. Distinctively, 3A induces fewer inflammatory responses after implantation compared with the other investigated alloys, 1E and 2P. 2P, being pure Mg, exhibits higher chemical reactivity, leading to an increased inflammatory response. However, despite 1E and 3A exhibiting similar chemical compositions and surface roughness, they induce substantially different inflammatory responses. Differences in surface texture may have a role with EBSD analysis revealing that 3A has a higher proportion of first-order pyramidal (10–11) {10–1–2} surface texture than 1E [ 4 ], which may induce different surface physiochemical properties including differences in surface energy and subsequently corrosion rates, surface interactions and bonding characteristics [ 3 ]. Other mechanical properties, such as strength and plasticity, may also impact host responses, warranting further investigation. The PCL-F3 coating empowered 3A with better antibacterial performance, evident in enhanced phagocytosis and other bactericidal process pathways. Of particular interest in 3A-PC-F3, the protein, TAP1 , showed the most significant upregulation. TAP1 plays a pivotal role in the immune system by transporting cytosolic peptides into the endoplasmic reticulum (ER), enabling MHC class I molecules to present these peptides on the cell surface for recognition by cytotoxic T cells [ 67 ]. It may work in conjunction with another highly upregulated protein, SEC61A1 , responsible for protein translocation into the ER lumen [ 68 ]. Similarly, CKAP4 , localised to the ER membrane, aids in protein trafficking [ 69 ], indicating its role in phagocytosis by facilitating the uptake of pathogens. At the metabolite level, tRNA charging and cysteine biosynthesis were significantly enhanced in 3A-PCL-F3 compared to the other materials, indicating an elevation in translation. In the chronic phase, immune response regulation pathways detected in 3A resembled that of tissue recovery without an implant, showcasing its outstanding biocompatibility. Signalling pathways in 3A-PCL-F3 were enriched in the extracellular region, whereas in 3A, enrichment was observed in mitochondria. The regulation of immune response signalling in both 3A and 3A-PC-F3 was minimal, although GZMA signalling remained activated in the latter group. This suggests that the degradation of PCL and F3 potentially contributed to cell-cell communication and adherence, whereas Mg 2+ predominantly influenced energy metabolism. Various types of PCL have been employed as scaffold materials to facilitate growth of cells and tissues and aid tissue regeneration [ 70 , 71 ]. Additionally, degradation of PCL was found to provide temporary support for tissue growth [ 72 ]. Therefore, the gradual degradation of PCL could potentially offer prolonged mechanical support in bone regeneration during the chronic phase of recovery. Of significance, most immune response pathways activated during the acute phase in 3A-PC-F3 diminished significantly at the chronic phase. Considering that GZMA is involved in various immune responses [ 73 ], particularly in eliminating infected or abnormal cells [ 74 ], the activation of GZMA signalling could potentially support extracellular matrix remodelling and tissue development. Furthermore, at the metabolite level, the enhanced biosynthesis of NAD in 3A-PC-F3 indicated increased energy production, which was reflected in elevated levels of various carnitines. This implies potential enhancement of cell and tissue development, indicating comprehensive biocompatibility for both 3A and 3A-PCL-F3. Collectively, it can be postulated that as the PCL-F3 coating degrades at the acute phase, it activates inflammatory signalling pathways and controls bacterial infection, while in the chronic phase the physical characteristics of 3A suppress foreign body reactions. 4.3 3A-PCL-F3 demonstrated better in vitro and in vivo antibacterial performance Various antibacterial mechanisms have been observed in coatings employing host-defence peptides, including the destruction of the bacterial membrane, blocking DNA replication, inhibiting ATP synthase, impeding cell respiration, and disrupting protein synthesis [ 72 ]. While many antibacterial coatings have demonstrated effective antibacterial properties against S. aureus [ 73 , 74 ] or E. coli [ 75 ], or both [ 76 , 77 ], there is a scarcity of research on the antibacterial abilities of magnesium coatings against stubborn drug-resistant bacteria. In this study, F3-PCL coating showed pronounced and enduring inhibitory effects on MRSA, both in vitro and in vivo , although the numbers of rats in each group are small. For in vitro tests, the antibacterial effects persisted for approximately 6 days (144 hours). Furthermore, after 73 hours of implantation, tissues collected from the implantation sites still inhibited MRSA. The sustained release of peptides from the coating is pivotal for the antibacterial efficacy. In a previous study [ 3 ], F3 peptide was immobilised on the surface of Mg alloys using click chemistry, which provides a two-dimensional polyurethane (PU) coating on the metal alloy surface (Fig. 8 A). In the current work, PCL was employed as the polymeric ‘scaffold’ to create a three-dimensional coating with F3 entrained within. The 2D coating covalently immobilises one terminus of the peptide to the alloy’s surface, while the 3D coating allows the peptides to reside within the coating layer on the surface of the alloy (Fig. 8 B). The in vitro antibacterial assessments confirmed enhanced antibacterial effects from the 3D coating which displayed a larger bacteria-free area and longer duration of action compared to the 2D coatings (Fig. 8 C) [ 3 ]. Theoretically, the 3D coating enables greater loading of the peptides. Moreover, for the 2D coating, once the peptides are consumed by either the physiological environment or the bacteria through enzymatic degradation, there is no capacity to supplement areas where peptides have been consumed, potentially reducing the overall efficacy. The intricate surface structure formed through the combination of PCL and F3 establishes a dense matrix. This matrix interacts with the peptides, restricting mobility and presenting a challenge for them to migrate from regions of high concentration to low concentration. Consequently, this results in a gradual, sustained release of the peptides from the coated surface. In addition, the combination of slow release and strengthened interaction inside the 3D coating facilitates F3 movement along concentration gradients, contributing to stable and continuous antibacterial effects which endured for almost seven days. The increased loading of the F3 peptide within the 3D coatings contributes to the sustained action. Further, research to understand the mode of action and optimise the coating’s performance are ongoing. 4.4 3A-PCL-F3 showed better biocompatibility Apart from antibacterial effects, corrosion resistance and biocompatibility are critical factors in the performance of the coatings. Reducing and limiting FBRs is an essential goal for any implants. Various technologies, such as thermal spraying [ 78 ], chemical conversion, and biomimetic approaches [ 79 , 80 ], have been employed to obtain protective antibacterial coatings. Common polymer-based antibacterial coatings include calcium phosphate-based coatings [ 72 ]. For polymer-based antibacterial coatings, biodegradable polyesters including polylactic acid (PLA), polyglycolic acid OK(PGA), polylactic acid-co-glycolic acid (PLGA), and their copolymers have demonstrated promising results (including antibacterial behaviours and biocompatibilities) when incorporating antibacterial elements onto Mg alloy coatings [ 81 – 84 ]. PCL has been confirmed an effective polymer medium for coating to further improve the corrosion resistance and biocompatibility of Mg [ 85 – 91 ], capable of physically or chemically interacting with F3 in the coating, likely via H-bonding. As a key measure of biocompatibility, cytocompatibility assesses the impact of coated metals on cell proliferation. Previously cell studies frequently demonstrated positive effects on cytocompatibility and cell proliferation from antibacterial coatings, particularly for bone-linked cells such as murine osteoblast-like cell line MC3T3-E1 [ 76 , 92 – 95 ] and human osteoblast cell line MG-63 [ 96 , 97 ]. These studies assess proliferation in conjunction with cell adhesion and osteoblast differentiation. In this study, 3A-PCL-F3 showed substantially enhanced proliferation, osteoblast differentiation, and adhesion of mouse osteoblast precursor MC3T3-E1 cells over other materials. Additionally, tissues collected from the implantation sites, brain, heart, and ovary of rats demonstrated that three-month post-implantation with 3A-PCL-F3, there was no detectable impacts on important organs. Furthermore, the implantation of 3A-PCL-F3 did not induce any significant immune or inflammatory responses, which has not been reported previously for other antibacterial coatings. The cytokine levels from the sera 3 months post implantation were similar among the control group, 3A and 3A-PCL-3A which further indicates its outstanding biocompatibility. 4.5 Future research directions The current results affirm our previous finding that 3A (fully annealed Mg alloy, AZ31) has better biocompatibility, promotes recovery of injured tissue, and contributes to the regeneration and development of osteocytes. 3A-PCL-F3 not only showed a better biocompatibility, but also demonstrated enhanced antibacterial performance in vitro and in vivo . Further investigations are required to understand why the annealed form of AZ31 resulted in such drastic differences in inflammatory responses. The microstructure and texture components, the annealing process, such as heating speed, temperature, holding time, furnace environment, and cooling speed, can influence the microstructures and phases of metallic compounds. Therefore, future work will delve into the impacts of various processing parameters on microstructure, surface physiochemical properties and in vivo responses. Notably, regardless of physical interaction or chemical bonding with the polymers, 3A demonstrated enhanced and longer-lasting antibacterial effects than 1E, even though they share similar chemistry and physical characteristics. Therefore, it necessary to study the structures formed between coatings and the metal substrate, as well as mechanisms for bactericidal effects at play. Moreover, exploring the influence of implant alloy substrate and coating properties on biophysical responses to implants requires further investigation and discovery. 5. Conclusions In this study, we developed a 3D coating using the cationic host defence peptide F3 (CHDP F3) and the biocompatible material PCL for Mg alloys, including 1E, 2P and 3A. PCL-F3 coated Mg alloys exhibited exceptional biocompatibility, stable antibacterial properties, and no adverse effects on vital organs in SD rats three months post-implantation. Proteomics and metabolomics analyses revealed that 3A did not activate significant inflammation or immune responses, while enhancing signalling pathways for tissue cell proliferation. PCL-F3 coated 3A showed no obvious foreign body responses, unlike 1E and 2P. Surface physiochemical properties, including a higher percentage of first-order pyramidal slip for 3A, may contribute to its outstanding performance. Future research will focus on understanding the mechanism behind 3A's biocompatibility, optimizing microstructures, and exploring similar treatments for other magnesium alloys and hexagonal-close-packed metals. In conclusion, PCL-F3 coated 3A demonstrates potential as an antibacterial implant for internal fixation in fracture repair, providing a biodegradable solution. Declarations Acknowledgments: HJL thanks Japanese JSPS committee and the University of Tokyo for providing financially support of the research of Mg treatment and microstructure analysis. We thank Mr. Bernhard Black, Mr. Ross Barrett and Mr. Hugh Allan from the University of the Sunshine Coast for samples machining and preparation; Doctor Yajun Ye, Doctor Guowei Liu and Doctor Weixiong Tang from the Department of Radiology of the First People’s Hospital of Foshan for CT and X ray imaging of the experimental rats. We appreciate the advice provided by Professor Abigail Elizur of the University of the Sunshine Coast. Funding sources: This study was supported in part by JSPS research grant (No. P16718), Natural Science Foundation of Guangdong Province (No. 2020A1515010855), National Science Foundation of China (31971355) and Genecology MCR Seed Funding of University of the Sunshine Coast. Deng Feng Project of Foshan First People’s Hospital (2019A008). References V. Nguyen, Osteoporosis prevention and osteoporosis exercise in com- munity-based public health programs, Osteoporos. Sarcopenia 3 (2017) 18–31. L. Cao, L. Wang, L. Fan, W. Xiao, B. Lin, Y. Xu, J. Liang, B. Cao, RGDC Peptide-Induced Biomimetic Calcium Phosphate Coating Formed on AZ31 Magnesium Alloy, Materials (Basel) 10 (4) (2017) 358, doi: 10.3390/ma10040358. T. Wang, G. Ni, T. Furushima, H. Diao, P. Zhang, S. Chen, C. Fog- arty, Z. Jiang, X. Liu, H. Li, Mg alloy surface immobilised with caerin peptides acquires enhanced antibacterial ability and putatively improved corrosion resistance, Mater. Sci. Eng. C 121 (2021) 111819, doi: 10.1016/j.msec.2020.111819. X. Liu, G. Chen, X. Zhong, T. Wang, X. He, W. Yuan, P. Zhang, Y. Liu, D. Cao, S. Chen, K. Manabe, Z. Jiang, T. Furushima, D. Kent, Y. Chen, G. Ni, M. Gao, H. Li. Degradation of differently processed Mg-based implants leads to distinct foreign body reactions (FBRs) through dissimilar signalling pathways. Journal of Magnesium and alloys, 11(6),2023, 2106-2124. https://doi.org/10.1016/j.jma.2022.03.017 H. Kjeldgaard, K. Holvik, B. Abrahamsen, G. Tell, H. Meyer, M. Flaherty, S. footnote. Explaining declining hip fracture rates in Norway: a population-based modelling study. The Lancet. May 08, 2023, DOI: https://doi.org/10.1016/j.lanepe.2023.100643 Y. Yang, Q. Wei, R. An, H. Zhang, J. Shen, X. Qin, X. Han, J. Li, X. Li, X. Gao, J. He, H. Mao. Anti-osteoporosis effect of Semen Cuscutae in ovariectomized mice through inhibition of bone resorption by osteoclasts. Journal of Ethnopharmacology. Volume 285, 1 March 2022, 114834 A. Sidambe. Biocompatibility of Advanced Manufactured Titanium Implants—A Review. Materials (Basel). 2014 Dec; 7(12): 8168–8188. Published online 2014 Dec 19. doi: 10.3390/ma7128168 Y. Li, C. Yang, H. Zhao, S. Qu, X. Li, Y. Li. New Developments of Ti-Based Alloys for Biomedical Applications. Materials (Basel). 2014 Mar; 7(3): 1709–1800. Published online 2014 Mar 4. doi: 10.3390/ma7031709 L Zhang, L. Chen. A Review on Biomedical Titanium Alloys: Recent Progress and Prospect. Advanced Engineering Materials. 2019, March 20, https://doi.org/10.1002/adem.201801215 M. Niinomi, Y. Liu, M. Nakai, H. Liu, H Li. Biomedical titanium alloys with Young’s moduli close to that of cortical bone. Regen Biomater. 2016 Sep; 3(3): 173–185. doi: 10.1093/rb/rbw016 E Mostaed, M. Jasinska, J. Drelich, M. Vedani. Zinc-based alloys for degradable vascular stent applications. Acta Biomater. 2018 Apr 15; 71: 1–23. doi: 10.1016/j.actbio.2018.03.005 M. Niinomi, M. Nakai. Titanium-Based Biomaterials for Preventing Stress Shielding between Implant Devices and Bone. Int J Biomater. 2011; 2011: 836587. doi: 10.1155/2011/836587 Y. Kim, M. Choi, J. Kim. Are titanium implants actually safe for magnetic resonance imaging examinations? Arch Plast Surg. 2019 Jan; 46(1): 96–97. doi: 10.5999/aps.2018.01466 G. Cecoro, D. Bencivenga, M. Annunziata, N. Cennamo, F. Ragione, A. Formisano, A. Piccirillo, E. Stampone, P. Volpe, L. Zeni, A. Borriello, L. Guida. Effects of Magnetic Stimulation on Dental Implant Osseointegration: A Scoping Review. Appl. Sci. 2022, 12(9), 4496; https://doi.org/10.3390/app12094496 M. Sarraf, E. Ghomi, S. Alipour, S. Ramakrishna, N. Sukiman. A state-of-the-art review of the fabrication and characteristics of titanium and its alloys for biomedical applications. Bio-Design and Manufacturing, volume 5, pages371–395 (2022) Y. Hwang, Y. Choi, Y. Hwang, H. Cho, D. Lee. Biocompatibility and Biological Corrosion Resistance of Ti–39Nb–6Zr+0.45Al Implant Alloy. J. Funct. Biomater. 2021, 12(1), 2; https://doi.org/10.3390/jfb12010002 A. Zomorodian, C. Santos, M. Carmezim, T. Silva, J. Fernandes, M. Montemor, In-vitro corrosion behaviour of the magnesium alloy with Al and Zn (AZ31) protected with a biodegradable polycaprolactone coating loaded with hydroxyapatite and cephalexin, Electrochim. Acta 179 (2015) 431–440. C. Romano, G. Manzi, N. Logoluso, D. Romano, Value of debridement and irrigation for the treatment of peri-prosthetic infections: a systematic review, Hip Int. 22 (Suppl 8) (2019) S19–S24 http:// dx.doi.org/ 10.5301/ HIP.2012.9566. R. Darouiche, Treatment of infections associated with surgical implants, N. Engl. J. Med. 350 (2004) 1422–1429 http:// dx.doi.org/ 10. 1056/NEJMra035415. Y. Jiang, B. Wang, Z. Jia, X. Lu, L. Fang, K. Wang, F. Ren, Poly- dopamine mediated assembly of hydroxyapatite nanoparticles and bone morphogenetic protein-2 on magnesium alloys for enhanced corrosion resistance and bone regeneration, J. Biomed. Mater. Res. A 105 (2017) 2750–2761 W. Sun, X. Qiao, M. Zheng, C. Xu, N. Gao, M. Starink, Microstructure and mechanical properties of a nanostructured Mg-8.2Gd-3.8Y-1.0Zn-0.4Zr supersaturated solid solution prepared by high pressure torsion, Mater. Design 135 (2017) 366–376. N. Soro, H. Attar, X. Wu, and M. S. Dargusch, “Investigation of the structure and mechanical properties of additively manufactured Ti-6Al-4V biomedical scaffolds designed with a Schwartz primitive unit-cell,” Materials Science and Engineering: A, vol. 745, pp. 195-202, 2019. N. Soro, N. Saintier, J. Merzeau, M. Veidt, and M. S. Dargusch, Quasi-static and fatigue properties of graded Ti–6Al–4V lattices produced by Laser Powder Bed Fusion (LPBF), Additive Manufacturing, vol. 37, p. 101653, 2021. L. Yuan, S. Ding, C. Wen. Additive manufacturing technology for porous metal implant applications and triple minimal surface structures: A review. Bioact Mater. 2019 (4): 56–70. Doi: 10.1016/j.bioactmat.2018.12.003 A. Yánez, A. Cuadrado, O. Martel, D. Monopoli. Gyroid porous titanium structures: A versatile solution to be used as scaffolds in bone defect reconstruction. Materials and Design, November 2017, 140(B), doi: 10.1016/j.matdes.2017.11.050 P. Hameed, C. Liu, R. Ummethala, K. Prashanth. Biomorphic porous Ti6Al4V gyroid scaffolds for bone implant applications fabricated by selective laser melting. Progress in Additive Manufacturing, 2021, 6(3), doi: 10.1007/s40964-021-00210-5 N. Soro, N. Saintier, H. Attar, and M. S. Dargusch, “Surface and morphological modification of selectively laser melted titanium lattices using a chemical post treatment,” Surface and Coatings Technology, vol. 393, p. 125794, 2020. ASTM E9-89a, 2000, Standard Test Methods of Compression Testing of Metallic Materials at Room Temperature, ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959, United States. N. Soro, E.Brodie, A. Abdal-hayc, A. Alali, D, Kenta, M. Darguscha. Additive manufacturing of biomimetic Titanium-Tantalum lattices for biomedical implant applications. Materials & Design. Materials & Design. Volume 218, June 2022, 110688 S. Wu, J. Xu, L. Zou, S. Luo, R. Yao, B. Zheng, G. Liang, D. Wu, Y. Li. Long-lasting renewable antibacterial porous polymeric coatings enable titanium biomaterials to prevent and treat peri-implant infection. Nature Communications, (2021) 12:3303 | https://doi.org/10.1038/s41467-021-23069-0 | S. Chen, P. Zhang, L. Xiao, Y. Liu, K. Wu, G. Ni, H. Li, T. Wang, X. Wu, G. Chen, X. Liu, Caerin 1.1 and 1.9 Peptides from Australian Tree Frog Inhibit Antibiotic-resistant bacteria growth in a murine skin infection model, Microbiol Spectr. (2021) e0005121, doi: 10.1128/Spectrum.00051-21. X. Gu, Y. Cheng, Y. Zheng, S. Zhong, T. Xi, In vitro corrosion and biocompatibility of binary magnesium alloys, Biomaterials 30 (2009) 484–498. J. Wi´sniewski, Quantitative evaluation of filter aided sample preparation (FASP) and multienzyme digestion FASP protocols, Anal. Chem. 88 (10) (2016) 5438–5443. G. Ni, S. Chen, M. Chen, J. Wu, B. Yang, J. Yuan, S.F. Walton, H. Li, M. Wei, Y. Wang, G. Chen, Liu X, T. Wang, Host-defense peptides caerin 1.1 and 1.9 stimulate TNF-alpha-dependent apoptotic signals in human cervical cancer HeLa cells, Front. Cell Dev. Biol. 8 (2020 Jul 31) 676 Y. Assenov, F. Ramírez, S.E. Schelhorn, T. Lengauer, M. Albrecht, Computing topological parameters of biological networks, Bioinformatics (Oxford, England) 24(2) (2008) 282-284, doi: 10.3389/ fcell.2020.00676. X. Yang, J. Li, S. Chen, L. Xiao, D. Cao, X. Wu, H. Li, G. Ni, T. Wang, G. Chen, X. Liu. Preclinical Pharmacokinetics, Biodistribution, and Acute Toxicity Evaluation of Caerin 1.9 Peptide in Sprague Dawley Rats. Evidence-Based Complementary and Alternative Medicine Volume 2022, Article ID 9869293, 13 pages https://doi.org/10.1155/2022/9869293 X. Pan, B. Ma, X. You, S. Chen, J. Wu, T. Wang, S. Walton, J. Yuan, X. Wu, G. Chen, Y. Wang, G. Ni, X Liu. Synthesized natural peptides from amphibian skin secretions increase the efficacy of a therapeutic vaccine by recruiting more T cells to the tumour site. BMC Complementary and Alternative Medicine (2019) 19:163 https://doi.org/10.1186/s12906-019-2571-z S. Chen, P. Zhang, L. Xiao, Y. Liu, K. Wu, G. Ni, H. Li, T. Wang, X. Wu, G. Chen, X. Liu, Caerin 1.1 and 1.9 peptides from Australian tree frog inhibit antibiotic-resistant bacteria growth in a murine skin infection model, Microbiology Spectrum 9 (1), 2021 Sep 3;9(1): e0005121. Doi: 10.1128/Spectrum.00051-21 L. Zumofen, K. Kopanska, E. Bono, U. Graf-Hausner. Properties of Additive-Manufactured Open Porous Titanium Structures for Patient-Specific Load-Bearing Implants. February 2022, Frontiers in Mechanical Engineering 7:1, Doi: 10.3389/fmech.2021.830126 C. Mallon, R. Gooberman-Hill, A. Blom, M. Whitehouse, A. Moore. Surgeons are deeply affected when patients are diagnosed with prosthetic joint infection. Plos one, 2018, 13(11): e0207260. https://doi.org/10.1371/journal. pone.0207260 T. Parisi, J. Konopka, H. Bedair, What is the Long-term Economic Societal Effect of Periprosthetic Infections After THA? A Markov Analysis. Clin Orthop Relat Res. 2017 Jul; 475(7): 1891–1900. N. Mookherjee, M. Anderson, H. Haagsman, D. Davidson. Antimicrobial host defence peptides: functions and clinical potential. Nature Review, 2020, 19, 311-332. https://doi.org/10.1038/s41573-019-0058-8 M. Simmaco, G. Kreil, D. Barra. Bombinins, antimicrobial peptides from Bombina species. Biochim. Biophys. Acta 1788, 1551–1555 (2009). J. Bowie, F. Separovic, M. Tyler. Host-defense peptides of Australian anurans. Part 2. Structure, activity, mechanism of action, and evolutionary significance. Peptides 2012, 37:174–188. Doi: 10.1016/j.peptides.2012.06.017. G. Ni, S. Chen, M. Chen, J. Wu, B. Yang, J. Yuan, S. Walton, H. Li, M. Wei, Y. Wang, G. Chen, X. Liu, T. Wang. Host-Defense Peptides Caerin 1.1 and 1.9 Stimulate TNF-Alpha-Dependent Apoptotic Signals in Human Cervical Cancer HeLa Cells. Front. Cell Dev. Biol. 2020, 8:676. Doi: 10.3389/fcell.2020.00676 P. Du, S. Furusawa, T. Furushima, Microstructure and performance of biodegradable magnesium alloy tubes fabricated by local-heating-as- sisted dieless drawing, J. Magnesium Alloys 8 (2020) 614–623. X. Gu, Y. Cheng, Y. Zheng, S. Zhong, T. Xi, In vitro corrosion and biocompatibility of binary magnesium alloys, Biomaterials 30 (2009) 484–498. L. Decrausaz, A. Goncalves, S. Domingos-Pereira, C. Pythoud, J. Stehle, J. Schiller, et al., A novel mucosal orthotopic murine model of human papillomavirus-associated genital cancers, Int. J. Cancer 128 (2011) 2105–2113 J. Wi´sniewski, Quantitative evaluation of filter aided sample preparation (FASP) and multienzyme digestion FASP protocols, Anal. Chem. 88 (10) (2016) 5438–5443. G. Ni, S. Chen, M. Chen, J. Wu, B. Yang, J. Yuan, S.F. Walton, H. Li, M. Wei, Y. Wang, G. Chen, Liu X, T. Wang, Host-defense peptides caerin 1.1 and 1.9 stimulate TNF-alpha-dependent apoptotic signals in human cervical cancer HeLa cells, Front. Cell Dev. Biol. 8 (2020 Jul 31) 676. Y. Assenov, F. Ramírez, S.E. Schelhorn, T. Lengauer, M. Albrecht, Computing topological parameters of biological networks, Bioinformatics (Oxford, England) 24(2) (2008) 282-284, doi: 10.3389/ fcell.2020.00676. S. Kerrien, B. Aranda, L. Breuza, A. Bridge, F. Broackes-Carter, C. Chen, M. Duesbury, M. Dumousseau, M. Feuermann, U. Hinz, C. Jandrasits, R.C. Jimenez, J. Khadake, U. Mahadevan, P. Masson, I. Pedruzzi, E. Pfeiffenberger, P. Porras, A. Raghunath, B. Roechert, S. Orchard, H. Hermjakob. The IntAct molecular interaction database in 2012, Nucleic Acids Res. 40 (Database issue) (2012) D841–D846. Y. Assenov, F. Ramírez, S.E. Schelhorn, T. Lengauer, M. Albrecht, Computing topological parameters of biological networks, Bioinformatics 24 (2008) 282–284. Y.H. An, R.A. Draughn, Mechanical Testing of Bone and the Bone-Im- plant Interface, CRC press, USA, 1999. Poplawski A, Hu K, Lee W, Natesan S, Peng D, Carlson S, Shi X, Balaz S, Markley JL, Glass KC: Molecular insights into the recognition of N-terminal histone modifications by the BRPF1 bromodomain. J Mol Biol 2014, 426(8):1661-1676. L. You, K. Yan, J. Zou, H. Zhao, N. Bertos, M. Park, E. Wang, X. Yang. The lysine acetyltransferase activator Brpf1 governs dentate gyrus development through neural stem cells and progenitors. PLoS Genet 2015, 11(3): e1005034. L. You, J. Zou, H. Zhao, N. Bertos, M. Park, E. Wang, X. Yang. Deficiency of the chromatin regulator BRPF1 causes abnormal brain development. J Biol Chem 2015, 290(11):7114-7129. L. You, L. Li, J. Zou, K.Yan, J. Belle, A. Nijnik, E. Wang E, X. Yang. BRPF1 is essential for development of fetal hematopoietic stem cells. J Clin Invest 2016, 126(9):3247-3262. J. Meier, C. Tallant, O. Fedorov, H. Witwicka, S. Hwang, R. van Stiphout, J. Lambert, C. Rogers, C. Yapp, B. Gerstenberger et al. Selective Targeting of Bromodomains of the Bromodomain-PHD Fingers Family Impairs Osteoclast Differentiation. ACS Chem Biol 2017, 12(10):2619-2630. D. Wang, K. Christensen, K. Chawla, G. Xiao, P. Krebsbach, R. Franceschi. Isolation and characterization of MC3T3-E1 preosteoblast subclones with distinct in vitro and in vivo differentiation/mineralization potential. J Bone Miner Res 1999, 14(6):893-903. X. Chen, Z. Wang, N. Duan, G. Zhu, E. Schwarz, C. Xie. Osteoblast-osteoclast interactions. Connect Tissue Res 2018, 59(2):99-107. H. Blair, Q. Larrouture, Y. Li, H. Lin, D. Beer-Stoltz, L. Liu, R. Tuan, L. Robinson, P. Schlesinger, D. Nelson. Osteoblast Differentiation and Bone Matrix Formation In Vivo and In Vitro. Tissue Eng Part B Rev 2017, 23(3):268-280. C. Fu, Q. Li, J. Zou, C. Xing, M. Luo, B. Yin, J. Chu, J. Yu, X. Liu, H. Wang, et al. JMJD3 regulates CD4 T cell trafficking by targeting actin cytoskeleton regulatory gene Pdlim4. J Clin Invest 2019, 129(11):4745-4757. P. Grigaravicius, A. von Deimling, P. Frappart. RINT1 functions as a multitasking protein at the crossroads between genomic stability, ER homeostasis, and autophagy. Autophagy 2016, 12(8):1413-1415. D. Park, K. Tao, F. Le Calvez-Kelm, T. Nguyen-Dumont, N. Robinot, F. Hammet, F. Odefrey, H. Tsimiklis, Z. Teo, L. Thingholm, et al. Rare mutations in RINT1 predispose carriers to breast and Lynch syndrome-spectrum cancers. Cancer Discov 2014, 4(7):804-815. E. Mariani, G. Lisignoli, R. Borzì, L. Pulsatelli. Biomaterials: Foreign Bodies or Tuners for the Immune Response? Int J Mol Sci 2019, 20(3). J. den Haan, R. Arens, M.van Zelm. The activation of the adaptive immune system: cross-talk between antigen-presenting cells, T cells and B cells. Immunol Lett 2014, 162(2 Pt B):103-112. U. Ritz, B. Seliger. The transporter associated with antigen processing (TAP): structural integrity, expression, function, and its clinical relevance. Mol Med 7, 149-158 (2001). R. Zimmermann, S. Eyrisch, M. Ahmad, V. Helms. Protein translocation across the ER membrane. Biochim Biophys Acta 1808, 912-924, doi: 10.1016/j.bbamem.2010.06.015 (2011). Y. Osugi, K. Fumoto, A. Kikuchi. CKAP4 Regulates Cell Migration via the Interaction with and Recycling of Integrin. Molecular and cellular biology 39, doi:10.1128/mcb.00073-19 (2019). E. Milot, N. Fotouhi-Ardakani, J. Filep. Myeloid nuclear differentiation antigen, neutrophil apoptosis and sepsis. Front Immunol 3, 397, doi:10.3389/fimmu.2012.00397 (2012). P. Poh, et al. In vitro and in vivo bone formation potential of surface calcium phosphate-coated polycaprolactone and polycaprolactone/bioactive glass composite scaffolds. Acta Biomater 30, 319-333, doi: 10.1016/j.actbio.2015.11.012 (2016). A. Baradaran-Rafii, E. Biazar, S. Heidari-keshel. Cellular Response of Limbal Stem Cells on Polycaprolactone Nanofibrous Scaffolds for Ocular Epithelial Regeneration. Curr Eye Res 41, 326-333, doi:10.3109/02713683.2015.1019004 (2016). B. Chuenjitkuntaworn, T. Osathanon, N. Nowwarote, P. Supaphol, P. Pavasant. The efficacy of polycaprolactone/hydroxyapatite scaffold in combination with mesenchymal stem cells for bone tissue engineering. J Biomed Mater Res A 104, 264-271, doi:10.1002/jbm.a.35558 (2016). K. Bratke, M. Kuepper, B. Bade, J. Virchow, W. Luttmann. Differential expression of human granzymes A, B, and K in natural killer cells and during CD8+ T cell differentiation in peripheral blood. Eur J Immunol 35, 2608-2616, doi:10.1002/eji.200526122 (2005). D. Zhang, Y. Liu, Z. Liu, Q. Wang. Advances in Antibacterial Functionalized Coatings on Mg and Its Alloys for Medical Use—A Review, Coatings 2020, 10(9), 828; https://doi.org/10.3390/coatings10090828 C. Tan, X. Zhang, Q. Li. Fabrication of multifunctional CaP-TC composite coatings and the corrosion protection they provide for magnesium alloys. Biomed. Eng. 2017, 62, 375–381. Y. Guo, S. Jia, L. Qiao, Y. Su, R. Gu, G. Li, J. Lian. A multifunctional polypyrrole/zinc oxide composite coating on biodegradable magnesium alloys for orthopedic implants. Colloids Surf. B Biointerfaces 2020, 194, 111186 N. Bai, C. Tan, Q. Li, Z. Xi. Study on the corrosion resistance and anti-infection of modified magnesium alloy. Biomed. Mater. Eng. 2017, 28, 339–345. A. Rezk, A. Sasikala, A. Nejad, H. Mousa, Y. Oh, C. Park, C. Kim. Strategic design of a Musselinspired in situ reduced Ag/Au Nanoparticle Coated Magnesium Alloy for enhanced viability, antibacterial property, and decelerated corrosion rates for degradable implant applications. Sci. Rep. 2019, 9, 117. K. Pang, J. Lee, Y. Seo, S. Kim, M. Kim, J. Lee. Biologic properties of nano-hydroxyapatite: An in vivo study of calvarial defects, ectopic bone formation and bone implantation. Bio-Med. Mater. Eng. 2015, 25, 25–38. S. Kozerski, L. Pawlowski, R. Jaworski, R. Roudet, F. Petit. Two zones microstructure of suspension plasma sprayed hydroxyapatite coatings. Surf. Coat. Technol. 2010, 204, 1380–1387. Z. Yin, W. Qi, R. Zeng, X. Chen, C. Gu, S. Guan, Y. Zheng. Advances in coatings on biodegradable magnesium alloys. J. Magnes. Alloy 2020, 8, 42–65. X. Lu, Z. Zhao, Y. Leng. Biomimetic calcium phosphate coatings on nitric-acid-treated titanium surfaces. Mater. Sci Eng. 2007, 27, 700–708. L. Griffith. Polymeric Biomaterials. Acta Mater. 2000, 48, 263–277. Y. Yang, C. Michalczyk, F. Singer, S. Virtanen, A. Boccaccini. In Vitro Study of Polycaprolactone/bioactive Glass Composite Coatings on Corrosion and Bioactivity of Pure Mg. Appl. Surf. Sci. 2015, 355, 832–841. L. Xu, A. Yamamoto. Characteristics and Cytocompatibility of Biodegradable Polymer Film on Magnesium by Spin Coating. Colloids Surf. B. Biointerfaces 2012, 93, 67–74. M. Virto, P. Frutos, S. Torrado, G. Frutos. Gentamicin release from modified acrylic bone cements with lactose and hydroxypropylmethylcellulose. Biomaterials 2003, 24, 79–87. X. Ji, Q. Cheng, J. Wang, Y. Zhao, Z. Han, F. Zhang, S. Li, R. Zeng, Z. Wang. Corrosion resistance and antibacterial effects of hydroxyapatite coating induced by polyacrylic acid and gentamicin sulfate on magnesium alloy. Front. Mater. Sci. 2019, 13, 87–98. Y. Zhao, X. Chen, S. Li, R. Zeng, F. Zhang, Z. Wang, S. Guan. Corrosion resistance and drug release profile of gentamicin-loaded polyelectrolyte multilayers on magnesium alloys: Effects of heat treatment. J. Colloid Interface Sci. 2019, 547, 309–317 E. Dayaghi, H. Bakhsheshi-Rad, E. Hamzah, A. Akhavan-Farid, A. Ismail, M. Aziz, E. Abdolahi. Magnesium-zinc scaffold loaded with tetracycline for tissue engineering application: In vitro cell biology and antibacterial activity assessment. Mater. Sci. Eng. C 2019, 102, 53–65. Q. Zheng, J. Li, W. Yuan, X. Liu, L. Tan,Y. Zheng, K. Yeung, S. Wu. Metal−Organic Frameworks Incorporated Polycaprolactone Film for Enhanced Corrosion Resistance and Biocompatibility of Mg Alloy. ACS Sustainable Chem. Eng.2019, 7, 18114−18124 Y. Zou, J. Wang, L. Cui, R. Zeng, Q. Wang, Q. Han, J. Qiu, X. Chen, D. Chen, S. Guan, et al. Corrosion resistance and antibacterial activity of zinc-loaded montmorillonite coatings on biodegradable magnesium alloy AZ31. Acta Biomater. 2019, 98, 196–214. X. Ji, L. Gao, J. Liu, J. Wang, Q. Cheng, J. Li, S. Li, K. Zhi, R. Zeng, Z. Wang. Corrosion resistance and antibacterial properties of hydroxyapatite coating induced by gentamicin-loaded polymeric multilayers on magnesium alloys. Colloids Surf. B Biointerfaces 2019, 179, 429–436. J. Song, P. Jin, M. Li, J. Liu, D. Wu, H. Yao, J. Wang. Antibacterial properties and biocompatibility in vivo and vitro of composite coating of pure magnesium ultrasonic micro-arc oxidation phytic acid copper loaded. J. Mater. Sci. Mater. Med. 2019, 30, 49–62. R. Zeng, L. Cui, K. Jiang, R. Liu, B. Zhao, Y. Zheng. In Vitro Corrosion and Cytocompatibility of a Microarc Oxidation Coating and Poly (L-lactic acid) Composite Coating on Mg-1Li-1Ca Alloy for Orthopaedic Implants. Acs Appl. Mater. Interfaces 2016, 8, 10014–10028 Y. Yang, K. Zheng, R. Liang, A. Mainka, N. Taccardi, J. Roether, R. Detsch, W. Goldmann, S. Virtanen, A. Boccaccini. Cu-releasing BG/PCL Coating on Mg with Antibacterial and Anticorrosive Properties for Bone Tissue Engineering. Biomed. Mater. 2017, 13, 015001. J. Chen, Y. Zhang, M. Ibrahima, I. Etim, L. Tan, K. Yang. In vitro degradation and antibacterial property of a copper-containing microarc oxidation coating on Mg-2Zn-1Gd-0.5Zr alloy. Colloids Surf. B Biointerfaces 2019, 179, 77–86 Additional Declarations The authors declare no competing interests. Supplementary Files Graphicabstract.png Graphic abstract for 3D coating of PCL and F3 Supplfiguresandtables1.zip Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4220574","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":287744434,"identity":"042ba2f8-0355-406f-b520-c6a2c4603453","order_by":0,"name":"Xiaosong Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiaosong","middleName":"","lastName":"Liu","suffix":""},{"id":287744435,"identity":"54ac34d6-b3ad-4601-a02b-a508a9bcc40d","order_by":1,"name":"Guoying Ni","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Guoying","middleName":"","lastName":"Ni","suffix":""},{"id":287744436,"identity":"f7712393-240a-427f-93fd-67e9b45a1aad","order_by":2,"name":"Guoqiang Chen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Guoqiang","middleName":"","lastName":"Chen","suffix":""},{"id":287744437,"identity":"a50f0e7c-a3f4-4ebc-8d21-c8873c8385b5","order_by":3,"name":"Xiaohong He","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiaohong","middleName":"","lastName":"He","suffix":""},{"id":287744438,"identity":"64cb07d2-7f17-4680-962b-30d7f1bb3e39","order_by":4,"name":"Pingping Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Pingping","middleName":"","lastName":"Zhang","suffix":""},{"id":287744439,"identity":"4fa52499-a5c2-496b-9480-0cf4c46deac8","order_by":5,"name":"Yuandong Luo","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yuandong","middleName":"","lastName":"Luo","suffix":""},{"id":287744440,"identity":"61e9815f-3197-4587-ab5f-c35e4ff67f0d","order_by":6,"name":"Quanlan Fu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Quanlan","middleName":"","lastName":"Fu","suffix":""},{"id":287744441,"identity":"19dab04f-df07-44b6-9037-03fd495d8a47","order_by":7,"name":"Junjie Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Junjie","middleName":"","lastName":"Li","suffix":""},{"id":287744442,"identity":"6fc7e8c5-4718-429e-bfc0-37cec04e589c","order_by":8,"name":"Shuxian Tang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Shuxian","middleName":"","lastName":"Tang","suffix":""},{"id":287744443,"identity":"a6a21645-4a11-4648-95a5-6ea847d65924","order_by":9,"name":"Guowei Ni","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Guowei","middleName":"","lastName":"Ni","suffix":""},{"id":287744444,"identity":"4befd4b2-f1dc-49ff-9f9d-a3b0d8a32a8c","order_by":10,"name":"Ken-ichi Manabe","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ken-ichi","middleName":"","lastName":"Manabe","suffix":""},{"id":287744445,"identity":"e1ff0964-a043-4ae4-9983-b4b24c3e9f43","order_by":11,"name":"Zhengyi Jiang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhengyi","middleName":"","lastName":"Jiang","suffix":""},{"id":287744446,"identity":"8e44aaa2-0cd2-47b9-85d0-4f7f6d3ef280","order_by":12,"name":"Tsuyoshi Furushima","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Tsuyoshi","middleName":"","lastName":"Furushima","suffix":""},{"id":287744447,"identity":"b8605bbc-009a-48a6-bcb4-21ffcf3119b3","order_by":13,"name":"Damon Kent","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAu0lEQVRIiWNgGAWjYDCCMyCiAsKWIF7LgTMkaznYRooWvjOHjz3+OO+wPX8D88HbPAx2iQ2EtEiebUs3OLjtcOKMA2zJ1jwMyYS1GJznMZMAakkwYOAxk+ZhYCZGC/83iYNzDtsbMPB/A2qpJ0LL2R42iYMNhxk3MPCwAbUcJsIvZ46ZSZw5lp444zCbseUcg+PGBLXwnUl+JlFRY23P39788MabimpZgloQgBnsTuLVj4JRMApGwSjAAwC4gTuCcxanuQAAAABJRU5ErkJggg==","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Damon","middleName":"","lastName":"Kent","suffix":""},{"id":287744448,"identity":"9ecd80de-c69e-418f-9dc9-0695c8fa6ff5","order_by":14,"name":"Bin Zhu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApUlEQVRIiWNgGAWjYDACCcYGhg82pGphnJFGmhYGBmYekrTIz25ue2yTUJe44UYC44ePOURoYZxzsN04J+EwSAuz5MxtRGhhlkhsk879cQCkhY2ZlxgtbCAtFhCHEamFB6SFIYGZBC0SMgfbJHsSDhvPPPOwmTi/yM9ufybxI6FOtu948sEPH4nRAgOOCy4kNpCgHgjs5fsPkKZjFIyCUTAKRg4AABkuOQX20djMAAAAAElFTkSuQmCC","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Bin","middleName":"","lastName":"Zhu","suffix":""},{"id":287744449,"identity":"2ac5a198-4a19-4d68-a0f4-cff4bba1e8f9","order_by":15,"name":"Tianfang Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYNCCCgglQZRiHjB5hmQtjG2kaLGXSH728Ou8w/b8DcwHb/Mw2CU2ELRFIs3cWHbb4cQZB9iSrXkYkonQIp1gJi257XCCAQOPmTQPAzMxWtK/SUvOOWxvwMD/DailnhgtOWaSHxsOM25g4GEDajlMhJb7b8qkGY6lJ844zGZsOcfguDFBLew9x7dJ/qixtudvb354401FtSxBLSDADI4cZhBhQIx6IGD8QaTCUTAKRsEoGKEAAC0wM3gx6jlRAAAAAElFTkSuQmCC","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Tianfang","middleName":"","lastName":"Wang","suffix":""},{"id":287744450,"identity":"477f3638-9e84-4adc-b755-a026f34f416b","order_by":16,"name":"Hejie Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYBACAwaGhAMMBTY8bPzNB4B8CRkitRikyfFLHEsAaeEhRguIPGws2ZADZhPWYs7e8PDABwPmxA0Hznx+daPGgoeB/fDRDfi0WPYcSDg4w4AtccPh3m3WOceADuNJS7uB12E3EhIO8xjwAG05u804hw2oRYLHDL+W+w8SDv8xkABqyXlmnPOPGC03GBIOMxgYgLzP/Di3jRgtZxISDvYYJIAC2Yw5t0+Ch42gX46fSf7wo+I/KCoff875VifHz374GF4twIhIgLHYJMAkfuUgwH4AxmL+QFj1KBgFo2AUjEQAAMzTTzD8Hr7lAAAAAElFTkSuQmCC","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Hejie","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-04-05 04:03:30","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-4220574/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4220574/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54270275,"identity":"a7e117b1-a331-4d2c-bdbc-29d884796eeb","added_by":"auto","created_at":"2024-04-08 06:31:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":320519,"visible":true,"origin":"","legend":"\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Schematic of the coating method; (\u003cstrong\u003eB\u003c/strong\u003e) Specimen’s size and surface (FIB-SEM); (\u003cstrong\u003eC\u003c/strong\u003e) PCL-F3 coated Mg alloy\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/d7de6a1ac75fc8701cc6f82b.png"},{"id":54270278,"identity":"33c30d8e-667b-4f95-8a15-31f617153a50","added_by":"auto","created_at":"2024-04-08 06:31:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":275645,"visible":true,"origin":"","legend":"\u003cp\u003eMg alloy microstructure and mechanical property characterisation of different Mg alloy specimen groups: (A) Thickness; (B) Grain size distributions; (C) Local average mis-orientation angles; (D) Strength under uniaxial tensile test\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/bf91a757af610093e64e7034.png"},{"id":54270280,"identity":"99112989-c251-44a7-8f5a-9e90df742467","added_by":"auto","created_at":"2024-04-08 06:31:54","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":779787,"visible":true,"origin":"","legend":"\u003cp\u003eLabel-free quantitative proteomic analysis of MC3T3-E1 cells cultured with the presence of Mg alloy specimen after 24hr. (\u003cstrong\u003eA\u003c/strong\u003e) Upset plot of upregulated (incl. presence only in the alloy groups) or downregulated (incl. absence in the alloy groups) DEPs (fold-change \u0026gt; 2 and \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) in three groups, including 1E, 2P and 3A, relative to the cell culture without any Mg alloys. The number beside each bar indicates the number of upregulated or downregulated DEPs in each group. The black dots and lines represent specific DEPs unique to each alloy group, while the vertical bar chart shows the number of common DEPs shared between alloy groups. (\u003cstrong\u003eB\u003c/strong\u003e) The contents (in TIC) of seven DEPs identified in all groups and upregulated in the alloy groups and the control (n = 3). (\u003cstrong\u003eC\u003c/strong\u003e) The canonical pathways associated with “cellular growth, proliferation and development”, “growth factor signalling”, and “organismal growth and development”, differentially regulated by the alloys with respect to the control, suggested by IPA. To discern significant differences among the groups, a comparative analysis was conducted using a threshold of -log(p-value) \u0026gt; 1.3. (\u003cstrong\u003eD\u003c/strong\u003e) The regulatory network significantly present only in the 3A group, identified by IPA. Cellular events/canonical pathways/regulators that were activated are indicated by orange, while others that were suppressed are indicated by blue. (\u003cstrong\u003eE\u003c/strong\u003e) MTT assay of MC3T3-E1 cells in different alloy groups (left), and in the 3A group in comparison with the Ti and 316L groups (right). (\u003cstrong\u003eF\u003c/strong\u003e) Microscopic images of MC3T3-E1 cells in the Ti, 316L, and 3A groups trypsinised for 2 min (left column) and 15 min (right column), respectively, after incubation for 24 h. (\u003cstrong\u003eG\u003c/strong\u003e) Comparison of mRNA levels of BRPF1, CTNNA1 and KAT6A by real-time PCR. NS, not significant; \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05;\u003csup\u003e **\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.01; \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.001; \u003csup\u003e****\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026nbsp;\u0026lt; 0.0001; by unpaired Student’s \u003cem\u003et\u003c/em\u003e-test. (See \u003cstrong\u003eTable S1 \u003c/strong\u003efor detailed proteomic analysis results)\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/09a3379cda1f355f3620900f.png"},{"id":54270279,"identity":"8d182c7f-c5e0-4f12-bdee-f2585b453cf0","added_by":"auto","created_at":"2024-04-08 06:31:54","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3306802,"visible":true,"origin":"","legend":"\u003cp\u003eCharacterisation of coated Mg alloys: (A) Coating thickness of different groups; (B) Weight of different groups; Surface morphology of coated metal (3A-F3-PCL) before (C) and after coating (D); (E) SEM image of PCL-F3 coating; (F) EDX/S analysis of coating elements; (G) Water contact angles of different groups before and after coating\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/09e40183b3ad0d50770f1cd6.png"},{"id":54270283,"identity":"ac6b3335-fbe2-4f5d-87aa-dd2a02f73c18","added_by":"auto","created_at":"2024-04-08 06:31:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1808315,"visible":true,"origin":"","legend":"\u003cp\u003eAnti-MRSA properties of Mg alloy implants \u003cem\u003ein vitro\u003c/em\u003e and comparative analysis of their implantation effects \u003cem\u003ein vivo\u003c/em\u003e at the acute phase of 3 days. (\u003cstrong\u003eA\u003c/strong\u003e) Comparison of anti-MRSA activity of different uncoated and coated alloy specimen, with respect to F3 only. (\u003cstrong\u003eB\u003c/strong\u003e) Morphology of implantation sites of the control (top left), 3A (top middle) and 3A-PCL-F3 (top right) (see \u003cstrong\u003eFigure S3\u003c/strong\u003e for the images of other groups), and the concentrations of MRSA in tissues collected from the implantation sites (bottom). (\u003cstrong\u003eC\u003c/strong\u003e) Volcano plot comparing the protein contents of 3A-PCL-F3 relative to 3A. Purple dots represent upregulated DEPs, and green dots represent downregulated DEPs (fold-change \u0026gt; 1.5 or \u0026lt; 0.66, and P \u0026lt; 0.05). (\u003cstrong\u003eD\u003c/strong\u003e) Comparison of the top six enriched biological processes in 3A-PCL-F3 and 3A by GSEA. (\u003cstrong\u003eE\u003c/strong\u003e) IPA compares the activation of immune response relevant pathways in the implant groups with respect to the IC. The black dot indicates insignificance. To discern significant differences among the groups, a comparative analysis was conducted using a threshold of -log(p-value) \u0026gt;1.3. (\u003cstrong\u003eF\u003c/strong\u003e) The regulatory network significantly presented only in 3A-PCL-F3, identified by IPA. Cellular events/canonical pathways/regulators that were activated are indicated in orange, while others that were suppressed are indicated in blue. (See \u003cstrong\u003eTable S2 \u003c/strong\u003efor detailed proteomic analysis results)\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/483603f3758fb49e504bda58.png"},{"id":54270286,"identity":"d379bf1f-0e93-4b7d-9efc-ffefe74bd554","added_by":"auto","created_at":"2024-04-08 06:31:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1586093,"visible":true,"origin":"","legend":"\u003cp\u003eComparative proteomic analysis of tissues collected from 3A and 3A-PCL-F3 at 3-month post-implantation. (\u003cstrong\u003eA\u003c/strong\u003e) Upset plot of upregulated or downregulated DEPs (fold-change \u0026gt; 1.5 or \u0026lt; 0.67, and P \u0026lt; 0.05) in 3A and 3A-PCL-F3 relative to the NIC. The number beside each bar indicates the number of DEPs in each group. The black dots and lines represent specific DEPs unique to each implant group, while the vertical bar chart shows the number of common shared DEPs between groups. (\u003cstrong\u003eB\u003c/strong\u003e) GSEA depicting the top six enriched cellular components by DEPs in 3A-PCL-F3 and 3A, respectively. (\u003cstrong\u003eC\u003c/strong\u003e) Top three most significant biological processes in 3A-PCL-F3 compared to 3A. (\u003cstrong\u003eD\u003c/strong\u003e) IPA of immune response relevant pathway regulation in implant groups at acute (3 days) and chronic (3 months) phases relative to the control. To discern significant differences among the groups, a comparative analysis was conducted using a threshold of -log(p-value) \u0026gt; 1.3. (\u003cstrong\u003eE\u003c/strong\u003e) ELISA analysis of TNF-α, IL-1β/IL-1F2, and IL-10 in the control, 3A, and 3A-PCL-F3. (\u003cstrong\u003eF\u003c/strong\u003e) HE stained tissues collected from the implantation sites, brain, heart, and ovary of rats in the control, 3A, and 3A-PCL-F3. (See \u003cstrong\u003eTable S3\u003c/strong\u003e for detailed proteomic analysis results)\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/53f3957c42783be28028c107.png"},{"id":54270284,"identity":"f121b516-7ec3-4b66-bcb3-226b859b18c5","added_by":"auto","created_at":"2024-04-08 06:31:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":757348,"visible":true,"origin":"","legend":"\u003cp\u003eMetabolomic analysis of tissues collected from the implantation sites of coated and uncoated Mg alloys in the acute and chronic phases with the introduction of MRSA bacteria. (\u003cstrong\u003eA\u003c/strong\u003e) Top 20 DEMs (Differentially Expressed Metabolites) identified in 3A-PCL-F3 compared to 3A. (\u003cstrong\u003eB\u003c/strong\u003e) IPA comparing regulation of metabolic pathways in the implant groups relative to the IC at the acute phase. To discern significant differences among the groups, a comparative analysis was conducted using a threshold of -log(p-value) \u0026gt; 1.3. (\u003cstrong\u003eC\u003c/strong\u003e) The regulatory network significantly present only in 3A-PCL-F3, identified by IPA. Cellular events/canonical pathways/regulators that were activated are indicated in orange, while others that were suppressed are indicated in blue. (\u003cstrong\u003eD\u003c/strong\u003e) Correlations among the DEMs of different classes in 3A-PCL-F3. (\u003cstrong\u003eE\u003c/strong\u003e) IPA comparing regulation of metabolic pathways in 3A and 3A-PCL-F3 with respect to the NIC in the chronic phase. (See \u003cstrong\u003eTable S3 \u003c/strong\u003eand\u003cstrong\u003e S4 \u003c/strong\u003efor detailed metabolomic analysis results in the acute and chronic phases, respectively)\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/0e566e63e072d6a74f415495.png"},{"id":54270281,"identity":"00bbd2dc-e99c-4df3-af8a-ab6ab7c3561a","added_by":"auto","created_at":"2024-04-08 06:31:55","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":163890,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic showing mode of action of 2D and 3D antibacterial polymer coatings: (A) 2D antibacterial coating, (B) 3D antibacterial coating, (C) Analyses of 2D [3] and 3D antibacterial coatings\u003c/p\u003e","description":"","filename":"image9.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/b8ee7597b762c98a38d222b9.png"},{"id":54271105,"identity":"f3031a47-8e5d-4c82-8cdb-98f77684e074","added_by":"auto","created_at":"2024-04-08 06:47:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5341739,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/efd53c0f-3505-4a7a-9b93-d4e4bddabbaf.pdf"},{"id":54270277,"identity":"818ee3db-a36b-4cd4-880f-fdec99de319f","added_by":"auto","created_at":"2024-04-08 06:31:54","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":217942,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphic abstract for 3D coating of PCL and F3\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Graphicabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/991e280de25a795df8547ea9.png"},{"id":54270498,"identity":"97931a19-cc38-4eb9-945a-9c2bcc9d8ea4","added_by":"auto","created_at":"2024-04-08 06:39:55","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":41458516,"visible":true,"origin":"","legend":"","description":"","filename":"Supplfiguresandtables1.zip","url":"https://assets-eu.researchsquare.com/files/rs-4220574/v1/b3c34498e9af7c55057c4ba1.zip"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eCaerin 1.9\u003c/strong\u003e-\u003cstrong\u003epolycaprolactone-coated magnesium implants enhance antibacterial performance and reduce foreign body responses in Sprague-Dawley rats\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eGlobally, populations are aging, presenting significant challenges to healthcare systems worldwide. Among the pressing issues associated with aging are fractures resulting from accidents and osteoporosis, particularly affecting the elderly [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Studies reveal that around half of women and one-fifth of men aged fifty and above have encountered at least one fracture [\u003cspan additionalcitationids=\"CR3 CR4\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Conventional bone internal fixation materials, such as titanium and stainless-steel alloys, exhibit notable differences in mechanical and physical properties compared to human bone tissue with negative impacts on biocompatibility. Particularly, notable differences in elastic moduli causes 'stress shielding' around the implant leading to failure [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Additionally, local release of metal ions elevates pH levels and increases risk of infection or inflammatory reactions [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Conversely, polymer implant materials face limitations due to their inferior mechanical properties [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Whether used as used as permanent or temporary implants, these materials often necessitate multiple surgeries, leading to unfavourable hospital experiences and financial burdens for patients [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Thus, there is a growing demand for materials with better biocompatibility for internal fixation, repair, and replacement of bone tissue. Among them, degradable metals-based biomaterials with compositions based on nutritionally essential trace elements (Mg, Fe, and Zn) are receiving substantial attention as they can provide necessary mechanical support and then degrade naturally with outstanding biocompatibility [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOrthopaedic applications impose stringent requirements on implants, encompassing mechanical and corrosion properties. These criteria include excellent mechanical strength (elastic modulus: 10\u0026ndash;20 GPa), osseointegration capability, and outstanding wear and corrosion resistance and/or degradation products which are well-tolerated in the human body. Magnesium (Mg) is emerging as a promising solution as it possesses a density and modulus akin to human bones [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Mg and its alloys provide high specific strength and the appropriate stiffness needed for hard tissue implants [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Moreover, Mg is essential for human health, playing a pivotal role in numerous physiological processes. Adults typically intake Mg\u003csup\u003e2+\u003c/sup\u003e daily in the range of 240\u0026ndash;420 mg, significantly surpassing intakes of other beneficial elements such as Fe\u003csup\u003e3+\u003c/sup\u003e (8\u0026ndash;18 mg) and Zn\u003csup\u003e2+\u003c/sup\u003e (8\u0026ndash;11 mg) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Over 60% of Mg in the human body is stored in the bones and muscles, totalling around 30g [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Mg participates in various metabolic processes, including protein synthesis, enzyme activation, regulation of the central nervous system, muscle function, and the operation of vital organs like the intestines and stomach. Additionally, Mg engages in physiological activities like calcium antagonism [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] and serves as a signal transmitter [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Despite its advantageous properties, the rapid degradation of Mg alloys in the human body has limited their clinical use. Consequently, various approaches have been employed to enhance the corrosion resistance of Mg alloys. These techniques encompass alloying [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan additionalcitationids=\"CR23 CR24 CR25\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], processing and surface modification [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan additionalcitationids=\"CR28 CR29 CR30\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], as well as the application of protective coatings [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan additionalcitationids=\"CR33 CR34 CR35\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAnother significant issue adversely affecting the usage of metal-based implant materials is periprosthetic infection (PPI), resulting from bacterial accumulation, colonisation, and biofilm formation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, and \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Clinical treatments for PPI involve antimicrobial therapies, surgical interventions; implant removal and replacement, all of which necessitate periods of post-operative recovery. This often leads to physical and mental discomfort for patients, along with unexpected expenses [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Recent studies have revealed that pure Mg exhibits antibacterial behaviours in both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e settings [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, its rapid degradation can lead to adverse physiological effects, including alkalosis, local inflammation, and cell death [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Consequently, Mg alloys in conjunction with surface engineering which provides slower degradation rates and enhanced antibacterial properties is required for further development of degradable Mg alloy-based biomaterials.\u003c/p\u003e \u003cp\u003ePreviously, the authors have reported on polymer-based coatings to improve corrosion resistance and biocompatibility of Mg alloys, and through incorporation of a natural host-defence peptide within the coating, exhibit outstanding antibacterial behaviours [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Cationic host defence peptides (CHDP), also known as antimicrobial peptides, can play a crucial role in infection control through direct micro-biocidal effects and/or by modulating host immune responses, while exhibiting the capacity to the limit heightened inflammation [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Widely expressed across various species, ranging from microorganisms, plants and invertebrates to more complex amphibians and mammals, CHDP are typically amphipathic small peptides with no more than 50 amino acids and a net positive charge of +\u0026thinsp;2 to +\u0026thinsp;9 at physiological pH [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. An example of CHDP is caerin 1.9 (F3), derived from the Australian tree frog of the genus \u003cem\u003eLitoria\u003c/em\u003e [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In our previous study, we immobilised F3 on surfaces of differently treated Mg alloys through a chemical click reaction. The F3-coated fully annealed Mg AZ31 significantly improved corrosion resistance and demonstrated up to 120 hours of bacterial resistance \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The fully annealed microstructure of AZ31 seems to offer an optimised substrate for the immobilisation of the peptide and displayed enhanced corrosion resistance both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In addition, FA AZ31 activated signalling pathways that promote tissue repair, while reducing inflammation and immune responses [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, aimed at enhancing antibacterial properties of Mg alloy biomaterials, we designed a three-dimensional (3D) coating utilising polycaprolactone (PCL) and F3 on the surfaces of three types of Mg specimens, including pure Mg (2P), cold-extruded AZ31 (1E) and FA AZ31 (3A). Our investigation delved into the \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e behaviours of these coated Mg specimens, involving the introduction of methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (MRSA) at the implantation sites in a rat model. The results revealed that all coated Mg specimens displayed improved corrosion resistance, significant antibacterial efficacy in both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e contexts, and heightened biocompatibility concerning impacts on selected vital organs and foreign body reactions. Of particular note, was the outstanding \u003cem\u003ein vivo\u003c/em\u003e performance observed with the PCL and F3-coated 3A condition which demonstrated enhanced activation of immune responses during the acute phase (within three days after implantation) of bacterial infection and optimal biocompatibility over the chronic phase (within three months after implantation) in a rat model. The findings indicate that the PCL-F3-coated 3A (referred to as 3A-PCL-F3) holds significant promise for application as a degradable biomaterial for medical implants.\u003c/p\u003e "},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Mg alloys and specimen preparation\u003c/h2\u003e \u003cp\u003eThree different Mg alloys were used in this study, including 1E, 2P, and 3A. The 3A samples underwent a full recrystallisation annealing heat treatment, as described previously [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In brief, they were heated to 330\u0026ndash;350 \u003csup\u003eo\u003c/sup\u003eC in argon, held for 3\u0026ndash;5 h, and then furnace cooled. The specimens were fabricated as small pins with a thickness of 5mm and thickness of 2 mm. In addition, samples of conventional medical Ti and 316L stainless steel with a similar size were also included in the study for comparison to the Mg alloys. Before the \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments, the alloy samples were polished. They were initially treated with 400-grit silicon carbide paper for 1\u0026ndash;3 min to remove the original oxide layer. Then, they were polished by 800\u0026ndash;2400 grit silicon carbide paper for 2\u0026ndash;5 min to improve the sample surface qualities and achieve uniform roughness. After each step of polishing and grinding, the specimens were rotated by 90\u0026deg; to ensure that the subsequent procedures removed the scratches generated in the previous step. Finally, all samples were cleaned in 70% ethanol at room temperature for 5 min using ultrasonics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Peptide synthesis\u003c/h2\u003e \u003cp\u003eCaerin 1.9 (F3) (GLFGVLGSIAKHVLPHVVPVIAEKL-NH\u003csub\u003e2\u003c/sub\u003e) were synthesized by ChinaPeptides Co., LTD (Shanghai, China). The purity of the peptides exceeded 99% as determined by ChinaPeptides Co., LTD using reverse-phase HPLC [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cell lines and osteoblast adhesion test\u003c/h2\u003e \u003cp\u003eMC3T3-E1 cells were procured from the cell resource centre of Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences. MC3T3-E1 osteoblasts were seeded into a 6-well plate with 1.0\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells and 2 ml culture medium per well. All the specimens were divided into 4 groups: one group is untreated, three other groups are Ti, 316L, and 3A respectively. Three metal specimens were placed into six-well plates according to group-set and cultured together for 48 h. After 48 h, the supernatant was collected completely, then 300 \u0026micro;l of trypsin was added, and the solution was placed in a cell culture incubator to digest the metal-treated MC3T3-E1 cells for 2 min. After 2 min, the cells were taken out, then observed under a microscope for the analysis of cells\u0026rsquo; digestion, and photos were taken. The undigested MC3T3-E1 cells were placed in the incubator to continue the digestion until the cells were fully digested.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 EBSD mapping\u003c/h2\u003e \u003cp\u003eElectron backscatter diffraction (EBSD) mapping of the Mg alloy microstructures was performed at the Institute of Industrial Sciences of the University of Tokyo using a JOEL JSM-7100F field emission gun scanning electron microscope. The EBSD scanning was carried out with an accelerating voltage of 15 kV and a scanning step size of 0.5 \u0026micro;m. Further details on the EBSD sample preparation method can be found in references [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The EBSD mapping position were as follows: ED/RD refers to the extrusion/rolling direction, TD is the transverse direction, and ND is the normal direction. The analysis of the EBSD mapping results was conducted using orientation-imaging microscopy (OIM) V7.0.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Micro hardness test\u003c/h2\u003e \u003cp\u003eMicro hardness tests were performed on the round specimens (diameter is 5mm, and thickness is 2 mm) with a roughness of 800 using an HMV-G micro-Vickers hardness tester at the Institute of Industrial Sciences (IIS) of the University of Tokyo, applying a load of HV0.01 (98.07mN) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Uniaxial tensile test\u003c/h2\u003e \u003cp\u003eUniaxial tensile tests were performed using a 100 KN Shimadzu universal material testing machine at the University of the Sunshine Coast. The Mg sample had the following dimensions: an engaged length of 30 mm, an overall length of 110 mm, and a rod diameter of 5 mm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Physical 3D coating of PCL and caerin peptide F3\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe samples prepared following section \u003cspan refid=\"Sec3\" class=\"InternalRef\"\u003e2.1\u003c/span\u003e were inactivated by exposing to UV light for 30 min prior to the coating process (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Biocompatible polycaprolactone (PCL) was chosen as the coating material for the metal surface. PCL pellets were dissolved in 10 ml pure chloroform to a ratio of 2% W/V, and then 45 mg F3 was added to the chloroform-PCL solution, followed by thorough vortex mixing at room temperature for approximately 2 h until a homogeneous solution was achieved. The metal samples were immersed in the solution and air-dried in a fume hood for 10 min. This step was repeated four more times. Figures\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC provide visual representations of the Mg alloy samples with F3 coating.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 FTIR tests\u003c/h2\u003e \u003cp\u003eIR spectra was obtained on a Spectrum Two FT-IR spectrometer (Perkin-Elmer, Waltham, MA) at room temperature, with the scan wavelength 4000\u0026ndash;5500 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. As a comparison, the IR spectra of PCL-coating (without peptide immobilisation) and PCL-F3 coating were also measured.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Water contact angles test\u003c/h2\u003e \u003cp\u003eWater contact angle measurements were conducted using a drop shape analysing by dropping with pure water to evaluate the hydrophilicity of the different titanium surfaces [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Mitochondrial membrane potential (ΔΨm) assay\u003c/h2\u003e \u003cp\u003eTwo devices were employed to analyse the mitochondrial membrane potential, including laser scanning confocal microscope and flow cytometer. The related methods are described as follows:\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe analysis of mitochondrial membrane potential with a laser scanning confocal microscope\u003c/b\u003e \u003c/p\u003e \u003cp\u003eΔΨm was detected using the JC-1 MOMP detection kit (Biosharp). MC3T3-E1 cells, a MC3T3-E1 Subclone 14 cell line (Mouse cranial parietal pre-cell subclonal 14), were seeded in a 24-well plate (5.0\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells per well in 0.5 ml DMEM medium). Three groups of Mg specimens were selected: 1E, 2P, and 3A. The sizes of three groups of specimens are all the same: length is 2.15 mm; width is 0.6 mm, 3 specimens in each group. These three groups of Mg specimens were employed to stimulate cells at 37 \u0026deg;C overnight. After removing the Mg specimens and the culture medium, the cells with PBS were washed once, then 500 \u0026micro;l of cell culture medium (excluding double antibodies), and 500 \u0026micro;l of 1\u0026times; JC-1 dyeing working solution were added and until the three solutions were mixed evenly. The evenly mixed solution was incubated at 37\u0026deg;C in a cell incubator for 30 minutes. After incubation, the supernatant was removed and 1\u0026times; JC-1 staining buffer was used to wash twice, and the remaining solution was immediately analysed by using a Laser confocal microscope (Leica). Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) was used as a positive control.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe analysis of mitochondrial membrane potential with a flow cytometer\u003c/b\u003e \u003c/p\u003e \u003cp\u003eMC3T3-E1 cells, a MC3T3-E1 Subclone 14 cell line (Mouse cranial parietal pre-cell subclonal 14), were seeded in a 24-well plate (5.0\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells per well in 0.5 ml DMEM medium). 1E, 2P, and 3A specimens were used, with a length of 2.15 mm and a width of 0.6 mm. They were co-cultured with the cells at 37 \u0026deg;C overnight and removed, and the cells were washed once with PBS. Then, 500 \u0026micro;l of cell culture medium (excluding double antibodies) and 500 \u0026micro;l of 1 \u0026times; JC-1 dyeing working solution were added, and the mixture was incubated at 37 \u0026deg;C for 30 min. The supernatant was removed, and the cells were washed by using 1\u0026times;JC-1 staining buffer, followed by the addition of 200 \u0026micro;l trypsin solution and incubation for 1.5 min. The digestion was terminated by using 400 \u0026micro;l of double antibody-free culture medium, with the cells transferred into Eppendorf tubes and centrifuged with 1,200 rpm for 5 min at 4 \u0026deg;C. The supernatant was discarded, and the cells were washed twice with 1\u0026times;JC-1 staining buffer and resuspended in 300 \u0026micro;l of wash buffer. Quantitative analysis was conducted by a flow cytometry (BD FACSAria): FITC indicates green fluorescence, PI indicates red fluorescence, and PI/FITC is the level of MOMP depolarisation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Invitro antibacterial tests\u003c/h2\u003e \u003cp\u003eThe invitro antibacterial tests were conducted by following our previous method [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. After 3\u0026ndash;5 min ultrasonic cleaning in the distilled water, all F3 and PCL coated Mg alloys samples (1E-PCL-F3, 2P\u0026ndash;PCL-F3 and 3A\u0026ndash;PCL-F3) were put into a bacteriostatic petri dish to conduct a 100-hr bacteriostatic test on drug-resistant \u003cem\u003eS. aureus\u003c/em\u003e in a 37\u0026deg;C temperature incubator. The methicillin-resistant \u003cem\u003eS. aureus\u003c/em\u003e (MRSA, GDM1.1263) were cultured to a logarithmic phase and adjust the suspension concentration of MH (Mueller-Hinton) medium to 2.0 \u0026times; 105 CFU/ml. A sterile cotton swab was used to dip the bacteria solution and squeeze the tube wall several times to remove the excess. The swab was used to smear the entire M-H drug-sensitive agar plate (Guangzhou Yuanming Bio Company). Aliquots of 30 \u0026micro;g of F1 and F3 peptides were added drug-sensitive papers (OXOID, UK) and the papers were pasted on M-H agar plates. The plates were inverted and incubated at 37\u0026deg;C overnight. A volume of 30 \u0026micro;g piperacillin sodium and tazobactam sodium with a weight ratio of 8:1 (Tazocin, Haikou Qili Pharmaceutical Co., Ltd, Haikou) and blank drug-sensitive tablets (BASD, Thermo Fisher Scientific, Shanghai) and two original AZ31 Mg alloys were used as controls. A Vernier calliper was used to measure the size of the zone of inhibition.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 MTT tests\u003c/h2\u003e \u003cp\u003eMC3T3-E1 cells were seeded in 96-well plates (1.0\u0026times;104 cells per well, 0.1 ml medium) overnight and divided into 4 groups, which were control group, 1E, 2P, and 3A metal material groups. On the second day, three kinds of metal materials, 1E, 2P and 3A, were added to the 96-well plates respectively, cultured in the incubator for 24 hours, and the metal materials were removed. 5 mg/mL of 20\u0026micro;l MTT was added to each well and incubated in a 5% CO2 incubator at 37℃ for 4 h. The culture medium was removed, 150 ul DMSO was added, and OD value of 490 nm absorbance was measured by Microplate Reader (Thermo).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Real time PCR tests\u003c/h2\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.13.1 RNA Isolation\u003c/h2\u003e \u003cp\u003eAfter co-culturing osteoblasts with metals 3A, 316L, and Ti for 48 hours, the metals were removed. The cells were then treated with trypsin, followed by centrifugation at 1200 rpm for 5 minutes. RNA from the osteoblasts was extracted using the Trizol method. The quality and concentration of the isolated RNA samples were evaluated using a micro-UV-Vis spectrophotometer (AmoyDxNanoDrop 2000c, Xiamen, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.13.2 Quantitative PCR (qPCR)\u003c/h2\u003e \u003cp\u003eThe expression of BRF1, Ctnna1, and KAT6A genes in osteoblasts was detected using the qPCR method. A β-actin-specific primer was used as an internal control. The sequences of the gene primers used for amplification are listed in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. cDNA was synthesized from 1\u0026micro;g RNA using the PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time). qPCR was performed according to the instructions of the TB Green\u0026reg; Premix Ex Taq\u0026trade; II (Tli RNaseH Plus) (TaKaRa RR820A). The instrument used was the Roche LC480 from Roche Diagnostics, Switzerland. The thermal cycling conditions were set as follows: initial denaturation at 95\u0026deg;C for 30 seconds, followed by 40 cycles of PCR reaction: 95\u0026deg;C for 5 seconds, 60\u0026deg;C for 20 seconds; and a dissociation curve analysis: 95\u0026deg;C for 5 seconds, 60\u0026deg;C for 1 minute, and 95\u0026deg;C for 0 seconds. Each qPCR was conducted in triplicate.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNucleotide sequences of the primers used for quantitative PCR analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;\u0026minus;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eβ-actin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward TATAAAACCCGGCGGCGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse GTCATCCATGGCGAACTGGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBRF1_1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward CCACTCTTTCCCCAAGAGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse GAGGAACAGAACTGTGTTTTGATGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBRF1_2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward ATGGTGGGACGAGGATACCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse GCTGCAAATTCTCTTGGGGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCtnna1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward CAGTTCGCTGCAGAAATGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse CCTGTGTAACAAGAGGCTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eKAT6A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward ATGGTAAAACTCGCTAACCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse CGTCCCGTCTTTGACGCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.14 \u003cem\u003eIn vivo\u003c/em\u003e tests\u003c/h2\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.14.1\u003c/b\u003e \u003cb\u003eRats\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eSix to eight weeks old Sprague Dawley (SD) rats were procured from the Animal Resource Centre of Guangdong Province. The rats were housed at the Animal Facility of the Foshan First People\u0026rsquo;s Hospital in Guangdong, China. All experimental procedures were approved and conducted in accordance with the guidelines of Animal Experimentation Ethics Committee (Ethics Approval Number: C202307-5) by the Foshan First People\u0026rsquo;s Hospital, the University of the Sunshine Coast\u0026rsquo;s Animal Ethics Committee (Ethics Approval Number: ANE23105). The rats were maintained in Specific-Pathogen-Free (SPF) conditions on a 12 h light/dark cycle at 22\u0026deg;C with 75% humidity. Each rat was individually housed in a cage and provided with sterilised standard mouse food and water. At the conclusion of each experiment, rats were euthanised by CO\u003csub\u003e2\u003c/sub\u003e inhalation, confirmed by the cessation of breath and heart function [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e2.14.2 Metal implants in rat femur\u003c/h2\u003e \u003cp\u003eThe ultrasonically cleaned specimens were exposed to UV radiation for 30 min on each side for sterilisation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The implantation was conducted in the animal house of Foshan First People\u0026rsquo;s Hospital. Twelve 8-week-old male SPF SD Rats were weighed at 266.646g. Rats were randomly divided into four groups, including control (no implants), 1E, 2P and 3A groups. Rats were anesthetised by intraperitoneal (\u003cem\u003ei.p.)\u003c/em\u003e injection of 1% sodium pentobarbital solution with a dose of 40 mg/kg. A sterile blade was used to cut about 1cm perpendicular to the femoral shaft, then the subcutaneous tissue and muscle were separated until the femoral condyle of the rats was exposed. A grinding drill was used to drill a hole located at the lateral condyle of the rats' femur perpendicular to the longitudinal axis of the femur [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The control group was not embedded with any implant after drilling. The incision was sutured layer by layer with 4\u0026thinsp;\u0026minus;\u0026thinsp;0 absorbable sutures.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e2.14.3 Degradation and biocompatibility of implants\u003c/h2\u003e \u003cp\u003eAfter 9 days of implantation, the rats were anesthetised via intraperitoneal injection of 1% sodium pentobarbital at the dose of 40 mg/kg. Peripheral blood samples were collected by eye bleeding for the investigation of serum electrolyte, liver, and kidney function. Following the blood collection, the rats were euthanised. The implants were removed from the femoral condyle, cleaned, dried and disinfected. After complete removal of attached soft tissue was completely removed, the implants were photographed to evaluate the degree of degradation. The organ tissues (including heart, liver, spleen, lung, kidney, brain, ovary, etc.) were collected and fixed with 10% formalin for hematoxylin-eosin (HE) staining. Furthermore, other several groups\u0026rsquo; tests last about 3 months. Post 3 months, the same tests including degradation and biocompatibility will be repeated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e2.14.4 SEM-EDS analysis\u003c/h2\u003e \u003cp\u003eMg alloy specimens were removed from the SD rats after 9 days of implantation, then cleaned ultrasonically with 70% ethanol and rinsed in distilled water for 3\u0026ndash;5 minutes. SEM-EDS analysis was conducted on Zeiss Sigma 300 Field Emission Electron Gun (FEG)-Scanning Electron Microscopy (SEM) with the following parameters: EHT is 3.00 KV, WD is 5.4 and Mag is 100\u0026times;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e2.14.5 Computerised tomography imaging\u003c/h2\u003e \u003cp\u003eThree-dimensional computerised tomography (3D CT) scans were conducted at the First People\u0026rsquo;s Hospital of Foshan. A clinical 64 slices CT system, specifically the GE Discovery 64 model from GE Healthcare (Waukehsa, USA), was utilised. All 3D CT imaging was performed while the rats were under an anaesthesia [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. For detailed CT methods, please refer to the \u003cb\u003eSupplementary Methods.\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e2.14.6 Cytokine ELISA\u003c/h2\u003e \u003cp\u003eCytokine ELISA for rat sera, targeting TNFα, IL-10, MCP-1 and IL-1β, was conducted using kits obtained from R\u0026amp;D system (Minneapolis, USA). The assays were performed following the manufacturer\u0026rsquo;s protocol provided.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e2.15 Proteomics analysis\u003c/h2\u003e \u003cp\u003e \u003cb\u003eProtein sample preparation\u003c/b\u003e \u003c/p\u003e \u003cp\u003eEither MC3T3-E1 cells collected from the co-culture with Mg specimen or mouse tissue samples were homogenised in SDT buffer (4%SDS, 100mM Tris-HCl, 1mM DTT, pH7.6), and 200 \u0026micro;g of proteins for each sample were subjected to trypsin digestion according to the filter-aided sample preparation (FASP) procedure described elsewhere [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The protein suspensions were digested with trypsin (Promega) overnight at 37\u0026deg;C, and the resulting peptides were desalted on C18 Cartridges (Empore\u0026trade; SPE Cartridges C18, bed I.D. 7 mm, volume 3 ml, Sigma), and lyophilised by vacuum centrifugation for TMT10plex labelling. A total of 100 \u0026micro;g peptide mixture of each sample was labelled using TMT reagent according to the manufacturer\u0026rsquo;s instructions (Thermo Scientific). Labelled peptides were fractionated by SCX chromatography using an AKTA Purifier system (GE Healthcare). The collected fractions were desalted on C18 Cartridges, lyophilised and resuspended for LC-MS/MS analysis (see \u003cb\u003eSupplementary Methods\u003c/b\u003e for more details).\u003c/p\u003e \u003cp\u003e \u003cb\u003enanoLC tandem Q-Exactive MS/MS analyses\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe peptide samples were analysed using a Q Exactive mass spectrometer coupled to Easy nLC (Thermo Scientific) following the method detailed previously. In brief, the peptides were loaded onto a reverse phase trap column (Thermo Scientific Acclaim PepMap100, 100 \u0026micro;m\u0026times;2 cm, nanoViper C18) connected to the C18-reversed phase analytical column (Thermo Scientific Easy Column, 10 cm long, 75 \u0026micro;m inner diameter, 3\u0026micro;m resin) in buffer A (0.1% Formic acid) and separated with a linear gradient of buffer B (84% acetonitrile and 0.1% Formic acid) at a flow rate of 300 nl/min. The mass spectrometer was operated in positive ion mode. MS data was acquired using a data-dependent top10 method dynamically selecting the most abundant precursor ions from the survey scan (300\u0026ndash;1800 m/z) for HCD fragmentation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eProtein identification and quantitation\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe MS/MS data was searched against Ensembl_Rattus_29107_20200311 (76,417 sequences, downloaded on Dec 12, 2014) database for protein identification using Mascot2.2 (Matrix Science, London, UK) and Proteome Discoverer1.4 software (Thermo Fisher Scientific, Waltham, MA, USA) with the following search settings: enzyme trypsin; two missed cleavage sites; precursor mass tolerance 20 ppm; fragment mass tolerance 0.1 Da; fixed modifications: Carbamidomethyl (C), TMT 10plex (N-term), TMT10 plex (K); variable modifications: oxidation (M), TMT 10plex (Y). The results of the search were further submitted to generate the final report using a cut-off of 1% FDR on peptide levels and only unique peptides were used for protein quantitation. All peptide ratios were normalised by the median protein ratio, and the median protein ratio was 1 after the normalisation. The significance of protein contents was statistically analysed using the student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test. The protein showing a fold change\u0026thinsp;\u0026ge;\u0026thinsp;1.2 compared to the control group and the \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significantly regulated.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGene ontology, domain and KEGG pathway analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe protein sequences of differentially expressed proteins were locally searched using the NCBI BLAST\u0026thinsp;+\u0026thinsp;client software (Version. 2.2.28). Gene ontology (GO) terms were mapped, and sequences were annotated using OMICSBOX software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.biobam.com/omicsbox/\u003c/span\u003e\u003cspan address=\"https://www.biobam.com/omicsbox/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). InterProScan software within OMICSBOX was used to identify protein domain signatures from the InterPro member database Pfam. Protein sequences were also compared with the online Kyoto Encyclopedia of Genes and Genomes (KEGG) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://geneontology.org/\u003c/span\u003e\u003cspan address=\"http://geneontology.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to retrieve their KEGG orthology identifications and map them to pathways in KEGG. Enrichment analysis was performed using the Fisher\u0026rsquo;s exact test, with the entire set of quantified proteins as background dataset. Benjamini-Hochberg correction for multiple testing was applied to adjust derived \u003cem\u003eP\u003c/em\u003e-values. Only functional categories and pathways with \u003cem\u003eP\u003c/em\u003e-value less than 0.05 were considered statistically significant.\u003c/p\u003e \u003cp\u003e \u003cb\u003eProtein-protein interaction analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe protein\u0026ndash;protein interaction (PPI) information for the studied proteins was obtained from IntAct molecular interaction database [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ebi.ac.uk/intact/\u003c/span\u003e\u003cspan address=\"http://www.ebi.ac.uk/intact/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using their gene symbols. Alternatively, STRING (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://string-db.org/\u003c/span\u003e\u003cspan address=\"http://string-db.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for PPI retrieval. The obtained results were downloaded and visualised through Cytoscape software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cytoscape.org/\u003c/span\u003e\u003cspan address=\"http://www.cytoscape.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, version 3.2.1). The statistical analysis of the PPI was conducted using the Network Analyser [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] in Cytoscape.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e2.16 Metabolomics analysis\u003c/h2\u003e \u003cp\u003e \u003cb\u003eSample preparation and extraction\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe rat tissue samples stored at -80\u0026deg;C refrigerator was thawed on ice. The thawed sample was homogenised for 20 s using a grinder operating at 30 Hz. A 400 \u0026micro;l solution (methanol: water\u0026thinsp;=\u0026thinsp;7:3, V/V) containing an internal standard was added in to 20 mg grinded sample, and shaken at 1,500 rpm for 5 min. After allowing it to on ice for 15 min, the sample was centrifuged at 12,000 rpm for 10 min at 4\u0026deg;C. A 300 \u0026micro;l portion of the supernatant was collected and placed in -20\u0026deg;C for 30 min. The sample was then centrifuged at 12,000 rpm for 3 min at 4\u0026deg;C. 200 \u0026micro;l aliquots of supernatant were transferred for LC-MS analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eLC-ESI-MS/MS analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe sample extracts were analysed using an LC-ESI-MS/MS system (UPLC, ExionLC AD; MS, QTRAP). The analytical conditions were as follows, UPLC: column, Waters ACQUITY UPLC HSS T3 C18 (1.8 \u0026micro;m, 2.1 mm \u0026times; 100 mm); column temperature, 40\u0026deg;C; flow rate, 0.4 ml/min; injection volume, 2 \u0026micro;l; solvent system, water (0.1% formic acid): acetonitrile (0.1% formic acid); gradient program, 95:5 V/V at 0 min, 10:90 V/V at 11.0 min, 10:90 V/V at 12.0 min, 95:5 V/V at 12.1 min, 95:5 V/V at 14.0 min. LIT and triple quadrupole (QQQ) scans were acquired on a QTRAP\u0026reg; LC-MS/MS System, equipped with an ESI Turbo Ion-Spray interface, operating in positive and negative ion mode and controlled by Analyst 1.6.3 software. The ESI source operation parameters were as follows: source temperature 500\u0026deg;C; ion spray voltage (IS) 5500 V (positive), -4500 V (negative); ion source gas I (GSI), gas II (GSII), curtain gases (CUR) were set at 55, 60, and 25.0 psi, respectively; the collision gas (CAD) was high. Instrument tuning and mass calibration were performed with 10 and 100 \u0026micro;mol/L polypropylene glycol solutions in QQQ and LIT modes, respectively. A specific set of MRM transitions were monitored for each period according to the metabolites eluted within this period.\u003c/p\u003e \u003cp\u003e \u003cb\u003eData analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUnsupervised PCA (principal component analysis) was performed by statistics function \u0026ldquo;prcomp\u0026rdquo; within R (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"https://www.biobam.com/omicsbox/\" target=\"_blank\"\u003ewww.r-project.org\u003c/a\u003e\u003c/span\u003e\u003cspan address=\"http://www.r-project.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The data were scaled to unit variance before conducting unsupervised PCA. The results of HCA (hierarchical cluster analysis) for samples and metabolites were presented as heatmaps with dendrograms. Pearson correlation coefficients (PCC) between samples were calculated by the \u0026ldquo;cor\u0026rdquo; function in R and displayed as heatmaps. Both HCA and PCC calculations were carried out using the R package ComplexHeatmap. For HCA, normalised signal intensities of metabolites (unit variance scaling) are visualised as a colour spectrum.\u003c/p\u003e \u003cp\u003eSignificantly regulated metabolites between groups were determined based on the criteria of VIP\u0026thinsp;\u0026ge;\u0026thinsp;1 and an absolute Log2FC (fold change)\u0026thinsp;\u0026ge;\u0026thinsp;1. VIP values were extracted from OPLS-DA result, which also included score plots and permutation plot. The data was log-transform (log2) and mean-centred before OPLS-DA. To prevent overfitting, a permutation test (200 permutations) was performed. Identified metabolites were annotated using KEGG Compound database, and the annotated metabolites were subsequently mapped to KEGG Pathway database. Significantly, enriched pathways were identified using a hypergeometric test\u0026rsquo;s \u003cem\u003eP\u003c/em\u003e-value for a given list of metabolites.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\n\u003ch2\u003e3.1 Characteristics of Mg alloys\u003c/h2\u003e\n\u003cp\u003eThe measured thicknesses of the three groups of specimens is presented in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA: 2P is thickest at 2.1mm; 2E and 3A have the similar thickness, with the values of 2.07mm and 2.05mm respectively. The microstructure and mechanical properties of 1E, 2P and 3A were firstly investigated. The average grain sizes were 22.2 \u0026micro;m for 2P, 9.2 \u0026micro;m for 1E and 15.9 \u0026micro;m for 3A (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB\u003cstrong\u003e)\u003c/strong\u003e samples. The misorientation angles of 2P and 3A showed the same tendency, neighbouring grains exhibiting angles between 1 and 3 degrees, suggesting that the two annealed Mg alloy microstructures have similar characteristics (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC). Meanwhile the misorientation angle of 1E condition is significantly different from those of 2P and 3A with the misorientation angle exhibiting a value of one. Cold extrusion led to different textures and microstructure along the extrusion direction (extrusion axis), while 2P and 3A both have the homogenous textures and microstructures.\u003c/p\u003e\n\u003cp\u003e1E has the highest average micro hardness of 81.6 HV, 2P has the lowest average micro hardness with a value of 41.5 HV, while 3A has a micro hardness of 66.5 HV [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]. Uniaxial testing results for the different Mg samples are shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD. Among the three groups, 1E has the highest strength with a yield strength of 233.4 MPa, maximum ultimate uniaxial tensile strength of 316.1MPa, and breaking strength of 272.7MPa. 3A has the second highest strength with yield strength of 204.8MPa, maximum strength of 277.9MPa, and breaking strength of 245.2MPa. Finally, 2P has the lowest uniaxial tensile strength with yield strength of 136.2MPa, maximum strength of 185.7MPa, and breaking strength of 159.1MPa. Both 1E and 3A meet strength requirements compatible with human bone which typically has yield strengths of at least 130\u0026ndash;180 MPa [\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\n\u003ch2\u003e3.2 Uncoated 3A stimulated proliferation of mouse osteoblast precursor cells\u003c/h2\u003e\n\u003cp\u003eIn our previous study, we revealed that in a mouse model the 3A condition activated fewer inflammation-associated pathways compared to 1E and 2P. Additionally, 3A induced signalling for cell organization and development, suggesting potential benefits for the recovery of injured tissues. Here, we investigate the effects of these materials on mouse osteoblast precursor MC3T3-E1 cells to assess potential impacts on bone development and growth. Our proteomic analysis revealed that more differentially expressed proteins (DEPs) were present in the 2P group, followed by 3A (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cstrong\u003eTable S1\u003c/strong\u003e). Seven upregulated DEPs were identified across all groups, including \u003cem\u003eBRPF1\u003c/em\u003e, \u003cem\u003eNR2C1\u003c/em\u003e, \u003cem\u003eACKR3\u003c/em\u003e, \u003cem\u003eSPP1\u003c/em\u003e, \u003cem\u003ePXDN\u003c/em\u003e, \u003cem\u003eCEP131\u003c/em\u003e, and \u003cem\u003eTNFAIP8\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). Notably, \u003cem\u003eBRPF1\u003c/em\u003e (Bromodomain and PHD Finger Containing 1) showed significant upregulation with 70, 48, and 64-fold changes in the 1E, 2P, and 3A groups, respectively. Regarding canonical pathways associated with \u0026lsquo;cellular growth, proliferation and development\u0026rsquo;, \u0026lsquo;growth factor signalling\u0026rsquo;, and \u0026lsquo;organismal growth and development\u0026rsquo;, the highest number of these pathways was activated in the 3A group compared to the untreated group, while less than 50% of these pathways were activated in the 1E group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC). Consequently, \u0026lsquo;binding of connective tissue cells\u0026rsquo;, \u0026lsquo;development of vasculature\u0026rsquo; and \u0026lsquo;mineralization of bone\u0026rsquo; were enhanced in 3A, while \u0026lsquo;bleeding\u0026rsquo; was comparatively inhibited (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e\n\u003cp\u003eThe proliferation of MC3T3-E1 cells was significantly enhanced, by approximately 16%, in the 3A condition relative to the untreated group, whereas no significant change was observed for 1E and 2P, nor in the medical Ti or 316L stainless steel groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE). Notably, 316L significantly inhibited growth of MC3T3-E1 cells. After 24 hours culture, a 2-minute trypsin digestion was not able to detach MC3T3-E1 cells from the plates in the 3A group, while a suspension of cells was observed in the other groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eF). After 15 minutes of digestion, many cells remained attached to the culture plates in the 3A group, whereas no attachment was observed in the other groups. At the mRNA level, the expression of the two mouse \u003cem\u003eBrpf1\u003c/em\u003e isomers was significantly upregulated only in the 3A group, as was expression of \u003cem\u003eCtnna1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eG).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec30\" class=\"Section2\"\u003e\n\u003ch2\u003e3.3 Characterisation of coated Mg alloys\u003c/h2\u003e\n\u003cp\u003eThe characteristics of Mg alloys with the F3 containing PCL coating were studied. All three coated metal sample groups had similar coating thickness averaging around 450 \u0026micro;m as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA. However, the weights of the coatings were different among the three sample groups (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB\u003cstrong\u003e)\u003c/strong\u003e. The 2P-PCL-F3 condition exhibited the highest coating weight with a value of 8.04 mg; 1E-PCL-F3 was next with a weight of about 6.53 mg and 3A-PCL-F3 had the lowest weight of 5.96 mg. The coatings changed the surface morphologies of the samples substantially. Before coating, 3A had a regular surface asperities and lower roughness as shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC. After coating, the surface of 3A in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eD was significantly rougher, with Ra and Rq values increased from 22.8 nm to 42.4 nm and 31.1 nm to 66.7 nm, respectively. SEM analysis in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eE showed that surface of the PCL-F3 coating developed in this work is as smooth as the PU-F3 coated surfaces in the prior study [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e], but its distribution is uneven and exhibits a regular granular structure on the metal surface. Further, the EDX/S analyses in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eF shows elemental distributions in the 3A-PCL-F3. The normal and transverse surfaces of coated samples had almost the same concentrations of nitrogen (4.98% and 4.96%, respectively), oxygen (19.36% and 19.67%, respectively) and carbon (62.2 and 60.17%, respectively). Therefore, it can be deduced that peptide distributions within the coatings were homogeneous and uniform across the surfaces.\u003c/p\u003e\n\u003cp\u003eThe results from FTIR analysis of the coated sample surfaces are shown in \u003cstrong\u003eFigure S1\u003c/strong\u003e. At wavelengths around 1100 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, the PCL signal is around 52%T, while for PCL-F3 it is more than 62%T. At a wavelength of 1150cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, the difference between the PCL and PC-F3 signals becomes more significant at around 28%T for PCL and 45%T for PCL-F3. At higher wavelengths (1750cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 3300cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) differences in the signals from PCL and PCL-F3 become less significant.\u003c/p\u003e\n\u003cp\u003eWater contact angles were conducted before and after application of the coatings to assess hygroscopic properties. They revealed that 2P had the lowest water contact angle of around 55.6\u0026deg; before coating, while after application of the PCL\u0026thinsp;+\u0026thinsp;F3 coating this was reduced to 38.2\u0026deg; indicative of the highest hydrophilicity compared with the other alloy samples. Meanwhile 1E and 3A both had similar water contact angles before application of the coating of 76.1\u0026deg; and 77.5\u0026deg;, respectively, which were reduced after the coating to 58.5\u0026deg; and 55.3\u0026deg;, respectively. The results show that the coatings substantially enhance hydrophilicity of the Mg alloy on the metal surfaces (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4 Coated Mg exhibited prolonged bactericidal effects, while in the acute phase the immune response was activated in all samples, except 3A\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ability to counter MRSA related infection was assessed in vitro for both uncoated and coated Mg alloys, and the results were compared to those from the peptide, F3, which displayed bactericidal activity for up to 72 h. The uncoated alloys exhibited no discernible impacts on MRSA infection, while all three coated Mg alloys demonstrated prolonged bacterial resistance. Specifically, 1E-PCL-F3 exhibited bactericidal effects lasting up to 120 h, whereas 2P-PCL-F3 and 3A-PCL-F3 inhibited MRSA up to 168 h, with the latter showing a slower decline in efficacy over time. Figure\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB shows the implantation sites, with 3A and 3A-PCL-F3 causing no significant inflammation during the acute stages. The numbers of MRSA isolated from tissues of similar weight collected during the acute phase were least in 3A-PCL-F3. Significant differences were observed between 3A-PCL-F3 and 1E-PCL-F3 consistent with the in vitro assay findings. Research has confirmed that F3 does not induce resistance to logarithmic P. aeruginosa and MRSA after 3 months culture, hence implantation of the PCL-F3 coated Mg samples is not expected to induce resistance to MRSA longer-term [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eCompared to the non-infected control (NIC), 2P showed the highest number of upregulated DEPs, followed by 3A-PCL-F3 and 1E-PCL-F3, with a similar trend observed in comparison with the infected control (IC) (\u003cstrong\u003eFigure S2A\u003c/strong\u003e and \u003cstrong\u003e5B\u003c/strong\u003e, and \u003cstrong\u003eTable S2\u003c/strong\u003e). 2P and 3A-PCL-F3 shared higher numbers of mutual upregulated DEPs compared to the NIC and IC. In 3A-PCL-F3, a total of 756 proteins were significantly upregulated, and 138 proteins were down-regulated compared to 3A. Among them were many proteins associated with cell homeostasis and tissue growth including \u003cem\u003eMTHFD1L\u003c/em\u003e, \u003cem\u003eSPARC\u003c/em\u003e, \u003cem\u003eATL3\u003c/em\u003e, \u003cem\u003eTGFBI\u003c/em\u003e, and \u003cem\u003eSEC61A1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eC). Trend analyses identified four profiles with significance (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Profile 17 exhibited 646 proteins with similar quantitative features in the 1E, 1E-PCL-F3, 2P, and 3A-PCL-F3 (\u003cstrong\u003eFigure S2C\u003c/strong\u003e). This profile exhibited the enrichment of immune response-relevant biological processes with the lowest FDR values, such as 'response to stress,' 'defence response,' and 'immune system response' (\u003cstrong\u003eFigure S2D\u003c/strong\u003e). Several biological processes related to mitochondrial function were among the top GO terms enriched in 3A, while processes possibly supporting an antibacterial environment, such as 'phagocytosis' and 'receptor-mediated endocytosis,' were highly enriched in 3A-PCL-F3 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD). The significant upregulation of \u003cem\u003eAIF1\u003c/em\u003e, \u003cem\u003eTXNDC5\u003c/em\u003e, \u003cem\u003eMYO1G\u003c/em\u003e, \u003cem\u003eITGB2\u003c/em\u003e, \u003cem\u003eSTXBP2\u003c/em\u003e, \u003cem\u003eVAMP8\u003c/em\u003e, \u003cem\u003eITGAM\u003c/em\u003e, and \u003cem\u003eANXA1\u003c/em\u003e supported the activation of 'phagocytosis' (\u003cstrong\u003eFigure S2E\u003c/strong\u003e) and 'cell activation involved in immune response' (\u003cstrong\u003eFigure S2F\u003c/strong\u003e), respectively.\u003c/p\u003e\n\u003cp\u003eAssessment of activation of the signalling response pathways in all implant groups relative to the IC revealed a distinctive feature in 3A which showed significant suppression of pathways associated with T cell function. These included the signalling of IL-8, IL-15, IL-2, IL-4, CD28, and CCR3 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE). Conversely, most of these showed increased activity in the other implant groups. Unique activation of the 'IL-12 signalling and production in macrophages' pathway was observed in 3A. Additionally, the upregulated DEPs supported significant activation of 'phagocytosis' specifically in 3A-PCL-F3 compared to the IC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eF). Furthermore, several other pathways potentially associated with bactericidal activity, such as 'immune response of myeloid cells', 'engulfment of myeloid cells', and 'migration of phagocytes', were also activated in 3A-PCL-F3 while 'bleeding' was significantly inhibited, suggesting potential favourable impacts on wound healing.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\n\u003ch2\u003e3.5 Uncoated and coated 3A showing better biocompatibility\u003c/h2\u003e\n\u003cp\u003eThere were more significantly up- or down-regulated DEPs in 3A-PCL-F3 compared to 3A with respect to the NIC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cstrong\u003eTable S3\u003c/strong\u003e). However, the overlap of DEPs between these two groups was limited. Notably, the biological processes enriched in 3A-PCL-F3 encompassed a multitude of metabolic activities associated with mitochondrial function. These included processes such as the 'tricarboxylic acid cycle,' 'mitochondrial electron transport, cytochrome c to oxygen,' 'proton transmembrane transport,' and 'mitochondrial ATP synthesis coupled electron transport' (\u003cstrong\u003eFigure S4A\u003c/strong\u003e). In contrast, 3A exhibited enrichment in developmental processes, such as diaphragm, seminal vesical epithelium, and seminal vesicle development (\u003cstrong\u003eFigure S4B\u003c/strong\u003e). Many DEPs upregulated in 3A-PCL-F3 play pivotal roles in cell growth and tissue repair, such as \u003cem\u003eFBLN2\u003c/em\u003e, \u003cem\u003eIGHM\u003c/em\u003e, \u003cem\u003eCLEC3B\u003c/em\u003e, \u003cem\u003eSUN1\u003c/em\u003e, and \u003cem\u003eCOL5A2\u003c/em\u003e (\u003cstrong\u003eFigure S4C\u003c/strong\u003e). Furthermore, upregulated DEPs exhibited extensive interactions. Notably, proteins like \u003cem\u003eSTAT3\u003c/em\u003e, \u003cem\u003eTUBB2B\u003c/em\u003e, \u003cem\u003eARF5\u003c/em\u003e, \u003cem\u003eSOD1\u003c/em\u003e, and \u003cem\u003eCANX\u003c/em\u003e displayed the highest connectivity. These proteins are mainly involved in regulating immune responses and cellular trafficking (\u003cstrong\u003eFigure S4D\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003eThere were important differences in the cellular components associated with the proteins in the 3A and 3A-PCL-F3. Proteins identified in the former were primarily linked to mitochondrial components, whereas the latter displayed enrichment of proteins in the extracellular region (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB). The top six most significantly enriched biological processes in 3A-PCL-F3 were all closely tied to cell growth and development. These processes encompassed 'regulation of insulin-like growth factor transport', 'FAM20C phosphorylates FAM20C substrates', and 'haemostasis' (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC and \u003cstrong\u003eFigure S4E\u003c/strong\u003e). Comparing immune response-relevant pathways at the chronic phase with those at the acute phase, a notable reduction in the degree of activation was observed in both 3A and 3A-PCL-F3, with respect to the NIC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD). Only one pathway with a z-score\u0026thinsp;\u0026gt;\u0026thinsp;2, granzyme A signalling, was activated in 3A-PCL-F3, while the 'neutrophil extracellular trap signalling pathway' was significantly and exceptionally suppressed. The extent of activation was substantially lower compared to the response at the acute phase when the implantation of 3A-PCL-F3 led to significant activation of immune responses. Blood samples from the 3A and 3A-PCL-F3 were used to evaluate IL10, TNF\u0026alpha;, and IL-1\u0026beta; levels, which appeared similar and indicated no systemic inflammation in the various implant groups compared to the control (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eE). Notably, no obvious pathological changes were detected in the tissues from the implantation sites, brain, heart, and ovaries, and tissues displayed normal morphological features (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eF\u003cstrong\u003e)\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6 Muscle cell proliferation was induced in 3A in the acute phase of bacterial infection, while metabolism of cholesterol derivatives was enhanced during the chronic phase\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExtracted metabolites from tissues at the implant sites were subjected to LC-MS/MS analysis assessed with respect to the IC in the acute phase. Metabolites such as L-homocystine, Phe-Lys, and 2-hydroxy-2-(4-hydroxy-3-methoxyphenyl) acetic acid showed remarkable upregulation, while there was distinct downregulation of several prostaglandins associated with oxidative stress and inflammation was in 3A (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eA). Significant regulation of multiple metabolic pathways was observed in the Mg alloy sample groups compared to the IC, with many more of them being suppressed than activated (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eB). The pathway that saw the most deactivation across all implants was the 'salvage pathways of pyrimidine deoxyribonucleotides'. Likewise, the biosynthesis of uridine-5'-phosphate, catecholamine, citrulline, and 'histamine degradation'\u0026mdash;essential pathways for DNA and RNA synthesis, neurotransmission, and the urea cycle\u0026mdash;were also inhibited. Of note, the 3A-PCL-F3 group exhibited heightened activation of 'tRNA charging', 'cysteine biosynthesis', 'NAD biosynthesis II (from tryptophan)', and 'CMP-N-acetylneuraminate biosynthesis I', in comparison to the other implant groups. Particularly, the regulatory network supported the activation of 'proliferation of muscle cells', 'angiogenesis', while the suppression of 'toxicity of cells' and \u0026lsquo;nervous tissue cell death\u0026rsquo; was only significantly identified in the 3A-PCL-F3 group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eC). Examining KEGG pathways, it was evident that 'steroid hormone biosynthesis', 'cortisol synthesis and secretion', and the aberrant production of glucocorticoids ('cushing syndrome') were enriched in 3A-PCL-F3 (\u003cstrong\u003eFigure S5A\u003c/strong\u003e). Four regulatory networks of significance were identified in 3A-PCL-F3 compared to the 3A group. Among these, the abnormal choline metabolism pathway was extensively regulated by six enzymes and two modules, interconnected by two differentially expressed metabolites (DEMs), namely cytidylic acid and citicoline (\u003cstrong\u003eFigure S5B\u003c/strong\u003e). The other three enriched networks involved conversion between [NAD(P)+] and NADPH, as well as C21-steroid hormone biosynthesis, utilizing the energy produced during the conversion of NADH to NAD+.\u003c/p\u003e\n\u003cp\u003eWe observed a more than ten-fold upregulation of 15 metabolites in 3A-PCL-F3 compared to 3A. Noteworthy among these were salicylaldehyde, 3-hydroxybenzoic acid, and methionine sulfoxide (\u003cstrong\u003eFigure S5C\u003c/strong\u003e). The upregulated differentially expressed metabolites (DEMs) from 12 classes displayed strong positive correlations, with many belonging to fatty acids and amino acid metabolites (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eD). Conversely, downregulated DEMs exhibited significantly lower correlations with others and encompassed compounds like 4-carboxypyrazole, triethanolamine, cyclo (Tyr-Leu), and farnesylacetone. The biosynthesis of NAD, catecholamine, and arginine were activated in 3A-PCL-F3 compared to the control, surpassing regulation observed for 3A (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003eE). Important canonical pathways activated in 3A included 'histamine degradation,' 'purine nucleotides degradation II,' and 'CMP-N-acetylneuraminate biosynthesis I'. Interestingly, the sole immune response relevant signalling pathway activated in both 3A and 3A-PCL-F3 derived from the DEMs was the 'macrophage alternative activation signalling pathway' (\u003cstrong\u003eTable S4\u003c/strong\u003e). An enrichment of KEGG pathways linked to cholesterol metabolism was identified in 3A-PCL-F3 relative to 3A such as 'steroid hormone biosynthesis,' 'cortisol synthesis,' and 'secretion and bile secretion' (\u003cstrong\u003eFigure S5D\u003c/strong\u003e), which accorded with activation of NAD biosynthesis. Consequently, this led to the identification of two closely regulated networks (\u003cstrong\u003eFigure S5E\u003c/strong\u003e). Six DEMs modulated ten enriched KEGG pathways relevant to steroid hormones and lipolysis, while eight DEMs were associated with amino acid and cholesterol metabolisms.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn this study, we characterised a series of Mg biomaterials (pure Mg, cold rolled AZ31, and fully annealed AZ31), both uncoated and coated with PCL incorporating Caerin F3 host-defence peptide. We investigated their \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e (in SD rats) antibacterial performance, as well as effects on tissues at the implantation sites, using proteomic and metabolomic analysis. Notably, among the different Mg alloy biomaterials investigated, 3A-PCL-F3 exhibited remarkable \u003cem\u003ein vitro\u003c/em\u003e antibacterial effects which continued up to 144 h, potentially achieved through the activation of diverse inflammatory responses, especially phagocytosis activated \u003cem\u003ein vivo\u003c/em\u003e during the acute phase. Furthermore, 3A-PCL-F3 also demonstrated superior biocompatibility, with limited immunoregulatory effects and enhanced NAD biosynthesis at 3 months post-implantation. Importantly, 3A promoted mouse osteoblast precursor cell MC3T3-E1 proliferation through upregulating expression of Brpf, a gene with the ability to promote bone formation.\u003c/p\u003e \u003cdiv id=\"Sec33\" class=\"Section2\"\u003e \u003ch2\u003e4.1 3A effectively promoted proliferation of murine osteoblastic cells\u003c/h2\u003e \u003cp\u003eIn previous research, quantitative proteomic analysis revealed that 3A activated pathways linked to wound healing and tissue development [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Building on this, our current study delves into the impacts of Mg alloy biomaterials on mouse osteoblast precursor MC3T3-E1 cells. Notably, BRPF1 was significantly upregulated in 3A, both in protein and mRNA levels, while medical grade Ti and 316L had no evident impact on transcription of this gene. \u003cem\u003eBRPF1\u003c/em\u003e is a crucial component of multiprotein complexes involved in histone acetylation, playing a pivotal role in gene expression regulation through chromatin remodelling [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. It has been found that \u003cem\u003eBRPF1\u003c/em\u003e is important for murine neural stem cell development [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] and its deletion led to bone marrow failure [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Additionally, the inhibition of pan BRPF bromodomain suppresses transcriptional programs required for osteoclastogenesis, both in mice and humans, according to both experimental and bioinformatics based [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Thus, upregulation of \u003cem\u003eBRPF1\u003c/em\u003e suggests enhanced osteoclast differentiation was induced by 3A, which potentially supports bone tissue repair and remodelling \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eUpregulation of BRPF1 in 3A is reflected in the pronounced activation of signalling pathways related to 'binding of connective tissue cells,' 'development of vasculature,' and 'mineralization of bone,' alongside the deactivation of 'bleeding'. Compared to the other Mg alloys and commonly used metallic biomaterials (Ti and 316L), 3A significantly promoted MC3T3-E1 cell growth, as supported by MTT assay, and also promoted their adhesion properties, indicating potential alterations in expression of molecules related to adhesion and extracellular matrix (ECM) composition. The resistance to trypsin in MC3T3-E1 cells, capable of differentiating into osteoblasts [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], suggests that osteogenic differentiation was induced by 3A. In addition, osteoblasts interact closely with the ECM and can form multicellular structures [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e], which may also hinder detachment. Moreover, two proteins, \u003cem\u003ePDLIM4\u003c/em\u003e and \u003cem\u003eRINT1\u003c/em\u003e, were present with relatively high abundance in 3A compared to 1E and 2P. \u003cem\u003ePDLIM4\u003c/em\u003e was suggested to play roles in the organisation of protein complexes and the regulation of cytoskeletal dynamics [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e], while \u003cem\u003eRINT1\u003c/em\u003e is associated with DNA repair and genome maintenance [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Thus, 3A exhibits strong potential to promote osteocyte growth \u003cem\u003ein vivo\u003c/em\u003e by orchestrating collective regulation of multiple proteins that support cell proliferation and tissue development.\u003c/p\u003e \u003cp\u003e \u003cb\u003e4.2 3A did not stimulate inflammatory responses in the acute and chronic phases and coating with PCL-F3 did not significantly alter biocompatibility\u003c/b\u003e \u003c/p\u003e \u003cp\u003eDuring the acute phase, after introduction of MRSA upon implantation, 3A demonstrated unique suppressive effects on signalling pathways associated with inflammatory responses. Proteomics revealed that only two immune response pathways were significantly activated, namely the 'neutrophil extracellular trap signalling pathway' and 'IL-12 signalling and production in macrophages'. This suggests distinctive immunomodulatory effects induced by 3A, leading to enhanced anti-inflammatory responses associated with immune tolerance and reduced tissue damage or foreign body reaction [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. Distinctively, 3A induces fewer inflammatory responses after implantation compared with the other investigated alloys, 1E and 2P. 2P, being pure Mg, exhibits higher chemical reactivity, leading to an increased inflammatory response. However, despite 1E and 3A exhibiting similar chemical compositions and surface roughness, they induce substantially different inflammatory responses. Differences in surface texture may have a role with EBSD analysis revealing that 3A has a higher proportion of first-order pyramidal (10\u0026ndash;11) {10\u0026ndash;1\u0026ndash;2} surface texture than 1E [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], which may induce different surface physiochemical properties including differences in surface energy and subsequently corrosion rates, surface interactions and bonding characteristics [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Other mechanical properties, such as strength and plasticity, may also impact host responses, warranting further investigation.\u003c/p\u003e \u003cp\u003eThe PCL-F3 coating empowered 3A with better antibacterial performance, evident in enhanced phagocytosis and other bactericidal process pathways. Of particular interest in 3A-PC-F3, the protein, \u003cem\u003eTAP1\u003c/em\u003e, showed the most significant upregulation. \u003cem\u003eTAP1\u003c/em\u003e plays a pivotal role in the immune system by transporting cytosolic peptides into the endoplasmic reticulum (ER), enabling MHC class I molecules to present these peptides on the cell surface for recognition by cytotoxic T cells [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. It may work in conjunction with another highly upregulated protein, \u003cem\u003eSEC61A1\u003c/em\u003e, responsible for protein translocation into the ER lumen [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Similarly, \u003cem\u003eCKAP4\u003c/em\u003e, localised to the ER membrane, aids in protein trafficking [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e], indicating its role in phagocytosis by facilitating the uptake of pathogens. At the metabolite level, tRNA charging and cysteine biosynthesis were significantly enhanced in 3A-PCL-F3 compared to the other materials, indicating an elevation in translation.\u003c/p\u003e \u003cp\u003eIn the chronic phase, immune response regulation pathways detected in 3A resembled that of tissue recovery without an implant, showcasing its outstanding biocompatibility. Signalling pathways in 3A-PCL-F3 were enriched in the extracellular region, whereas in 3A, enrichment was observed in mitochondria. The regulation of immune response signalling in both 3A and 3A-PC-F3 was minimal, although GZMA signalling remained activated in the latter group. This suggests that the degradation of PCL and F3 potentially contributed to cell-cell communication and adherence, whereas Mg\u003csup\u003e2+\u003c/sup\u003e predominantly influenced energy metabolism. Various types of PCL have been employed as scaffold materials to facilitate growth of cells and tissues and aid tissue regeneration [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e, \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. Additionally, degradation of PCL was found to provide temporary support for tissue growth [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. Therefore, the gradual degradation of PCL could potentially offer prolonged mechanical support in bone regeneration during the chronic phase of recovery. Of significance, most immune response pathways activated during the acute phase in 3A-PC-F3 diminished significantly at the chronic phase. Considering that GZMA is involved in various immune responses [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e], particularly in eliminating infected or abnormal cells [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e], the activation of GZMA signalling could potentially support extracellular matrix remodelling and tissue development. Furthermore, at the metabolite level, the enhanced biosynthesis of NAD in 3A-PC-F3 indicated increased energy production, which was reflected in elevated levels of various carnitines. This implies potential enhancement of cell and tissue development, indicating comprehensive biocompatibility for both 3A and 3A-PCL-F3. Collectively, it can be postulated that as the PCL-F3 coating degrades at the acute phase, it activates inflammatory signalling pathways and controls bacterial infection, while in the chronic phase the physical characteristics of 3A suppress foreign body reactions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec34\" class=\"Section2\"\u003e \u003ch2\u003e4.3 3A-PCL-F3 demonstrated better \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e antibacterial performance\u003c/h2\u003e \u003cp\u003eVarious antibacterial mechanisms have been observed in coatings employing host-defence peptides, including the destruction of the bacterial membrane, blocking DNA replication, inhibiting ATP synthase, impeding cell respiration, and disrupting protein synthesis [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. While many antibacterial coatings have demonstrated effective antibacterial properties against \u003cem\u003eS. aureus\u003c/em\u003e [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e, \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e] or \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e], or both [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e], there is a scarcity of research on the antibacterial abilities of magnesium coatings against stubborn drug-resistant bacteria. In this study, F3-PCL coating showed pronounced and enduring inhibitory effects on MRSA, both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, although the numbers of rats in each group are small. For \u003cem\u003ein vitro\u003c/em\u003e tests, the antibacterial effects persisted for approximately 6 days (144 hours). Furthermore, after 73 hours of implantation, tissues collected from the implantation sites still inhibited MRSA.\u003c/p\u003e \u003cp\u003eThe sustained release of peptides from the coating is pivotal for the antibacterial efficacy. In a previous study [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], F3 peptide was immobilised on the surface of Mg alloys using click chemistry, which provides a two-dimensional polyurethane (PU) coating on the metal alloy surface (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). In the current work, PCL was employed as the polymeric \u0026lsquo;scaffold\u0026rsquo; to create a three-dimensional coating with F3 entrained within. The 2D coating covalently immobilises one terminus of the peptide to the alloy\u0026rsquo;s surface, while the 3D coating allows the peptides to reside within the coating layer on the surface of the alloy (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). The \u003cem\u003ein vitro\u003c/em\u003e antibacterial assessments confirmed enhanced antibacterial effects from the 3D coating which displayed a larger bacteria-free area and longer duration of action compared to the 2D coatings (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Theoretically, the 3D coating enables greater loading of the peptides. Moreover, for the 2D coating, once the peptides are consumed by either the physiological environment or the bacteria through enzymatic degradation, there is no capacity to supplement areas where peptides have been consumed, potentially reducing the overall efficacy.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe intricate surface structure formed through the combination of PCL and F3 establishes a dense matrix. This matrix interacts with the peptides, restricting mobility and presenting a challenge for them to migrate from regions of high concentration to low concentration. Consequently, this results in a gradual, sustained release of the peptides from the coated surface. In addition, the combination of slow release and strengthened interaction inside the 3D coating facilitates F3 movement along concentration gradients, contributing to stable and continuous antibacterial effects which endured for almost seven days. The increased loading of the F3 peptide within the 3D coatings contributes to the sustained action. Further, research to understand the mode of action and optimise the coating\u0026rsquo;s performance are ongoing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec35\" class=\"Section2\"\u003e \u003ch2\u003e4.4 3A-PCL-F3 showed better biocompatibility\u003c/h2\u003e \u003cp\u003eApart from antibacterial effects, corrosion resistance and biocompatibility are critical factors in the performance of the coatings. Reducing and limiting FBRs is an essential goal for any implants. Various technologies, such as thermal spraying [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e], chemical conversion, and biomimetic approaches [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e, \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e], have been employed to obtain protective antibacterial coatings. Common polymer-based antibacterial coatings include calcium phosphate-based coatings [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. For polymer-based antibacterial coatings, biodegradable polyesters including polylactic acid (PLA), polyglycolic acid OK(PGA), polylactic acid-co-glycolic acid (PLGA), and their copolymers have demonstrated promising results (including antibacterial behaviours and biocompatibilities) when incorporating antibacterial elements onto Mg alloy coatings [\u003cspan additionalcitationids=\"CR82 CR83\" citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]. PCL has been confirmed an effective polymer medium for coating to further improve the corrosion resistance and biocompatibility of Mg [\u003cspan additionalcitationids=\"CR86 CR87 CR88 CR89 CR90\" citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e91\u003c/span\u003e], capable of physically or chemically interacting with F3 in the coating, likely via H-bonding.\u003c/p\u003e \u003cp\u003eAs a key measure of biocompatibility, cytocompatibility assesses the impact of coated metals on cell proliferation. Previously cell studies frequently demonstrated positive effects on cytocompatibility and cell proliferation from antibacterial coatings, particularly for bone-linked cells such as murine osteoblast-like cell line MC3T3-E1 [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan additionalcitationids=\"CR93 CR94\" citationid=\"CR92\" class=\"CitationRef\"\u003e92\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e95\u003c/span\u003e] and human osteoblast cell line MG-63 [\u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e96\u003c/span\u003e, \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e97\u003c/span\u003e]. These studies assess proliferation in conjunction with cell adhesion and osteoblast differentiation. In this study, 3A-PCL-F3 showed substantially enhanced proliferation, osteoblast differentiation, and adhesion of mouse osteoblast precursor MC3T3-E1 cells over other materials. Additionally, tissues collected from the implantation sites, brain, heart, and ovary of rats demonstrated that three-month post-implantation with 3A-PCL-F3, there was no detectable impacts on important organs. Furthermore, the implantation of 3A-PCL-F3 did not induce any significant immune or inflammatory responses, which has not been reported previously for other antibacterial coatings. The cytokine levels from the sera 3 months post implantation were similar among the control group, 3A and 3A-PCL-3A which further indicates its outstanding biocompatibility.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec36\" class=\"Section2\"\u003e \u003ch2\u003e4.5 Future research directions\u003c/h2\u003e \u003cp\u003eThe current results affirm our previous finding that 3A (fully annealed Mg alloy, AZ31) has better biocompatibility, promotes recovery of injured tissue, and contributes to the regeneration and development of osteocytes. 3A-PCL-F3 not only showed a better biocompatibility, but also demonstrated enhanced antibacterial performance \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Further investigations are required to understand why the annealed form of AZ31 resulted in such drastic differences in inflammatory responses. The microstructure and texture components, the annealing process, such as heating speed, temperature, holding time, furnace environment, and cooling speed, can influence the microstructures and phases of metallic compounds. Therefore, future work will delve into the impacts of various processing parameters on microstructure, surface physiochemical properties and \u003cem\u003ein vivo\u003c/em\u003e responses.\u003c/p\u003e \u003cp\u003eNotably, regardless of physical interaction or chemical bonding with the polymers, 3A demonstrated enhanced and longer-lasting antibacterial effects than 1E, even though they share similar chemistry and physical characteristics. Therefore, it necessary to study the structures formed between coatings and the metal substrate, as well as mechanisms for bactericidal effects at play. Moreover, exploring the influence of implant alloy substrate and coating properties on biophysical responses to implants requires further investigation and discovery.\u003c/p\u003e \u003c/div\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn this study, we developed a 3D coating using the cationic host defence peptide F3 (CHDP F3) and the biocompatible material PCL for Mg alloys, including 1E, 2P and 3A. PCL-F3 coated Mg alloys exhibited exceptional biocompatibility, stable antibacterial properties, and no adverse effects on vital organs in SD rats three months post-implantation. Proteomics and metabolomics analyses revealed that 3A did not activate significant inflammation or immune responses, while enhancing signalling pathways for tissue cell proliferation. PCL-F3 coated 3A showed no obvious foreign body responses, unlike 1E and 2P. Surface physiochemical properties, including a higher percentage of first-order pyramidal slip for 3A, may contribute to its outstanding performance. Future research will focus on understanding the mechanism behind 3A's biocompatibility, optimizing microstructures, and exploring similar treatments for other magnesium alloys and hexagonal-close-packed metals. In conclusion, PCL-F3 coated 3A demonstrates potential as an antibacterial implant for internal fixation in fracture repair, providing a biodegradable solution.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHJL thanks Japanese JSPS committee and the University of Tokyo for providing financially support of the research of Mg treatment and microstructure analysis. We thank Mr. Bernhard Black, Mr. Ross Barrett and Mr. Hugh Allan from the University of the Sunshine Coast for samples machining and preparation; Doctor Yajun Ye, Doctor Guowei Liu and Doctor Weixiong Tang from the Department of Radiology of the First People\u0026rsquo;s Hospital of Foshan for CT and X ray imaging of the experimental rats. We appreciate the advice provided by Professor Abigail Elizur of the University of the Sunshine Coast.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding sources:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported in part by JSPS research grant (No. P16718), Natural Science Foundation of Guangdong Province (No. 2020A1515010855), National Science Foundation of China (31971355) and Genecology MCR Seed Funding of University of the Sunshine Coast. Deng Feng Project of Foshan First People\u0026rsquo;s Hospital (2019A008).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eV. Nguyen, Osteoporosis prevention and osteoporosis exercise in com- munity-based public health programs, Osteoporos. Sarcopenia 3 (2017) 18\u0026ndash;31. \u003c/li\u003e\n\u003cli\u003eL. Cao, L. Wang, L. Fan, W. Xiao, B. Lin, Y. Xu, J. Liang, B. Cao, RGDC Peptide-Induced Biomimetic Calcium Phosphate Coating Formed on AZ31 Magnesium Alloy, Materials (Basel) 10 (4) (2017) 358, doi: 10.3390/ma10040358. \u003c/li\u003e\n\u003cli\u003eT. Wang, G. Ni, T. Furushima, H. Diao, P. Zhang, S. Chen, C. Fog- arty, Z. Jiang, X. Liu, H. Li, Mg alloy surface immobilised with caerin peptides acquires enhanced antibacterial ability and putatively improved corrosion resistance, Mater. Sci. Eng. C 121 (2021) 111819, doi: 10.1016/j.msec.2020.111819.\u003c/li\u003e\n\u003cli\u003eX. Liu, G. Chen, X. Zhong, T. Wang, X. He, W. Yuan, P. Zhang, Y. Liu, D. Cao, S. Chen, K. Manabe, Z. Jiang, T. Furushima, D. Kent, Y. Chen, G. Ni, M. Gao, H. Li. Degradation of differently processed Mg-based implants leads to distinct foreign body reactions (FBRs) through dissimilar signalling pathways. Journal of Magnesium and alloys, 11(6),2023, 2106-2124. https://doi.org/10.1016/j.jma.2022.03.017\u003c/li\u003e\n\u003cli\u003eH. Kjeldgaard, K. Holvik, B. Abrahamsen, G. Tell, H. Meyer, M. Flaherty, S. footnote. Explaining declining hip fracture rates in Norway: a population-based modelling study. The Lancet. May 08, 2023, DOI: https://doi.org/10.1016/j.lanepe.2023.100643\u003c/li\u003e\n\u003cli\u003eY. Yang, Q. Wei, R. An, H. Zhang, J. Shen, X. Qin, X. Han, J. Li, X. Li, X. Gao, J. He, H. Mao. Anti-osteoporosis effect of Semen Cuscutae in ovariectomized mice through inhibition of bone resorption by osteoclasts. Journal of Ethnopharmacology. Volume 285, 1 March 2022, 114834\u003c/li\u003e\n\u003cli\u003eA. Sidambe. Biocompatibility of Advanced Manufactured Titanium Implants\u0026mdash;A Review. Materials (Basel). 2014 Dec; 7(12): 8168\u0026ndash;8188. Published online 2014 Dec 19. doi: 10.3390/ma7128168\u003c/li\u003e\n\u003cli\u003eY. Li, C. Yang, H. Zhao, S. Qu, X. Li, Y. Li. New Developments of Ti-Based Alloys for Biomedical Applications. Materials (Basel). 2014 Mar; 7(3): 1709\u0026ndash;1800. Published online 2014 Mar 4. doi: 10.3390/ma7031709\u003c/li\u003e\n\u003cli\u003eL Zhang, L. Chen. A Review on Biomedical Titanium Alloys: Recent Progress and Prospect. Advanced Engineering Materials. 2019, March 20, https://doi.org/10.1002/adem.201801215\u003c/li\u003e\n\u003cli\u003eM. Niinomi, Y. Liu, M. Nakai, H. Liu, H Li. Biomedical titanium alloys with Young\u0026rsquo;s moduli close to that of cortical bone. Regen Biomater. 2016 Sep; 3(3): 173\u0026ndash;185. doi: 10.1093/rb/rbw016\u003c/li\u003e\n\u003cli\u003eE Mostaed, M. Jasinska, J. Drelich, M. Vedani. Zinc-based alloys for degradable vascular stent applications. Acta Biomater. 2018 Apr 15; 71: 1\u0026ndash;23. doi: 10.1016/j.actbio.2018.03.005\u003c/li\u003e\n\u003cli\u003eM. Niinomi, M. Nakai. Titanium-Based Biomaterials for Preventing Stress Shielding between Implant Devices and Bone. Int J Biomater. 2011; 2011: 836587. doi: 10.1155/2011/836587\u003c/li\u003e\n\u003cli\u003eY. Kim, M. Choi, J. Kim. Are titanium implants actually safe for magnetic resonance imaging examinations? Arch Plast Surg. 2019 Jan; 46(1): 96\u0026ndash;97. doi: 10.5999/aps.2018.01466\u003c/li\u003e\n\u003cli\u003eG. Cecoro, D. Bencivenga, M. Annunziata, N. Cennamo, F. Ragione, A. Formisano, A. Piccirillo, E. Stampone, P. Volpe, L. Zeni, A. Borriello, L. Guida. Effects of Magnetic Stimulation on Dental Implant Osseointegration: A Scoping Review. Appl. Sci. 2022, 12(9), 4496; https://doi.org/10.3390/app12094496\u003c/li\u003e\n\u003cli\u003eM. Sarraf, E. Ghomi, S. Alipour, S. Ramakrishna, N. Sukiman. A state-of-the-art review of the fabrication and characteristics of titanium and its alloys for biomedical applications. Bio-Design and Manufacturing, volume 5, pages371\u0026ndash;395 (2022)\u003c/li\u003e\n\u003cli\u003eY. Hwang, Y. Choi, Y. Hwang, H. Cho, D. Lee. Biocompatibility and Biological Corrosion Resistance of Ti\u0026ndash;39Nb\u0026ndash;6Zr+0.45Al Implant Alloy. J. Funct. Biomater. 2021, 12(1), 2; https://doi.org/10.3390/jfb12010002\u003c/li\u003e\n\u003cli\u003eA. Zomorodian, C. Santos, M. Carmezim, T. Silva, J. Fernandes, M. Montemor, In-vitro corrosion behaviour of the magnesium alloy with Al and Zn (AZ31) protected with a biodegradable polycaprolactone coating loaded with hydroxyapatite and cephalexin, Electrochim. Acta 179 (2015) 431\u0026ndash;440.\u003c/li\u003e\n\u003cli\u003eC. Romano, G. Manzi, N. Logoluso, D. Romano, Value of debridement and irrigation for the treatment of peri-prosthetic infections: a systematic review, Hip Int. 22 (Suppl 8) (2019) S19\u0026ndash;S24 http:// dx.doi.org/ 10.5301/ HIP.2012.9566. \u003c/li\u003e\n\u003cli\u003eR. Darouiche, Treatment of infections associated with surgical implants, N. Engl. J. Med. 350 (2004) 1422\u0026ndash;1429 http:// dx.doi.org/ 10. 1056/NEJMra035415.\u003c/li\u003e\n\u003cli\u003eY. Jiang, B. Wang, Z. Jia, X. Lu, L. Fang, K. Wang, F. Ren, Poly- dopamine mediated assembly of hydroxyapatite nanoparticles and bone morphogenetic protein-2 on magnesium alloys for enhanced corrosion resistance and bone regeneration, J. Biomed. Mater. Res. A 105 (2017) 2750\u0026ndash;2761\u003c/li\u003e\n\u003cli\u003eW. Sun, X. Qiao, M. Zheng, C. Xu, N. Gao, M. Starink, Microstructure and mechanical properties of a nanostructured Mg-8.2Gd-3.8Y-1.0Zn-0.4Zr supersaturated solid solution prepared by high pressure torsion, Mater. Design 135 (2017) 366\u0026ndash;376.\u003c/li\u003e\n\u003cli\u003eN. Soro, H. Attar, X. Wu, and M. S. Dargusch, \u0026ldquo;Investigation of the structure and mechanical properties of additively manufactured Ti-6Al-4V biomedical scaffolds designed with a Schwartz primitive unit-cell,\u0026rdquo; Materials Science and Engineering: A, vol. 745, pp. 195-202, 2019.\u003c/li\u003e\n\u003cli\u003eN. Soro, N. Saintier, J. Merzeau, M. Veidt, and M. S. Dargusch, Quasi-static and fatigue properties of graded Ti\u0026ndash;6Al\u0026ndash;4V lattices produced by Laser Powder Bed Fusion (LPBF), Additive Manufacturing, vol. 37, p. 101653, 2021.\u003c/li\u003e\n\u003cli\u003eL. Yuan, S. Ding, C. Wen. Additive manufacturing technology for porous metal implant applications and triple minimal surface structures: A review. Bioact Mater. 2019 (4): 56\u0026ndash;70. Doi: 10.1016/j.bioactmat.2018.12.003\u003c/li\u003e\n\u003cli\u003eA. Y\u0026aacute;nez, A. Cuadrado, O. Martel, D. Monopoli. Gyroid porous titanium structures: A versatile solution to be used as scaffolds in bone defect reconstruction. Materials and Design, November 2017, 140(B), doi: 10.1016/j.matdes.2017.11.050\u003c/li\u003e\n\u003cli\u003eP. Hameed, C. Liu, R. Ummethala, K. Prashanth. Biomorphic porous Ti6Al4V gyroid scaffolds for bone implant applications fabricated by selective laser melting. Progress in Additive Manufacturing, 2021, 6(3), doi: 10.1007/s40964-021-00210-5\u003c/li\u003e\n\u003cli\u003eN. Soro, N. Saintier, H. Attar, and M. S. Dargusch, \u0026ldquo;Surface and morphological modification of selectively laser melted titanium lattices using a chemical post treatment,\u0026rdquo; Surface and Coatings Technology, vol. 393, p. 125794, 2020.\u003c/li\u003e\n\u003cli\u003eASTM E9-89a, 2000, Standard Test Methods of Compression Testing of Metallic Materials at Room Temperature, ASTM International, 100 Barr Harbor Drive, PO Box C700, West Conshohocken, PA 19428-2959, United States.\u003c/li\u003e\n\u003cli\u003eN. Soro, E.Brodie, A. Abdal-hayc, A. Alali, D, Kenta, M. Darguscha. Additive manufacturing of biomimetic Titanium-Tantalum lattices for biomedical implant applications. Materials \u0026amp; Design. Materials \u0026amp; Design. Volume 218, June 2022, 110688\u003c/li\u003e\n\u003cli\u003eS. Wu, J. Xu, L. Zou, S. Luo, R. Yao, B. Zheng, G. Liang, D. Wu, Y. Li. Long-lasting renewable antibacterial porous polymeric coatings enable titanium biomaterials to prevent and treat peri-implant infection. Nature Communications, (2021) 12:3303 | https://doi.org/10.1038/s41467-021-23069-0 | \u003c/li\u003e\n\u003cli\u003eS. Chen, P. Zhang, L. Xiao, Y. Liu, K. Wu, G. Ni, H. Li, T. Wang, X. Wu, G. Chen, X. Liu, Caerin 1.1 and 1.9 Peptides from Australian Tree Frog Inhibit Antibiotic-resistant bacteria growth in a murine skin infection model, Microbiol Spectr. (2021) e0005121, doi: 10.1128/Spectrum.00051-21. \u003c/li\u003e\n\u003cli\u003eX. Gu, Y. Cheng, Y. Zheng, S. Zhong, T. Xi, In vitro corrosion and biocompatibility of binary magnesium alloys, Biomaterials 30 (2009) 484\u0026ndash;498.\u003c/li\u003e\n\u003cli\u003eJ. Wi\u0026acute;sniewski, Quantitative evaluation of filter aided sample preparation (FASP) and multienzyme digestion FASP protocols, Anal. Chem. 88 (10) (2016) 5438\u0026ndash;5443. \u003c/li\u003e\n\u003cli\u003eG. Ni, S. Chen, M. Chen, J. Wu, B. Yang, J. Yuan, S.F. Walton, H. Li, M. Wei, Y. Wang, G. Chen, Liu X, T. Wang, Host-defense peptides caerin 1.1 and 1.9 stimulate TNF-alpha-dependent apoptotic signals in human cervical cancer HeLa cells, Front. Cell Dev. Biol. 8 (2020 Jul 31) 676 Y. Assenov, F. Ram\u0026iacute;rez, S.E. Schelhorn, T. Lengauer, M. Albrecht, Computing topological parameters of biological networks, Bioinformatics (Oxford, England) 24(2) (2008) 282-284, doi: 10.3389/ fcell.2020.00676.\u003c/li\u003e\n\u003cli\u003eX. Yang, J. Li, S. Chen, L. Xiao, D. Cao, X. Wu, H. Li, G. Ni, T. Wang, G. Chen, X. Liu. Preclinical Pharmacokinetics, Biodistribution, and Acute Toxicity Evaluation of Caerin 1.9 Peptide in Sprague Dawley Rats. Evidence-Based Complementary and Alternative Medicine Volume 2022, Article ID 9869293, 13 pages https://doi.org/10.1155/2022/9869293 \u003c/li\u003e\n\u003cli\u003eX. Pan, B. Ma, X. You, S. Chen, J. Wu, T. Wang, S. Walton, J. Yuan, X. Wu, G. Chen, Y. Wang, G. Ni, X Liu. Synthesized natural peptides from amphibian skin secretions increase the efficacy of a therapeutic vaccine by recruiting more T cells to the tumour site. BMC Complementary and Alternative Medicine (2019) 19:163 https://doi.org/10.1186/s12906-019-2571-z\u003c/li\u003e\n\u003cli\u003eS. Chen, P. Zhang, L. Xiao, Y. Liu, K. Wu, G. Ni, H. Li, T. Wang, X. Wu, G. Chen, X. Liu, Caerin 1.1 and 1.9 peptides from Australian tree frog inhibit antibiotic-resistant bacteria growth in a murine skin infection model, Microbiology Spectrum 9 (1), 2021 Sep 3;9(1): e0005121. Doi: 10.1128/Spectrum.00051-21 \u003c/li\u003e\n\u003cli\u003eL. Zumofen, K. Kopanska, E. Bono, U. Graf-Hausner. Properties of Additive-Manufactured Open Porous Titanium Structures for Patient-Specific Load-Bearing Implants. February 2022, Frontiers in Mechanical Engineering 7:1, Doi: 10.3389/fmech.2021.830126\u003c/li\u003e\n\u003cli\u003eC. Mallon, R. Gooberman-Hill, A. Blom, M. Whitehouse, A. Moore. Surgeons are deeply affected when patients are diagnosed with prosthetic joint infection. Plos one, 2018, 13(11): e0207260. https://doi.org/10.1371/journal. pone.0207260\u003c/li\u003e\n\u003cli\u003eT. Parisi, J. Konopka, H. Bedair, What is the Long-term Economic Societal Effect of Periprosthetic Infections After THA? A Markov Analysis. Clin Orthop Relat Res. 2017 Jul; 475(7): 1891\u0026ndash;1900.\u003c/li\u003e\n\u003cli\u003eN. Mookherjee, M. Anderson, H. Haagsman, D. Davidson. Antimicrobial host defence peptides: functions and clinical potential. Nature Review, 2020, 19, 311-332. https://doi.org/10.1038/s41573-019-0058-8\u003c/li\u003e\n\u003cli\u003eM. Simmaco, G. Kreil, D. Barra. Bombinins, antimicrobial peptides from Bombina species. Biochim. Biophys. Acta 1788, 1551\u0026ndash;1555 (2009).\u003c/li\u003e\n\u003cli\u003eJ. Bowie, F. Separovic, M. Tyler. Host-defense peptides of Australian anurans. Part 2. Structure, activity, mechanism of action, and evolutionary significance. Peptides 2012, 37:174\u0026ndash;188. Doi: 10.1016/j.peptides.2012.06.017.\u003c/li\u003e\n\u003cli\u003eG. Ni, S. Chen, M. Chen, J. Wu, B. Yang, J. Yuan, S. Walton, H. Li, M. Wei, Y. Wang, G. Chen, X. Liu, T. Wang. Host-Defense Peptides Caerin 1.1 and 1.9 Stimulate TNF-Alpha-Dependent Apoptotic Signals in Human Cervical Cancer HeLa Cells. Front. Cell Dev. Biol. 2020, 8:676. Doi: 10.3389/fcell.2020.00676\u003c/li\u003e\n\u003cli\u003eP. Du, S. Furusawa, T. Furushima, Microstructure and performance of biodegradable magnesium alloy tubes fabricated by local-heating-as- sisted dieless drawing, J. Magnesium Alloys 8 (2020) 614\u0026ndash;623.\u003c/li\u003e\n\u003cli\u003eX. Gu, Y. Cheng, Y. Zheng, S. Zhong, T. Xi, In vitro corrosion and biocompatibility of binary magnesium alloys, Biomaterials 30 (2009) 484\u0026ndash;498.\u003c/li\u003e\n\u003cli\u003eL. Decrausaz, A. Goncalves, S. Domingos-Pereira, C. Pythoud, J. Stehle, J. Schiller, et al., A novel mucosal orthotopic murine model of human papillomavirus-associated genital cancers, Int. J. Cancer 128 (2011) 2105\u0026ndash;2113\u003c/li\u003e\n\u003cli\u003eJ. Wi\u0026acute;sniewski, Quantitative evaluation of filter aided sample preparation (FASP) and multienzyme digestion FASP protocols, Anal. Chem. 88 (10) (2016) 5438\u0026ndash;5443.\u003c/li\u003e\n\u003cli\u003eG. Ni, S. Chen, M. Chen, J. Wu, B. Yang, J. Yuan, S.F. Walton, H. Li, M. Wei, Y. Wang, G. Chen, Liu X, T. Wang, Host-defense peptides caerin 1.1 and 1.9 stimulate TNF-alpha-dependent apoptotic signals in human cervical cancer HeLa cells, Front. Cell Dev. Biol. 8 (2020 Jul 31) 676.\u003c/li\u003e\n\u003cli\u003eY. Assenov, F. Ram\u0026iacute;rez, S.E. Schelhorn, T. Lengauer, M. Albrecht, Computing topological parameters of biological networks, Bioinformatics (Oxford, England) 24(2) (2008) 282-284, doi: 10.3389/ fcell.2020.00676.\u003c/li\u003e\n\u003cli\u003eS. Kerrien, B. Aranda, L. Breuza, A. Bridge, F. Broackes-Carter, C. Chen, M. Duesbury, M. Dumousseau, M. Feuermann, U. Hinz, C. Jandrasits, R.C. Jimenez, J. Khadake, U. Mahadevan, P. Masson, I. Pedruzzi, E. Pfeiffenberger, P. Porras, A. Raghunath, B. Roechert, S. Orchard, H. Hermjakob. The IntAct molecular interaction database in 2012, Nucleic Acids Res. 40 (Database issue) (2012) D841\u0026ndash;D846. \u003c/li\u003e\n\u003cli\u003eY. Assenov, F. Ram\u0026iacute;rez, S.E. Schelhorn, T. Lengauer, M. Albrecht, Computing topological parameters of biological networks, Bioinformatics 24 (2008) 282\u0026ndash;284.\u003c/li\u003e\n\u003cli\u003eY.H. An, R.A. Draughn, Mechanical Testing of Bone and the Bone-Im- plant Interface, CRC press, USA, 1999.\u003c/li\u003e\n\u003cli\u003ePoplawski A, Hu K, Lee W, Natesan S, Peng D, Carlson S, Shi X, Balaz S, Markley JL, Glass KC: Molecular insights into the recognition of N-terminal histone modifications by the BRPF1 bromodomain. J Mol Biol 2014, 426(8):1661-1676.\u003c/li\u003e\n\u003cli\u003eL. You, K. Yan, J. Zou, H. Zhao, N. Bertos, M. Park, E. Wang, X. Yang. The lysine acetyltransferase activator Brpf1 governs dentate gyrus development through neural stem cells and progenitors. PLoS Genet 2015, 11(3): e1005034.\u003c/li\u003e\n\u003cli\u003eL. You, J. Zou, H. Zhao, N. Bertos, M. Park, E. Wang, X. Yang. Deficiency of the chromatin regulator BRPF1 causes abnormal brain development. J Biol Chem 2015, 290(11):7114-7129.\u003c/li\u003e\n\u003cli\u003eL. You, L. Li, J. Zou, K.Yan, J. Belle, A. Nijnik, E. Wang E, X. Yang. BRPF1 is essential for development of fetal hematopoietic stem cells. J Clin Invest 2016, 126(9):3247-3262.\u003c/li\u003e\n\u003cli\u003eJ. Meier, C. Tallant, O. Fedorov, H. Witwicka, S. Hwang, R. van Stiphout, J. Lambert, C. Rogers, C. Yapp, B. Gerstenberger et al. Selective Targeting of Bromodomains of the Bromodomain-PHD Fingers Family Impairs Osteoclast Differentiation. ACS Chem Biol 2017, 12(10):2619-2630.\u003c/li\u003e\n\u003cli\u003eD. Wang, K. Christensen, K. Chawla, G. Xiao, P. Krebsbach, R. Franceschi. Isolation and characterization of MC3T3-E1 preosteoblast subclones with distinct in vitro and in vivo differentiation/mineralization potential. J Bone Miner Res 1999, 14(6):893-903.\u003c/li\u003e\n\u003cli\u003eX. Chen, Z. Wang, N. Duan, G. Zhu, E. Schwarz, C. Xie. Osteoblast-osteoclast interactions. Connect Tissue Res 2018, 59(2):99-107.\u003c/li\u003e\n\u003cli\u003eH. Blair, Q. Larrouture, Y. Li, H. Lin, D. Beer-Stoltz, L. Liu, R. Tuan, L. Robinson, P. Schlesinger, D. Nelson. Osteoblast Differentiation and Bone Matrix Formation In Vivo and In Vitro. Tissue Eng Part B Rev 2017, 23(3):268-280.\u003c/li\u003e\n\u003cli\u003eC. Fu, Q. Li, J. Zou, C. Xing, M. Luo, B. Yin, J. Chu, J. Yu, X. Liu, H. Wang, et al. JMJD3 regulates CD4 T cell trafficking by targeting actin cytoskeleton regulatory gene Pdlim4. J Clin Invest 2019, 129(11):4745-4757.\u003c/li\u003e\n\u003cli\u003eP. Grigaravicius, A. von Deimling, P. Frappart. RINT1 functions as a multitasking protein at the crossroads between genomic stability, ER homeostasis, and autophagy. Autophagy 2016, 12(8):1413-1415.\u003c/li\u003e\n\u003cli\u003eD. Park, K. Tao, F. Le Calvez-Kelm, T. Nguyen-Dumont, N. Robinot, F. Hammet, F. Odefrey, H. Tsimiklis, Z. Teo, L. Thingholm, et al. Rare mutations in RINT1 predispose carriers to breast and Lynch syndrome-spectrum cancers. Cancer Discov 2014, 4(7):804-815.\u003c/li\u003e\n\u003cli\u003eE. Mariani, G. Lisignoli, R. Borz\u0026igrave;, L. Pulsatelli. Biomaterials: Foreign Bodies or Tuners for the Immune Response? Int J Mol Sci 2019, 20(3).\u003c/li\u003e\n\u003cli\u003eJ. den Haan, R. Arens, M.van Zelm. The activation of the adaptive immune system: cross-talk between antigen-presenting cells, T cells and B cells. Immunol Lett 2014, 162(2 Pt B):103-112.\u003c/li\u003e\n\u003cli\u003eU. Ritz, B. Seliger. The transporter associated with antigen processing (TAP): structural integrity, expression, function, and its clinical relevance. Mol Med 7, 149-158 (2001).\u003c/li\u003e\n\u003cli\u003eR. Zimmermann, S. Eyrisch, M. Ahmad, V. Helms. Protein translocation across the ER membrane. Biochim Biophys Acta 1808, 912-924, doi: 10.1016/j.bbamem.2010.06.015 (2011).\u003c/li\u003e\n\u003cli\u003eY. Osugi, K. Fumoto, A. Kikuchi. CKAP4 Regulates Cell Migration via the Interaction with and Recycling of Integrin. Molecular and cellular biology 39, doi:10.1128/mcb.00073-19 (2019).\u003c/li\u003e\n\u003cli\u003eE. Milot, N. Fotouhi-Ardakani, J. Filep. Myeloid nuclear differentiation antigen, neutrophil apoptosis and sepsis. Front Immunol 3, 397, doi:10.3389/fimmu.2012.00397 (2012).\u003c/li\u003e\n\u003cli\u003eP. Poh, et al. In vitro and in vivo bone formation potential of surface calcium phosphate-coated polycaprolactone and polycaprolactone/bioactive glass composite scaffolds. Acta Biomater 30, 319-333, doi: 10.1016/j.actbio.2015.11.012 (2016).\u003c/li\u003e\n\u003cli\u003eA. Baradaran-Rafii, E. Biazar, S. Heidari-keshel. Cellular Response of Limbal Stem Cells on Polycaprolactone Nanofibrous Scaffolds for Ocular Epithelial Regeneration. Curr Eye Res 41, 326-333, doi:10.3109/02713683.2015.1019004 (2016).\u003c/li\u003e\n\u003cli\u003eB. Chuenjitkuntaworn, T. Osathanon, N. Nowwarote, P. Supaphol, P. Pavasant. The efficacy of polycaprolactone/hydroxyapatite scaffold in combination with mesenchymal stem cells for bone tissue engineering. J Biomed Mater Res A 104, 264-271, doi:10.1002/jbm.a.35558 (2016).\u003c/li\u003e\n\u003cli\u003eK. Bratke, M. Kuepper, B. Bade, J. Virchow, W. Luttmann. Differential expression of human granzymes A, B, and K in natural killer cells and during CD8+ T cell differentiation in peripheral blood. Eur J Immunol 35, 2608-2616, doi:10.1002/eji.200526122 (2005).\u003c/li\u003e\n\u003cli\u003eD. Zhang, Y. Liu, Z. Liu, Q. Wang. Advances in Antibacterial Functionalized Coatings on Mg and Its Alloys for Medical Use\u0026mdash;A Review, Coatings 2020, 10(9), 828; https://doi.org/10.3390/coatings10090828\u003c/li\u003e\n\u003cli\u003eC. Tan, X. Zhang, Q. Li. Fabrication of multifunctional CaP-TC composite coatings and the corrosion protection they provide for magnesium alloys. Biomed. Eng. 2017, 62, 375\u0026ndash;381.\u003c/li\u003e\n\u003cli\u003eY. Guo, S. Jia, L. Qiao, Y. Su, R. Gu, G. Li, J. Lian. A multifunctional polypyrrole/zinc oxide composite coating on biodegradable magnesium alloys for orthopedic implants. Colloids Surf. B Biointerfaces 2020, 194, 111186\u003c/li\u003e\n\u003cli\u003eN. Bai, C. Tan, Q. Li, Z. Xi. Study on the corrosion resistance and anti-infection of modified magnesium alloy. Biomed. Mater. Eng. 2017, 28, 339\u0026ndash;345.\u003c/li\u003e\n\u003cli\u003eA. Rezk, A. Sasikala, A. Nejad, H. Mousa, Y. Oh, C. Park, C. Kim. Strategic design of a Musselinspired in situ reduced Ag/Au Nanoparticle Coated Magnesium Alloy for enhanced viability, antibacterial property, and decelerated corrosion rates for degradable implant applications. Sci. Rep. 2019, 9, 117.\u003c/li\u003e\n\u003cli\u003eK. Pang, J. Lee, Y. Seo, S. Kim, M. Kim, J. Lee. Biologic properties of nano-hydroxyapatite: An in vivo study of calvarial defects, ectopic bone formation and bone implantation. Bio-Med. Mater. Eng. 2015, 25, 25\u0026ndash;38.\u003c/li\u003e\n\u003cli\u003eS. Kozerski, L. Pawlowski, R. Jaworski, R. Roudet, F. Petit. Two zones microstructure of suspension plasma sprayed hydroxyapatite coatings. Surf. Coat. Technol. 2010, 204, 1380\u0026ndash;1387. \u003c/li\u003e\n\u003cli\u003eZ. Yin, W. Qi, R. Zeng, X. Chen, C. Gu, S. Guan, Y. Zheng. Advances in coatings on biodegradable magnesium alloys. J. Magnes. Alloy 2020, 8, 42\u0026ndash;65.\u003c/li\u003e\n\u003cli\u003eX. Lu, Z. Zhao, Y. Leng. Biomimetic calcium phosphate coatings on nitric-acid-treated titanium surfaces. Mater. Sci Eng. 2007, 27, 700\u0026ndash;708. \u003c/li\u003e\n\u003cli\u003eL. Griffith. Polymeric Biomaterials. Acta Mater. 2000, 48, 263\u0026ndash;277. \u003c/li\u003e\n\u003cli\u003eY. Yang, C. Michalczyk, F. Singer, S. Virtanen, A. Boccaccini. In Vitro Study of Polycaprolactone/bioactive Glass Composite Coatings on Corrosion and Bioactivity of Pure Mg. Appl. Surf. Sci. 2015, 355, 832\u0026ndash;841. \u003c/li\u003e\n\u003cli\u003eL. Xu, A. Yamamoto. Characteristics and Cytocompatibility of Biodegradable Polymer Film on Magnesium by Spin Coating. Colloids Surf. B. Biointerfaces 2012, 93, 67\u0026ndash;74. \u003c/li\u003e\n\u003cli\u003eM. Virto, P. Frutos, S. Torrado, G. Frutos. Gentamicin release from modified acrylic bone cements with lactose and hydroxypropylmethylcellulose. Biomaterials 2003, 24, 79\u0026ndash;87.\u003c/li\u003e\n\u003cli\u003eX. Ji, Q. Cheng, J. Wang, Y. Zhao, Z. Han, F. Zhang, S. Li, R. Zeng, Z. Wang. Corrosion resistance and antibacterial effects of hydroxyapatite coating induced by polyacrylic acid and gentamicin sulfate on magnesium alloy. Front. Mater. Sci. 2019, 13, 87\u0026ndash;98.\u003c/li\u003e\n\u003cli\u003eY. Zhao, X. Chen, S. Li, R. Zeng, F. Zhang, Z. Wang, S. Guan. Corrosion resistance and drug release profile of gentamicin-loaded polyelectrolyte multilayers on magnesium alloys: Effects of heat treatment. J. Colloid Interface Sci. 2019, 547, 309\u0026ndash;317\u003c/li\u003e\n\u003cli\u003eE. Dayaghi, H. Bakhsheshi-Rad, E. Hamzah, A. Akhavan-Farid, A. Ismail, M. Aziz, E. Abdolahi. Magnesium-zinc scaffold loaded with tetracycline for tissue engineering application: In vitro cell biology and antibacterial activity assessment. Mater. Sci. Eng. C 2019, 102, 53\u0026ndash;65.\u003c/li\u003e\n\u003cli\u003eQ. Zheng, J. Li, W. Yuan, X. Liu, L. Tan,Y. Zheng, K. Yeung, S. Wu. Metal\u0026minus;Organic Frameworks Incorporated Polycaprolactone Film for Enhanced Corrosion Resistance and Biocompatibility of Mg Alloy. ACS Sustainable Chem. Eng.2019, 7, 18114\u0026minus;18124 \u003c/li\u003e\n\u003cli\u003eY. Zou, J. Wang, L. Cui, R. Zeng, Q. Wang, Q. Han, J. Qiu, X. Chen, D. Chen, S. Guan, et al. Corrosion resistance and antibacterial activity of zinc-loaded montmorillonite coatings on biodegradable magnesium alloy AZ31. Acta Biomater. 2019, 98, 196\u0026ndash;214. \u003c/li\u003e\n\u003cli\u003eX. Ji, L. Gao, J. Liu, J. Wang, Q. Cheng, J. Li, S. Li, K. Zhi, R. Zeng, Z. Wang. Corrosion resistance and antibacterial properties of hydroxyapatite coating induced by gentamicin-loaded polymeric multilayers on magnesium alloys. Colloids Surf. B Biointerfaces 2019, 179, 429\u0026ndash;436. \u003c/li\u003e\n\u003cli\u003eJ. Song, P. Jin, M. Li, J. Liu, D. Wu, H. Yao, J. Wang. Antibacterial properties and biocompatibility in vivo and vitro of composite coating of pure magnesium ultrasonic micro-arc oxidation phytic acid copper loaded. J. Mater. Sci. Mater. Med. 2019, 30, 49\u0026ndash;62. \u003c/li\u003e\n\u003cli\u003eR. Zeng, L. Cui, K. Jiang, R. Liu, B. Zhao, Y. Zheng. In Vitro Corrosion and Cytocompatibility of a Microarc Oxidation Coating and Poly (L-lactic acid) Composite Coating on Mg-1Li-1Ca Alloy for Orthopaedic Implants. Acs Appl. Mater. Interfaces 2016, 8, 10014\u0026ndash;10028\u003c/li\u003e\n\u003cli\u003eY. Yang, K. Zheng, R. Liang, A. Mainka, N. Taccardi, J. Roether, R. Detsch, W. Goldmann, S. Virtanen, A. Boccaccini. Cu-releasing BG/PCL Coating on Mg with Antibacterial and Anticorrosive Properties for Bone Tissue Engineering. Biomed. Mater. 2017, 13, 015001.\u003c/li\u003e\n\u003cli\u003eJ. Chen, Y. Zhang, M. Ibrahima, I. Etim, L. Tan, K. Yang. In vitro degradation and antibacterial property of a copper-containing microarc oxidation coating on Mg-2Zn-1Gd-0.5Zr alloy. Colloids Surf. B Biointerfaces 2019, 179, 77\u0026ndash;86\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Cancer Research Institute, First People’s Hospital of Foshan","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Biocompatibility, antibacterial behaviour, mitochondrial membrane potential, proteomics, metabolomics, foreign body reaction, immune system response","lastPublishedDoi":"10.21203/rs.3.rs-4220574/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4220574/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMagnesium (Mg) alloys show outstanding promise for development of degradable implants for hard tissue engineering. However, rapid corrosion and associated reductions in mechanical properties has limited their clinical application. Furthermore, bacterial infections remain an ongoing challenge for implants. Previously, we established that the magnesium alloy, AZ31(Mg-3%Al-1%Zn-0.4%Mn) in a fully annealed form, exhibits improved biocompatibility and corrosion resistance over both pure Mg and cold-extruded AZ31. Multi-omics analyses of tissues of Sprague-Dawley (SD) rats revealed that annealed AZ31 does not significantly activate inflammation and immune responses, while it enhanced signalling in tissue cell proliferation associated pathways. Furthermore, we employed coatings incorporating the host defence peptide (CHDP), caerin 1.9 (abbreviated as F3) into a biocompatible polymer, polycaprolactone (PCL), to develop functional 3-dimensional surface coating to improve biocompatibility and antibacterial performance of the Mg alloy materials. In this study, we have assessed the responses from MC3T3-E1 cells cultured with the Mg alloys to further understand cellular responses. The annealed AZ31 alloy stimulated proliferation of mice osteoblast precursor cells and caused upregulation in expression of Brpf1 protein and other signalling pathways related to bone mineralization and haemostasis, which promote bone tissue formation. The coated and annealed AZ31 alloy (F3-PCL-3A) demonstrated exceptional biocompatibility, causing no adverse effects on hepatic or renal function, and displaying no observable changes in vital organs three months after implantation in SD rats. F3-PCL-3A displayed long-lasting and stable antibacterial properties both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. Proteomics and metabolomics analyses of tissues in direct-contact with implants revealed that F3-PCL-3A did not activate inflammation or immune-associated signalling pathways in SD rats 3 months post-implantation. Meanwhile, it activated inflammatory responses, especially phagocytosis pathways up to 72 hours post implantation, indicating enhanced antibacterial capability during the acute stage after implantation. In summary, F3-PCL-3A shows outstanding promise for degradable implants with active antibacterial capabilities for internal fixation and fracture repair.\u003c/p\u003e","manuscriptTitle":"Caerin 1.9-polycaprolactone-coated magnesium implants enhance antibacterial performance and reduce foreign body responses in Sprague-Dawley rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-08 06:31:49","doi":"10.21203/rs.3.rs-4220574/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0f0ee1be-902b-4668-9fa1-741837ff4f60","owner":[],"postedDate":"April 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":30293758,"name":"Materials Engineering"},{"id":30293759,"name":"Biomedical Engineering"},{"id":30293760,"name":"Analytical Biochemistry"}],"tags":[],"updatedAt":"2024-04-08T06:31:49+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-08 06:31:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4220574","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4220574","identity":"rs-4220574","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}