LncRNA H19 improves angiogenesis in mouse pulmonary artery endothelial cells by regulating the HIF-1α/VEGF signaling pathway

LncRNA H19 improves angiogenesis in mouse pulmonary artery endothelial cells by regulating the HIF-1α/VEGF signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LncRNA H19 improves angiogenesis in mouse pulmonary artery endothelial cells by regulating the HIF-1α/VEGF signaling pathway Lei Dou, Wei You, Yannan Chai, Huiju Shi, Qing Liu, Qiaoli Jiang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4657431/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Dec, 2024 Read the published version in Biochemical Genetics → Version 1 posted 17 You are reading this latest preprint version Abstract Persistent pulmonary hypertension of the newborn (PPHN) is a syndrome of acute respiratory failure characterized by systemic hypoxemia and elevated pulmonary arterial pressure, which leads to pathological changes in pulmonary vascular remodeling and endothelial cell function. Long non-coding RNA (lncRNA) H19 has been shown to be involved in the regulation of arterial endothelial cell function, but its regulatory role in PHN is not fully understood. In the present study, mouse pulmonary artery endothelial cells (MPAECs) were cultured in a hypoxic environment. Subsequently, the regulatory function of lncRNA H19 on MPAECs was explored by constructing adenoviruses knocking down and overexpressing lncRNA H19. The results revealed that the hypoxic environment could induce the proliferation and migration of MPAECs, as well as the high expression of lncRNA H19 in MPAECs. Knockdown of lncRNA H19 expression in MPAECs reversed hypoxic environment-induced functional changes in endothelial cells, whereas overexpression of lncRNA H19 further enhanced the proliferation and migration of MPAECs. In addition, further assays revealed that lncRNA H19 upregulated the hypoxia-inducible factor-1α (HIF-1α)/vascular endothelial growth factor (VEGF) pathway through sponge adsorption of microRNA-20a-5p, which in turn promoted changes in endothelial cell function. LncRNA H19 may interfere with vascular remodeling in hypoxia-induced pulmonary hypertension by upregulating the expression of HIF-1α and VEGF in vascular endothelial cells. PPHN lncRNA H19 VEGF HIF-1α angiogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Persistent pulmonary hypertension of the newborn (PPHN) is a condition in which the pulmonary vascular resistance fails to decrease at birth, resulting in a reduction in pulmonary blood flow and impaired gas exchange ( 1 ). Abnormal pulmonary vascular reactivity is the main clinical feature of PPHN ( 2 ). Vascular dysfunction often develops during fetal life and interferes with the normal adaptation of pulmonary circulation at birth. Infants with PPHN develop important hypoxemia, which increases the risk of mortality and long-term disability ( 3 , 4 ). Previous studies have shown that adverse stimuli such as chronic hypoxia in utero can alter the reactivity and structure of the pulmonary vasculature, leading to a failure to dilate the pulmonary vasculature at birth ( 5 , 6 ). Hypoxia-inducible factor-1α (HIF-1α), a protein containing a basic helix-loop-helix PAS structural domain, is a major transcriptional regulator of cellular and developmental responses to hypoxia ( 7 ). HIF-1α can participate in the regulation of cellular responses to hypoxia by upregulating the transcription factor vascular endothelial growth factor (VEGF) ( 8 , 9 ). VEGF is a specific endothelial cell mitogen that regulates endothelial cell differentiation, angiogenesis and vascular maintenance ( 10 ). VEGF is essential for early vascular development, which is one of the most potent and critical regulators of pulmonary vascular growth, development, and maintenance throughout embryonic, fetal and postnatal life ( 11 ). In human fetal lung, VEGF is localized to alveolar epithelial cells and myocytes ( 10 ). Previous studies have demonstrated that targeting VEGF upregulates endothelial nitric oxide (NO) synthase in endothelial cells ( 12 ) and improves blood flow in vivo ( 13 ). Persistent intrauterine pulmonary hypertension prevents vessel growth, which may be associated with altered VEGF-NO signaling ( 14 ). Lung VEGF expression is significantly reduced in chronic intrauterine pulmonary hypertension. Impaired VEGF signaling can potentially impair vascular function as well as the growth and structure of the developing lung, contributing to the pathogenesis of PPHN ( 15 ). However, the expression of pulmonary VEGF mRNA and its receptor is elevated in patients with severe pulmonary hypertension and in models of hypoxia-induced pulmonary hypertension ( 16 – 18 ), suggesting that the HIF-1α/VEGF axis may be involved in regulating the development of hypoxia-induced PPHN. However, the underlying regulatory mechanisms are not fully understood. Long non-coding RNAs (lncRNAs) are by-products of RNA polymerase II transcription and are a group of non-coding transcripts ≥ 200 nucleotides in length. LncRNAs have little or no potential to encode proteins ( 19 , 20 ). With the development of high-throughput sequencing technologies, cumulative evidence suggests that IncRNAs can regulate the expression of protein-coding genes epigenetically, transcriptionally and post-transcriptionally, thereby affecting a range of biological processes ( 21 , 22 ). LncRNA H19, located on human chromosome 11p15.5, is one of the best known imprinted genes, which are involved in a variety of diseases such as cancer ( 23 ), diabetes ( 24 ) and cardiovascular diseases ( 25 ). Numerous diseases such as lung cancer, pulmonary hypertension and asthma are recognized as systemic diseases with pulmonary manifestations. The progression of these diseases has been reported to be closely related to the regulation of lncRNA H19 ( 26 – 28 ). LncRNA H19 was reported to be able to promote lung fibrosis by inhibiting microRNA (miRNA or miR)-140 expression in human lung fibroblasts, leading to enhanced extracellular matrix deposition ( 26 ). In addition, lncRNA H19 has specific regulatory roles in airway smooth muscle cells, adult myocytes, cardiomyocytes, small cell lung cancer lines and non-small cell lung cancer lines ( 29 – 31 ). The study of lncRNAs’ involvement in pulmonary vascular remodeling has been recently an emerging field. LncRNA H19 has been shown to be involved in the remodeling of small pulmonary arteries and the development of pulmonary hypertension in adults ( 32 , 33 ). Pulmonary artery smooth muscle cell overproliferation and arterial endothelial cell dysfunction can lead to vascular remodeling ( 34 ). It was shown that lncRNA H19 was able to bind to let-7b as a competitive endogenous RNA, downregulate its expression, upregulate cyclin D1 expression, and promote vascular smooth muscle proliferation and vascular remodeling ( 29 ). It was also shown that, by binding and isolating let-7b, lncRNA H19 upregulated angiotensin I receptor-1 (AT1R) expression in platelet-derived growth factor-BB-stimulated rat pulmonary artery smooth muscle cells ( 35 ). Angiotensin II binding to AT1R activates the MAPK signaling pathway, which promotes vascular and smooth muscle cell proliferation and vascular remodeling ( 35 ). However, whether lncRNA H19 is involved in the regulation of the pathogenesis of PPHN is unclear. The aim of the present study was to establish a mouse pulmonary artery endothelial cell dysfunction model to simulate PPHN pathology in vitro by hypoxia induction. Subsequently, the knockdown and overexpression of lncRNA H19 in combination with cell transfection and counting were used to investigate whether lncRNA H19 was involved in PPHN and its intrinsic regulatory mechanism, which may provide new therapeutic targets and ideas for PPHN. Materials and methods Reagents . Mouse pulmonary artery endothelial cells (MPAECs) were purchased from Shanghai Fuyu Biotechnology Co., Ltd. Transwell chambers, DMEM, and RPMI1640 serum-free and complete media were purchased from Gibco (Thermo Fisher Scientific, Inc. (cat. no. FY22FN2097). Fetal bovine serum (cat. no. 10099-141) was purchased from Gibco (Thermo Fisher Scientific, Inc.). Sterile PBS and trypsin were purchased from Shanghai Biyuntian Biotechnology Co., Ltd. Formaldehyde fixative and 0.1% crystal violet staining solution were purchased from Wuhan Xavier Biotechnology Co., LTD. Total RNA extraction and reverse transcription kits were purchased from Takara. Quantitative PCR (qPCR) primers were designed and synthesized by Takara Bio, Inc. Anti-VEGF and anti-HIF-1α antibodies were purchased from Abcam, while anti-β-actin antibody was purchased from Peprotech, Inc. Cell experiments . After reaching ~ 50% confluence, MPAECs were incubated for 12 h in medium with a serum concentration of 0.02%. Subsequently, the cells were grouped according to the purpose of the experiment as follows: i) Normoxic group (Normal): Cells were placed in a normoxic cell culture incubator for 24, 48 and 72 h; ii) hypoxia group (Hypoxia): Cells were placed in a hypoxic cell culture incubator (3% O 2 ) for 24, 48 and 72 h; iii) knockdown negative control (NC) group [small hairpin (sh)NC]: 12 h after shNC transfection of cells, cells were cultured in 3% O 2 for 48 h; iv) knockdown experimental group (shRNA-lncRNA H19): 12 h after shRNA-lncRNA H19 transfection, cells were cultured in 3% O 2 for 48 h; v) overexpression (OE)-NC group (OE-NC): 12 h after OE-NC transfection, cells were cultured in 3% O 2 for 48 h; vi) OE experimental group (OE-lncRNA H19): 12 h after OE-lncRNA H19 transfection, cells were cultured in 3% O 2 for 48 h; vii) NC group of small interfering RNA (NC): 12 h after NC transfection, cells were incubated in 3% O 2 for 48 h; and viii) small interfering RNA (siRNA) experimental group (siRNA-miR-20a-5p): Following transfection of siRNA-miR-20a-5p for 12 h, the cells were cultured in 3% O 2 for 48 h. Cell transfection . For the cell transfection group, adenovirus was added directly into complete medium at a multiplicity of infection of 100. After 24 h of transfection, the medium was changed to normal complete medium. Subsequent analysis was performed after the appropriate time of infection according to the instructions. Cell migration assay. Transwell chambers (8µm pores, Corning Inc., Corning NY) were pre-coated with 1% matrigel incubated at 37℃for 30 min. Next, the gelatin was aspirated off and the chambers were washed three times with PBS. Serum-free medium was then used to culture MPAECs Cells in logarithmic growth phase were employed and washed with PBS, and trypsin was then added to digest the cells. Cells were then centrifuged at 1,000 rpm at room temperature for 5 min. The supernatant was subsequently discarded, and the cells were resuspended by adding 1 ml serum-free culture medium. Next, 100–150 µl cell suspension was added to the upper chamber of the Transwell plate, while 700 µl complete medium containing 20% FBS was added to the lower chamber of the Transwell plate. Cells were incubated for 5 h. Next, the cells were gently wiped off from the upper chamber with a cotton swab, while the upper layer of liquid was discarded from the Transwell plate, which was then soaked in 4% paraformaldehyde for 15 min. The chambers were then washed three times with PBS (each time with slow shaking for 5 min). After staining with 0.1% crystal violet for 15 min at room temperature, the chambers were washed three times with PBS. Flow cytometry analysis . In the cell transfection group, adenovirus was added directly to complete medium at a multiplicity of infection (MOI) of 100. After 24 h of transfection, the medium was changed to complete medium. Flow cytometry was performed 48 h after infection to detect apoptosis or cell cycle. For apoptosis analysis, the apoptosis rate was detected by annexin V and PI double staining (cat. no. 640932; BioLegend, Inc.) according to the manufacturer’s instructions. Briefly, cells were collected and washed once with PBS. Next, 100 µl Annexin V Binding Buffer was added to each tube to resuspend the cells. In total, 5 µl Annexin V-APC and 10 µl PI were added to stain the cells at room temperature in the dark for 15 min. Finally, the samples were transferred to flow-through sampling tubes after adding 400 µl buffer. For cell cycle assay, a DNA content assay kit to evaluate the cell cycle (cat. no. CA1510; Beijing Solarbio Science & Technology Co., Ltd.) was used after collection of each group of cells, following the instructions of the kit’s manufacturer. CytoFLEX S flow cytometer (Beckman Coulter, Inc.) was used to perform the assay. Cell Counting Kit-8 (CCK-8) assay . After cell counting, cells were washed twice with PBS. Next, the supernatant was discarded, and the cells were inoculated at 5x 10 3 cells per well in 96-well plates. After mixing, cells were incubated overnight. CCK-8 assay was carried out the next day at 0, 6, 24, 48 and 72 h after the addition of adenovirus at a MOI of 50 and incubation with the cells for 48 h. A total of 10 µl CCK-8 solution was added to each well, and the plates were incubated in an incubator for 0.5-4 h [optical density (OD) ≤ 2.0]. Absorbance was detected at 450nm qPCR detection . Total RNA from MPAECs was extracted according to the RNAiso plus manufacturer’s instructions (Invitrogen). Total RNA was reverse transcribed into cDNA according to the instructions of the reverse transcription kit (cat. no. RR037Q; Takara Biomedical Technology Co., Ltd.) and stored at -20˚C. The sequence of the primers were as follows: GAPDH, which was used as the internal reference gene (upstream sequence 5’-3’: GGCACAGTCAAGGCTGAGAATG, downstream sequence 5’-3’: ATGGTGGGTGAAGACGCCAGTA); target gene lncRNA H19 gene (upstream sequence 5’-3’: TCGCTCCACTGACCTTCTAAAC, downstream sequence 5’-3’: CCTGCCTTTCTATGTGCCATTC); HIF-1α gene (upstream sequence 5’-3’: CCACCACAACTGCCACCACTG, downstream sequence 5’-3’: TGCCACTGTATGCTGATGCCTTAG); and VEGF gene (upstream sequence 5’-3’: GGTGAGAGGTCTAGTTCCCGA, downstream sequence 5’-3’: CCATGAACTTTCTGCTCTTC). qPCR detection was performed using SYBR Green Mixture (cat. no. RR820Q; Takara Biomedical Technology Co., Ltd.). The reaction system and reaction conditions were prepared according to the instructions. Three biological replicates were conducted for each group. The relative expression (RQ) of the target genes was calculated using the ΔΔCq method ( 23 ): RQ = 2 − ΔΔCq . Western blot detection . RIPA buffer was used to lyse MPAECs at the end of the treatment period. Sonication was used to fully lyse the cells. The cells were then centrifuged at 12,000 rpm for 10 min at 4˚C. Next, the supernatant was separated and analyzed with BCA Protein Quantification Kit (cat. no. P0010S; Shanghai Biyuntian Biotechnology Co., Ltd) to adjust the total cellular protein concentration. Samples were then incubated at 100˚C for 5 min after adding 5X sampling buffer. Proteins were separated by SDS-PAGE and then transferred to PVDF membranes, which were then blocked with skimmed milk. After three washes with TBS-Tween 20 (TBST) buffer, the primary antibody was added and incubated overnight on a shaker at 4˚C, anti-HIF-1α (1:1000; cat. no. PA3-16521; Thermo Fisher Scientific Inc.), anti-VEGF (1:1000; cat. no. MA5-13182; Thermo Fisher Scientific Inc.), anti-β-actin (1:1000; cat. no. AC026; ABclonal Technology Co.Ltd.). After three washes with TBST buffer, the secondary antibody was added and incubated at room temperature for 1 -1.5 h. Subsequently, the proteins were visualized using ECL system (cat. no.WBULP; Merck Pty. Ltd.). Finally, ImageJ software (version 2022) was used for semiquantitative analysis of protein expression. β-actin was used as internal reference. Statistical analysis . Experimental data were statistically analyzed using SPSS 23. 0 software (IBM Corp.). Results were expressed as the mean ± standard deviation. GraphPad software (Version 9.0) was used to draw statistical analysis-related graphs. Independent samples Student’s t-tests were used for comparisons between two groups, while one-way ANOVA test was used between for comparisons multiple groups, followed by Bonferroni as a post hoc test. P < 0.05 was considered to indicate a statistically significant difference. Results 3.1 Hypoxia induces dysfunction and promotes the expression of lncRNA H19 and angiogenesis-related genes in mouse pulmonary artery endothelial cells The regulation of endothelial cell migration is fundamental to angiogenesis. Therefore, in this study, MPAECs were cultured in an atmospheric low oxygen workstation (3% O 2 , 5% CO 2 , 94% N 2 , 37°C) or an atmospheric normoxic incubator (21% O 2 , 5% CO 2 , 74% N 2 , 37°C) for 24 h, 48 h and 72 h, respectively. Transwell results showed that compared with the normoxic culture group, low oxygen treatment with 3% O 2 significantly promoted the migration of MPAECs in a time-dependent manner, with the maximum number and area of purple color at 48 h, indicating significant cell migration (Figure. 1A). As shown in Fig. 1 B-C, hypoxia significantly inhibited the apoptosis of MPAECs (P < 0.05). With the prolongation of hypoxia incubation time, MPAECs exhibited excessive proliferation (Fig. 1 D). The above results suggest the successful establishment of a hypoxia-induced mouse pulmonary artery endothelial cell dysfunction mimicking pulmonary hypertension model, which provides a basis for further investigation of the mechanism of pulmonary artery endothelial cell vascular remodeling in PPHN. HIF-1α and VEGF are markers of endothelial cell angiogenesis. In our study, qPCR results showed that hypoxia induction significantly promoted the expression level of lncRNA H19 in MPAECs (Fig. 1 E). In addition, the expression of HIF-1α and VEGF mRNA was also significantly increased (Fig. 2 F-G). Further, as shown in Fig. 2 H-J, hypoxia induction significantly upregulated HIF-1α and VEGF protein expression in MPAECs. This suggests that lncRNA H19 may be involved in mediating the potential role of angiogenesis in MPAECs. 3.2LncRNA H19 promotes protein expression of HIF-1α and VEGF in mouse pulmonary artery endothelial cells under hypoxic conditions LncRNA H19 knockdown and overexpression cell models were constructed to further clarify the regulatory relationship between lncRNA H19 and HIF-1α/VEGF. The results showed that knockdown of lncRNA H19 was able to significantly downregulate the mRNA and protein levels of HIF-1α and VEGF in a hypoxic environment (Fig. 2 A-F). Conversely, overexpression of lncRNA H19 was able to significantly promote the expression of HIF-1α and VEGF at both mRNA and protein levels (Fig. 2 G-L). This suggests that lncRNA H19 may play a critical role in hypoxia-induced pulmonary hypertension by regulating the HIF-1α/VEGF signaling pathway. 3.3 LncRNA H19 affects migration and proliferation of mouse pulmonary artery endothelial cells under hypoxic conditions Transwell and CCK8 were used to further observe the effects of knockdown and overexpression of lncRNA H19 on the migration and proliferation of endothelial cells in mouse pulmonary artery vasculature under hypoxic conditions. Transwell results showed that knockdown of lncRNA H19 significantly reduced the purple coloring area of endothelial cells, while overexpression of lncRNA H19 significantly increased the purple coloring area of endothelial cells (Fig. 3 A-B). In addition, CCK8 results showed that endothelial cells exhibited excessive proliferation under hypoxic conditions. However, knocking down lncRNA H19 significantly inhibits excessive proliferation of endothelial cells, while overexpression of lncRNA H19 further promotes excessive proliferation of endothelial cells (Fig. 3 C-D). 3.4 LncRNA H19 regulates apoptosis and cell cycle in mouse pulmonary artery endothelial cells under hypoxic conditions Flow cytometry was used to further observe the effects of knockdown/overexpression of lncRNA H19 in a hypoxic environment on apoptosis in mouse pulmonary artery endothelial cells. The results showed that the anti-apoptotic ability of mouse pulmonary artery vascular endothelial cells was impaired after lncRNA H19 was knocked down (Fig. 4 A-B). Conversely, after overexpression of lncRNA H19, the anti-apoptotic ability of mouse pulmonary artery vascular endothelial cells was significantly activated (Fig. 4 C-D). The cell cycle includes the G1, S, G2 and M phases. Subsequently, the DNA content of the cells was detected using a flow cytometric sorter, which allowed for the determination of the temporal phase of the cell cycle that the cells were in and the proportion of cells in each phase. We found that the (G2 + S)/(G1 + G2 + S) ratio of endothelial cells was significantly reduced after inhibiting the expression of lncRNA H19 using shRNA, which suggests that the cell proliferation activity was significantly inhibited (Fig. 4 E-F). However, after overexpression of lncRNA H19, the (G2 + S)/(G1 + G2 + S) ratio of endothelial cells was significantly increased, which indicated that the cell proliferative activity was increased (Fig. 4 G-H). 3.5 miR-20a-5p ameliorates dysfunction on mouse pulmonary artery endothelial cells by regulating the HIF-1α/VEGF signaling pathway Previous studies have shown that lncRNA H19 can participate in the regulation of myofibroblast fibrosis by directly targeting miR-20a-5p( 36 ). Our results confirmed that lncRNA H19 negatively regulate the expression of miR-20a-5p (Fig. 5 A-B). However, the effect of miR-20a-5p on mouse pulmonary artery endothelial cells is unclear. Therefore, siRNA was used to knock down miR-20a-5p in mouse pulmonary artery endothelial cells to further validate the targeted regulatory role of lncRNA H19. As shown in Fig. 5 C-H, after miR-20a-5p was knocked down in mouse pulmonary artery endothelial cells, mRNA and protein expression of HIF-1α and VEGF were significantly activated. Furthermore, knockdown of miR-20a-5p significantly increased the migration of mouse pulmonary artery endothelial cells (Fig. 5 I), but the rate of endothelial cell apoptosis was down-regulated (Fig. 5 J-K). 3.6 lncRNA H19 influences endothelial cell migration and apoptosis by regulating miR-20a-5p. Using transwell and flow cytometry, we examined the effects of knocking down or adding miR-20a-5p mimics on endothelial cell migration and apoptosis in the context of lncRNA H19 knockdown or overexpression. The results showed that in the case of lncRNA H19 inhibition using shRNA-LncRNA H19, adding siRNA-miR-20a-5p promoted endothelial cell migration and alleviated the inhibition of endothelial cell apoptosis. Conversely, in the case of lncRNA H19 overexpression, adding miR-20a-5p mimics inhibited endothelial cell migration and promoted endothelial cell apoptosis. These findings indicate that lncRNA H19 affects endothelial cell function by regulating the expression of miR-20a-5p. Discussion PPHN is a clinical neonatal critical illness with a relatively high incidence, which may occur in 1–2 per 1,000 newborns ( 37 , 38 ). PPHN has become a disease with high morbidity, mortality and disability ( 39 , 40 ). Impaired relaxation of the pulmonary vasculature in the early postnatal period leads to pulmonary circulatory resistance exceeding body circulatory resistance, resulting in severe hypoxemia and respiratory distress, and ultimately PPHN ( 3 ). Currently, the clinical treatment strategy for PPHN is focused on mechanical ventilation to maintain systemic circulatory pressure and reduce pulmonary hypertension ( 41 ). Neonatal care, including the use of inhaled NO and other vasodilators, improves the prognosis of infants with PPHN ( 42 ). However, clinical statistics show that ≤ 30% of newborns affected by PPHN do not respond to this treatment and require invasive life support measures ( 5 ). Therefore, it is important to further explore effective novel treatment strategies for PPHN. The pathophysiology of PPHN is marked by increased pulmonary vascular resistance, resulting in reduced pulmonary blood flow and, therefore, reduced oxygenated blood volume returning to the left side of the heart, leading to hypoxia, reduced end-organ perfusion, acidosis and cyanosis. Therefore, hypoxic culture is often used to simulate the pathological state of PPHN in mechanistic studies ( 43 ). In the present study, hypoxic treatment with 3% O 2 was used to induce lung endothelial cell dysfunction to establish a PPHN cell model. The results showed that the proliferation and migration of endothelial cells were significantly promoted, while apoptosis was significantly inhibited under hypoxic conditions. Previous study have also found that a low-oxygen environment can promote the vascular remodeling of endothelial cells ( 44 ), which is consistent with the present findings. LncRNA is a ncRNA with a length > 200 bp, which is widely involved in the occurrence and development of a variety of diseases, such as cancer and respiratory diseases ( 45 ). Previous studies have demonstrated that lncRNA H19 can regulate endothelial cell function and angiogenesis in a variety of diseases, including glioma ( 46 ), hypoxic-ischemic brain damage ( 47 ) and arteriosclerosis obliterans ( 48 ). In the current study, a hypoxic environment could effectively promote the expression level of lncRNA H19 in MPAECs, which was accompanied by high expression of HIF-1α and VEGF. HIF-1α is an important transcription factor that regulates the effects of hypoxia. HIF-1α has a broad distribution and role, which can enhance the tolerance of vascular endothelial cell to hypoxia by regulating downstream target genes ( 14 ). It has been shown that increased HIF-1α signaling contributes to pulmonary vascular remodeling in adult pulmonary hypertension ( 49 ). VEGF is an important target gene for HIF-1α, as well as one of the most potent and critical regulators of pulmonary vascular growth, development and maintenance throughout embryonic, fetal and postnatal life ( 50 , 51 ). VEGF is strongly expressed in the developing respiratory epithelium from the embryonic stage, and promotes angiogenesis by regulating endothelial cell proliferation, migration and differentiation ( 52 – 54 ). Disruption of VEGF gene expression leads to severe defects in blood vessel formation. Loss of a single VEGF allele results in a notable reduction in endothelial cells, which in turn causes early embryonic mortality ( 55 ). Previous studies have reported elevated lung VEGF mRNA in chronic hypoxia-induced pulmonary hypertension ( 18 , 56 ). In addition, IL-33 expression is elevated in human pulmonary artery epithelial cells in a hypoxic environment, which may be due to increased downstream expression of HIF-1α and VEGF, triggering vascular remodeling and leading to hypoxic pulmonary hypertension ( 57 ), which is compatible with the present results. A recent clinical study showed that newborns with PPHN have reduced levels of VEGF in their blood ( 58 ). In addition, another study showed a decrease in pulmonary VEGF due to monocrotaline-mediated pulmonary hypertension ( 59 ). These studies suggest possible non-hypoxia-dependent mechanisms that may regulate pulmonary VEGF expression, such as altered hemodynamic stress. Therefore, the expression of VEGF and its intrinsic regulatory mechanisms in PPHN models mediated by different mechanisms need to be further explored. The current study focused on lncRNA H19 upstream of the HIF-1α and VEGF genes. It was found that hypoxia induced elevated expression of lncRNA H19 in pulmonary artery epithelial cells of mice, suggesting that lncRNA H19 is involved in mediating angiogenesis in MPAECs. Numerous studies have demonstrated that lncRNAs play powerful regulatory functions in biological processes at the epigenetic, transcriptional and post-transcriptional levels ( 60 – 62 ). Previous research has revealed that vascular remodeling is the result of pulmonary artery smooth muscle cell overproliferation and arterial endothelial cell dysfunction ( 34 ). LncRNA H19 can play a central role in vascular smooth muscle cell proliferation and myocardial extracellular matrix alteration, suggesting that it may be a potential drug target in pulmonary arterial hypertension. In addition, it has been shown that patients with end-stage pulmonary arterial hypertension have significantly increased levels of lncRNA H19 in their blood, which is positively correlated with the degree of right ventricular hypertrophy ( 35 ). The lncRNA H19/let-7b axis was reported to be involved in PDGF-BB-stimulated pulmonary artery vascular remodeling ( 29 ). Similarly, Wang et al ( 32 ) reported elevated lncRNA H19 in a melatonin-mediated rat model of pulmonary hypertension. Targeted modulation of the lncRNA H19/miR-200a/PDCD4 axis could exert therapeutic effects in pulmonary arterial hypertension in rats. The above results suggest that lncRNA H19 may play a potential role in the pathological progression of PPHN. In the present study, the anti-apoptotic function of mouse pulmonary artery vascular endothelial cells was impaired after lncRNA H19 was knocked down. Conversely, overexpression of lncRNA H19 significantly activated the anti-apoptotic function of mouse pulmonary artery vascular endothelial cells, which is consistent with previous findings. It has been reported that miR-20a-5p is a target of lncRNA H19 ( 36 ), and the current results also found that lncRNA H19 could negatively regulate the expression of miR-20a-5p. However, it is not yet known whether lncRNA H19 affects endothelial cell function through the regulation of miR-20a-5p under hypoxic conditions. Therefore, miR-20a-5p siRNA or mimics were added while knocking down or overexpressing lncRNA H19. The results showed that this effectively reversed the effects of lncRNA H19 on endothelial cell migration and apoptosis, which indicates that lncRNA H19 may be involved in regulating the HIF-1α/VEGF signaling pathway by targeting miR-20a-5p to promote the improvement of pulmonary artery endothelial cell function. Thus, the present results suggest that the lncRNA H19/miR-20a-5p/HIF-1α/VEGF regulatory axis may play an important role in the pathological regulatory process of PPHN. Notably, the current PPHN cell model exposure factor was a hypoxic environment. Combined with the results of previous studies, it was found that different environmental and temporal exposure factors may lead to different results. Therefore, further studies are still needed to investigate and validate the PPHN regulatory mechanisms in different models. In conclusion, lncRNA H19 may interfere with vascular remodeling in hypoxia-induced pulmonary hypertension by upregulating the expression of HIF-1α and VEGF in vascular endothelial cells. The lncRNA H19/miR-20a-5p/HIF-1α/VEGF regulatory axis may play a key regulatory role in the PPHN process. Declarations Acknowledgements Not applicable. Funding The present study was supported by Shenzhen Nanshan District Technical Research and Development and Creative Design Project Subdivision Funds for Education (Healthcare) Technology Projects (grant no. NS2023115), Southern University of Science and Technology Hospital President’s Research Fund Project (grant no. 2021-C1), and Shenzhen Science and Technology Plan Project (Basic Research Special Project) (Natural Science Foundation) (grant no. JCYJ20230807091859031). Availability of data and materials The authors confirm that the raw data and all replicates supporting the findings of this study are available within the article. Authors’ contributions LD and WY supervised the entire project. LD and YC wrote the manuscript. HS, QL and QJ performed the main experiments. HL provided technical support and professional expertise. HL and QJ saw and verified all the raw data. LD and WY revised the manuscript. All authors have read and agreed to the published version of the manuscript. Ethics approval and consent to participate Not applicable. Patient consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Fortas, F., et al., Life-threatening PPHN refractory to nitric oxide: proposal for a rational therapeutic algorithm. Eur J Pediatr, 2021. 180 (8): p. 2379-2387. Singh, Y. and S. Lakshminrusimha, Pathophysiology and Management of Persistent Pulmonary Hypertension of the Newborn. Clin Perinatol, 2021. 48 (3): p. 595-618. Sankaran, D. and S. Lakshminrusimha, Pulmonary hypertension in the newborn- etiology and pathogenesis. Semin Fetal Neonatal Med, 2022. 27 (4): p. 101381. Babooa, N., W.J. Shi, and C. Chen, Factors relating caesarean section to persistent pulmonary hypertension of the newborn. World J Pediatr, 2017. 13 (6): p. 517-527. Nair, J. and S. Lakshminrusimha, Update on PPHN: mechanisms and treatment. Semin Perinatol, 2014. 38 (2): p. 78-91. Wedgwood, S., R.H. Steinhorn, and S. Lakshminrusimha, Optimal oxygenation and role of free radicals in PPHN. Free Radic Biol Med, 2019. 142 : p. 97-106. Rashid, M., et al., Up-down regulation of HIF-1α in cancer progression. Gene, 2021. 798 : p. 145796. Song, S., et al., HIF-1α increases the osteogenic capacity of ADSCs by coupling angiogenesis and osteogenesis via the HIF-1α/VEGF/AKT/mTOR signaling pathway. J Nanobiotechnology, 2023. 21 (1): p. 257. Lu, S., et al., Arsenic Sulfide Inhibits Hepatocellular Carcinoma Metastasis by Suppressing the HIF-1α/VEGF Pathway. Front Biosci (Landmark Ed), 2023. 28 (7): p. 152. Shifren, J.L., et al., In the human fetus, vascular endothelial growth factor is expressed in epithelial cells and myocytes, but not vascular endothelium: implications for mode of action. J Clin Endocrinol Metab, 1994. 79 (1): p. 316-22. Wiszniak, S. and Q. Schwarz, Exploring the Intracrine Functions of VEGF-A. Biomolecules, 2021. 11 (1). Kroll, J. and J. Waltenberger, VEGF-A induces expression of eNOS and iNOS in endothelial cells via VEGF receptor-2 (KDR). Biochem Biophys Res Commun, 1998. 252 (3): p. 743-6. Bauters, C., et al., Recovery of disturbed endothelium-dependent flow in the collateral-perfused rabbit ischemic hindlimb after administration of vascular endothelial growth factor. Circulation, 1995. 91 (11): p. 2802-9. Grover, T.R., et al., rhVEGF treatment preserves pulmonary vascular reactivity and structure in an experimental model of pulmonary hypertension in fetal sheep. Am J Physiol Lung Cell Mol Physiol, 2005. 289 (2): p. L315-21. Grover, T.R., et al., Intrauterine hypertension decreases lung VEGF expression and VEGF inhibition causes pulmonary hypertension in the ovine fetus. Am J Physiol Lung Cell Mol Physiol, 2003. 284 (3): p. L508-17. Voelkel, N.F. and J. Gomez-Arroyo, The role of vascular endothelial growth factor in pulmonary arterial hypertension. The angiogenesis paradox. Am J Respir Cell Mol Biol, 2014. 51 (4): p. 474-84. Nadeau, S., et al., Changes in expression of vascular endothelial growth factor and its receptors in neonatal hypoxia-induced pulmonary hypertension. Pediatr Res, 2005. 58 (2): p. 199-205. Tuder, R.M., B.E. Flook, and N.F. Voelkel, Increased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia. Modulation of gene expression by nitric oxide. J Clin Invest, 1995. 95 (4): p. 1798-807. Jathar, S., et al., Technological Developments in lncRNA Biology. Adv Exp Med Biol, 2017. 1008 : p. 283-323. Zhang, W., et al., Differential long noncoding RNA/mRNA expression profiling and functional network analysis during osteogenic differentiation of human bone marrow mesenchymal stem cells. Stem Cell Res Ther, 2017. 8 (1): p. 30. Ashrafizadeh, M., et al., Long noncoding RNAs (lncRNAs) in pancreatic cancer progression. Drug Discov Today, 2022. 27 (8): p. 2181-2198. Bridges, M.C., A.C. Daulagala, and A. Kourtidis, LNCcation: lncRNA localization and function. J Cell Biol, 2021. 220 (2). Müller, V., et al., Interplay of lncRNA H19/miR-675 and lncRNA NEAT1/miR-204 in breast cancer. Mol Oncol, 2019. 13 (5): p. 1137-1149. Li, B., et al., The MSC-Derived Exosomal lncRNA H19 Promotes Wound Healing in Diabetic Foot Ulcers by Upregulating PTEN via MicroRNA-152-3p. Mol Ther Nucleic Acids, 2020. 19 : p. 814-826. Zhang, L., et al., H19 knockdown suppresses proliferation and induces apoptosis by regulating miR-148b/WNT/β-catenin in ox-LDL -stimulated vascular smooth muscle cells. J Biomed Sci, 2018. 25 (1): p. 11. Wang, X., et al., Knockdown of Long Noncoding RNA H19 Represses the Progress of Pulmonary Fibrosis through the Transforming Growth Factor β/Smad3 Pathway by Regulating MicroRNA 140. Mol Cell Biol, 2019. 39 (12). Zhang, R., et al., Curcumenol triggered ferroptosis in lung cancer cells via lncRNA H19/miR-19b-3p/FTH1 axis. Bioact Mater, 2022. 13 : p. 23-36. Chen, X., et al., Muc5ac Production Inhibited by Decreased lncRNA H19 via PI3K/Akt/NF-kB in Asthma. J Asthma Allergy, 2021. 14 : p. 1033-1043. Sun, W., et al., Long noncoding RNA H19 promotes vascular remodeling by sponging let-7a to upregulate the expression of cyclin D1. Biochem Biophys Res Commun, 2019. 508 (4): p. 1038-1042. Tan, Y., et al., Ginsenoside Rb3 alleviates smoke-induced lung injury via the H19/miR-29b-3p/HGMB1/TLR4 signalling pathway. J Cell Mol Med, 2021. 25 (5): p. 2725-2729. Xie, J., et al., Targeting non-coding RNA H19: A potential therapeutic approach in pulmonary diseases. Front Pharmacol, 2022. 13 : p. 978151. Wang, R., et al., Identifying Involvement of H19-miR-675-3p-IGF1R and H19-miR-200a-PDCD4 in Treating Pulmonary Hypertension with Melatonin. Mol Ther Nucleic Acids, 2018. 13 : p. 44-54. Hoffmann, J., et al., Microarray analysis in pulmonary hypertension. Eur Respir J, 2016. 48 (1): p. 229-41. Kim, J., Apelin-APJ signaling: a potential therapeutic target for pulmonary arterial hypertension. Mol Cells, 2014. 37 (3): p. 196-201. Su, H., et al., LncRNA H19 promotes the proliferation of pulmonary artery smooth muscle cells through AT(1)R via sponging let-7b in monocrotaline-induced pulmonary arterial hypertension. Respir Res, 2018. 19 (1): p. 254. Lin, J.R., et al., Long non-coding RNA H19 promotes myoblast fibrogenesis via regulating the miR-20a-5p-Tgfbr2 axis. Clinical and Experimental Pharmacology and Physiology, 2021. 48 (6): p. 921-931. Rubin, R., New Device Okayed for Treating Pulmonary Hypertension in Newborns. Jama, 2022. 328 (7): p. 612. Kipfmueller, F., et al., Echocardiographic Assessment of Pulmonary Hypertension in Neonates with Congenital Diaphragmatic Hernia Using Pulmonary Artery Flow Characteristics. J Clin Med, 2022. 11 (11). Ruoss, J.L., et al., Management of cardiac dysfunction in neonates with pulmonary hypertension and the role of the ductus arteriosus. Semin Fetal Neonatal Med, 2022. 27 (4): p. 101368. Chetan, C., et al., Oral versus intravenous sildenafil for pulmonary hypertension in neonates: a randomized trial. BMC Pediatr, 2022. 22 (1): p. 311. Pels, A., et al., Neonatal pulmonary hypertension after severe early-onset fetal growth restriction: post hoc reflections on the Dutch STRIDER study. Eur J Pediatr, 2022. 181 (4): p. 1709-1718. Ball, M.K., et al., Evidence-Based Guidelines for Acute Stabilization and Management of Neonates with Persistent Pulmonary Hypertension of the Newborn. Am J Perinatol, 2023. 40 (14): p. 1495-1508. Dakshinamurti, S., Pathophysiologic mechanisms of persistent pulmonary hypertension of the newborn. Pediatr Pulmonol, 2005. 39 (6): p. 492-503. Chelladurai, P., et al., Epigenetic reactivation of transcriptional programs orchestrating fetal lung development in human pulmonary hypertension. Science Translational Medicine, 2022. 14 (648). Paulin, R. and E.D. Michelakis, The metabolic theory of pulmonary arterial hypertension. Circ Res, 2014. 115 (1): p. 148-64. Jia, P., et al., Long non-coding RNA H19 regulates glioma angiogenesis and the biological behavior of glioma-associated endothelial cells by inhibiting microRNA-29a. Cancer Letters, 2016. 381 (2): p. 359-369. Fang, H., et al., Long Noncoding RNA H19 Overexpression Protects against Hypoxic-Ischemic Brain Damage by Inhibiting miR-107 and Up-Regulating Vascular Endothelial Growth Factor. American Journal of Pathology, 2021. 191 (3): p. 503-514. Li, Z.F., et al., Effect of lncRNA H19 on the apoptosis of vascular endothelial cells in arteriosclerosis obliterans via the NF-κB pathway. European Review for Medical and Pharmacological Sciences, 2019. 23 (10): p. 4491-4497. Makker, K., et al., Altered hypoxia-inducible factor-1α (HIF-1α) signaling contributes to impaired angiogenesis in fetal lambs with persistent pulmonary hypertension of the newborn (PPHN). Physiol Rep, 2019. 7 (3): p. e13986. Jiang, Y., et al., Increased SUMO-1 expression in response to hypoxia: Interaction with HIF-1α in hypoxic pulmonary hypertension. Int J Mol Med, 2015. 36 (1): p. 271-81. Johns, R.A., et al., Hypoxia-Inducible Factor 1α Is a Critical Downstream Mediator for Hypoxia-Induced Mitogenic Factor (FIZZ1/RELMα)-Induced Pulmonary Hypertension. Arterioscler Thromb Vasc Biol, 2016. 36 (1): p. 134-44. Pugliese, S.C., et al., The role of inflammation in hypoxic pulmonary hypertension: from cellular mechanisms to clinical phenotypes. Am J Physiol Lung Cell Mol Physiol, 2015. 308 (3): p. L229-52. Maron, B.A., R.F. Machado, and L. Shimoda, Pulmonary vascular and ventricular dysfunction in the susceptible patient (2015 Grover Conference series). Pulm Circ, 2016. 6 (4): p. 426-438. Thompson, A.A.R. and A. Lawrie, Targeting Vascular Remodeling to Treat Pulmonary Arterial Hypertension. Trends Mol Med, 2017. 23 (1): p. 31-45. Krishnan, U. and E.B. Rosenzweig, Pulmonary hypertension in chronic lung disease of infancy. Curr Opin Pediatr, 2015. 27 (2): p. 177-83. Christou, H., et al., Increased vascular endothelial growth factor production in the lungs of rats with hypoxia-induced pulmonary hypertension. Am J Respir Cell Mol Biol, 1998. 18 (6): p. 768-76. Liu, J., et al., IL-33 Initiates Vascular Remodelling in Hypoxic Pulmonary Hypertension by up-Regulating HIF-1α and VEGF Expression in Vascular Endothelial Cells. EBioMedicine, 2018. 33 : p. 196-210. Lassus, P., et al., Pulmonary vascular endothelial growth factor and Flt-1 in fetuses, in acute and chronic lung disease, and in persistent pulmonary hypertension of the newborn. Am J Respir Crit Care Med, 2001. 164 (10 Pt 1): p. 1981-7. Partovian, C., et al., Heart and lung VEGF mRNA expression in rats with monocrotaline- or hypoxia-induced pulmonary hypertension. Am J Physiol, 1998. 275 (6): p. H1948-56. Qin, Y., et al., Overexpressed lncRNA AC068039.4 Contributes to Proliferation and Cell Cycle Progression of Pulmonary Artery Smooth Muscle Cells Via Sponging miR-26a-5p/TRPC6 in Hypoxic Pulmonary Arterial Hypertension. Shock, 2021. 55 (2): p. 244-255. Qin, S., et al., Sex differences in the proliferation of pulmonary artery endothelial cells: implications for plexiform arteriopathy. J Cell Sci, 2020. 133 (9). Boucherat, O., et al., The cancer theory of pulmonary arterial hypertension. Pulm Circ, 2017. 7 (2): p. 285-299. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 04 Dec, 2024 Read the published version in Biochemical Genetics → Version 1 posted Editorial decision: Revision requested 07 Oct, 2024 Reviews received at journal 04 Oct, 2024 Reviewers agreed at journal 03 Oct, 2024 Reviews received at journal 02 Oct, 2024 Reviews received at journal 26 Sep, 2024 Reviewers agreed at journal 26 Sep, 2024 Reviews received at journal 26 Sep, 2024 Reviews received at journal 25 Sep, 2024 Reviewers agreed at journal 24 Sep, 2024 Reviewers agreed at journal 24 Sep, 2024 Reviewers agreed at journal 24 Sep, 2024 Reviewers agreed at journal 18 Sep, 2024 Reviewers agreed at journal 18 Sep, 2024 Reviewers invited by journal 07 Jul, 2024 Editor assigned by journal 01 Jul, 2024 Submission checks completed at journal 01 Jul, 2024 First submitted to journal 29 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4657431","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":329791413,"identity":"235adc6c-5a0f-477b-985f-b77c8b777408","order_by":0,"name":"Lei Dou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDUlEQVRIie3PMUvDQBTA8XcE4hJy6wXBz/DExaHYr5IQcKql4OLgIAjpYKNr+y3i5viOg3a5eGugS/0GmcRiqZ4WoULS4uZwf47j7uAH9wBcrv8YASPAzubCbiDePMLpLmIXntuTt0UIxB4C6jeBXSScjZDqgemiMXKxfII+56VU9bUAPryLm0ikNcoxzpOiSr3jXMNlNO7HRFMBQpdFE8GqhyrAeYyV5x+y7MPaAIl8ASgu2skKn+3H1ME7yyApjLZkvYcAEiso9b1vQj0kmbWTSE8HcoRpMqnSkyi3ZPI1S3kvgrZZwtnt4+JtddYNjXypl5Y88FLVV6+dIz7MG0lTwdb+J+JyuVyunz4B+U1xI0TCIqcAAAAASUVORK5CYII=","orcid":"","institution":"Southern University of Science and Technology Hospital","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"Dou","suffix":""},{"id":329791415,"identity":"6a08bd5a-cb85-4653-bd8f-39c675712882","order_by":1,"name":"Wei You","email":"","orcid":"","institution":"The First Hospital Affiliated to Shenzhen University)","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"You","suffix":""},{"id":329791417,"identity":"7126b8ec-a1f1-4815-9346-3378dc7f1c17","order_by":2,"name":"Yannan Chai","email":"","orcid":"","institution":"Southern University of Science and Technology Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yannan","middleName":"","lastName":"Chai","suffix":""},{"id":329791418,"identity":"5e64e668-ea8b-4be5-a33a-1783fc543157","order_by":3,"name":"Huiju Shi","email":"","orcid":"","institution":"Southern University of Science and Technology Hospital","correspondingAuthor":false,"prefix":"","firstName":"Huiju","middleName":"","lastName":"Shi","suffix":""},{"id":329791422,"identity":"d6ea2333-fd7f-45b6-b677-d21bae7114a3","order_by":4,"name":"Qing Liu","email":"","orcid":"","institution":"Southern University of Science and Technology Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Liu","suffix":""},{"id":329791423,"identity":"ab739a94-c8f2-47e0-844b-b6868172a040","order_by":5,"name":"Qiaoli Jiang","email":"","orcid":"","institution":"Southern University of Science and Technology Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qiaoli","middleName":"","lastName":"Jiang","suffix":""},{"id":329791426,"identity":"d9329161-4c93-4512-b47c-d354f3c50be7","order_by":6,"name":"Huiling Li","email":"","orcid":"","institution":"Southern University of Science and Technology Hospital","correspondingAuthor":false,"prefix":"","firstName":"Huiling","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-06-29 04:23:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4657431/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4657431/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10528-024-10983-3","type":"published","date":"2024-12-04T15:57:56+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60908626,"identity":"1ca20b40-cb27-484f-927c-3666b7c73484","added_by":"auto","created_at":"2024-07-23 12:28:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1640983,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of hypoxia on cell migration, apoptosis and proliferation, and induction of the expression of lncRNA H19 and angiogenesis-related markers in endothelial cells derived from mouse pulmonary arteries. (A) MPAEC Transwell migration assay. (B and C) Apoptosis detection in MPAECs by flow cytometry (D) MPAEC proliferation detection by Cell Counting Kit-8 assay. (E-G) Expression of lncRNA H19, as well as HIF-1α and VEGF mRNA, MPAECs, as detected by quantitative PCR. (H-J) Expression of HIF-1α and VEGF proteins in MPAECs, as detected by western blotting. Normal, normoxic group; hypoxia, hypoxic group (n=3). \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05. MPAEC, mouse pulmonary artery endothelial cell; lncRNA, long non-coding RNA; HIF-1α, hypoxia-inducible factor-1α; VEGF, vascular endothelial growth factor.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4657431/v1/db84e7938c1783fa2fa40319.png"},{"id":60908631,"identity":"45c94202-ea45-4075-ba95-f45ea3102b22","added_by":"auto","created_at":"2024-07-23 12:28:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":699783,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of knockdown/overexpression of lnRNA H19 on angiogenesis-related markers in MPAECs under hypoxic conditions. (A-C) After knockdown of lncRNA H19, the expression of lncRNA H19 as well as that of HIF-1α and VEGF mRNA in MPAECs was detected by qPCR. (D-F) After knockdown of lncRNA H19, the expression of HIF-1α and VEGF proteins in MPAECs was detected by WB. (G-I) After overexpression of lncRNA H19, the expression of lncRNA H19 as well as HIF-1α and VEGF mRNA was detected in MPAECs by qPCR. (J-L) After overexpression of lncRNA H19, the expression of HIF-1α and VEGF proteins in MPAECs was detected by WB. shNC, knockdown of lncRNA H19 negative control group; shRNA-LncRNA H19, lncRNA H19 knockdown experimental group; OE-NC, lncRNA H19 overexpression negative control group; OE-LncRNA H19, lncRNA H19 overexpression experimental group (n=3). \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01, \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001. OE, overexpression; lncRNA, long non-coding RNA; qPCR, quantitative PCR; HIF-1α, hypoxia-inducible factor-1α; VEGF, vascular endothelial growth factor; MPAEC, mouse pulmonary artery endothelial cell; WB, western blotting; sh, small hairpin; NC, negative control.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4657431/v1/1fbcad0f85395f884d188a26.png"},{"id":60909070,"identity":"22ca5093-c49d-468a-9a5c-0865cd39c3b8","added_by":"auto","created_at":"2024-07-23 12:36:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2042531,"visible":true,"origin":"","legend":"\u003cp\u003eKnockdown/overexpression of lncRNA H19 affects the migration and proliferation of MPAECs under hypoxic conditions. (A and B) Pulmonary artery endothelial cell migration in mice after knockdown/overexpression of lncRNA H19 under hypoxic conditions, as evaluated by Transwell assay. (C and D) Proliferation of MPAECs after knockdown/overexpression of lncRNA H19, as determined by Cell Counting Kit-8 assay. shNC, knockdown of lncRNA H19 negative control group; shRNA-LncRNA H19, lncRNA H19 knockdown experimental group; OE-NC, lncRNA H19 overexpression negative control group; OE-LncRNA H19, lncRNA H19 overexpression experimental group (n=3). \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01. MPAEC, mouse pulmonary artery endothelial cell; OE, overexpression; lncRNA, long non-coding RNA; sh, small hairpin; NC, negative control.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4657431/v1/68f60c7e85dbd74141d09209.png"},{"id":60909068,"identity":"cbb53a29-17c5-434b-b2aa-55d685d53da1","added_by":"auto","created_at":"2024-07-23 12:36:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1438713,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of knockdown/overexpression of lncRNA H19 on apoptosis and cell cycle in MPAECs under hypoxic conditions. (A and B) Effect of knockdown of lncRNA H19 on apoptosis in MPAECs, as detected by flow cytometry. (C and D) Effect of overexpression of lncRNA H19 on apoptosis in MPAECs, as detected by flow cytometry. (E and F) Effect of knockdown of lncRNA H19 on the cell cycle of MPAECs, as determined by flow cytometry. (G and H) Effect of overexpression of lncRNA H19 on the cell cycle of MPAECs, as determined by flow cytometry. shNC, knockdown of lncRNA H19 negative control group; shRNA-LncRNA H19, lncRNA H19 knockdown experimental group; OE-NC, lncRNA H19 overexpression negative control group; OE-LncRNA H19, lncRNA H19 overexpression experimental group (n=3). \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001. MPAEC, mouse pulmonary artery endothelial cell; lncRNA, long non-coding RNA; sh, small hairpin; NC, negative control; OE, overexpression.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4657431/v1/56c0dd2c48b7d7f47b15178d.png"},{"id":60909822,"identity":"2c794fd3-9ddc-47fd-b7a2-64cf46f955a7","added_by":"auto","created_at":"2024-07-23 12:44:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":666775,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of knockdown of miR-20a-5p on endothelial cells of mouse pulmonary artery. (A and B) Expression of miR-20a-5p after knockdown/overexpression of long non-coding RNA H19. (C-E) After knockdown of miR-20a-5p, miR-20a-5p expression and mRNA expression of HIF-1α and VEGF in MPAECs was detected by quantitative PCR. (F-H) After knockdown of miR-20a-5p, the protein expression of HIF-1α and VEGF in MPAECs was detected by western blotting. (I) MPAEC migration after knockdown of miR-20a-5p was evaluated by Transwell assay. (J-K) Proliferation of MPAECs after knockdown of miR-20a-5p, as detected by flow cytometry. NC, knockdown miR-20a-5p negative control group; siRNA-miR-20a-5p, knockdown miR-20a-5p group (n=3). \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01, \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001. miR, microRNA; HIF-1α, hypoxia-inducible factor-1α; VEGF, vascular endothelial growth factor; MPAEC, mouse pulmonary artery endothelial cell; NC, negative control; si, small interfering.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4657431/v1/68d7c1e77cdb11a3cdff0641.png"},{"id":60908627,"identity":"4255fda4-24bb-4965-98c3-8a313e53aaae","added_by":"auto","created_at":"2024-07-23 12:28:01","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":903284,"visible":true,"origin":"","legend":"\u003cp\u003elncRNA H19 influences endothelial cell migration and apoptosis by regulating miR-20a-5p. (A and B) Effect of knocking down or adding miR-20a-5p mimics on lncRNA H19 knockdown or overexpression of endothelial cell migration. (C and D) Effect of knocking down or adding miR-20a-5p mimics on lncRNA H19 knockdown or overexpression of endothelial apoptosis. shRNA-LncRNA H19, lncRNA H19 knockdown experimental group; OE-LncRNA H19, lncRNA H19 overexpression experimental group; NC, knockdown miR-20a-5p negative control group; siRNA-miR-20a-5p, knockdown miR-20a-5p group; Mimics-control, mimics control group; Mimics-miR-20a-5p, miR-20a-5p mimics group (n=3). \u003csup\u003e*\u003c/sup\u003eP\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003eP\u0026lt;0.01, \u003csup\u003e***\u003c/sup\u003eP\u0026lt;0.001. miR, microRNA; lncRNA, long non-coding RNA; sh, small hairpin; OE, overexpression; NC, negative control.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4657431/v1/d6034af70f3e56e19cfa2272.png"},{"id":70964808,"identity":"8c0be506-6484-46f8-863f-83f274719253","added_by":"auto","created_at":"2024-12-09 16:16:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8673729,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4657431/v1/4f835222-7c4f-4789-bf1a-19b2a6226831.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"LncRNA H19 improves angiogenesis in mouse pulmonary artery endothelial cells by regulating the HIF-1α/VEGF signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePersistent pulmonary hypertension of the newborn (PPHN) is a condition in which the pulmonary vascular resistance fails to decrease at birth, resulting in a reduction in pulmonary blood flow and impaired gas exchange (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Abnormal pulmonary vascular reactivity is the main clinical feature of PPHN (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Vascular dysfunction often develops during fetal life and interferes with the normal adaptation of pulmonary circulation at birth. Infants with PPHN develop important hypoxemia, which increases the risk of mortality and long-term disability (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrevious studies have shown that adverse stimuli such as chronic hypoxia in utero can alter the reactivity and structure of the pulmonary vasculature, leading to a failure to dilate the pulmonary vasculature at birth (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Hypoxia-inducible factor-1α (HIF-1α), a protein containing a basic helix-loop-helix PAS structural domain, is a major transcriptional regulator of cellular and developmental responses to hypoxia (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). HIF-1α can participate in the regulation of cellular responses to hypoxia by upregulating the transcription factor vascular endothelial growth factor (VEGF) (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). VEGF is a specific endothelial cell mitogen that regulates endothelial cell differentiation, angiogenesis and vascular maintenance (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). VEGF is essential for early vascular development, which is one of the most potent and critical regulators of pulmonary vascular growth, development, and maintenance throughout embryonic, fetal and postnatal life (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). In human fetal lung, VEGF is localized to alveolar epithelial cells and myocytes (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Previous studies have demonstrated that targeting VEGF upregulates endothelial nitric oxide (NO) synthase in endothelial cells (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e) and improves blood flow \u003cem\u003ein vivo\u003c/em\u003e (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Persistent intrauterine pulmonary hypertension prevents vessel growth, which may be associated with altered VEGF-NO signaling (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Lung VEGF expression is significantly reduced in chronic intrauterine pulmonary hypertension. Impaired VEGF signaling can potentially impair vascular function as well as the growth and structure of the developing lung, contributing to the pathogenesis of PPHN (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). However, the expression of pulmonary VEGF mRNA and its receptor is elevated in patients with severe pulmonary hypertension and in models of hypoxia-induced pulmonary hypertension (\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e), suggesting that the HIF-1α/VEGF axis may be involved in regulating the development of hypoxia-induced PPHN. However, the underlying regulatory mechanisms are not fully understood.\u003c/p\u003e \u003cp\u003eLong non-coding RNAs (lncRNAs) are by-products of RNA polymerase II transcription and are a group of non-coding transcripts\u0026thinsp;\u0026ge;\u0026thinsp;200 nucleotides in length. LncRNAs have little or no potential to encode proteins (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). With the development of high-throughput sequencing technologies, cumulative evidence suggests that IncRNAs can regulate the expression of protein-coding genes epigenetically, transcriptionally and post-transcriptionally, thereby affecting a range of biological processes (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). LncRNA H19, located on human chromosome 11p15.5, is one of the best known imprinted genes, which are involved in a variety of diseases such as cancer (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), diabetes (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e) and cardiovascular diseases (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Numerous diseases such as lung cancer, pulmonary hypertension and asthma are recognized as systemic diseases with pulmonary manifestations. The progression of these diseases has been reported to be closely related to the regulation of lncRNA H19 (\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). LncRNA H19 was reported to be able to promote lung fibrosis by inhibiting microRNA (miRNA or miR)-140 expression in human lung fibroblasts, leading to enhanced extracellular matrix deposition (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). In addition, lncRNA H19 has specific regulatory roles in airway smooth muscle cells, adult myocytes, cardiomyocytes, small cell lung cancer lines and non-small cell lung cancer lines (\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). The study of lncRNAs\u0026rsquo; involvement in pulmonary vascular remodeling has been recently an emerging field. LncRNA H19 has been shown to be involved in the remodeling of small pulmonary arteries and the development of pulmonary hypertension in adults (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e). Pulmonary artery smooth muscle cell overproliferation and arterial endothelial cell dysfunction can lead to vascular remodeling (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). It was shown that lncRNA H19 was able to bind to let-7b as a competitive endogenous RNA, downregulate its expression, upregulate cyclin D1 expression, and promote vascular smooth muscle proliferation and vascular remodeling (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). It was also shown that, by binding and isolating let-7b, lncRNA H19 upregulated angiotensin I receptor-1 (AT1R) expression in platelet-derived growth factor-BB-stimulated rat pulmonary artery smooth muscle cells (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Angiotensin II binding to AT1R activates the MAPK signaling pathway, which promotes vascular and smooth muscle cell proliferation and vascular remodeling (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). However, whether lncRNA H19 is involved in the regulation of the pathogenesis of PPHN is unclear. The aim of the present study was to establish a mouse pulmonary artery endothelial cell dysfunction model to simulate PPHN pathology \u003cem\u003ein vitro\u003c/em\u003e by hypoxia induction. Subsequently, the knockdown and overexpression of lncRNA H19 in combination with cell transfection and counting were used to investigate whether lncRNA H19 was involved in PPHN and its intrinsic regulatory mechanism, which may provide new therapeutic targets and ideas for PPHN.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e \u003cem\u003eReagents\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eMouse pulmonary artery endothelial cells (MPAECs) were purchased from Shanghai Fuyu Biotechnology Co., Ltd. Transwell chambers, DMEM, and RPMI1640 serum-free and complete media were purchased from Gibco (Thermo Fisher Scientific, Inc. (cat. no. FY22FN2097). Fetal bovine serum (cat. no. 10099-141) was purchased from Gibco (Thermo Fisher Scientific, Inc.). Sterile PBS and trypsin were purchased from Shanghai Biyuntian Biotechnology Co., Ltd. Formaldehyde fixative and 0.1% crystal violet staining solution were purchased from Wuhan Xavier Biotechnology Co., LTD. Total RNA extraction and reverse transcription kits were purchased from Takara. Quantitative PCR (qPCR) primers were designed and synthesized by Takara Bio, Inc. Anti-VEGF and anti-HIF-1α antibodies were purchased from Abcam, while anti-β-actin antibody was purchased from Peprotech, Inc.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCell experiments\u003c/em\u003e. After reaching\u0026thinsp;~\u0026thinsp;50% confluence, MPAECs were incubated for 12 h in medium with a serum concentration of 0.02%. Subsequently, the cells were grouped according to the purpose of the experiment as follows: i) Normoxic group (Normal): Cells were placed in a normoxic cell culture incubator for 24, 48 and 72 h; ii) hypoxia group (Hypoxia): Cells were placed in a hypoxic cell culture incubator (3% O\u003csub\u003e2\u003c/sub\u003e) for 24, 48 and 72 h; iii) knockdown negative control (NC) group [small hairpin (sh)NC]: 12 h after shNC transfection of cells, cells were cultured in 3% O\u003csub\u003e2\u003c/sub\u003e for 48 h; iv) knockdown experimental group (shRNA-lncRNA H19): 12 h after shRNA-lncRNA H19 transfection, cells were cultured in 3% O\u003csub\u003e2\u003c/sub\u003e for 48 h; v) overexpression (OE)-NC group (OE-NC): 12 h after OE-NC transfection, cells were cultured in 3% O\u003csub\u003e2\u003c/sub\u003e for 48 h; vi) OE experimental group (OE-lncRNA H19): 12 h after OE-lncRNA H19 transfection, cells were cultured in 3% O\u003csub\u003e2\u003c/sub\u003e for 48 h; vii) NC group of small interfering RNA (NC): 12 h after NC transfection, cells were incubated in 3% O\u003csub\u003e2\u003c/sub\u003e for 48 h; and viii) small interfering RNA (siRNA) experimental group (siRNA-miR-20a-5p): Following transfection of siRNA-miR-20a-5p for 12 h, the cells were cultured in 3% O\u003csub\u003e2\u003c/sub\u003e for 48 h.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCell transfection\u003c/em\u003e. For the cell transfection group, adenovirus was added directly into complete medium at a multiplicity of infection of 100. After 24 h of transfection, the medium was changed to normal complete medium. Subsequent analysis was performed after the appropriate time of infection according to the instructions.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCell migration assay.\u003c/em\u003e Transwell chambers (8\u0026micro;m pores, Corning Inc., Corning NY) were pre-coated with 1% matrigel incubated at 37℃for 30 min. Next, the gelatin was aspirated off and the chambers were washed three times with PBS. Serum-free medium was then used to culture MPAECs Cells in logarithmic growth phase were employed and washed with PBS, and trypsin was then added to digest the cells. Cells were then centrifuged at 1,000 rpm at room temperature for 5 min. The supernatant was subsequently discarded, and the cells were resuspended by adding 1 ml serum-free culture medium. Next, 100\u0026ndash;150 \u0026micro;l cell suspension was added to the upper chamber of the Transwell plate, while 700 \u0026micro;l complete medium containing 20% FBS was added to the lower chamber of the Transwell plate. Cells were incubated for 5 h. Next, the cells were gently wiped off from the upper chamber with a cotton swab, while the upper layer of liquid was discarded from the Transwell plate, which was then soaked in 4% paraformaldehyde for 15 min. The chambers were then washed three times with PBS (each time with slow shaking for 5 min). After staining with 0.1% crystal violet for 15 min at room temperature, the chambers were washed three times with PBS.\u003c/p\u003e \u003cp\u003e \u003cem\u003eFlow cytometry analysis\u003c/em\u003e. In the cell transfection group, adenovirus was added directly to complete medium at a multiplicity of infection (MOI) of 100. After 24 h of transfection, the medium was changed to complete medium. Flow cytometry was performed 48 h after infection to detect apoptosis or cell cycle.\u003c/p\u003e \u003cp\u003eFor apoptosis analysis, the apoptosis rate was detected by annexin V and PI double staining (cat. no. 640932; BioLegend, Inc.) according to the manufacturer\u0026rsquo;s instructions. Briefly, cells were collected and washed once with PBS. Next, 100 \u0026micro;l Annexin V Binding Buffer was added to each tube to resuspend the cells. In total, 5 \u0026micro;l Annexin V-APC and 10 \u0026micro;l PI were added to stain the cells at room temperature in the dark for 15 min. Finally, the samples were transferred to flow-through sampling tubes after adding 400 \u0026micro;l buffer.\u003c/p\u003e \u003cp\u003eFor cell cycle assay, a DNA content assay kit to evaluate the cell cycle (cat. no. CA1510; Beijing Solarbio Science \u0026amp; Technology Co., Ltd.) was used after collection of each group of cells, following the instructions of the kit\u0026rsquo;s manufacturer. CytoFLEX S flow cytometer (Beckman Coulter, Inc.) was used to perform the assay.\u003c/p\u003e \u003cp\u003e \u003cem\u003eCell Counting Kit-8 (CCK-8) assay\u003c/em\u003e. After cell counting, cells were washed twice with PBS. Next, the supernatant was discarded, and the cells were inoculated at 5x 10\u003csup\u003e3\u003c/sup\u003e cells per well in 96-well plates. After mixing, cells were incubated overnight. CCK-8 assay was carried out the next day at 0, 6, 24, 48 and 72 h after the addition of adenovirus at a MOI of 50 and incubation with the cells for 48 h. A total of 10 \u0026micro;l CCK-8 solution was added to each well, and the plates were incubated in an incubator for 0.5-4 h [optical density (OD)\u0026thinsp;\u0026le;\u0026thinsp;2.0]. Absorbance was detected at 450nm\u003c/p\u003e \u003cp\u003e \u003cem\u003eqPCR detection\u003c/em\u003e. Total RNA from MPAECs was extracted according to the RNAiso plus manufacturer\u0026rsquo;s instructions (Invitrogen). Total RNA was reverse transcribed into cDNA according to the instructions of the reverse transcription kit (cat. no. RR037Q; Takara Biomedical Technology Co., Ltd.) and stored at -20˚C. The sequence of the primers were as follows: GAPDH, which was used as the internal reference gene (upstream sequence 5\u0026rsquo;-3\u0026rsquo;: GGCACAGTCAAGGCTGAGAATG, downstream sequence 5\u0026rsquo;-3\u0026rsquo;: ATGGTGGGTGAAGACGCCAGTA); target gene lncRNA H19 gene (upstream sequence 5\u0026rsquo;-3\u0026rsquo;: TCGCTCCACTGACCTTCTAAAC, downstream sequence 5\u0026rsquo;-3\u0026rsquo;: CCTGCCTTTCTATGTGCCATTC); HIF-1α gene (upstream sequence 5\u0026rsquo;-3\u0026rsquo;: CCACCACAACTGCCACCACTG, downstream sequence 5\u0026rsquo;-3\u0026rsquo;: TGCCACTGTATGCTGATGCCTTAG); and VEGF gene (upstream sequence 5\u0026rsquo;-3\u0026rsquo;: GGTGAGAGGTCTAGTTCCCGA, downstream sequence 5\u0026rsquo;-3\u0026rsquo;: CCATGAACTTTCTGCTCTTC). qPCR detection was performed using SYBR Green Mixture (cat. no. RR820Q; Takara Biomedical Technology Co., Ltd.). The reaction system and reaction conditions were prepared according to the instructions. Three biological replicates were conducted for each group. The relative expression (RQ) of the target genes was calculated using the ΔΔCq method (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e): RQ\u0026thinsp;=\u0026thinsp;2\u003csup\u003e\u0026minus;\u0026thinsp;ΔΔCq\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003cem\u003eWestern blot detection\u003c/em\u003e. RIPA buffer was used to lyse MPAECs at the end of the treatment period. Sonication was used to fully lyse the cells. The cells were then centrifuged at 12,000 rpm for 10 min at 4˚C. Next, the supernatant was separated and analyzed with BCA Protein Quantification Kit (cat. no. P0010S; Shanghai Biyuntian Biotechnology Co., Ltd) to adjust the total cellular protein concentration. Samples were then incubated at 100˚C for 5 min after adding 5X sampling buffer. Proteins were separated by SDS-PAGE and then transferred to PVDF membranes, which were then blocked with skimmed milk. After three washes with TBS-Tween 20 (TBST) buffer, the primary antibody was added and incubated overnight on a shaker at 4˚C, anti-HIF-1α (1:1000; cat. no. PA3-16521; Thermo Fisher Scientific Inc.), anti-VEGF (1:1000; cat. no. MA5-13182; Thermo Fisher Scientific Inc.), anti-β-actin (1:1000; cat. no. AC026; ABclonal Technology Co.Ltd.). After three washes with TBST buffer, the secondary antibody was added and incubated at room temperature for 1 -1.5 h. Subsequently, the proteins were visualized using ECL system (cat. no.WBULP; Merck Pty. Ltd.). Finally, ImageJ software (version 2022) was used for semiquantitative analysis of protein expression. β-actin was used as internal reference.\u003c/p\u003e \u003cp\u003e \u003cem\u003eStatistical analysis\u003c/em\u003e. Experimental data were statistically analyzed using SPSS 23. 0 software (IBM Corp.). Results were expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. GraphPad software (Version 9.0) was used to draw statistical analysis-related graphs. Independent samples Student\u0026rsquo;s t-tests were used for comparisons between two groups, while one-way ANOVA test was used between for comparisons multiple groups, followed by Bonferroni as a post hoc test. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to indicate a statistically significant difference.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003e3.1 Hypoxia induces dysfunction and promotes the expression of lncRNA H19 and angiogenesis-related genes in mouse pulmonary artery endothelial cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe regulation of endothelial cell migration is fundamental to angiogenesis. Therefore, in this study, MPAECs were cultured in an atmospheric low oxygen workstation (3% O\u003csub\u003e2\u003c/sub\u003e, 5% CO\u003csub\u003e2\u003c/sub\u003e, 94% N\u003csub\u003e2\u003c/sub\u003e, 37\u0026deg;C) or an atmospheric normoxic incubator (21% O\u003csub\u003e2\u003c/sub\u003e, 5% CO\u003csub\u003e2\u003c/sub\u003e, 74% N\u003csub\u003e2\u003c/sub\u003e, 37\u0026deg;C) for 24 h, 48 h and 72 h, respectively. Transwell results showed that compared with the normoxic culture group, low oxygen treatment with 3% O\u003csub\u003e2\u003c/sub\u003e significantly promoted the migration of MPAECs in a time-dependent manner, with the maximum number and area of purple color at 48 h, indicating significant cell migration (Figure. 1A). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C, hypoxia significantly inhibited the apoptosis of MPAECs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). With the prolongation of hypoxia incubation time, MPAECs exhibited excessive proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The above results suggest the successful establishment of a hypoxia-induced mouse pulmonary artery endothelial cell dysfunction mimicking pulmonary hypertension model, which provides a basis for further investigation of the mechanism of pulmonary artery endothelial cell vascular remodeling in PPHN.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eHIF-1α and VEGF are markers of endothelial cell angiogenesis. In our study, qPCR results showed that hypoxia induction significantly promoted the expression level of lncRNA H19 in MPAECs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). In addition, the expression of HIF-1α and VEGF mRNA was also significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-G). Further, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eH-J, hypoxia induction significantly upregulated HIF-1α and VEGF protein expression in MPAECs. This suggests that lncRNA H19 may be involved in mediating the potential role of angiogenesis in MPAECs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.2LncRNA H19 promotes protein expression of HIF-1α and VEGF in mouse pulmonary artery endothelial cells under hypoxic conditions\u003c/b\u003e \u003c/p\u003e \u003cp\u003eLncRNA H19 knockdown and overexpression cell models were constructed to further clarify the regulatory relationship between lncRNA H19 and HIF-1α/VEGF. The results showed that knockdown of lncRNA H19 was able to significantly downregulate the mRNA and protein levels of HIF-1α and VEGF in a hypoxic environment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-F). Conversely, overexpression of lncRNA H19 was able to significantly promote the expression of HIF-1α and VEGF at both mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eG-L). This suggests that lncRNA H19 may play a critical role in hypoxia-induced pulmonary hypertension by regulating the HIF-1α/VEGF signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.3 LncRNA H19 affects migration and proliferation of mouse pulmonary artery endothelial cells under hypoxic conditions\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTranswell and CCK8 were used to further observe the effects of knockdown and overexpression of lncRNA H19 on the migration and proliferation of endothelial cells in mouse pulmonary artery vasculature under hypoxic conditions. Transwell results showed that knockdown of lncRNA H19 significantly reduced the purple coloring area of endothelial cells, while overexpression of lncRNA H19 significantly increased the purple coloring area of endothelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). In addition, CCK8 results showed that endothelial cells exhibited excessive proliferation under hypoxic conditions. However, knocking down lncRNA H19 significantly inhibits excessive proliferation of endothelial cells, while overexpression of lncRNA H19 further promotes excessive proliferation of endothelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.4 \u003cb\u003eLncRNA H19 regulates apoptosis and cell cycle in mouse pulmonary artery endothelial cells under hypoxic conditions\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFlow cytometry was used to further observe the effects of knockdown/overexpression of lncRNA H19 in a hypoxic environment on apoptosis in mouse pulmonary artery endothelial cells. The results showed that the anti-apoptotic ability of mouse pulmonary artery vascular endothelial cells was impaired after lncRNA H19 was knocked down (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Conversely, after overexpression of lncRNA H19, the anti-apoptotic ability of mouse pulmonary artery vascular endothelial cells was significantly activated (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe cell cycle includes the G1, S, G2 and M phases. Subsequently, the DNA content of the cells was detected using a flow cytometric sorter, which allowed for the determination of the temporal phase of the cell cycle that the cells were in and the proportion of cells in each phase. We found that the (G2\u0026thinsp;+\u0026thinsp;S)/(G1\u0026thinsp;+\u0026thinsp;G2\u0026thinsp;+\u0026thinsp;S) ratio of endothelial cells was significantly reduced after inhibiting the expression of lncRNA H19 using shRNA, which suggests that the cell proliferation activity was significantly inhibited (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-F). However, after overexpression of lncRNA H19, the (G2\u0026thinsp;+\u0026thinsp;S)/(G1\u0026thinsp;+\u0026thinsp;G2\u0026thinsp;+\u0026thinsp;S) ratio of endothelial cells was significantly increased, which indicated that the cell proliferative activity was increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-H).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.5 miR-20a-5p ameliorates dysfunction on mouse pulmonary artery endothelial cells by regulating the HIF-1α/VEGF signaling pathway\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePrevious studies have shown that lncRNA H19 can participate in the regulation of myofibroblast fibrosis by directly targeting miR-20a-5p(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). Our results confirmed that lncRNA H19 negatively regulate the expression of miR-20a-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). However, the effect of miR-20a-5p on mouse pulmonary artery endothelial cells is unclear. Therefore, siRNA was used to knock down miR-20a-5p in mouse pulmonary artery endothelial cells to further validate the targeted regulatory role of lncRNA H19. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-H, after miR-20a-5p was knocked down in mouse pulmonary artery endothelial cells, mRNA and protein expression of HIF-1α and VEGF were significantly activated. Furthermore, knockdown of miR-20a-5p significantly increased the migration of mouse pulmonary artery endothelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003eI), but the rate of endothelial cell apoptosis was down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ-K).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.6 lncRNA H19 influences endothelial cell migration and apoptosis by regulating miR-20a-5p.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUsing transwell and flow cytometry, we examined the effects of knocking down or adding miR-20a-5p mimics on endothelial cell migration and apoptosis in the context of lncRNA H19 knockdown or overexpression. The results showed that in the case of lncRNA H19 inhibition using shRNA-LncRNA H19, adding siRNA-miR-20a-5p promoted endothelial cell migration and alleviated the inhibition of endothelial cell apoptosis. Conversely, in the case of lncRNA H19 overexpression, adding miR-20a-5p mimics inhibited endothelial cell migration and promoted endothelial cell apoptosis. These findings indicate that lncRNA H19 affects endothelial cell function by regulating the expression of miR-20a-5p.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePPHN is a clinical neonatal critical illness with a relatively high incidence, which may occur in 1\u0026ndash;2 per 1,000 newborns (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). PPHN has become a disease with high morbidity, mortality and disability (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Impaired relaxation of the pulmonary vasculature in the early postnatal period leads to pulmonary circulatory resistance exceeding body circulatory resistance, resulting in severe hypoxemia and respiratory distress, and ultimately PPHN (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Currently, the clinical treatment strategy for PPHN is focused on mechanical ventilation to maintain systemic circulatory pressure and reduce pulmonary hypertension (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Neonatal care, including the use of inhaled NO and other vasodilators, improves the prognosis of infants with PPHN (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). However, clinical statistics show that \u0026le;\u0026thinsp;30% of newborns affected by PPHN do not respond to this treatment and require invasive life support measures (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Therefore, it is important to further explore effective novel treatment strategies for PPHN.\u003c/p\u003e \u003cp\u003eThe pathophysiology of PPHN is marked by increased pulmonary vascular resistance, resulting in reduced pulmonary blood flow and, therefore, reduced oxygenated blood volume returning to the left side of the heart, leading to hypoxia, reduced end-organ perfusion, acidosis and cyanosis. Therefore, hypoxic culture is often used to simulate the pathological state of PPHN in mechanistic studies (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). In the present study, hypoxic treatment with 3% O\u003csub\u003e2\u003c/sub\u003e was used to induce lung endothelial cell dysfunction to establish a PPHN cell model. The results showed that the proliferation and migration of endothelial cells were significantly promoted, while apoptosis was significantly inhibited under hypoxic conditions. Previous study have also found that a low-oxygen environment can promote the vascular remodeling of endothelial cells (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e), which is consistent with the present findings.\u003c/p\u003e \u003cp\u003eLncRNA is a ncRNA with a length\u0026thinsp;\u0026gt;\u0026thinsp;200 bp, which is widely involved in the occurrence and development of a variety of diseases, such as cancer and respiratory diseases (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). Previous studies have demonstrated that lncRNA H19 can regulate endothelial cell function and angiogenesis in a variety of diseases, including glioma (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e), hypoxic-ischemic brain damage (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e) and arteriosclerosis obliterans (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). In the current study, a hypoxic environment could effectively promote the expression level of lncRNA H19 in MPAECs, which was accompanied by high expression of HIF-1α and VEGF. HIF-1α is an important transcription factor that regulates the effects of hypoxia. HIF-1α has a broad distribution and role, which can enhance the tolerance of vascular endothelial cell to hypoxia by regulating downstream target genes (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). It has been shown that increased HIF-1α signaling contributes to pulmonary vascular remodeling in adult pulmonary hypertension (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). VEGF is an important target gene for HIF-1α, as well as one of the most potent and critical regulators of pulmonary vascular growth, development and maintenance throughout embryonic, fetal and postnatal life (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). VEGF is strongly expressed in the developing respiratory epithelium from the embryonic stage, and promotes angiogenesis by regulating endothelial cell proliferation, migration and differentiation (\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e). Disruption of VEGF gene expression leads to severe defects in blood vessel formation. Loss of a single VEGF allele results in a notable reduction in endothelial cells, which in turn causes early embryonic mortality (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). Previous studies have reported elevated lung VEGF mRNA in chronic hypoxia-induced pulmonary hypertension (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). In addition, IL-33 expression is elevated in human pulmonary artery epithelial cells in a hypoxic environment, which may be due to increased downstream expression of HIF-1α and VEGF, triggering vascular remodeling and leading to hypoxic pulmonary hypertension (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e), which is compatible with the present results. A recent clinical study showed that newborns with PPHN have reduced levels of VEGF in their blood (\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e). In addition, another study showed a decrease in pulmonary VEGF due to monocrotaline-mediated pulmonary hypertension (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e). These studies suggest possible non-hypoxia-dependent mechanisms that may regulate pulmonary VEGF expression, such as altered hemodynamic stress. Therefore, the expression of VEGF and its intrinsic regulatory mechanisms in PPHN models mediated by different mechanisms need to be further explored.\u003c/p\u003e \u003cp\u003eThe current study focused on lncRNA H19 upstream of the HIF-1α and VEGF genes. It was found that hypoxia induced elevated expression of lncRNA H19 in pulmonary artery epithelial cells of mice, suggesting that lncRNA H19 is involved in mediating angiogenesis in MPAECs. Numerous studies have demonstrated that lncRNAs play powerful regulatory functions in biological processes at the epigenetic, transcriptional and post-transcriptional levels (\u003cspan additionalcitationids=\"CR61\" citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e). Previous research has revealed that vascular remodeling is the result of pulmonary artery smooth muscle cell overproliferation and arterial endothelial cell dysfunction (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). LncRNA H19 can play a central role in vascular smooth muscle cell proliferation and myocardial extracellular matrix alteration, suggesting that it may be a potential drug target in pulmonary arterial hypertension. In addition, it has been shown that patients with end-stage pulmonary arterial hypertension have significantly increased levels of lncRNA H19 in their blood, which is positively correlated with the degree of right ventricular hypertrophy (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). The lncRNA H19/let-7b axis was reported to be involved in PDGF-BB-stimulated pulmonary artery vascular remodeling (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Similarly, Wang \u003cem\u003eet al\u003c/em\u003e (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e) reported elevated lncRNA H19 in a melatonin-mediated rat model of pulmonary hypertension. Targeted modulation of the lncRNA H19/miR-200a/PDCD4 axis could exert therapeutic effects in pulmonary arterial hypertension in rats. The above results suggest that lncRNA H19 may play a potential role in the pathological progression of PPHN. In the present study, the anti-apoptotic function of mouse pulmonary artery vascular endothelial cells was impaired after lncRNA H19 was knocked down. Conversely, overexpression of lncRNA H19 significantly activated the anti-apoptotic function of mouse pulmonary artery vascular endothelial cells, which is consistent with previous findings.\u003c/p\u003e \u003cp\u003eIt has been reported that miR-20a-5p is a target of lncRNA H19 (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), and the current results also found that lncRNA H19 could negatively regulate the expression of miR-20a-5p. However, it is not yet known whether lncRNA H19 affects endothelial cell function through the regulation of miR-20a-5p under hypoxic conditions. Therefore, miR-20a-5p siRNA or mimics were added while knocking down or overexpressing lncRNA H19. The results showed that this effectively reversed the effects of lncRNA H19 on endothelial cell migration and apoptosis, which indicates that lncRNA H19 may be involved in regulating the HIF-1α/VEGF signaling pathway by targeting miR-20a-5p to promote the improvement of pulmonary artery endothelial cell function. Thus, the present results suggest that the lncRNA H19/miR-20a-5p/HIF-1α/VEGF regulatory axis may play an important role in the pathological regulatory process of PPHN. Notably, the current PPHN cell model exposure factor was a hypoxic environment. Combined with the results of previous studies, it was found that different environmental and temporal exposure factors may lead to different results. Therefore, further studies are still needed to investigate and validate the PPHN regulatory mechanisms in different models.\u003c/p\u003e \u003cp\u003eIn conclusion, lncRNA H19 may interfere with vascular remodeling in hypoxia-induced pulmonary hypertension by upregulating the expression of HIF-1α and VEGF in vascular endothelial cells. The lncRNA H19/miR-20a-5p/HIF-1α/VEGF regulatory axis may play a key regulatory role in the PPHN process.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study was supported by Shenzhen Nanshan District Technical Research and Development and Creative Design Project Subdivision Funds for Education (Healthcare) Technology Projects (grant no. NS2023115), Southern University of Science and Technology Hospital President\u0026rsquo;s Research Fund Project (grant no. 2021-C1), and Shenzhen Science and Technology Plan Project (Basic Research Special Project) (Natural Science Foundation) (grant no. JCYJ20230807091859031).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors confirm that the raw data and all replicates supporting the findings of this study are available within the article. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLD and WY supervised the entire project. LD and YC wrote the manuscript. HS, QL and QJ performed the main experiments. HL provided technical support and professional expertise. HL and QJ saw and verified all the raw data. LD and WY revised the manuscript. All authors have read and agreed to the published version of the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatient consent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eFortas, F., et al., \u003cem\u003eLife-threatening PPHN refractory to nitric oxide: proposal for a rational therapeutic algorithm.\u003c/em\u003e Eur J Pediatr, 2021. \u003cstrong\u003e180\u003c/strong\u003e(8): p. 2379-2387.\u003c/li\u003e\n\u003cli\u003eSingh, Y. and S. Lakshminrusimha, \u003cem\u003ePathophysiology and Management of Persistent Pulmonary Hypertension of the Newborn.\u003c/em\u003e Clin Perinatol, 2021. \u003cstrong\u003e48\u003c/strong\u003e(3): p. 595-618.\u003c/li\u003e\n\u003cli\u003eSankaran, D. and S. Lakshminrusimha, \u003cem\u003ePulmonary hypertension in the newborn- etiology and pathogenesis.\u003c/em\u003e Semin Fetal Neonatal Med, 2022. \u003cstrong\u003e27\u003c/strong\u003e(4): p. 101381.\u003c/li\u003e\n\u003cli\u003eBabooa, N., W.J. Shi, and C. Chen, \u003cem\u003eFactors relating caesarean section to persistent pulmonary hypertension of the newborn.\u003c/em\u003e World J Pediatr, 2017. \u003cstrong\u003e13\u003c/strong\u003e(6): p. 517-527.\u003c/li\u003e\n\u003cli\u003eNair, J. and S. Lakshminrusimha, \u003cem\u003eUpdate on PPHN: mechanisms and treatment.\u003c/em\u003e Semin Perinatol, 2014. \u003cstrong\u003e38\u003c/strong\u003e(2): p. 78-91.\u003c/li\u003e\n\u003cli\u003eWedgwood, S., R.H. Steinhorn, and S. Lakshminrusimha, \u003cem\u003eOptimal oxygenation and role of free radicals in PPHN.\u003c/em\u003e Free Radic Biol Med, 2019. \u003cstrong\u003e142\u003c/strong\u003e: p. 97-106.\u003c/li\u003e\n\u003cli\u003eRashid, M., et al., \u003cem\u003eUp-down regulation of HIF-1\u0026alpha; in cancer progression.\u003c/em\u003e Gene, 2021. \u003cstrong\u003e798\u003c/strong\u003e: p. 145796.\u003c/li\u003e\n\u003cli\u003eSong, S., et al., \u003cem\u003eHIF-1\u0026alpha; increases the osteogenic capacity of ADSCs by coupling angiogenesis and osteogenesis via the HIF-1\u0026alpha;/VEGF/AKT/mTOR signaling pathway.\u003c/em\u003e J Nanobiotechnology, 2023. \u003cstrong\u003e21\u003c/strong\u003e(1): p. 257.\u003c/li\u003e\n\u003cli\u003eLu, S., et al., \u003cem\u003eArsenic Sulfide Inhibits Hepatocellular Carcinoma Metastasis by Suppressing the HIF-1\u0026alpha;/VEGF Pathway.\u003c/em\u003e Front Biosci (Landmark Ed), 2023. \u003cstrong\u003e28\u003c/strong\u003e(7): p. 152.\u003c/li\u003e\n\u003cli\u003eShifren, J.L., et al., \u003cem\u003eIn the human fetus, vascular endothelial growth factor is expressed in epithelial cells and myocytes, but not vascular endothelium: implications for mode of action.\u003c/em\u003e J Clin Endocrinol Metab, 1994. \u003cstrong\u003e79\u003c/strong\u003e(1): p. 316-22.\u003c/li\u003e\n\u003cli\u003eWiszniak, S. and Q. Schwarz, \u003cem\u003eExploring the Intracrine Functions of VEGF-A.\u003c/em\u003e Biomolecules, 2021. \u003cstrong\u003e11\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eKroll, J. and J. Waltenberger, \u003cem\u003eVEGF-A induces expression of eNOS and iNOS in endothelial cells via VEGF receptor-2 (KDR).\u003c/em\u003e Biochem Biophys Res Commun, 1998. \u003cstrong\u003e252\u003c/strong\u003e(3): p. 743-6.\u003c/li\u003e\n\u003cli\u003eBauters, C., et al., \u003cem\u003eRecovery of disturbed endothelium-dependent flow in the collateral-perfused rabbit ischemic hindlimb after administration of vascular endothelial growth factor.\u003c/em\u003e Circulation, 1995. \u003cstrong\u003e91\u003c/strong\u003e(11): p. 2802-9.\u003c/li\u003e\n\u003cli\u003eGrover, T.R., et al., \u003cem\u003erhVEGF treatment preserves pulmonary vascular reactivity and structure in an experimental model of pulmonary hypertension in fetal sheep.\u003c/em\u003e Am J Physiol Lung Cell Mol Physiol, 2005. \u003cstrong\u003e289\u003c/strong\u003e(2): p. L315-21.\u003c/li\u003e\n\u003cli\u003eGrover, T.R., et al., \u003cem\u003eIntrauterine hypertension decreases lung VEGF expression and VEGF inhibition causes pulmonary hypertension in the ovine fetus.\u003c/em\u003e Am J Physiol Lung Cell Mol Physiol, 2003. \u003cstrong\u003e284\u003c/strong\u003e(3): p. L508-17.\u003c/li\u003e\n\u003cli\u003eVoelkel, N.F. and J. Gomez-Arroyo, \u003cem\u003eThe role of vascular endothelial growth factor in pulmonary arterial hypertension. The angiogenesis paradox.\u003c/em\u003e Am J Respir Cell Mol Biol, 2014. \u003cstrong\u003e51\u003c/strong\u003e(4): p. 474-84.\u003c/li\u003e\n\u003cli\u003eNadeau, S., et al., \u003cem\u003eChanges in expression of vascular endothelial growth factor and its receptors in neonatal hypoxia-induced pulmonary hypertension.\u003c/em\u003e Pediatr Res, 2005. \u003cstrong\u003e58\u003c/strong\u003e(2): p. 199-205.\u003c/li\u003e\n\u003cli\u003eTuder, R.M., B.E. Flook, and N.F. Voelkel, \u003cem\u003eIncreased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia. Modulation of gene expression by nitric oxide.\u003c/em\u003e J Clin Invest, 1995. \u003cstrong\u003e95\u003c/strong\u003e(4): p. 1798-807.\u003c/li\u003e\n\u003cli\u003eJathar, S., et al., \u003cem\u003eTechnological Developments in lncRNA Biology.\u003c/em\u003e Adv Exp Med Biol, 2017. \u003cstrong\u003e1008\u003c/strong\u003e: p. 283-323.\u003c/li\u003e\n\u003cli\u003eZhang, W., et al., \u003cem\u003eDifferential long noncoding RNA/mRNA expression profiling and functional network analysis during osteogenic differentiation of human bone marrow mesenchymal stem cells.\u003c/em\u003e Stem Cell Res Ther, 2017. \u003cstrong\u003e8\u003c/strong\u003e(1): p. 30.\u003c/li\u003e\n\u003cli\u003eAshrafizadeh, M., et al., \u003cem\u003eLong noncoding RNAs (lncRNAs) in pancreatic cancer progression.\u003c/em\u003e Drug Discov Today, 2022. \u003cstrong\u003e27\u003c/strong\u003e(8): p. 2181-2198.\u003c/li\u003e\n\u003cli\u003eBridges, M.C., A.C. Daulagala, and A. Kourtidis, \u003cem\u003eLNCcation: lncRNA localization and function.\u003c/em\u003e J Cell Biol, 2021. \u003cstrong\u003e220\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eM\u0026uuml;ller, V., et al., \u003cem\u003eInterplay of lncRNA H19/miR-675 and lncRNA NEAT1/miR-204 in breast cancer.\u003c/em\u003e Mol Oncol, 2019. \u003cstrong\u003e13\u003c/strong\u003e(5): p. 1137-1149.\u003c/li\u003e\n\u003cli\u003eLi, B., et al., \u003cem\u003eThe MSC-Derived Exosomal lncRNA H19 Promotes Wound Healing in Diabetic Foot Ulcers by Upregulating PTEN via MicroRNA-152-3p.\u003c/em\u003e Mol Ther Nucleic Acids, 2020. \u003cstrong\u003e19\u003c/strong\u003e: p. 814-826.\u003c/li\u003e\n\u003cli\u003eZhang, L., et al., \u003cem\u003eH19 knockdown suppresses proliferation and induces apoptosis by regulating miR-148b/WNT/\u0026beta;-catenin in ox-LDL -stimulated vascular smooth muscle cells.\u003c/em\u003e J Biomed Sci, 2018. \u003cstrong\u003e25\u003c/strong\u003e(1): p. 11.\u003c/li\u003e\n\u003cli\u003eWang, X., et al., \u003cem\u003eKnockdown of Long Noncoding RNA H19 Represses the Progress of Pulmonary Fibrosis through the Transforming Growth Factor \u0026beta;/Smad3 Pathway by Regulating MicroRNA 140.\u003c/em\u003e Mol Cell Biol, 2019. \u003cstrong\u003e39\u003c/strong\u003e(12).\u003c/li\u003e\n\u003cli\u003eZhang, R., et al., \u003cem\u003eCurcumenol triggered ferroptosis in lung cancer cells via lncRNA H19/miR-19b-3p/FTH1 axis.\u003c/em\u003e Bioact Mater, 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 23-36.\u003c/li\u003e\n\u003cli\u003eChen, X., et al., \u003cem\u003eMuc5ac Production Inhibited by Decreased lncRNA H19 via PI3K/Akt/NF-kB in Asthma.\u003c/em\u003e J Asthma Allergy, 2021. \u003cstrong\u003e14\u003c/strong\u003e: p. 1033-1043.\u003c/li\u003e\n\u003cli\u003eSun, W., et al., \u003cem\u003eLong noncoding RNA H19 promotes vascular remodeling by sponging let-7a to upregulate the expression of cyclin D1.\u003c/em\u003e Biochem Biophys Res Commun, 2019. \u003cstrong\u003e508\u003c/strong\u003e(4): p. 1038-1042.\u003c/li\u003e\n\u003cli\u003eTan, Y., et al., \u003cem\u003eGinsenoside Rb3 alleviates smoke-induced lung injury via the H19/miR-29b-3p/HGMB1/TLR4 signalling pathway.\u003c/em\u003e J Cell Mol Med, 2021. \u003cstrong\u003e25\u003c/strong\u003e(5): p. 2725-2729.\u003c/li\u003e\n\u003cli\u003eXie, J., et al., \u003cem\u003eTargeting non-coding RNA H19: A potential therapeutic approach in pulmonary diseases.\u003c/em\u003e Front Pharmacol, 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 978151.\u003c/li\u003e\n\u003cli\u003eWang, R., et al., \u003cem\u003eIdentifying Involvement of H19-miR-675-3p-IGF1R and H19-miR-200a-PDCD4 in Treating Pulmonary Hypertension with Melatonin.\u003c/em\u003e Mol Ther Nucleic Acids, 2018. \u003cstrong\u003e13\u003c/strong\u003e: p. 44-54.\u003c/li\u003e\n\u003cli\u003eHoffmann, J., et al., \u003cem\u003eMicroarray analysis in pulmonary hypertension.\u003c/em\u003e Eur Respir J, 2016. \u003cstrong\u003e48\u003c/strong\u003e(1): p. 229-41.\u003c/li\u003e\n\u003cli\u003eKim, J., \u003cem\u003eApelin-APJ signaling: a potential therapeutic target for pulmonary arterial hypertension.\u003c/em\u003e Mol Cells, 2014. \u003cstrong\u003e37\u003c/strong\u003e(3): p. 196-201.\u003c/li\u003e\n\u003cli\u003eSu, H., et al., \u003cem\u003eLncRNA H19 promotes the proliferation of pulmonary artery smooth muscle cells through AT(1)R via sponging let-7b in monocrotaline-induced pulmonary arterial hypertension.\u003c/em\u003e Respir Res, 2018. \u003cstrong\u003e19\u003c/strong\u003e(1): p. 254.\u003c/li\u003e\n\u003cli\u003eLin, J.R., et al., \u003cem\u003eLong non-coding RNA H19 promotes myoblast fibrogenesis via regulating the miR-20a-5p-Tgfbr2 axis.\u003c/em\u003e Clinical and Experimental Pharmacology and Physiology, 2021. \u003cstrong\u003e48\u003c/strong\u003e(6): p. 921-931.\u003c/li\u003e\n\u003cli\u003eRubin, R., \u003cem\u003eNew Device Okayed for Treating Pulmonary Hypertension in Newborns.\u003c/em\u003e Jama, 2022. \u003cstrong\u003e328\u003c/strong\u003e(7): p. 612.\u003c/li\u003e\n\u003cli\u003eKipfmueller, F., et al., \u003cem\u003eEchocardiographic Assessment of Pulmonary Hypertension in Neonates with Congenital Diaphragmatic Hernia Using Pulmonary Artery Flow Characteristics.\u003c/em\u003e J Clin Med, 2022. \u003cstrong\u003e11\u003c/strong\u003e(11).\u003c/li\u003e\n\u003cli\u003eRuoss, J.L., et al., \u003cem\u003eManagement of cardiac dysfunction in neonates with pulmonary hypertension and the role of the ductus arteriosus.\u003c/em\u003e Semin Fetal Neonatal Med, 2022. \u003cstrong\u003e27\u003c/strong\u003e(4): p. 101368.\u003c/li\u003e\n\u003cli\u003eChetan, C., et al., \u003cem\u003eOral versus intravenous sildenafil for pulmonary hypertension in neonates: a randomized trial.\u003c/em\u003e BMC Pediatr, 2022. \u003cstrong\u003e22\u003c/strong\u003e(1): p. 311.\u003c/li\u003e\n\u003cli\u003ePels, A., et al., \u003cem\u003eNeonatal pulmonary hypertension after severe early-onset fetal growth restriction: post hoc reflections on the Dutch STRIDER study.\u003c/em\u003e Eur J Pediatr, 2022. \u003cstrong\u003e181\u003c/strong\u003e(4): p. 1709-1718.\u003c/li\u003e\n\u003cli\u003eBall, M.K., et al., \u003cem\u003eEvidence-Based Guidelines for Acute Stabilization and Management of Neonates with Persistent Pulmonary Hypertension of the Newborn.\u003c/em\u003e Am J Perinatol, 2023. \u003cstrong\u003e40\u003c/strong\u003e(14): p. 1495-1508.\u003c/li\u003e\n\u003cli\u003eDakshinamurti, S., \u003cem\u003ePathophysiologic mechanisms of persistent pulmonary hypertension of the newborn.\u003c/em\u003e Pediatr Pulmonol, 2005. \u003cstrong\u003e39\u003c/strong\u003e(6): p. 492-503.\u003c/li\u003e\n\u003cli\u003eChelladurai, P., et al., \u003cem\u003eEpigenetic reactivation of transcriptional programs orchestrating fetal lung development in human pulmonary hypertension.\u003c/em\u003e Science Translational Medicine, 2022. \u003cstrong\u003e14\u003c/strong\u003e(648).\u003c/li\u003e\n\u003cli\u003ePaulin, R. and E.D. Michelakis, \u003cem\u003eThe metabolic theory of pulmonary arterial hypertension.\u003c/em\u003e Circ Res, 2014. \u003cstrong\u003e115\u003c/strong\u003e(1): p. 148-64.\u003c/li\u003e\n\u003cli\u003eJia, P., et al., \u003cem\u003eLong non-coding RNA H19 regulates glioma angiogenesis and the biological behavior of glioma-associated endothelial cells by inhibiting microRNA-29a.\u003c/em\u003e Cancer Letters, 2016. \u003cstrong\u003e381\u003c/strong\u003e(2): p. 359-369.\u003c/li\u003e\n\u003cli\u003eFang, H., et al., \u003cem\u003eLong Noncoding RNA H19 Overexpression Protects against Hypoxic-Ischemic Brain Damage by Inhibiting miR-107 and Up-Regulating Vascular Endothelial Growth Factor.\u003c/em\u003e American Journal of Pathology, 2021. \u003cstrong\u003e191\u003c/strong\u003e(3): p. 503-514.\u003c/li\u003e\n\u003cli\u003eLi, Z.F., et al., \u003cem\u003eEffect of lncRNA H19 on the apoptosis of vascular endothelial cells in arteriosclerosis obliterans via the NF-\u0026kappa;B pathway.\u003c/em\u003e European Review for Medical and Pharmacological Sciences, 2019. \u003cstrong\u003e23\u003c/strong\u003e(10): p. 4491-4497.\u003c/li\u003e\n\u003cli\u003eMakker, K., et al., \u003cem\u003eAltered hypoxia-inducible factor-1\u0026alpha; (HIF-1\u0026alpha;) signaling contributes to impaired angiogenesis in fetal lambs with persistent pulmonary hypertension of the newborn (PPHN).\u003c/em\u003e Physiol Rep, 2019. \u003cstrong\u003e7\u003c/strong\u003e(3): p. e13986.\u003c/li\u003e\n\u003cli\u003eJiang, Y., et al., \u003cem\u003eIncreased SUMO-1 expression in response to hypoxia: Interaction with HIF-1\u0026alpha; in hypoxic pulmonary hypertension.\u003c/em\u003e Int J Mol Med, 2015. \u003cstrong\u003e36\u003c/strong\u003e(1): p. 271-81.\u003c/li\u003e\n\u003cli\u003eJohns, R.A., et al., \u003cem\u003eHypoxia-Inducible Factor 1\u0026alpha; Is a Critical Downstream Mediator for Hypoxia-Induced Mitogenic Factor (FIZZ1/RELM\u0026alpha;)-Induced Pulmonary Hypertension.\u003c/em\u003e Arterioscler Thromb Vasc Biol, 2016. \u003cstrong\u003e36\u003c/strong\u003e(1): p. 134-44.\u003c/li\u003e\n\u003cli\u003ePugliese, S.C., et al., \u003cem\u003eThe role of inflammation in hypoxic pulmonary hypertension: from cellular mechanisms to clinical phenotypes.\u003c/em\u003e Am J Physiol Lung Cell Mol Physiol, 2015. \u003cstrong\u003e308\u003c/strong\u003e(3): p. L229-52.\u003c/li\u003e\n\u003cli\u003eMaron, B.A., R.F. Machado, and L. Shimoda, \u003cem\u003ePulmonary vascular and ventricular dysfunction in the susceptible patient (2015 Grover Conference series).\u003c/em\u003e Pulm Circ, 2016. \u003cstrong\u003e6\u003c/strong\u003e(4): p. 426-438.\u003c/li\u003e\n\u003cli\u003eThompson, A.A.R. and A. Lawrie, \u003cem\u003eTargeting Vascular Remodeling to Treat Pulmonary Arterial Hypertension.\u003c/em\u003e Trends Mol Med, 2017. \u003cstrong\u003e23\u003c/strong\u003e(1): p. 31-45.\u003c/li\u003e\n\u003cli\u003eKrishnan, U. and E.B. Rosenzweig, \u003cem\u003ePulmonary hypertension in chronic lung disease of infancy.\u003c/em\u003e Curr Opin Pediatr, 2015. \u003cstrong\u003e27\u003c/strong\u003e(2): p. 177-83.\u003c/li\u003e\n\u003cli\u003eChristou, H., et al., \u003cem\u003eIncreased vascular endothelial growth factor production in the lungs of rats with hypoxia-induced pulmonary hypertension.\u003c/em\u003e Am J Respir Cell Mol Biol, 1998. \u003cstrong\u003e18\u003c/strong\u003e(6): p. 768-76.\u003c/li\u003e\n\u003cli\u003eLiu, J., et al., \u003cem\u003eIL-33 Initiates Vascular Remodelling in Hypoxic Pulmonary Hypertension by up-Regulating HIF-1\u0026alpha; and VEGF Expression in Vascular Endothelial Cells.\u003c/em\u003e EBioMedicine, 2018. \u003cstrong\u003e33\u003c/strong\u003e: p. 196-210.\u003c/li\u003e\n\u003cli\u003eLassus, P., et al., \u003cem\u003ePulmonary vascular endothelial growth factor and Flt-1 in fetuses, in acute and chronic lung disease, and in persistent pulmonary hypertension of the newborn.\u003c/em\u003e Am J Respir Crit Care Med, 2001. \u003cstrong\u003e164\u003c/strong\u003e(10 Pt 1): p. 1981-7.\u003c/li\u003e\n\u003cli\u003ePartovian, C., et al., \u003cem\u003eHeart and lung VEGF mRNA expression in rats with monocrotaline- or hypoxia-induced pulmonary hypertension.\u003c/em\u003e Am J Physiol, 1998. \u003cstrong\u003e275\u003c/strong\u003e(6): p. H1948-56.\u003c/li\u003e\n\u003cli\u003eQin, Y., et al., \u003cem\u003eOverexpressed lncRNA AC068039.4 Contributes to Proliferation and Cell Cycle Progression of Pulmonary Artery Smooth Muscle Cells Via Sponging miR-26a-5p/TRPC6 in Hypoxic Pulmonary Arterial Hypertension.\u003c/em\u003e Shock, 2021. \u003cstrong\u003e55\u003c/strong\u003e(2): p. 244-255.\u003c/li\u003e\n\u003cli\u003eQin, S., et al., \u003cem\u003eSex differences in the proliferation of pulmonary artery endothelial cells: implications for plexiform arteriopathy.\u003c/em\u003e J Cell Sci, 2020. \u003cstrong\u003e133\u003c/strong\u003e(9).\u003c/li\u003e\n\u003cli\u003eBoucherat, O., et al., \u003cem\u003eThe cancer theory of pulmonary arterial hypertension.\u003c/em\u003e Pulm Circ, 2017. \u003cstrong\u003e7\u003c/strong\u003e(2): p. 285-299.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"biochemical-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bigi","sideBox":"Learn more about [Biochemical Genetics](http://link.springer.com/journal/10528)","snPcode":"10528","submissionUrl":"https://submission.nature.com/new-submission/10528/3","title":"Biochemical Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"PPHN, lncRNA H19, VEGF, HIF-1α, angiogenesis","lastPublishedDoi":"10.21203/rs.3.rs-4657431/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4657431/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePersistent pulmonary hypertension of the newborn (PPHN) is a syndrome of acute respiratory failure characterized by systemic hypoxemia and elevated pulmonary arterial pressure, which leads to pathological changes in pulmonary vascular remodeling and endothelial cell function. Long non-coding RNA (lncRNA) H19 has been shown to be involved in the regulation of arterial endothelial cell function, but its regulatory role in PHN is not fully understood. In the present study, mouse pulmonary artery endothelial cells (MPAECs) were cultured in a hypoxic environment. Subsequently, the regulatory function of lncRNA H19 on MPAECs was explored by constructing adenoviruses knocking down and overexpressing lncRNA H19. The results revealed that the hypoxic environment could induce the proliferation and migration of MPAECs, as well as the high expression of lncRNA H19 in MPAECs. Knockdown of lncRNA H19 expression in MPAECs reversed hypoxic environment-induced functional changes in endothelial cells, whereas overexpression of lncRNA H19 further enhanced the proliferation and migration of MPAECs. In addition, further assays revealed that lncRNA H19 upregulated the hypoxia-inducible factor-1α (HIF-1α)/vascular endothelial growth factor (VEGF) pathway through sponge adsorption of microRNA-20a-5p, which in turn promoted changes in endothelial cell function. LncRNA H19 may interfere with vascular remodeling in hypoxia-induced pulmonary hypertension by upregulating the expression of HIF-1α and VEGF in vascular endothelial cells.\u003c/p\u003e","manuscriptTitle":"LncRNA H19 improves angiogenesis in mouse pulmonary artery endothelial cells by regulating the HIF-1α/VEGF signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-23 12:27:56","doi":"10.21203/rs.3.rs-4657431/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-07T12:44:31+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-04T19:03:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"264184068897843972111606249402804500013","date":"2024-10-03T12:03:29+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-02T16:55:54+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-26T21:34:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"134176674490221068272082579616310468743","date":"2024-09-26T17:35:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-26T14:24:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-25T16:40:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"52718361680304848228186919304347165470","date":"2024-09-24T19:18:44+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"161612565773592737306837986288396835733","date":"2024-09-24T10:10:22+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"125023384978106097261775514930591516233","date":"2024-09-24T09:12:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"137362669139286264945794004514175525958","date":"2024-09-18T12:50:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"117356363081423298739165996043034988593","date":"2024-09-18T12:30:50+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-07T10:34:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-01T06:13:03+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-01T06:12:45+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biochemical Genetics","date":"2024-06-29T04:16:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"biochemical-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bigi","sideBox":"Learn more about [Biochemical Genetics](http://link.springer.com/journal/10528)","snPcode":"10528","submissionUrl":"https://submission.nature.com/new-submission/10528/3","title":"Biochemical Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"a0930223-e311-44d7-b02e-fdb21f3f8998","owner":[],"postedDate":"July 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-12-09T16:04:58+00:00","versionOfRecord":{"articleIdentity":"rs-4657431","link":"https://doi.org/10.1007/s10528-024-10983-3","journal":{"identity":"biochemical-genetics","isVorOnly":false,"title":"Biochemical Genetics"},"publishedOn":"2024-12-04 15:57:56","publishedOnDateReadable":"December 4th, 2024"},"versionCreatedAt":"2024-07-23 12:27:56","video":"","vorDoi":"10.1007/s10528-024-10983-3","vorDoiUrl":"https://doi.org/10.1007/s10528-024-10983-3","workflowStages":[]},"version":"v1","identity":"rs-4657431","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4657431","identity":"rs-4657431","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}