Template DNA degradation-based fluorescent turn-off silver nanoclusters for nucleic acids detection with exonuclease III-assisted cycle amplification | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Template DNA degradation-based fluorescent turn-off silver nanoclusters for nucleic acids detection with exonuclease III-assisted cycle amplification Zhikun Zhang, Minghua Zu, Cuixia Hu, Shan Guan, Yuechao Shi, Yumin Liu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3834958/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract DNA-templated silver nanoclusters (DNA/AgNCs) exhibited the outstanding optical characteristics for molecular diagnosis. Herein, we developed the degradation of template DNA- based fluorescent turn-off template ssDNA/AgNCs probe to construct the nucleic acids detection platform with exonuclease III (Exo III)-assisted cycle amplification. Our results demonstrated that the template DNA degradation of DNA/AgNCs dramatically decreased the fluorescent signal own to the morphological change. Inspired by this mechanism, target nucleic acids in our detection system could effectively hybridize with template DNA of ssDNA/AgNCs, and template DNA were cyclically degraded by Exo III-assisted cyclic degradation. The degradation of template ssDNA induced the changing of the morphology and the decreasing of fluorescent of AgNCs. Target DNA can be detected at low temperature (37 o C) without thermal cycles, showing a wide linear relationship from 0.4 to 200 nM. The limit of detection (LOD) was as low as 0.1 nM. The strategy offered a promising method to nucleic acids detection, which had excellent practicability in testing. biomarkers fluorescent probe nucleic acids silver nanoclusters Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Specific nucleic acids are potentially closely associated with the emergence of severe diseases (Vlassov, Laktionov et al. 2010 , Gilboa, Garden et al. 2020 ). These nucleic acids can serve as early biomarkers for conditions forecast, such as cancer, contagious diseases and so on. Diagnosing these diseases in their initial stages can significantly enhance the chances of survival and cure, decreasing patient’s plain (Falconnet, She et al. 2015 , Bartosik and Jirakova 2019 , Qi and Du 2022 ). As “gold standard” for nucleic acids detection with many times cycles amplification by bulky thermal cycles (Rödiger, Liebsch et al. 2014 , Chen, Sun et al. 2022 ) with the high specificity and efficiency, polymerase chain reaction (PCR) has been extensively applied in the fields of nucleic acids detection. However, this method requires costly equipment, time-consuming, and technical personnel with thermal cycles, which make PCR unable to meet needs for nucleic acids-based disease’s diagnosis. Thus, it is of practical significance to develop a sensitive, convenient, and simple nucleic acids assay. Due to that nucleic acid concentration in clinical samples is extremely low, detection techniques predominantly rely on nucleic acid amplification (Dong, Cui et al. 2012 ). Now, the isothermal strategies for nucleic acids detection has attracted widespread attention own to the convenient and simple operation with rapid process, such as the hybridization chain reaction (HCR) (Dong, Cui et al. 2012 , Ikbal, Lim et al. 2015 ), catalyzed hairpin assembly (CHA) (Li, Cheng et al. 2016 , Fang, Xie et al. 2018 ), toehold mediated strand displacement reaction (SDR) (Zhang, Wang et al. 2018 , Ding, Yu et al. 2023 ), nicking endonuclease signal amplification (NESA) (Suea-Ngam, Bezinge et al. 2020 , Liu, Wu et al. 2021 , Tang, Xu et al. 2022 ), and exonuclease-assisted nucleic acids detection (Li, Huang et al. 2019 , Wen, Yang et al. 2020 , Zhang, Li et al. 2022 ). Exonuclease III (Exo III)-assisted nucleic acids amplification have more specificity and selectively than that of other methods with simply operation at isothermal low temperature. Exo III specifically catalyzed the stepwise removal of mononucleotides in the direction from the 3 ’ to 5 ’ terminus of duplex DNA without the specific recognition site to selectively degrade one single-stranded DNA in duplex DNA (Li, Yang et al. 2019 , Liu, Lei et al. 2020 , Zhang, Li et al. 2022 ). Based on this character, Exo III can be utilized to programmatically degrade double-stranded nucleic acids to single-stranded nucleic acids. DNA-templated silver nanoclusters (AgNCs) as fluorescent probes exhibited dramatically unique optical properties own to the ultrasmall particles with core sizes below 2 nm (Zhang, Liu et al. 2017 ). The size- and shape-dependent optical properties-based DNA/AgNCs have been developed to construct molecular detection systems (Zhang, Liu et al. 2017 , Lv, Dong et al. 2020 , Yao, Xu et al. 2021 , Qian, Yang et al. 2023 ). Inspired by the degradation of ssDNA from dsDNA with Exo III, we investigated the effect of the degradation of template DNA of AgNCs on the fluorescent signal of DNA-templated silver nanoclusters (DNA/AgNCs). Meanwhile, a novel fluorescent turn-off AgNCs detection platform were constructed by Exo III-assisted cyclic amplification to rapid, sensitive nucleic acids detection at 37 o C. The degradation of template DNA-based fluorescent turn-off DNA/AgNCs probe holds significant promise for constructing nucleic acid detection platform. 2. Materials and methods 2.1. Chemicals and instruments Silver nitrate (AgNO 3 ) and sodium chloride (NaCl) were purchased from Tianjin Yingda Rare Chemical Reagent Factory. Sodium borohydride (NaBH 4 ) was purchased from Tianjing Fuchen Chemical Reagents factory. Sodium hydrogen phosphate (Na 2 HPO 4 ) and Sodium dihydrogen phosphate were purchased from Tianjin Damao Chemical Reagent Factory. Exonuclease Ⅲ was bought from Thermo Scientific. Fluorescent spectra were recorded on a RF-5301PC, Shimadzu, Japan. All oligonucleotides with HPLC purification were purchased from Synbio Technologies (Shanghai, China) (Table 1 ). Table 1 DNA sequences used in the ssDNA/AgNCs-based nucleic acids detection. Name Sequence (from 5’to 3’) Target DNA GTGGGAGGCCCGGTGGGAGGATGTAGCTA ssDNA 1 ATCCTCCCACCGGGCCTCCCAC ssDNA 3 TCACAGATGAGTAAAAAAAAAAAA ssDNA 4 AAAAAAAAAAAACCCAGGTTCTCT ssDNA 5 ACTCATCTGTGAATGCTGTAGCTTATCAGACT ssDNA 6 TCAACATCAGTCTGATAAGCTACAGCATTCACAGATGAGTATACAA 2.2 Synthesis of template ssDNA/AgNCs Fluorescent template ssDNA/AgNCs probes were synthesized based on the method previously reported by our group (Zhang, Liu et al. 2017 ). Briefly, 30 µL of 100 µM DNA solution and 10 µL of 2 mM AgNO 3 solution were added into 950 µL of 20 mM PB buffer, then, mixed, and vigorously stirred for 20 min under room temperature. Afterwards, 10 µL of 2 mM NaBH 4 solution was quickly added and stirred for one hour. 2.3 Sensitivity of template ssDNA/AgNCs-based target DNA detection in the presence of ExoⅢ-cyclic amplification 10 µL target DNA with various concentrations were added into the 90 µL template ssDNA/AgNCs, afterwards, 10 U Exo Ⅲ were added into the above mixture. Finally, it was incubated at 37°C for 2 hours and detected by fluorescent spectrum. 2.4 Selectivity Several interferents were chosen to investigate the selectivity of the detection platform, including interferents ssDNA 1 , ssDNA 2 , ssDNA 3 , ssDNA 4 , glucose, and urea. 10 µL interferents were added into 90 µL template ssDNA/AgNCs-based detection system, which were incubated 37°C in the dark for 2 hours. All interfering substances were selected at a concentration of 10 nM. 3. Results and discussion 3.1 DNA-templated AgNCs synthesis for the degradation of template DNA-based fluorescent turn-off mechanism Own to the excellent programmable characteristics, DNA as templates can be used to synthesize ssDNA/AgNCs, which were typically composed of 2–30 silver atoms (Yang, Deng et al. 2022 ). The size of DNA/Ag NCs was generally smaller than 2 nm with high fluorescence intensity and excellent photostability(New, Lee et al. 2016 ). To investigate the effect of the degradation of template DNA on fluorescent turn-off signal for AgNCs, DNA-templated AgNCs were synthesized by the NaBH 4 reduction reaction (Zhang, Liu et al. 2017 ). Six different ssDNAs were designed to synthesize fluorescent ssDNA/AgNCs. As can be seen in Fig. 1 a and 1 b, the template ssDNA 1 /AgNCs displayed an excitation peak at 566 nm and a strong emission peak at 619 nm, and the photographs of ssDNA 1 /AgNCs have also a strong red fluorescence under UV light. However, there were no obvious fluorescent signals using other template ssDNAs for AgNCs preparation. It demonstrated that ssDNA 1 can effectively bind with Ag + to synthesize ssDNA/AgNCs with the strong fluorescent signal (Fig. 1 a and c ). Thus, template ssDNA 1 were utilized to synthesize AgNCs for further investigation. To study the effect of DNA templates on the morphology and fluorescent signal of ssDNA/AgNCs, we employed other ssDNA named target DNA to hybridize with template DNA, and further used enzyme Exo Ⅲ to degrade the template DNA. The polyacrylamide gel electrophoresis was employed to verify the degradation reaction of template DNA in the presence of Exo Ⅲ. Double strand DNA comprised of templated DNA and target DNA exhibited noticeable delay compared to the templated DNA or target DNA bands owing to the high molecular weight (Fig. 2 a). However, it gets broken down when Exo Ⅲ were added into the dsDNA, and the band intensity become weak and small molecular band. While, templated DNA and T-DNA were added into the Exo Ⅲ solution, which doesn't influence the templated DNA and T-DNA. It demonstrated the template DNA were degraded in the presence of target DNA within Exo Ⅲ. We can use the target DNA and Exo Ⅲ to degrade the template DNA for template DNA/AgNCs. To test the morphology and fluorescent signal of AgNCs before/ after the template DNA degradation in the presence of target DNA within Exo Ⅲ, TEM images were shown for AgNCs in Fig. 2 b and 2 c. It displayed the size (2–5 nm) of AgNCs increased to almost 20 nm with the addition of target DNA. It also suggested the quenching of DNA/AgNCs result from the generation of degradation template DNA in the presence of Exo III. Meanwhile, Fig. 2 d and 2 e were the corresponding fluorescent spectra and photographs in the UV light of AgNCs before/ after the addition of target DNA (Fig. 2 b and 2 c). The fluorescent intensity were decreased because of the degradation of template DNA, and the color became also weaken. The results demonstrated the fluorescent signal of DNA-template AgNCs were decreased when the template DNA were degraded in the presence of target DNA within Exo III. The degradation of template DNA could effectively control turn/ off fluorescent signal of ssDNA/AgNCs. 3.2. Construction of AgNCs-based target DNA detection by modulating the template DNA By inspired the fluorescent turn-off mechanism, we designed ssDNA 1 /AgNCs-based fluorescent nucleic acids detection platform with Exo Ⅲ-cyclic assisted amplification (Fig. 3 ). In our system, there were two main factors and reactions. ssDNA 1 /AgNCs were used as probe to readout signal (Fig. 3 a). Target DNA can specifically hybridize with template DNA, which were degrade by Exo III, releasing target DNA to link with template DNA again. Exo III was mainly utilized to digest the templated DNA in the dsDNA of templated DNA and target DNA. AgNCs size- and shape would be changed owing to the aggregation(Zhang, Liu et al. 2017 , Lin, Xuan et al. 2020 ). Fluorescent signal decreased for readout because of the size- and shape-dependent optical properties (Fig. 3 c). This strategy enabled target DNA to cyclically degrade template DNA to decrease the fluorescent signal of AgNCs for improving the sensitivity (Fig. 3 b). In the absence of target DNA, the templated DNA was resistant to Exo III, and the templated DNA could not be cleaved to change fluorescent signal. So, negative samples exhibited stronger fluorescent signal than positive samples. The system turned from pink to colorless when the target DNA was added into the detection system (Fig. 3 c), indicating that our strategies was feasibility to test target nucleic acids. 3.3 Optimal of ExoⅢ concentration Exo Ⅲ-assisted amplification were used to effectively improve the sensitivity, and the concentration of Exo Ⅲ is crucial in the detection platform. Initially, we chose two concentrations to test the principle of fluorescent detection. 5 U or 10 U concentration Exo Ⅲ were added into the detection system to test our strategies (Fig. 5 ). Compared the results from different concentration of ExoⅢin the detection system, the results showed that the fluorescent intensity have an obvious decreased between positive and negative in the presence of 10 U Exo Ⅲ, which is stronger than 5 U system. It indicated that our system was dramatically affected by the Exo Ⅲ, and 10U Exo Ⅲ was optimal concentration for the detection platform. 3.4 Sensitivity We tested the sensitivity of the proposed method by adding series of target DNA solution into the system. As illustrated in Fig. 5 a, the fluorescence intensity decreases monotonically with increasing concentration of the target DNA from 0.4 to 200 nM. In the logarithmic scale, the fluorescence intensity exhibited a linear correlation with the target nucleic acids concentration in the range from 0.4 nM to 200 nM (Fig. 5 b). The correlation equation was F=-177.7×LogC + 2456.2 with a correlation coefficient (R 2 ) of 0.962, where F is the fluorescence intensity obtained at 120 min and C was the target DNA concentration (nM). The detection limit was calculated to be 0.1 nM based on the principle of the average signal of the control group plus 3 times standard deviation. 3.5 Selectivity and recovery tests of simulated samples Since that the components were highly complex for actual samples, potential interferents might impact the detection platform’s accuracy, leading to false positive results. The selectivity of our system in presence of interfering substances were investigated under the optimal condition (Fig. 6 ). Four types of interferents DNA and glucose, urea were chose as interferents to evaluate the specificity and selectivity for our detection. The results showed only target DNA could significantly decrease the fluorescent signal, and the fluorescent signal of other interferents were almost similar with that of blank samples. It demonstrated that other interferents can’t affect the detection signal and our system specifically recognized the target DNA. That mean that the detection have a great specificity and selectivity for target DNA. To assess the practical accuracy of our suggested platform, we analyzed the target DNA in the mixture samples with all the interferents. Several concentrations of target DNA were chosen from 0.6 to 10 nM to test the recovery for the detection platform. The recovery percentages were displayed in Table 2 . We observed the recovery rates were from 98.9% and 104.4%. Such outcomes suggest that our platform was proficient in precisely quantifying target nucleic acids within complicated samples. Table 2 Fluorescent detection for simulated samples with adding target DNA. Added (nM) Fluorescent intensity Detecting fluorescent intensity Found concentration (nM) Recovery (%) RSD (%) 0.60 2495.68 2580 0.62 103.3 1.6 5.0 2332.01 2308 4.9 98.9 3.2 6.0 2317.94 2421 6.2 104.4 2.5 10.0 2278.51 2312 10.1 101.5 3.0 4. Conclusion In summary, DNA/AgNCs have excellent optical characteristics for molecular detection. In our system, we verified the degradation of template DNA-based fluorescent turn-off AgNCs mechanism own the morphology-based optical characteristics. Meanwhile, a novel nucleic acids detection platform were constructed by Exo III-cyclic amplification with outstanding selectivity and sensitivity at low temperature without the need for cumbersome thermal cycles. A consistent correlation was observed between target DNA concentration and fluorescence signal ranging from 0.4 to 200 nM. Impressively, the limit of detection was as low as 0.1 nM (3N/S). All these findings highlight the considerable potential of this platform for detecting nucleic acids in clinical settings. Declarations Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements This research was funded by the Natural Science Foundation of Hebei province (No. 21372411D) and Key Research and Development and Transformation Plan Project of Qinghai Province, Qinghai Province Department of Science and Technology (No. 2023-QY-211). References Bartosik, M. and Jirakova L. (2019) Electrochemical analysis of nucleic acids as potential cancer biomarkers. Current Opinion in Electrochemistry 14: 96-103. Chen, S., Sun Y., Fan F., Chen S., Zhang Y., Zhang Y., Meng X. and Lin J.-M. (2022) Present status of microfluidic PCR chip in nucleic acid detection and future perspective. TrAC Trends in Analytical Chemistry: 116737. Ding, S., Yu X., Zhao Y. and Zhao C. (2023) Identification of single nucleotide polymorphisms by a peptide nucleic acid-based sandwich hybridization assay coupled with toehold-mediated strand displacement reactions. Analytica Chimica Acta 1242: 340810. Dong, J., Cui X., Deng Y. and Tang Z. (2012) Amplified detection of nucleic acid by G-quadruplex based hybridization chain reaction. Biosensors and Bioelectronics 38(1): 258-263. Falconnet, D., She J., Tornay R. l., Leimgruber E., Bernasconi D., Lagopoulos L., Renaud P., Demierre N. and Van Den Bogaard P. (2015) Rapid, sensitive and real-time multiplexing platform for the analysis of protein and nucleic-acid biomarkers. Analytical chemistry 87(3): 1582-1589. Fang, H., Xie N., Ou M., Huang J., Li W., Wang Q., Liu J., Yang X. and Wang K. (2018) Detection of nucleic acids in complex samples via magnetic microbead-assisted catalyzed hairpin assembly and “DD–A” FRET. Analytical chemistry 90(12): 7164-7170. Gilboa, T., Garden P. M. and Cohen L. (2020) Single-molecule analysis of nucleic acid biomarkers–A review. Analytica Chimica Acta 1115: 61-85. Ikbal, J., Lim G. S. and Gao Z. (2015) The hybridization chain reaction in the development of ultrasensitive nucleic acid assays. TrAC Trends in Analytical Chemistry 64: 86-99. Li, X., Cheng W., Li D., Wu J., Ding X., Cheng Q. and Ding S. (2016) A novel surface plasmon resonance biosensor for enzyme-free and highly sensitive detection of microRNA based on multi component nucleic acid enzyme (MNAzyme)-mediated catalyzed hairpin assembly. Biosensors and Bioelectronics 80: 98-104. Li, X., Huang N., Zhang L., Zhao J. and Zhao S. (2019) A T7 exonuclease assisted dual-cycle signal amplification assay of miRNA using nanospheres-enhanced fluorescence polarization. Talanta 202: 297-302. Li, X., Yang J., Yuan R. and Xiang Y. (2019) Programming cascaded recycling amplifications for highly sensitive and label-free electrochemical sensing of transcription factors in tumor cells. Biosensors and Bioelectronics 142: 111574. Lin, X., Xuan D., Li F., Liu C., Fan P., Xiao F., Liang H. and Yang S. (2020) DNA-AgNCs as a fluorescence turn-off probe for dual functional detection of H2O2 and Fe (II) ions. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 229: 117894. Liu, Y., Wu S.-H., Du X.-Y. and Sun J.-J. (2021) Plasmonic Ag nanocube enhanced SERS biosensor for sensitive detection of oral cancer DNA based on nicking endonuclease signal amplification and heated electrode. Sensors and Actuators B: Chemical 338: 129854. Liu, Z., Lei S., Zou L., Li G. and Ye B. (2020) Grafting homogenous electrochemical biosensing strategy based on reverse proximity ligation and Exo III assisted target circulation for multiplexed communicable disease DNA assay. Biosensors and Bioelectronics 167: 112487. Lv, J., Dong Y., Gu Z. and Yang D. (2020) Programmable DNA nanoflowers for biosensing, bioimaging, and therapeutics. Chemistry–A European Journal 26(64): 14512-14524. New, S. Y., Lee S. T. and Su X. D. (2016) DNA-templated silver nanoclusters: structural correlation and fluorescence modulation. Nanoscale: 10.1039.C1036NR05872H. Qi, L. and Du Y. (2022) Diagnosis of disease relevant nucleic acid biomarkers with off-the-shelf devices. Journal of Materials Chemistry B 10(21): 3959-3973. Qian, J., Yang Y., Gong F., Shan X., Ji X. and He Z. (2023) Ratiometric fluorescence biosensing of silver NanoCluster Beacons for ATP detection based on ligation-triggered rolling cycle amplification. Microchemical Journal 190: 108663. Rödiger, S., Liebsch C., Schmidt C., Lehmann W., Resch-Genger U., Schedler U. and Schierack P. (2014) Nucleic acid detection based on the use of microbeads: a review. Microchimica Acta 181: 1151-1168. Suea-Ngam, A., Bezinge L., Mateescu B., Howes P. D., deMello A. J. and Richards D. A. (2020) Enzyme-assisted nucleic acid detection for infectious disease diagnostics: moving toward the point-of-care. ACS sensors 5(9): 2701-2723. Tang, Q., Xu J., Wei S., Chen H., Chen J., Zhang H. and Liu L. (2022) Label-free and highly sensitive detection of CRP based on the combination of nicking endonuclease-assisted signal amplification and capillary electrophoresis-UV assay. Analytica Chimica Acta 1221: 340131. Vlassov, V., Laktionov P. and Rykova E. (2010) Circulating nucleic acids as a potential source for cancer biomarkers. Current Molecular Medicine 10(2): 142-165. Wen, K., Yang X., Zhang C., Wei H., Zou G. and Zhu Y. (2020) Exonuclease III-assisted positive feedback signal amplification strategy for ultrasensitive electrochemical detection of nucleic acids. Sensors and Actuators B: Chemical 304: 127410. Yang, C., Deng H., He J., Zhang X., Gao J., Shang X., Zuo S., Yuan R. and Xu W. (2022) Amplifiable ratiometric fluorescence biosensing of nanosilver multiclusters populated in three-way-junction DNA branches. Biosensors & Bioelectronics: The International Journal for the Professional Involved with Research, Technology and Applications of Biosensers and Related Devices: 199. Yao, C., Xu Y., Hu P., Ou J. and Yang D. (2021) Gene-like precise construction of functional DNA materials. Accounts of Materials Research 3(1): 42-53. Zhang, C., Li G., Ye B., Zou L., Wang W. and Ji Y. (2022) A reproducible electrochemical biosensor for tobramycin highly sensitive detection based on ExoIII-assisted nucleic acid circulation and CHA reaction. Microchemical Journal 183: 108040. Zhang, J., Wang L.-L., Hou M.-F., Xia Y.-K., He W.-H., Yan A., Weng Y.-P., Zeng L.-P. and Chen J.-H. (2018) A ratiometric electrochemical biosensor for the exosomal microRNAs detection based on bipedal DNA walkers propelled by locked nucleic acid modified toehold mediate strand displacement reaction. Biosensors and Bioelectronics 102: 33-40. Zhang, Z., Liu Y., Liu P., Yang L., Jiang X., Luo D. and Yang D. (2017) Non-invasive detection of gastric cancer relevant D-amino acids with luminescent DNA/silver nanoclusters. Nanoscale 9: 19367-19373. Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 22 Jan, 2024 Reviewers invited by journal 22 Jan, 2024 Editor invited by journal 08 Jan, 2024 Editor assigned by journal 04 Jan, 2024 First submitted to journal 03 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3834958","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":268619700,"identity":"7b994bb5-42ad-4e2e-8500-5e999dc7ac2c","order_by":0,"name":"Zhikun Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYDACCcZmMG0AIj6QrIVxBnFaGJjhWph5iNEhP7u52Zh3B4O9OfvZw69tyqwZ+Nu7E/BqYZxzsDmZ9wwDs2VPXpp1zrl0BokzZzfg1cIskdh8mLeNgc3gQI6ZcW7bYQYDiVz8WtigWngMzr8xM7YkRgsPUEsyUIuEwY0c48eMxGiRAGoxnNsmYWBw440ZY8+5dB6CfpGfkf5Y4m2bjb3B+RzjDz/KrOX423vxa4FZBvEXAxtxUQMHzB+AWkjSMQpGwSgYBSMDAACIcj84rGkKOAAAAABJRU5ErkJggg==","orcid":"","institution":"Hebei University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Zhikun","middleName":"","lastName":"Zhang","suffix":""},{"id":268619701,"identity":"ae640a50-1e3e-43d9-a31a-f4c1a02ea0b1","order_by":1,"name":"Minghua Zu","email":"","orcid":"","institution":"Hebei University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Minghua","middleName":"","lastName":"Zu","suffix":""},{"id":268619702,"identity":"428d5d71-7039-4bce-b415-4d29d83ae814","order_by":2,"name":"Cuixia Hu","email":"","orcid":"","institution":"Hebei University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Cuixia","middleName":"","lastName":"Hu","suffix":""},{"id":268619703,"identity":"17908cde-c438-4514-8231-8ead055883f2","order_by":3,"name":"Shan Guan","email":"","orcid":"","institution":"Hebei University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Shan","middleName":"","lastName":"Guan","suffix":""},{"id":268619704,"identity":"d6ca38eb-e25f-40aa-910b-66d3840250bd","order_by":4,"name":"Yuechao Shi","email":"","orcid":"","institution":"Hebei University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yuechao","middleName":"","lastName":"Shi","suffix":""},{"id":268619705,"identity":"249fb0c0-b320-4573-9e4f-7f8e073b869c","order_by":5,"name":"Yumin Liu","email":"","orcid":"","institution":"Hebei University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yumin","middleName":"","lastName":"Liu","suffix":""},{"id":268619706,"identity":"b59c2ca9-7d0a-4742-a7b1-2f18eaedc983","order_by":6,"name":"Jilong Han","email":"","orcid":"","institution":"Hebei University of Science and Technology","correspondingAuthor":false,"prefix":"","firstName":"Jilong","middleName":"","lastName":"Han","suffix":""}],"badges":[],"createdAt":"2024-01-04 16:23:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3834958/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3834958/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50084868,"identity":"59f22aa9-040f-40f0-bd82-ef98cb3e5451","added_by":"auto","created_at":"2024-01-24 09:05:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":204333,"visible":true,"origin":"","legend":"\u003cp\u003eThe fluorescent ssDNA/AgNCs were synthesized by different ssDNAs as stabilizing ligands. a) the excitation and b) emission spectrum of ssDNA/AgNCs, c) the inset shows photographs of ssDNA/AgNCs under UV light, d) comparison of the fluorescent AgNCs signal.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3834958/v1/d78045c58927ae5abd85e65d.png"},{"id":50084863,"identity":"f962e843-5874-4572-872d-cf276abae465","added_by":"auto","created_at":"2024-01-24 09:05:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":633664,"visible":true,"origin":"","legend":"\u003cp\u003eTemplate DNA degradation for fluorescence turn/ off AgNCs in the presence of target DNA within Exo Ⅲ. a) Polyacrylamide gel electrophoresis for validation of template DNA degradation. TEM image of DNA/Ag NCs before (b) and after (c) adding T-DNA in our detection system. The fluorescent spectrums and photographs in the UV light of AgNCs before/ after the addition of target DNA.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3834958/v1/2540ab72ca4adff08ad956b8.png"},{"id":50084866,"identity":"028a2ea5-d0d6-419e-a6f6-864e39449ddc","added_by":"auto","created_at":"2024-01-24 09:05:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":250519,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of the DNA/AgNCs-based nucleic acids detection platform. a) the synthesis of ssDNA/AgNCs; b) the templated DNA in the double strand DNA were degraded by Exo III. c) the principle of fluorescent nucleic acids detection, the inserted was the detection system with and without target DNA, respectively.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3834958/v1/eee3a2e84ef695fd4cfc87d2.png"},{"id":50084865,"identity":"341e8620-f5e7-4de8-afde-5678767f93f4","added_by":"auto","created_at":"2024-01-24 09:05:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":209106,"visible":true,"origin":"","legend":"\u003cp\u003eThe optimal of Exo Ⅲ for AgNCs-based detection platform. a) the emission spectra of AgNCs in the presence of varying concentration of Exo Ⅲ, b) the plot of the relative fluorescent intensity at 619nm versus the concentration of Exo Ⅲ, c) the comparison of fluorescent intensity of varying concentrations of Exo Ⅲ.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3834958/v1/66a62eca9b6e34edb3bd8bca.png"},{"id":50085072,"identity":"a491630b-fae2-4399-84ce-91024138d903","added_by":"auto","created_at":"2024-01-24 09:13:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":137040,"visible":true,"origin":"","legend":"\u003cp\u003eSensitivity of AgNCs-based nucleic acids detection system. a) the emission spectra of AgNCs in the presence of varying concentration of target DNA, b) the plot of the relative fluorescent intensity at 619 nm versus the concentration of target DNA.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3834958/v1/e19346cdf6caa8840f6a5985.png"},{"id":50084864,"identity":"59fbaf9c-c10e-401e-bdd7-e2c74a28f709","added_by":"auto","created_at":"2024-01-24 09:05:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":61832,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of interferents on the detection of target DNA by fluorescent template DNA/AgNCs detection.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3834958/v1/4cccc16d864723a462da34d0.png"},{"id":50085305,"identity":"e41a7c9e-b28b-4fdc-96a8-fc4fa9dbfdd2","added_by":"auto","created_at":"2024-01-24 09:21:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1534224,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3834958/v1/6724219a-97db-448f-99e1-44abc5df1190.pdf"}],"financialInterests":"","formattedTitle":"Template DNA degradation-based fluorescent turn-off silver nanoclusters for nucleic acids detection with exonuclease III-assisted cycle amplification","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eSpecific nucleic acids are potentially closely associated with the emergence of severe diseases (Vlassov, Laktionov et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, Gilboa, Garden et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). These nucleic acids can serve as early biomarkers for conditions forecast, such as cancer, contagious diseases and so on. Diagnosing these diseases in their initial stages can significantly enhance the chances of survival and cure, decreasing patient\u0026rsquo;s plain (Falconnet, She et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Bartosik and Jirakova \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Qi and Du \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). As \u0026ldquo;gold standard\u0026rdquo; for nucleic acids detection with many times cycles amplification by bulky thermal cycles (R\u0026ouml;diger, Liebsch et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Chen, Sun et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) with the high specificity and efficiency, polymerase chain reaction (PCR) has been extensively applied in the fields of nucleic acids detection. However, this method requires costly equipment, time-consuming, and technical personnel with thermal cycles, which make PCR unable to meet needs for nucleic acids-based disease\u0026rsquo;s diagnosis. Thus, it is of practical significance to develop a sensitive, convenient, and simple nucleic acids assay.\u003c/p\u003e \u003cp\u003eDue to that nucleic acid concentration in clinical samples is extremely low, detection techniques predominantly rely on nucleic acid amplification (Dong, Cui et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Now, the isothermal strategies for nucleic acids detection has attracted widespread attention own to the convenient and simple operation with rapid process, such as the hybridization chain reaction (HCR) (Dong, Cui et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2012\u003c/span\u003e, Ikbal, Lim et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), catalyzed hairpin assembly (CHA) (Li, Cheng et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Fang, Xie et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), toehold mediated strand displacement reaction (SDR) (Zhang, Wang et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Ding, Yu et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), nicking endonuclease signal amplification (NESA) (Suea-Ngam, Bezinge et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Liu, Wu et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Tang, Xu et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and exonuclease-assisted nucleic acids detection (Li, Huang et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Wen, Yang et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Zhang, Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Exonuclease III (Exo III)-assisted nucleic acids amplification have more specificity and selectively than that of other methods with simply operation at isothermal low temperature. Exo III specifically catalyzed the stepwise removal of mononucleotides in the direction from the 3\u003csup\u003e\u0026rsquo;\u003c/sup\u003e to 5\u003csup\u003e\u0026rsquo;\u003c/sup\u003e terminus of duplex DNA without the specific recognition site to selectively degrade one single-stranded DNA in duplex DNA (Li, Yang et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Liu, Lei et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Zhang, Li et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Based on this character, Exo III can be utilized to programmatically degrade double-stranded nucleic acids to single-stranded nucleic acids.\u003c/p\u003e \u003cp\u003eDNA-templated silver nanoclusters (AgNCs) as fluorescent probes exhibited dramatically unique optical properties own to the ultrasmall particles with core sizes below 2 nm (Zhang, Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The size- and shape-dependent optical properties-based DNA/AgNCs have been developed to construct molecular detection systems (Zhang, Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Lv, Dong et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, Yao, Xu et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Qian, Yang et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Inspired by the degradation of ssDNA from dsDNA with Exo III, we investigated the effect of the degradation of template DNA of AgNCs on the fluorescent signal of DNA-templated silver nanoclusters (DNA/AgNCs). Meanwhile, a novel fluorescent turn-off AgNCs detection platform were constructed by Exo III-assisted cyclic amplification to rapid, sensitive nucleic acids detection at 37 \u003csup\u003eo\u003c/sup\u003eC. The degradation of template DNA-based fluorescent turn-off DNA/AgNCs probe holds significant promise for constructing nucleic acid detection platform.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Chemicals and instruments\u003c/h2\u003e \u003cp\u003eSilver nitrate (AgNO\u003csub\u003e3\u003c/sub\u003e) and sodium chloride (NaCl) were purchased from Tianjin Yingda Rare Chemical Reagent Factory. Sodium borohydride (NaBH\u003csub\u003e4\u003c/sub\u003e) was purchased from Tianjing Fuchen Chemical Reagents factory. Sodium hydrogen phosphate (Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e) and Sodium dihydrogen phosphate were purchased from Tianjin Damao Chemical Reagent Factory. Exonuclease Ⅲ was bought from Thermo Scientific. Fluorescent spectra were recorded on a RF-5301PC, Shimadzu, Japan. All oligonucleotides with HPLC purification were purchased from Synbio Technologies (Shanghai, China) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDNA sequences used in the ssDNA/AgNCs-based nucleic acids detection.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (from 5\u0026rsquo;to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget DNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGGGAGGCCCGGTGGGAGGATGTAGCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003essDNA\u003csub\u003e1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCCTCCCACCGGGCCTCCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003essDNA\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACAGATGAGTAAAAAAAAAAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003essDNA\u003csub\u003e4\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAAAAAAAAAACCCAGGTTCTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003essDNA\u003csub\u003e5\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTCATCTGTGAATGCTGTAGCTTATCAGACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003essDNA\u003csub\u003e6\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAACATCAGTCTGATAAGCTACAGCATTCACAGATGAGTATACAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Synthesis of template ssDNA/AgNCs\u003c/h2\u003e \u003cp\u003eFluorescent template ssDNA/AgNCs probes were synthesized based on the method previously reported by our group (Zhang, Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Briefly, 30 \u0026micro;L of 100 \u0026micro;M DNA solution and 10 \u0026micro;L of 2 mM AgNO\u003csub\u003e3\u003c/sub\u003e solution were added into 950 \u0026micro;L of 20 mM PB buffer, then, mixed, and vigorously stirred for 20 min under room temperature. Afterwards, 10 \u0026micro;L of 2 mM NaBH\u003csub\u003e4\u003c/sub\u003e solution was quickly added and stirred for one hour.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Sensitivity of template ssDNA/AgNCs-based target DNA detection in the presence of ExoⅢ-cyclic amplification\u003c/h2\u003e \u003cp\u003e10 \u0026micro;L target DNA with various concentrations were added into the 90 \u0026micro;L template ssDNA/AgNCs, afterwards, 10 U Exo Ⅲ were added into the above mixture. Finally, it was incubated at 37\u0026deg;C for 2 hours and detected by fluorescent spectrum.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Selectivity\u003c/h2\u003e \u003cp\u003eSeveral interferents were chosen to investigate the selectivity of the detection platform, including interferents ssDNA\u003csub\u003e1\u003c/sub\u003e, ssDNA\u003csub\u003e2\u003c/sub\u003e, ssDNA\u003csub\u003e3\u003c/sub\u003e, ssDNA\u003csub\u003e4\u003c/sub\u003e, glucose, and urea. 10 \u0026micro;L interferents were added into 90 \u0026micro;L template ssDNA/AgNCs-based detection system, which were incubated 37\u0026deg;C in the dark for 2 hours. All interfering substances were selected at a concentration of 10 nM.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results and discussion","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e3.1 DNA-templated AgNCs synthesis for the degradation of template DNA-based fluorescent turn-off mechanism\u003c/h2\u003e \u003cp\u003eOwn to the excellent programmable characteristics, DNA as templates can be used to synthesize ssDNA/AgNCs, which were typically composed of 2\u0026ndash;30 silver atoms (Yang, Deng et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The size of DNA/Ag NCs was generally smaller than 2 nm with high fluorescence intensity and excellent photostability(New, Lee et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo investigate the effect of the degradation of template DNA on fluorescent turn-off signal for AgNCs, DNA-templated AgNCs were synthesized by the NaBH\u003csub\u003e4\u003c/sub\u003e reduction reaction (Zhang, Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Six different ssDNAs were designed to synthesize fluorescent ssDNA/AgNCs. As can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb, the template ssDNA\u003csub\u003e1\u003c/sub\u003e/AgNCs displayed an excitation peak at 566 nm and a strong emission peak at 619 nm, and the photographs of ssDNA\u003csub\u003e1\u003c/sub\u003e/AgNCs have also a strong red fluorescence under UV light. However, there were no obvious fluorescent signals using other template ssDNAs for AgNCs preparation. It demonstrated that ssDNA\u003csub\u003e1\u003c/sub\u003e can effectively bind with Ag\u003csup\u003e+\u003c/sup\u003e to synthesize ssDNA/AgNCs with the strong fluorescent signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea \u003cb\u003eand c\u003c/b\u003e). Thus, template ssDNA\u003csub\u003e1\u003c/sub\u003e were utilized to synthesize AgNCs for further investigation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo study the effect of DNA templates on the morphology and fluorescent signal of ssDNA/AgNCs, we employed other ssDNA named target DNA to hybridize with template DNA, and further used enzyme Exo Ⅲ to degrade the template DNA. The polyacrylamide gel electrophoresis was employed to verify the degradation reaction of template DNA in the presence of Exo Ⅲ. Double strand DNA comprised of templated DNA and target DNA exhibited noticeable delay compared to the templated DNA or target DNA bands owing to the high molecular weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). However, it gets broken down when Exo Ⅲ were added into the dsDNA, and the band intensity become weak and small molecular band. While, templated DNA and T-DNA were added into the Exo Ⅲ solution, which doesn't influence the templated DNA and T-DNA. It demonstrated the template DNA were degraded in the presence of target DNA within Exo Ⅲ. We can use the target DNA and Exo Ⅲ to degrade the template DNA for template DNA/AgNCs.\u003c/p\u003e \u003cp\u003eTo test the morphology and fluorescent signal of AgNCs before/ after the template DNA degradation in the presence of target DNA within Exo Ⅲ, TEM images were shown for AgNCs in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec. It displayed the size (2\u0026ndash;5 nm) of AgNCs increased to almost 20 nm with the addition of target DNA. It also suggested the quenching of DNA/AgNCs result from the generation of degradation template DNA in the presence of Exo III. Meanwhile, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee were the corresponding fluorescent spectra and photographs in the UV light of AgNCs before/ after the addition of target DNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). The fluorescent intensity were decreased because of the degradation of template DNA, and the color became also weaken. The results demonstrated the fluorescent signal of DNA-template AgNCs were decreased when the template DNA were degraded in the presence of target DNA within Exo III. The degradation of template DNA could effectively control turn/ off fluorescent signal of ssDNA/AgNCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Construction of AgNCs-based target DNA detection by modulating the template DNA\u003c/h2\u003e \u003cp\u003eBy inspired the fluorescent turn-off mechanism, we designed ssDNA\u003csub\u003e1\u003c/sub\u003e/AgNCs-based fluorescent nucleic acids detection platform with Exo Ⅲ-cyclic assisted amplification (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In our system, there were two main factors and reactions. ssDNA\u003csub\u003e1\u003c/sub\u003e/AgNCs were used as probe to readout signal (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Target DNA can specifically hybridize with template DNA, which were degrade by Exo III, releasing target DNA to link with template DNA again. Exo III was mainly utilized to digest the templated DNA in the dsDNA of templated DNA and target DNA. AgNCs size- and shape would be changed owing to the aggregation(Zhang, Liu et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Lin, Xuan et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Fluorescent signal decreased for readout because of the size- and shape-dependent optical properties (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). This strategy enabled target DNA to cyclically degrade template DNA to decrease the fluorescent signal of AgNCs for improving the sensitivity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). In the absence of target DNA, the templated DNA was resistant to Exo III, and the templated DNA could not be cleaved to change fluorescent signal. So, negative samples exhibited stronger fluorescent signal than positive samples. The system turned from pink to colorless when the target DNA was added into the detection system (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec), indicating that our strategies was feasibility to test target nucleic acids.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Optimal of ExoⅢ concentration\u003c/h2\u003e \u003cp\u003eExo Ⅲ-assisted amplification were used to effectively improve the sensitivity, and the concentration of Exo Ⅲ is crucial in the detection platform. Initially, we chose two concentrations to test the principle of fluorescent detection. 5 U or 10 U concentration Exo Ⅲ were added into the detection system to test our strategies (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Compared the results from different concentration of ExoⅢin the detection system, the results showed that the fluorescent intensity have an obvious decreased between positive and negative in the presence of 10 U Exo Ⅲ, which is stronger than 5 U system. It indicated that our system was dramatically affected by the Exo Ⅲ, and 10U Exo Ⅲ was optimal concentration for the detection platform.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Sensitivity\u003c/h2\u003e \u003cp\u003eWe tested the sensitivity of the proposed method by adding series of target DNA solution into the system. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, the fluorescence intensity decreases monotonically with increasing concentration of the target DNA from 0.4 to 200 nM. In the logarithmic scale, the fluorescence intensity exhibited a linear correlation with the target nucleic acids concentration in the range from 0.4 nM to 200 nM (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). The correlation equation was F=-177.7\u0026times;LogC\u0026thinsp;+\u0026thinsp;2456.2 with a correlation coefficient (R\u003csup\u003e2\u003c/sup\u003e) of 0.962, where F is the fluorescence intensity obtained at 120 min and C was the target DNA concentration (nM). The detection limit was calculated to be 0.1 nM based on the principle of the average signal of the control group plus 3 times standard deviation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Selectivity and recovery tests of simulated samples\u003c/h2\u003e \u003cp\u003eSince that the components were highly complex for actual samples, potential interferents might impact the detection platform\u0026rsquo;s accuracy, leading to false positive results. The selectivity of our system in presence of interfering substances were investigated under the optimal condition (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Four types of interferents DNA and glucose, urea were chose as interferents to evaluate the specificity and selectivity for our detection. The results showed only target DNA could significantly decrease the fluorescent signal, and the fluorescent signal of other interferents were almost similar with that of blank samples. It demonstrated that other interferents can\u0026rsquo;t affect the detection signal and our system specifically recognized the target DNA. That mean that the detection have a great specificity and selectivity for target DNA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo assess the practical accuracy of our suggested platform, we analyzed the target DNA in the mixture samples with all the interferents. Several concentrations of target DNA were chosen from 0.6 to 10 nM to test the recovery for the detection platform. The recovery percentages were displayed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. We observed the recovery rates were from 98.9% and 104.4%. Such outcomes suggest that our platform was proficient in precisely quantifying target nucleic acids within complicated samples.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFluorescent detection for simulated samples with adding target DNA.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdded (nM)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFluorescent intensity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDetecting fluorescent intensity\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFound concentration (nM)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRecovery (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRSD\u003c/p\u003e \u003cp\u003e(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2495.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2580\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e103.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e1.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2332.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2308\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e98.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2317.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2421\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e104.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2278.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2312\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e101.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e3.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eIn summary, DNA/AgNCs have excellent optical characteristics for molecular detection. In our system, we verified the degradation of template DNA-based fluorescent turn-off AgNCs mechanism own the morphology-based optical characteristics. Meanwhile, a novel nucleic acids detection platform were constructed by Exo III-cyclic amplification with outstanding selectivity and sensitivity at low temperature without the need for cumbersome thermal cycles. A consistent correlation was observed between target DNA concentration and fluorescence signal ranging from 0.4 to 200 nM. Impressively, the limit of detection was as low as 0.1 nM (3N/S). All these findings highlight the considerable potential of this platform for detecting nucleic acids in clinical settings.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u0026nbsp;\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;This research was funded by the Natural Science Foundation of Hebei province (No. 21372411D) and Key Research and Development and Transformation Plan Project of Qinghai Province, Qinghai Province Department of Science and Technology (No. 2023-QY-211).\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBartosik, M. and Jirakova L. (2019) Electrochemical analysis of nucleic acids as potential cancer biomarkers. Current Opinion in Electrochemistry 14: 96-103.\u003c/li\u003e\n \u003cli\u003eChen, S., Sun Y., Fan F., Chen S., Zhang Y., Zhang Y., Meng X. and Lin J.-M. (2022) Present status of microfluidic PCR chip in nucleic acid detection and future perspective. TrAC Trends in Analytical Chemistry: 116737.\u003c/li\u003e\n \u003cli\u003eDing, S., Yu X., Zhao Y. and Zhao C. (2023) Identification of single nucleotide polymorphisms by a peptide nucleic acid-based sandwich hybridization assay coupled with toehold-mediated strand displacement reactions. Analytica Chimica Acta 1242: 340810.\u003c/li\u003e\n \u003cli\u003eDong, J., Cui X., Deng Y. and Tang Z. (2012) Amplified detection of nucleic acid by G-quadruplex based hybridization chain reaction. Biosensors and Bioelectronics 38(1): 258-263.\u003c/li\u003e\n \u003cli\u003eFalconnet, D., She J., Tornay R. l., Leimgruber E., Bernasconi D., Lagopoulos L., Renaud P., Demierre N. and Van Den Bogaard P. (2015) Rapid, sensitive and real-time multiplexing platform for the analysis of protein and nucleic-acid biomarkers. Analytical chemistry 87(3): 1582-1589.\u003c/li\u003e\n \u003cli\u003eFang, H., Xie N., Ou M., Huang J., Li W., Wang Q., Liu J., Yang X. and Wang K. (2018) Detection of nucleic acids in complex samples via magnetic microbead-assisted catalyzed hairpin assembly and \u0026ldquo;DD\u0026ndash;A\u0026rdquo; FRET. Analytical chemistry 90(12): 7164-7170.\u003c/li\u003e\n \u003cli\u003eGilboa, T., Garden P. M. and Cohen L. (2020) Single-molecule analysis of nucleic acid biomarkers\u0026ndash;A review. Analytica Chimica Acta 1115: 61-85.\u003c/li\u003e\n \u003cli\u003eIkbal, J., Lim G. S. and Gao Z. (2015) The hybridization chain reaction in the development of ultrasensitive nucleic acid assays. TrAC Trends in Analytical Chemistry 64: 86-99.\u003c/li\u003e\n \u003cli\u003eLi, X., Cheng W., Li D., Wu J., Ding X., Cheng Q. and Ding S. (2016) A novel surface plasmon resonance biosensor for enzyme-free and highly sensitive detection of microRNA based on multi component nucleic acid enzyme (MNAzyme)-mediated catalyzed hairpin assembly. Biosensors and Bioelectronics 80: 98-104.\u003c/li\u003e\n \u003cli\u003eLi, X., Huang N., Zhang L., Zhao J. and Zhao S. (2019) A T7 exonuclease assisted dual-cycle signal amplification assay of miRNA using nanospheres-enhanced fluorescence polarization. Talanta 202: 297-302.\u003c/li\u003e\n \u003cli\u003eLi, X., Yang J., Yuan R. and Xiang Y. (2019) Programming cascaded recycling amplifications for highly sensitive and label-free electrochemical sensing of transcription factors in tumor cells. Biosensors and Bioelectronics 142: 111574.\u003c/li\u003e\n \u003cli\u003eLin, X., Xuan D., Li F., Liu C., Fan P., Xiao F., Liang H. and Yang S. (2020) DNA-AgNCs as a fluorescence turn-off probe for dual functional detection of H2O2 and Fe (II) ions. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 229: 117894.\u003c/li\u003e\n \u003cli\u003eLiu, Y., Wu S.-H., Du X.-Y. and Sun J.-J. (2021) Plasmonic Ag nanocube enhanced SERS biosensor for sensitive detection of oral cancer DNA based on nicking endonuclease signal amplification and heated electrode. Sensors and Actuators B: Chemical 338: 129854.\u003c/li\u003e\n \u003cli\u003eLiu, Z., Lei S., Zou L., Li G. and Ye B. (2020) Grafting homogenous electrochemical biosensing strategy based on reverse proximity ligation and Exo III assisted target circulation for multiplexed communicable disease DNA assay. Biosensors and Bioelectronics 167: 112487.\u003c/li\u003e\n \u003cli\u003eLv, J., Dong Y., Gu Z. and Yang D. (2020) Programmable DNA nanoflowers for biosensing, bioimaging, and therapeutics. Chemistry\u0026ndash;A European Journal 26(64): 14512-14524.\u003c/li\u003e\n \u003cli\u003eNew, S. Y., Lee S. T. and Su X. D. (2016) DNA-templated silver nanoclusters: structural correlation and fluorescence modulation. Nanoscale: 10.1039.C1036NR05872H.\u003c/li\u003e\n \u003cli\u003eQi, L. and Du Y. (2022) Diagnosis of disease relevant nucleic acid biomarkers with off-the-shelf devices. Journal of Materials Chemistry B 10(21): 3959-3973.\u003c/li\u003e\n \u003cli\u003eQian, J., Yang Y., Gong F., Shan X., Ji X. and He Z. (2023) Ratiometric fluorescence biosensing of silver NanoCluster Beacons for ATP detection based on ligation-triggered rolling cycle amplification. Microchemical Journal 190: 108663.\u003c/li\u003e\n \u003cli\u003eR\u0026ouml;diger, S., Liebsch C., Schmidt C., Lehmann W., Resch-Genger U., Schedler U. and Schierack P. (2014) Nucleic acid detection based on the use of microbeads: a review. Microchimica Acta 181: 1151-1168.\u003c/li\u003e\n \u003cli\u003eSuea-Ngam, A., Bezinge L., Mateescu B., Howes P. D., deMello A. J. and Richards D. A. (2020) Enzyme-assisted nucleic acid detection for infectious disease diagnostics: moving toward the point-of-care. ACS sensors 5(9): 2701-2723.\u003c/li\u003e\n \u003cli\u003eTang, Q., Xu J., Wei S., Chen H., Chen J., Zhang H. and Liu L. (2022) Label-free and highly sensitive detection of CRP based on the combination of nicking endonuclease-assisted signal amplification and capillary electrophoresis-UV assay. Analytica Chimica Acta 1221: 340131.\u003c/li\u003e\n \u003cli\u003eVlassov, V., Laktionov P. and Rykova E. (2010) Circulating nucleic acids as a potential source for cancer biomarkers. Current Molecular Medicine 10(2): 142-165.\u003c/li\u003e\n \u003cli\u003eWen, K., Yang X., Zhang C., Wei H., Zou G. and Zhu Y. (2020) Exonuclease III-assisted positive feedback signal amplification strategy for ultrasensitive electrochemical detection of nucleic acids. Sensors and Actuators B: Chemical 304: 127410.\u003c/li\u003e\n \u003cli\u003eYang, C., Deng H., He J., Zhang X., Gao J., Shang X., Zuo S., Yuan R. and Xu W. (2022) Amplifiable ratiometric fluorescence biosensing of nanosilver multiclusters populated in three-way-junction DNA branches. Biosensors \u0026amp; Bioelectronics: The International Journal for the Professional Involved with Research, Technology and Applications of Biosensers and Related Devices: 199.\u003c/li\u003e\n \u003cli\u003eYao, C., Xu Y., Hu P., Ou J. and Yang D. (2021) Gene-like precise construction of functional DNA materials. Accounts of Materials Research 3(1): 42-53.\u003c/li\u003e\n \u003cli\u003eZhang, C., Li G., Ye B., Zou L., Wang W. and Ji Y. (2022) A reproducible electrochemical biosensor for tobramycin highly sensitive detection based on ExoIII-assisted nucleic acid circulation and CHA reaction. Microchemical Journal 183: 108040.\u003c/li\u003e\n \u003cli\u003eZhang, J., Wang L.-L., Hou M.-F., Xia Y.-K., He W.-H., Yan A., Weng Y.-P., Zeng L.-P. and Chen J.-H. (2018) A ratiometric electrochemical biosensor for the exosomal microRNAs detection based on bipedal DNA walkers propelled by locked nucleic acid modified toehold mediate strand displacement reaction. Biosensors and Bioelectronics 102: 33-40.\u003c/li\u003e\n \u003cli\u003eZhang, Z., Liu Y., Liu P., Yang L., Jiang X., Luo D. and Yang D. (2017) Non-invasive detection of gastric cancer relevant D-amino acids with luminescent DNA/silver nanoclusters. Nanoscale 9: 19367-19373.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"chemical-papers","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"chpa","sideBox":"Learn more about [Chemical Papers](http://link.springer.com/journal/11696)","snPcode":"11696","submissionUrl":"https://www.editorialmanager.com/CHPA/default.aspx","title":"Chemical Papers","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"biomarkers, fluorescent probe, nucleic acids, silver nanoclusters","lastPublishedDoi":"10.21203/rs.3.rs-3834958/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3834958/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDNA-templated silver nanoclusters (DNA/AgNCs) exhibited the outstanding optical characteristics for molecular diagnosis. Herein, we developed the degradation of template DNA- based fluorescent turn-off template ssDNA/AgNCs probe to construct the nucleic acids detection platform with exonuclease III (Exo III)-assisted cycle amplification. Our results demonstrated that the template DNA degradation of DNA/AgNCs dramatically decreased the fluorescent signal own to the morphological change. Inspired by this mechanism, target nucleic acids in our detection system could effectively hybridize with template DNA of ssDNA/AgNCs, and template DNA were cyclically degraded by Exo III-assisted cyclic degradation. The degradation of template ssDNA induced the changing of the morphology and the decreasing of fluorescent of AgNCs. Target DNA can be detected at low temperature (37 \u003csup\u003eo\u003c/sup\u003eC) without thermal cycles, showing a wide linear relationship from 0.4 to 200 nM. The limit of detection (LOD) was as low as 0.1 nM. The strategy offered a promising method to nucleic acids detection, which had excellent practicability in testing.\u003c/p\u003e","manuscriptTitle":"Template DNA degradation-based fluorescent turn-off silver nanoclusters for nucleic acids detection with exonuclease III-assisted cycle amplification","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-24 09:05:01","doi":"10.21203/rs.3.rs-3834958/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2024-01-22T09:39:12+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-22T09:28:47+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"Chemical Papers","date":"2024-01-08T09:08:35+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-05T01:27:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"Chemical Papers","date":"2024-01-03T16:26:35+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"chemical-papers","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"chpa","sideBox":"Learn more about [Chemical Papers](http://link.springer.com/journal/11696)","snPcode":"11696","submissionUrl":"https://www.editorialmanager.com/CHPA/default.aspx","title":"Chemical Papers","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9eff5397-fc5c-408d-bb47-2ce83a333659","owner":[],"postedDate":"January 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-04-02T11:18:34+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-24 09:05:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3834958","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3834958","identity":"rs-3834958","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.