αMI-domain of Integrin Mac-1 Binds the Cytokine Pleiotrophin Using Multiple Mechanisms

preprint OA: closed CC-BY-ND-4.0
📄 Open PDF Full text JSON View at publisher
Full text 89,352 characters · extracted from oa-pdf · 8 sections · click to expand

Keywords

integrin, macrophages, Mac-1, pleiotrophin, NMR .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 2 SUMMARY The integrin Mac -1 (α Mβ2, CD11b/CD18, CR3) is an important adhesion receptor expressed on macrophages and neutrophils. Mac-1 is also the most promiscuous member of the integrin family that binds a diverse set of ligands through its α MI-domain. However, the binding mechanism of most ligands is not clear. We have determined the interaction of αMI-domain with the cytokine pleiotrophin (PTN), a cationic protein known to bind αMI-domain and induce Mac-1-mediated cell adhesion and migration. Our data show that PTN’s N-terminal domain binds a unique site near the N- and C-termini of the α MI-domain using a metal-independent mechanism. However, stronger interaction is achieved when an acidic amino acid in a zwitterionic motif in PTN’s C -terminal domain chelates the divalent cation in the metal ion -dependent adhesion site of the active α MI-domain. T hese results indicate that αMI-domain can bind ligands using multiple mechanisms, and suggest that active αMI-domain prefers acidic amino acids in zwitterionic motifs. HIGHLIGHTS • αMI-domain’s interaction with the cytokine pleiotrophin (PTN) was investigated with solution NMR. • αMI-domain binds PTN using multiple mechanisms. • PTN’s N-terminal domain binds both active and inactive αMI-domains using a unique site near αMI- domain’s termini. • PTN’s C-terminal domain binds only active αMI-domain through a metal-dependent interaction. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 3

Introduction

Mac-1 (αMβ2, CD11b/CD18, CR3) is a member of the αβ heterodimeric adhesion receptor family known as integrins. Mac-1 is primarily expressed in neutrophils , monocytes, and macrophages. It is responsible for many important activities in these cells, including phagocytosis, migration, and degranulation (Coxon et al., 1996; Lu and Springer, 1997; Ding et al., 1999; Prince et al., 2001 ). It has also been increasingly recognized as a vital regulator of the inflammatory state of these cells, capable of promoting both pro- inflammatory and anti-inflammatory pathways in a context dependent way ( Rosetti and Mayadas, 2016). Mac-1’s diverse biological activities are closely connected with its broad ligand specificity. It is the most promiscuous member of the integrin family and is known to bind nearly 100 different ligands with little consensus among their structures (Lamers et al., 2021 ). The best-known and most characterized Mac- 1 ligands include fibrinogen (Altieri et al., 1990; Ugarova et al., 1998), complement factor C3b (Michishita et al., 1993), and intercellular adhesion molecule 1 (ICAM -1) (Smith et al., 1989 ; Diamond et al., 1990), and GPIbα (Simon et al., 2000). Still, it is also known to bind such diverse ligands as JAM-3 (Santoso et al., 2002), elastase (Cai and Wright, 1996), myeloperoxidase (Johansson et al., 1997), plasminogen (Lishko et al., 2004), ovalbumin (Zhang and Plow, 1996), keyhole limpet hemocyanin (Shappell et al., 1990; Davis, 1992), CCN1(Schober et al., 2003) , and CD40L (Wolf et al., 2011) . Recently, it was also shown to bind SIRPα and mediate the merging of macrophages (Podolnikova et al., 2019). Although many ligands are known to bind Mac-1, the binding mechanisms of only a handful of ligands were confirmed with structures (Bajic et al., 2013; Jensen et al., 2016; Morgan et al., 2019; Trstenjak et al., 2020; Fernandez et al., 2022; Goldsmith et al., 2022). The binding interactions of other ligands and their functional consequences remain to be elucidated. Surprisingly, despite the structural diversity among Mac -1 ligands, most bind to the I -domain of the αM subunit (αMI-domain). αMI-domain is a two hundred residue Rossmann fold domain inserted between blades two and three of αM’s β-propeller. It contains a divalent metal binding site called the metal ion - dependent adhesion site (MIDAS) . MIDAS facilitates metal ion -mediated binding of some ligands by allowing the divalent cation in the MIDAS to be chelated by an acidic amino acid in the ligand . T he .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 4 conformation of the αMI-domain is crucial to the strength of metal- mediated ligand binding. In particular, when the αMI-domain is in the inactive or “closed” conformation, the coordination of the metal in MIDAS does not allow efficient chelation of the metal ion by the ligand. However, when the αMI-domain is in the active or “open” conformation, the movement of its C-terminal helix away from MIDAS allows the ligand’s acidic amino acid to chelate the metal ion with much higher affinity (Lee et al., 1995). Although metal-mediated ligand binding is prevalent among integrins, it has long been known that Mac-1 uses other ligand binding mechanisms because some Mac-1-binding sequence motifs do not contain acidic amino acids (Yakubenko et al., 2001). In addition, a systematic peptide screening revealed that motifs containing basic amino acids flanked by hydrophobic amino acids also have a high affinity for αMI-domain (Podolnikova et al., 2015b) . This has led to the discovery of several new integrin ligands, including the cathelicidin peptide LL-37 ( Lishko et al., 2016 ; Zhang et al., 2016) , the opioid peptide dynorphin A (Podolnikova et al., 2015a), the chemokine PF4 (Lishko et al., 2018), the cytokine pleiotrophin (PTN) (Shen et al., 2017), and many cationic ligands (Podolnikova et al., 2015b). PTN is a cytokine consisting of two thrombospondin type-1 repeat domains and plays important roles in cell differe ntiation and proliferation (Ryan et al., 2016 ; Wang, 2020). It is also a modulator of microglia activity (Fernandez-Calle et al., 2017; Miao et al., 2019; Linnerbauer et al., 2021), where Mac-1 is highly expressed. Our previous work showed that PTN induced adhesion and migration of various Mac- 1-expressing cells, and PTN can activate ERK1/2 in a Mac-1- dependent manner (Shen et al., 2017). As a representative cationic ligand, we wondered if PTN’s interaction with αMI-domain can provide insight into the binding mechanism of this class of ligands. Solution NMR characterization of the interaction of PTN with inactive αMI-domain showed that the interaction is independent of Mg 2+ and the binding interface includes the α5-β5 loop of inactive αMI-domain and PTN’s N-terminal domain (PTN-NTD) (Feng et al., 2021). However, these data do not explain the observation that Mg2+ ions significantly enhanced the binding of PTN to active αMI-domain (Shen et al., 2017), implying that a divalent cation-dependent mechanism is also part of the interaction. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 5 In the current study, we investigated PTN’s interaction with both active and inactive αMI-domain. Our data indicate the Mg2+-independent interactions between α MI-domain and PTN involve a binding interface formed by PTN-NTD and residues from the α5- β5/α6-β6 loops near the termini of αMI-domain. However, the Mg2+-dependent mechanism uses acidic amino acids in PTN to chelate the metal ion in αMI- domain’s MIDAS. In particular, residue E98 in the PTN’s C-terminal domain (PTN-CTD) was shown to be the preferred chelator of MIDAS metal. We attribute this preference to the fact that E98 is part of a zwitterionic motif and its interaction with the metal is stabilized by favorable electrostatic interactions between charged residues around E98 and the MIDAS. Using these data, we created models of the inactive αMI-domain-PTN-NTD and active α MI-domain-PTN-CTD complexes using HADDOCK (Dominguez et al., 2003). We also carried out molecular dynamics (MD) simulations of these models to provide additional insights into the mechanism by which the αMI-domain can interact with its ligands. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 6

Results

Mg2+-independent interactions between PTN and α MI-domain. We have shown previously that although PTN has the highest affinity for active αMI-domain, it also interacts weakly with inactive αMI-domain (Shen et al., 2017). Additional studies showed the metal -independent interaction is mediated by the α5 -β5 loop near the termini of inactive αMI-domain and PTN-NTD (Feng et al., 2021). To determine the structure of the inactive αMI-domain-PTN-NTD complex, we collected the F1-13C-edited/F3-13C,15N-filtered HSQCNOESY spectrum of a sample containing 0.2 mM 13C, 15N-labeled inactive αMI-domain and 1.0 mM unlabeled PTN-NTD with no Mg2+. These data revealed many intermolecular contacts between PTN-NTD and inactive αMI-domain (Figure 1). In particular, methyl groups of residue L32 in PTN-NTD had definitive contacts with G263 and I265 in the α5- β5 loop of inactive αMI-domain. In addition, the methyl group of residue T26 in PTN-NTD contacted residue K290 in inactive αMI-domain, T34 in PTN-NTD contacted both residues K290 and P291 in inactive αMI-domain, and T50 in PTN-NTD contacted residue P291 in inactive αMI-domain. R52 in PTN-NTD also contacted I265 in inactive αMI-domain. To confirm the assignments of the PTN residues, we collected the F1-13C,15N-filtered/F3-13C-edited NOESYHSQC spectrum of a sample containing 0.2 mM unlabeled inactive αMI-domain and 0.5 mM 13C, 15N-labeled PTN-NTD. These data provided the 13C chemical shifts of the PTN-NTD atoms at the interaction interface (Figure S1). It should be noted that the NMR signal from K290 was mis-assigned to K168 previously (Feng et al., 2021). In the Figure 1. Contacts between the inactive α MI-domain and PTN -NTD. Strips from F1-13C-edited/F3- 13C,15N-filtered HSQCNOESY spectrum of 13C,15N-labeled inactive α MI-domain and unlabeled PTN - NTD. Inactive αMI-domain assignments are shown in red. PTN -NTD assignments are shown in green. Ribbon diagram of inactive α MI-domain and PTN -NTD with residues involved in the intermolecular contacts labeled are shown on the right. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 7 current study, the assignment of residue K290 in αMI-domain was confirmed through selective 15N-labeling of lysines and a K290R mutant of inactive αMI-domain (Figure S2). The 15N-edited NOESYHSQC spectrum of inactive αM I-domain containing selectively 15N-labeled lysines allowed the side chain hydrogens of lysines to be assigned. K290 was the only lysine whose side chain proton resonance frequencies matched the intermolecular NOE cross peaks in the F1-13C-edited/ F3-13C,15N- filtered HSQCNOESY spectrum. We also acquired an F1-13C-edited/F3-13C,15N-filtered HSQCNOESY spectrum of 13C,15N-labeled inactive αMI- domain in the presence of PTN-CTD. The data produced no identifiable intermolecular cross peaks between PTN-CTD and inactive αMI-domain (Figure S3). This is consistent with the observation that only PTN - NTD can produce the large c hemical shift perturbations in 15N-HSQC spectrum of inactive αMI-domain while PTN-CTD induces only minor perturbations. (Feng et al., 2021). Altogether, these data indicate that the interaction interface between PTN-NTD and inactive αMI- domain includes the α5 -β5 and α6- β6 loops of inactive αMI-domain and PTN -NTD. In addition, both inactive and the Q163C/Q309C active αMI-domain (Shimaoka et al., 2002) induced similar chemical shift changes in PTN-NTD (Figure S4). This implies that PTN-NTD most likely has similar metal-independent interactions with active αMI-domain, suggesting that the Mg 2+-independent interaction between PTN and αMI-domain is not sensitive to the activation state of αMI-domain. Mg2+-dependent interactions between αMI-domain and PTN. Our previous study has shown that PTN’s affinity for active αMI-domain is higher than for inactive αMI-domain and Mg2+ is required for the interaction (Shen et al., 2017). To elucidate the underlying mechanism, we investigated PTN’s interaction with the Q163C/Q309C mutant of α MI-domain, which is forced into the active conformation by a well- placed disulfide bond (Shimaoka et al., 2002). A previous study has shown that the Q163C/Q309C mutant is more suitable for NMR studies because, while it has the same conformation and ligand affinity as active αMI-domains created by the removal of residue I316 ( Xiong et al., 2000), it possesses higher stability and better NMR spectral quality ( Nguyen et al., 2023) . B ecause of these favorable properties , the .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 8 Q163C/Q309C mutant was chosen for this study. All subsequent mentions of active α MI-domain in this article refer to the Q163C/Q309C mutant. Interestingly, w hen we titrated the active α MI-domain with PTN in the presence of Mg 2+, PTN induced similar spectral changes in active αMI-domain as glutamate, a ligand known to chelate the metal in the MIDAS of the I316G active αMI-domain (Vorup-Jensen et al., 2005) (Figure 2A). In particular, adding either glutamate or PTN to the Mg2+-bound active αMI-domain led to intensity decreases in some signals and the appearance of new signals, consistent with slow time scale exchange between ligand -free and Figure 2. Ligand-induced changes in the 15N-HSQC spectrum of active αMI-domain. (A) 15N- HSQC of the active α MI-domain in the presence of different ligands. The changes in the spectrum of active α M-I domain produced by wild-type PTN or PTN domains are similar to those produced by glutamate, including the appearance of the residues around MIDAS (G143, S144, G207, K245). The signal intensities of the MIDAS residues induced by PTN-NTD were much weaker than those induced by PTN -CTD at the same concentration. Ribbon representation of active αMI-domain with labeled MIDAS residues are shown on the top right. B) 15N-HSQC signal of residue G228 in Mg 2+ - saturated active α MI-domain with different concentrations of PTN. The signal underwent slow time scale exchanges when titrated with PTN. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 9 ligand-bound forms of αMI-domain. Figure 2B shows the signal of residue G228 of αMI-domain undergoing slow exchange when titrated with PTN. Three of the new signals that appeared in the presence of ligands were assigned to residues G143, S144, and I145, all are residues in one of the MIDAS segments that directly chelate the metal. The similarity in ligand-induced spectral perturbations shows that glutamate and PTN interacted with the MIDAS similarly. This finding supports the idea that PTN binds active α MI-domain through metal-mediated interactions. Some MIDAS residues also exhibit PTN-domain-specific chemical shifts. In particular, wild-type PTN binding produced two signals from residue S144. However, only one of the signals was seen when PTN-CTD was the ligand whereas PTN-NTD only produced the other signal (Figure S5). We interpret this as an indication that chelation of the metal by different domains resulted in differences in the chemical shifts of the S144 signal. The fact that both signals are present when wild-type PTN is the ligand indicates both PTN-NTD and PTN -CTD can chelate the metal. However, PTN-CTD produced higher intensity signals that are consistent with stable chelation of the MIDAS metal. In contrast, the intensities of these signals were much weaker when PTN-NTD was mixed with active α MI-domain (Figure 2A). This indicates PTN-CTD may have higher affinity for active α MI-domain than PTN-NTD. It should also be noted that PTN did not induce these changes in the absence of Mg2+ (Figure S6), supporting the idea that the observed active αMI-domain spectral changes induced by PTN are metal-dependent. Using intensity increases in the ligand-bound species as a measure of the binding allowed us to obtain the Kd of interaction f by fitting the intensity changes to a one-to-one binding model. We also carried out principle component analysis on the spectral data using the software TRENDNMR (Xu and Van Doren, 2016) and used the magnitude of principle component 1 as a measure of the binding to estimate the Kd of interaction. Figure 3A and Table S1 show Kd s obtained by these analyses. The Kd for glutamate was ~ 5.5 mM, whereas the K d of interaction for PTN wa s ~ 0.1 mM , significantly lower than that of the metal- independent interaction (~ 1 mM) (Feng et al., 2021). To determine which domain of PTN is responsible for the metal-dependent interaction, we titrated active αMI-domain with PTN-CTD and PTN-NTD. The Kd for PTN-CTD binding was ~ 0.1 mM. The Kd for PTN-NTD binding could not be estimated accurately .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 10 because of the low intensities of the new ligand-induced signals, but it is at least 9 times greater than the Kd for PTN and PTN-CTD. These results support the conclusion that PTN-CTD contributed more to binding active αMI-domain through metal-chelation. Another observation supporting PTN-CTD as the dominant metal binding domain is that Co2+- bound active α MI-domain induce d pseudocontact shifts ( PCS) mostly in residues from PTN -CTD. The MIDAS of αMI-domain can chelate paramagnetic Co2+ and Co2+ bound αMI-domain retains its ligand affinity (Michishita et al., 1993). The dipole-dipole interaction between the paramagnetic Co2+ ion and nearby atoms can induce a change in the chemical shifts of these atoms, commonly referred to as PCS (Nitsche and Otting, 2017). In protein-ligand interactions, the binding of the ligand to a paramagneti metal -containing protein can induce PCS in the ligand, if the interaction is sufficiently rigid. To investigate whether these transferred Figure 3 : PTN -CTD is the binding site for active α MI-domain. A) Active αMI-domain’s Kd of binding for wild-type PTN (blue), PTN-CTD (red), PTN-NTD (magenta), and glutamate (green). Kds were calculated by either fitting the ligand induced signal intensity increases in six residues with high signal -to-noise or using global spectral changes estimated with TrendNMR. Error bars reflect S.D. in data fitting. B) The ribbon representation of active αMI-domain with residues used to calculate the Kd shown in the stick form. C) 15N-HSQC of PTN in the presence of Co2+ (black) and Co2+/active αMI-domain (red). D) The ribbon representation of PTN with residues exhibiting PCS shown in red. All except two residues exhibiting a PCS peak were located in PTN-CTD. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 11 PCS can be observed in PTN, we collect ed the spectrum of 15N-labeled PTN in the presence and absence of Co2+-bound active αMI-domain. The results showed that the presence of Co2+-bound active αMI-domain induced an additional signal from some PTN residues (Figure 3C). The chemical shift differences between the new and original signals we re consistent with diagonal shifts expected of small PCS. Most residues exhibiting a PCS peak were in PTN-CTD (Figure 3D). To confirm these signals resulted from PTN-CTD’s binding to Co2+-bound active αMI-domain, we also collected similar data of PTN -CTD with Mg2+-bound active αMI-domain and Co2+-bound inactive αMI-domain. The absence of either Co2+ or active αMI-domain produced no PCS in PTN-CTD (Figure S7). These results support the conclusion that PTN-CTD maintains more stable interactions with active αMI-domain. It should be noted that the intensities of these PCS signals are only about 11 % of the non- PCS signals, and higher concentrations of α MI-domain or Co2+ did not increase the relative intensities of the PCS signals (data not shown). This implies that PTN-CTD may bind to active αMI-domain in multiple ways and only some binding modes can induce PCS. To identify which residue in PTN-CTD chelates the divalent cation in MIDAS , we collected the F1- 13C-edited/F3-13C,15N-filtered HSQCNOESY spectrum of 13C-labeled active αMI-domain and unlabeled PTN-CTD. However, no intermolecular NOE w as observed (Figure S 8). This indicates no significant contact exists between the side chains of these proteins. We then collected 1H-1H and 1H-13C projections of the 13C-HSQC-NOESY-15N-HMQC spectrum of a sample containing 1 mM 13C-labeled PTN and 0.25 mM 2H, 15N-labeled active αMI-domain. Our data showed that several MIDAS residues from active αMI-domain, including G143, S144, I145, and R208, have intermolecular contacts with a glutamate side chain and the side chain methyl group of A 93 in PTN-CTD (Figure 4). Due to chemical shift degeneracy in glutamate side chain atoms, we could not identify the exact glutamate. However, the closest glutamate to A93 is E98. Therefore, we hypothesized that E98 was likely the chelator of the metal ion in MIDAS. We also collected 4D 13C-HSQC-NOESY-15N-HMQC spectrum of 2H, 15N-labeled PTN-CTD in the presence of 13C-labeled active αMI-domain. However, no intermolecular contacts were detected. These results indicate that while backbone amide hydrogens of active αMI-domain were at the binding interface, none of the backbone amide hydrogens in PTN-CTD were at the interface. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 12 To confirm that E98 is involved in metal chelation , we prepared several mutants of PTN -CTD. There are three acidic clusters in PTN-CTD, including E76/D78, E66/E98, and a string of four acidic amino acids in the unstructured C -terminal tail (E120/E127/E132/D136) ( Figure 5B ). We created PTN -CTD mutants missing one of the three clusters. We also mutated H95, which is in the 90s loop (residues R92 to K101 in PTN) and can potentially chelate metal ions. To monitor the binding, we titrated active αMI-domain with different PTN-CTD mutants and estimated the Kd using signal intensity increases experienced by the ligand-bound species. The results show that the mutation of E98 reduced the affinity most significantly (Figure 5A and Table S2). In particular, the removal of E76/D78 and the C-terminal tail (PTN-CTD Δtail) had only a marginal effect on PTN-CTD affinity whereas the mutation of E98 alone led to more than 5 fold decrease in affinity. Although the H95S mutation did not change the affinity drastically, both H95S and E98Q mutations produced large changes in chemical shift perturbation patterns in active αMI-domain when compared to wild- type PTN-CTD (Figure 5B and Table S3). This indicates that E98 and H95 are in the Figure 4. Contacts between backbone amide hydrogen of 2H, 15N-labeled active αMI-domain and 13C-labeled PTN -CTD seen in 1H-1H and 1H-13C projections of 4D 13C-HSQC-NOESY-15N- HMQC. The assignments of PTN -CTD atoms are labeled in red and the assignments of α MI- domain atoms are labeled in green. Ribbon representations of active αMI-domain and PTN-CTD with residues involved in the intermolecular contacts labeled are shown on the right. Due to degenerate chemical shifts, the glutamate cannot be assigned unambiguously. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 13 binding interface. It is worth noting that the mutation of E98 alone was not sufficient to eliminate the binding. The mutation of other acidic clusters also produced small decreases in affinity, indicating that other acidic amino acids also act as the chelator. In addition to observing the effects of PTN-CTD mutations on the 15N-edited HSQC spectrum of active αMI-domain, we also examined the effect of H95 and E98 mutations on the PCS induced in PTN- CTD by Co2+-bound active αMI-domain. Figure 6A shows the impact of the mutations on the PCS signals of PTN-CTD residues with the strongest PCS peaks. The data revealed that the E98Q and H95S mutations Figure 5. The effect of PTN mutations on its interactions with active αMI-domain. (A) The Kd of the interaction between active αMI-domain and PTN-CTD mutants. The Kds were obtained by fitting the ligand induced intensity changes of either signals with high signal-to-noise ratio or by fitting the global spectral changes estimated using TRENDNMR. K d for wild -type PTN -CTD is shown in blue, E76Q /D78N is shown in cyan, PTN -CTD Δ tail is shown in lime, H95S is shown purple, E98Q is shown in orange, E66Q/E98Q is shown in yellow. Error bars reflect S. D. in data fitting. (B) Differences in active αMI- domain backbone amide chemical shift changes induced by PTN -CTD mutants (ΔΔδ). The values were calculated by subtracting the chemical shift changes induced by the PTN-CTD mutant from the chemical shift changes induced by wild-type PTN-CTD. The ribbon representation of PTN-CTD with the mutated residues in the stick representation is shown on the right. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 14 diminished the PCS signal intensities of these residues by more than 75 % . The effect of the mutation of another acidic cluster, E76Q/D78N, on the PCS was far smaller. In particular, the PCS signal of W52 side chain indole Nε-Hε was not changed at all by the E76Q/D78N mutations . These data imply that both E98 and H95 are important to maintaining stable interactions needed to produce PCS signals. One question is how H95 interacts with MIDAS. We hypothesized that H95 in PTN-CTD interacts with the acidic pocket formed by αMI-domain residues D242, E244, and D273 next to the MIDAS (Figure 6B), thereby stabilizing the interactions between E98 and active αMI-domain. S imilar stabilizing interactions between ligands and MIDAS of α I -domains were seen in the interactions of leukocidin GH and GP1bα with α MI-domain as well as in the binding of ICAM-1 to αLI-domain (Shimaoka et al., 2003; Figure 6. The role of H95 in binding active α MI-domain. A) Effect of PTN -CTD mutations on PCS induced by Co2+-bound active αMI-domain. The mutation of E98Q, E66Q/E98Q and H95S drastically reduced the PCS of PTN-CTD residues. PCS signals of residues are indicated by red arrows. B) Ribbon (left) and surface (right) representations of active αMI-domain. The Mg2+ ion in MIDAS is represented by the green sphere. Side chains of amino acids in the acidic patch are shown and labeled. Surface is colored based on the electrostatic surface potential range of -10 kBT/e (red) to 10 k BT/e (blue). Two representations are shown in the same orientation. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 15 Morgan et al., 2019; Trstenjak et al., 2020). To confirm this, we prepared H95K and H95R mutants of PTN- CTD. Replacing H95 with another basic amino acid would preserve the electrostatic interaction with the acidic pocket near MIDAS and the PCS resulting from this more stable interaction would be retained. Figure 6A shows the 15N-HSQC spectra of H95K and H95R mutants of PTN-CTD in the presence of Co2+-bound active αMI-domain. The data demonstrate that, unlike the H95S mutation, substituting H95 with a basic amino acid preserves the PCS. Modeling of the complexes formed by αMI-domain and PTN domains. To model both Mg2+-dependent and Mg2+-independent interactions between PTN and αMI-domain, we docked PTN domain structures onto the structure of either active or inactive αMI-domain. We first confirmed that the structure of αMI-domain was not changed significantly by PTN domains. To do this, we assessed the conformation of the PTN domain- bound αMI-domain using the PCS induced in αMI-domain by Co2+. Our data show that the PCS of ligand- bound forms of both inactive and active α MI-domain fit the crystal structures of free αMI-domain well. In particular, the 81 PCS measured for the PTN -NTD bound inactive αMI-domain fitted the crystal structure of inactive αMI-domain (PDB ID 1JLM) with a Q factor of 0.055, and the ~ 30 PCS measured for the PTN- CTD bound active αMI-domain fitted the crystal structure of active αMI-domain (PDB ID 1IDO) with a Q factor of 0.071 (Figure S9). These data indicate that the crystal structures of both inactive and active αMI- domain were a good starting point for modeling. For inactive αMI-domain, we also obtained the Cα chemical shifts in the presence and absence of PTN-NTD. These chemical shifts are excellent predictors of secondary structures of the protein (Wishart et al., 1991, 1992; Wishart and Sykes, 1994). Analysis of the Cα chemical shifts showed the secondary structure of the protein has not changed (Figure S10). We also collected the backbone amide 1H-15N residual dipolar couplings (RDC) of αMI-domain aligned in neutral polyacrylamide gel, both in the presence and absence of PTN-NTD. Although PTN-NTD appears to change the alignment of αMI-domain, both sets of RDCs fit the crystal structure of inactive α MI-domain (PDB code 1JLM) well (Conilescu Q factor of 0.25 and 0.28 , respectively) (Figure S11). Because each PTN domain is small and .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 16 stabilized by multiple disulfide bonds, we do not expect interactions with α MI-domain to change their structures. To construct the model, we docked PTN -NTD onto inactive αMI-domain using the program HADDOCK (Dominguez et al., 2003). The intermolecular NOEs were included as non-ambiguous distance constraints (Table S4). Loop residues identified as being in the interface (residues 260 to 266, 289 to 293 in αMI-domain, and residues 25 to 27, 32 to 34, and 46 to 52 in PTN-NTD) were designated as flexible in the docking. The crystal structure of inactive α MI-domain (PDB 1JLM) and the NMR structure of PTN - NTD (PDB 2N6F) were used as the starting structures. C lustering analysis of the 200 resulting models showed all models belonged to the same cluster. This indicate s the NOE information is sufficient to determine the structure unambiguously. After superimposing the inactive αMI-domain, the backbone RMSD of the structured region of PTN-NTD (residues 16 to 56) among the top 10 structures with the lowest overall HADDOCK scores was 1.9 Å. The docked structure shows the non-basic face of PTN-NTD and the loop formed by residues 26 to 34 contact the α5 -β5 and α6 -β6 loop in α MI-domain (Figure 7) . Besides hydrophobic contacts between L32 in PTN -NTD and I265 in α MI-domain as well as between PTN ’s threonine methyls and P291 of α MI-domain, there were also several polar and electrostatic interaction s in the interface, including between R261 in αMI-domain and D29 in PTN-NTD, R293 in αMI-domain and E36 in PTN-NTD (Figure 7). We also docked PTN -CTD onto active α MI-domain using HADDOCK. A distance constraint between the MIDAS metal ion and the side chain of E98 was added based on crystal structures of active αMI-domain with other ligands (Bajic et al., 2013; Jensen et al., 2016; Trstenjak et al., 2020). In addition, we also added distance constraints extracted from the NOESY data (Table S5). In particular, distance constraints between residues A93 in PTN -CTD and residues S144 and R208 in active α MI-domain were used as well as constraints between E98 in PTN-CTD and residues G143, S144, I145, and R208 in active αMI-domain. HADDOCK clustered the 200 resulting structures into three clusters. Approximately 150 .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 17 structures belonged to cluster 1. As expected, the main interaction is mediated by the 90s loop of PTN-CTD and MIDAS of αMI-domain. However, significant heterogeneity exists in the orientation PTN-CTD adopts relative to αMI-domain (Figure 8). As a result, the backbone RMSD for the structured portion of PTN-CTD (residues 66 to 109) after superimposing αMI-domain is 3.9 Å. Even though no distance constraints were specified between H95 of PTN-CTD and any residue in active αMI-domain, H95 was hydrogen bonded to the acidic amino acids in the acidic pocket formed by D242, E244, and D273 in active αMI-domain in some of the structures. To investigate the stability and validity of the models, we carried out a 500-ns MD simulation of the complexes in explicit solvents using the software AMBER (Case et al., 2005 ). Figure 9A shows the RMSF of PTN-NTD backbone relative to the starting structure after superimposing the inactive αMI-domain backbone. Although a small shift in the position of the PTN -NTD at the beginning of the simulation was seen, PTN-NTD remained in stable contact with αMI-domain during the simulation. The RMSF of the PTN- NTD backbone for the last 100 ns of the simulation was only ~ 2 Å (Figure 9A). In addition, the simulation revealed that the C-terminus of inactive αMI-domain can have significant electrostatic interactions with Figure 7. HADDOCK models of inactive αMI-domain bound to PTN-NTD. (A) Top 10 models with lowest HADDOCK scores after superimposing αMI-domain. The backbone RMSD of PTN- NTD is 1.9 Å. Only αMI-domain from model 1 is shown. (B) One of the structures from the best 10 structures with the lowest HADDOCK score showing contacts in the binding interface between the proteins. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 18 basic amino acids in PTN-NTD. In particular, residue E320 in inactive αMI-domain had strong interactions with both K49 and R52 in PTN-NTD, D294 in inactive αMI-domain hydrogen bonded to R52 in PTN-NTD, and the C-terminal carboxyl group of αMI-domain has interactions with K54 in PTN -NTD (Figure 9D, frame 1). The residues in the C -terminus of α MI-domain experienced significant PTN-induced chemical shift changes (Feng et al., 2021) . However, NMR data showed no intermolecular NOEs between these residues and PTN-NTD. Results from the MD simulation indicate that the chemical shift perturbations may be due to dynamic electrostatic interactions between the C-terminus and the basic patch on PTN-NTD. Similar MD simulations of PTN-CTD-bound to active αMI-domain were also carried out. We used a model with H95 in the acidic pocket as our starting structure. Similar to the HADDOCK results, PTN- CTD was considerably more dynamic than PTN-NTD in the simulation (Figure 9A). In particular, although the interaction of E98 with the MIDAS metal remained stable, the main body of PTN-CTD rotated by close to ~35 ° before gaining stability (Figure 9B), causing H95 to to loss contact with the acidic pocket on the Figure 8. HADDOCK models of active α MI-domain bound to PTN-CTD. (A) Top 10 models with the lowest HADDOCK scores in cluster 1. The αMI-domain in the structures were superimposed. The backbone RMSD of PTN -CTD is 3.9 Å while the backbone RMSD of the binding loop (residues 92 to 101) is 2.5 Å. Only αMI-domain from model 1 is shown. (B) One of the structures with H95 close to the acidic pocket formed by D273, D242 and E244. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 19 surface. However, the rotation allowed E66 of PTN-CTD to have electrostatic interactions with R208 in αMI-domain, compensating for the loss of H95’s interaction with αMI-domain (Figure 9C & 9D). Figure 9. MD simulations of the models of PTN-NTD bound to inactive αMI-domain and PTN- CTD bound to active αMI-domain. A) RMSF of PTN-NTD and PTN-CTD structured regions relative to the starting structures after superimposing the αMI-domain. B) Changes in the orientation of PTN-CTD relative to αMI-domain during the simulation. The orientation is estimated by the angle between the vectors formed by the β1 strand in active αMI-domain (residues 133 to 140) and the middle β strand in PTN-CTD (residues 84 to 91). C) Intermolecular hydrogen bonds between H95 in PTN-CTD and Asp/Glu in αMI-domain (black), and E66 in PTN-CTD and Arg/Lys in αMI-domain (red) during the simulation of active αMI- domain bound to PTN-CTD. D) Frames from the simulations. 1. PTN-NTD’s basic face interacting with the C-terminus αMI-domain. 2. PTN-CTD’s H95 interacting with acidic amino acids near MIDAS. 3. PTN-CTD’s E66 interacting with R208 near the MIDAS. The positions of the frames in the simulations are marked with the frame numbers in panel A. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 20

Discussion

In this study, we investigated the interaction of α MI-domain with PTN. Our data indicate that the αMI-domain can have both metal -dependent and metal- independent interactions with PTN. The metal - independent interaction is dominated by the binding of PTN-NTD to the bottom of αMI-domain and has fast time scale dynamics (Feng et al., 2021). This interaction also appears to be independent of the activation state of αMI-domain. The metal-mediated binding is between PTN-CTD and active αMI-domain. Its binding kinetics falls into the slow NMR time scale. We previously reported that PTN-NTD is responsible for binding the inactive α MI-domain in a metal-independent fashion (Feng et al., 2021). In this study, we determined the high-resolution structure of the complex. The data revealed that , besides the α5-β5 loop, the α6- β6 loop of inactive αMI-domain also has extensive interactions with PTN-NTD. In particular, L32 of PTN-NTD contacts residues in the α5-β5 loop of inactive αMI-domain, with I265 being the most prominent residue in these interactions. T hree threonines on one face of NTD also have extensive interactions with residues K290 and P291 in the α6-β6 loop. Finally, the side chain of R52 in PTN -NTD also contact ed I265 from inactive αMI-domain. These contacts enabled us to model the structure of the complex using HADDOCK. Furthermore, MD simulations of the complex provided insight into why PTN per turbed the C -terminus of inactive αMI-domain. In particular, the simulation showed that the basic face of PTN -NTD has extensive electrostatic interactions with the C-terminus of αMI-domain. This explains the PTN-induced chemical shift perturbations previously observed in the C-terminus of inactive αMI-domain (Feng et al., 2021). Besides the metal-independent interaction between inactive αMI-domain and PTN-NTD, our results indicate PTN-CTD can bind active αMI-domain using the canonical metal-chelation mechanism. Although many PTN-CTD acidic amino acids can chelate the divalent cation in the MIDAS , the most stable metal chelator in PTN is residue E98. PTN’s involvement in the metal-mediated binding mechanism is somewhat surprising because PTN’s highly positive net charge makes it an ideal basic ligand, many of whom are known to bind using a metal -free mechanism (Yakubenko et al., 2001). However, the few acidic amino acids in basic ligands may be sufficient to chelate the metal. In addition, even though PTN is highly basic, .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 21 it does not have a significant amount of hydrophobic amino acids surrounding these basic amino acids, another feature required in the basic protein binding motif ( Podolnikova et al., 2015b). Therefore, it may be unable to take advantage of αMI-domain’s binding site for basic/hydrophobic ligands. One interesting finding of the study is that no single acidic amino acid in PTN is essential to binding. This implies that active α MI-domain does not chelate just one acidic amino acid in PTN but can interact with multiple acidic amino acids. Signs of heterogeneous binding modes were also reported for the interaction of denatured fibrinogen with active α MI-domain as well as α XI-domain (Vorup-Jensen et al., 2005). LL-37’s interaction with active αMI-domain also appears to be heterogeneous in SPR analysis (Zhang et al., 2016). The heterogeneity explains why the PCS and non-PCS signals coexist and the intensities of PCS signals are only about 11 % of the normal peak. In particular, this may reflect that PCS signals can only be produced when E98 is the metal chelator and active αMI-domain doesn’t always bind E98. E98’s ability to produce PCS is most likely the result of other interactions stabilizing PTN’s interaction with αMI- domain when E98 is in the MIDAS . One contact that may contribute to this is the interaction between PTN’s H95 and the acidic pocket near MIDAS formed by D242, E244, and D273. The importance of H95 was demonstrated by the fact that its mutation to serine produced significant changes in PTN-CTD induced chemical shift perturbations observed in the 15N-HSQC spectrum of αMI-domain. Mutating H95 to anything other than another basic amino acid also resulted in the loss of all PCS. Chelation of the MIDAS metal by other PTN acidic amino acids besides E98 makes this interaction impossible and can result in dynamic s that average the PCS to zero. However, the small magnitude of PCS observed in PTN indicates that even the interaction mediated by E98 chelation may be dynamic . This agrees with HADDOCK modeling and MD simulation, both of which showed dynamic movements in PTN -CTD’s interaction with active α MI- domain when E98 is the chelator. It is worth noting that conformational dynamics were also observed in the crystal structure of the drug simvastatin bound to active αMI-domain (Jensen et al., 2016). H95 and E98 can also be viewed as forming a zwitterionic ligand. In this regard, the interaction of active αMI-domain with PTN is akin to integrins that bind the zwitterionic RGD motif across two different domains in the α and β subunits. However, in the case of αMI-domain, the binding sites for the positive and .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 22 negative ions are found on the same domain. In addition, α MI-domain is not the only α I-domain with a preference for zwitterionic ligands. A homologous acidic pocket in the human αLI-domain was shown to be crucial to the binding of the zwitterionic motif 34ETPLPK39 in ICAM-1 (Shimaoka et al., 2003). The same phenomenon likely exists in ICAM-1 and αMI-domain binding. In particular, it has been proposed that D229 in D3 of ICAM-1 is most likely the metal chelator (Diamond et al., 1991; Mao et al., 2011). Interestingly, R231 is situated nearby and the side chains of D229 and R231 point in the same direction, enabling R231 to bind the acidic pocket of D242, E244, and D273 on αMI-domain. Such zwitterionic interaction was also observed in leukocidin GH’s interaction with α MI-domain. In particular, R294 and K319 in leukocidin H bind the acidic pocket while E323 of leukocidin H chelates the metal in αMI-domain (Trstenjak et al., 2020). The same phenomenon was also proposed for GP1bα’s interaction with αMI-domain with H220 in GP1bα playing the role of the basic amino acid while E224 chelates the metal (Morgan et al., 2019). In addition, the removal of K39 in ICAM -1, K319 in leukocidin H, and H220 in GP1bα significantly reduced the binding of the respective ligand to α MI-domain (Shimaoka et al., 2003; Morgan et al., 2019; Trstenjak et al., 2020). However, in the case of PTN, removing H95 only eliminated PCS experienced by PTN without changing the binding affinity. This suggests that H95’s interaction with the acidic pocket may not be as strong as in other ligands . Factors such as the accessibility of E98 , and the favorable interaction between residue E66 in PTN and residue R208 in αMI-domain, may also contribute to αMI-domain’s preference for E98. It should be noted that other ligands also utilize residue R208 in their interaction with αMI-domain. In particular, acidic amino acids in both C3d and leukocidin H have contacts with residue R208 in αMI-domain. C3d also has electrostatic interactions with residues E178 and E179 located next to R208 (Bajic et al., 2013; Trstenjak et al., 2020) . The emerging trend from these studies is that the charged residues around αMI- domain’s MIDAS play important roles in mediating interaction with ligands. It should also be noted that the acidic pocket next to the MIDAS may serve as a ligand-binding site independent of the MIDAS. In particular, the acidic pocket can be an ideal binding site for basic proteins and peptides, which are known to have strong affinities for active αMI-domain (Podolnikova et al., 2015b; Lishko et al., 2018) . Although the binding site for most of the basic ligands has not been confirmed , a .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 23 previous study on the interaction between α MI-domain and the archetypal basic α MI-domain ligand, the peptide P2-C from fibrinogen, showed that mutations of residues around MIDAS significantly attenuated the binding of P2-C to αMI-domain (Yakubenko et al., 2001). This strongly supports the proposal that basic ligands can bind to sites around MIDAS. The finding that both PTN domains are involved in αMI-domain binding suggests a mechanism by which PTN may cross-link cells to the extracellular matrix. In particular, because both domains of PTN can bind GAG as well as active αMI-domain, it is plausible that one domain may bind GAG while the other binds αMI-domain. It is also tempting to speculate whether NTD and CTD from the same molecule of PTN can simultaneously bind the MIDAS and N/C-termini sites. However, the short linker between NTD and CTD makes such a scenario sterically challenging. The finding that wild-type PTN’s affinity for active αMI- domain is no higher than that of PTN -CTD also supports the lack of simultaneous binding of αMI-domain by both PTN domains from the same PTN molecule. In addition, PTN’s binding site for active αMI-domain does not overlap with PTN’s GAG-binding site. This explains why a previous study has shown that PTN immobilized on proteoglycans can still support macrophage adhesion (Shen et al., 2017) The electrostatic surface potentials of αLI-domain and αXI-domain are significantly different from that of αMI-domain (Vorup-Jensen and Jensen, 2018). In particular, the αLI-domain has a hydrophobic patch near its MIDAS in addition to the acidic pocket. This patch is absent in both αMI-domain and αXI-domain and may be the reason behind αLI-domain’s monospecificity. In particular, the hydrophobic patch helps to exclude solvent from the MIDAS of αLI-domain, thereby strengthening the electrostatic interaction between the ligand and the divalent cation. This may be the reason behind αLI-domain’s high affinity for domain 1 of ICAM-1 (Shimaoka et al., 2003; San Sebastian et al., 2006). Similar hydrophobic interaction with other ligands may be a prerequisite for achieving strong affinity for α LI-domain. The lack of this hydrophobic patch in αMI-domain and αXI-domain suggests that these domains may be less selective and would bind any charged ligands , albeit at lower affinity . This feature may part ly explain ligand binding promiscuity exhibited by Mac-1. The ligand specificities of αMI-domain and αXI-domain are also not identical. The basis for this difference lie in the absence of the acidic pocket in α XI-domain. The lack of an acidic pocket near .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 24 the MIDAS significantly enhances αXI-domain’s affinity for anionic polymers such as heparin and unfolded proteins compared to αMI-domain or αLI-domain (Vorup-Jensen et al., 2005). These differences may be the key to developing specific inhibitors for each α I-domain. In summary, we have determined the interaction between PTN and αMI-domain. We conclude that PTN can bind αMI-domain using two different mechanisms depending on the activation state of αMI-domain. When αMI-domain is in the inactive state, PTN binds to the bottom side of αMI-domain using PTN-NTD and a metal-independent mechanism. When αMI-domain is in the active state, the interaction is dominated by the canonical metal-chelation mechanism in which PTN’s residue E98 acts as the major chelator of the divalent cation in the MIDAS. In addition, the chelation of the metal by E98 is stabilized by favorable electrostatic interactions between PTN and active α MI-domain residues near the MIDAS. We think these interactions are crucial to determining the ligand specificity of αMI-domain. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 25 KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Origami (DE3) competent E. coli Novagen 70837 BL21 (DE3) competent E. coli NEB C2527H Chemicals, peptides, and recombinant proteins Yeast Extract Millipore Sigma 1138859010 Tryptone VWR Life Science 97063-390 IPTG (Isopropyl ß-D-1-thiogalactopyranoside) Fisher Science BP1755-1 Ampicillin Fisher Science BP1760-5 Kanamycin VWR Life Science 75856-684 Tetracyclin Alfa Aesar B21408.22 15NH4Cl Cambridge Isotope Laboratories NLM-467-PK D2O Cambridge Isotope Laboratories DLM-4-PK 13C-labeled glucose Cambridge Isotope Laboratories CLM-1396-PK Deuterated Celtone base powder Cambridge Isotope Laboratories CGM-1030P- C-0.5 Critical commercial assays Q5® Site-Directed Mutagenesis Kit NEB E0554 QIAGEN Plasmid Mini Kit QIAGEN 12123 Deposited data Chemical shift assignments of Mg2+ species of the Q163C/Q309C αMI-domain and unambiguous distance restraints used in HADDOCK docking of PTN-CTD. BMRB BMRB ID 31139 Chemical shift assignments of inactive αMI-domain and unambiguous distance restraints used in HADDOCK docking of PTN-NTD. BMRB BMRB ID 31138 Coordinates of the top 10 HADDOCK models of the active αMI-domain-PTN-CTD complex. PDB PDB ID 8VOI Coordinates of the top 10 HADDOCK models of the inactive αMI-domain-PTN-NTD complex. PDB PDB ID 8VOH Oligonucleotides Primer PTN-CTD E66Q mutagenesis F: ATTTGGCGCGCAGTGCAAATACC R: TGCTTCTTCCAGTTGCAG This manuscript N/A PTN-CTD E98Q mutagenesis F: GCACAATGCCCAGTGCCAGAAGAC R: AGGGCTCGCTTCAGAC This manuscript N/A PTN-CTD E76Q/D78N mutagenesis F: GTAACCTGAACACAGCCCTGAAG R: ACTGTCCCCAGGCCTGGAAC This manuscript N/A PTN-CTD H95S F: GCGAGCCCTGAGCAATGCCGAAT Q: TTCAGACTTCCAGTTCTGG This manuscript N/A .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 26 PTN-CTD H95K F: GCGAGCCCTGAAAAATGCCGAAT R: TTCAGACTTCCAGTTCTGGTC This manuscript N/A PTN-CTD H95R F: GCGAGCCCTGCGCAATGCCGAAT R: TTCAGACTTCCAGTTCTGGTCTTCAGG This manuscript N/A PTN-CTD clone into pHUE with SacII/HindIII F:GGGCCGCGGTGGAAACTGGAAGAAGCAATTT G R: GGGAAGCTTCTAATCCAGCATCTTCTCCTGTT This manuscript N/A Recombinant DNA pET-15b-PTN Eathen Ryan et al (Ryan et al., 2016) N/A pHUE-PTN-NTD Eathen Ryan et al (Ryan et al., 2016) N/A pHUE-PTN-CTD-Δtail Eathen Ryan et al (Ryan et al., 2016) N/A pHUE CTD mutants (Δ tail, E76Q/D78N, H95S, E98Q, E66Q/E98Q, H95R, H95K) This manuscript N/A pHUE-inactive αMI-domain Wei Feng et al. (Feng et al., 2021) N/A pHUE-active αMI-domain Q163C/Q309C Hoa Nguyen et al (Nguyen et al., 2023) N/A Software and algorithms nmrPipe NIST IBBR Website: https://www.ib br.umd.edu/nm rpipe/ NMRViewJ NMRFX Website: https://nmrfx.o rg/nmrfx/nmrvi ewj VMD University of Illinois at Urbana-Chamipaign Website: https://www.ks .uiuc.edu/Rese arch/vmd/ ChimeraX University of California San Francisco Website: https://www.cg l.ucsf.edu/chim erax/ Paramagpy Henry Orton, Australian National University. https://henryort on.github.io/pa ramagpy/build/ html/index.htm l xcurvfit Brian Sykes, University of Alberta http://www.bio nmr.ualberta.ca /bds/software/x crvfit/latest/ind ex.html .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 27 GraphPad Prism 9 Prism https://www.gr aphpad.com/fe atures HADDOCK2.4 Utrecht University https://wenmr.s cience.uu.nl/ AMBER22 UCSF ambermd.org Other HiTrap SP HP Cytiva 17115401 HisTrap HP Cytiva 17524802 HiLoad® 16/600 Superdex® 75 pg Cytiva GE28-9893-33 ÄKTA Pure system Cytiva 29018224 Amicon® Ultra-15 Millipore Sigma UFC901024 Amicon® Ultra-4 Millipore Sigma UFC801024 AVANCE 600 MHz Bruker N/A Avance II 850 MHz Bruker N/A Inova 800 MHz Agilent N/A

Method

DETAILS Expression and Purification of α MI-domains. The expression and purification of α MI-domain were accomplished using the previously reported procedures ( Feng et al., 2021; Nguyen et al., 2023) . Briefly, the open reading frame (ORF) of the wild-type human αMI-domain (E131-T324) was cloned into the pHUE vector (Catanzariti et al., 2004) using SacII and HindIII as restriction sites. The activating Q163C/Q309C cysteine mutations were introduced into α MI-domain using the Q5 Site -Directed Mutagenesis Kit (NEB). The plasmids were transformed into either BL21(DE3) (NEB) or OrigamiB(DE3) (Novagen) and the cells were grown in M9 media at 37 °C until the culture reached an OD600 of ~ 0.8-1. The protein expression was induced with 0.5 mM IPTG, and the cell pellet was harvested after overnight incubation at 22oC. The pellet was resuspended and incubated on ice in the lysis buffer (20 mM sodium phosphate, 0.5 M NaCl, 10 mM imidazole, 5% glycerol) containing 1 mg/ml lysozyme for 20 min on ice. After sonication and centrifugation, the supernatant was loaded onto a 5-mL HisTrap column (Cytiva), and the protein was eluted from the column by running a 0.01 to 0.5 M imidazole gradient. To separate His-ubiquitin from αMI-domain, the protein was digested with enzyme USP2 (1:50 molar ratio) overnight at room temperature in 20 mM Tris, 0.1 M NaCl (Catanzariti et al., 2004). The digestion mixture was subjected to Ni2+ column purification again. αMI-domain in the flow -through was further purified with a 120- mL Superdex 75 column using a .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 28 buffer containing 20 mM HEPES, 0.3 M NaCl, pH 7.0. Finally, the protein was exchanged in to 20 mM HEPES, 0.1 M NaCl, pH 7.0 for NMR analyses. To prepare isotope labeled protein, 15N, 13C or 2H labeling was accomplished by adding 15NH4Cl, 13C glucose, D2O, and deuterated Celtone base powder (Cambridge Isotope). The 2H, 15N-labeled αMI-domain was prepared by seeding freshly transformed colony in 20 mL of LB until the OD600 reached 1.0. Cells from 5 mL of the LB culture were gently pelleted, used to inoculate 50 mL of 2H, 15N minimal media, and grew overnight at 37 °C. The 50- mL culture was then used to seed 0.45 L of media the next day and grown as described before. The protein was expressed and harvested with the same procedure mentioned above. Expression and Purification of PTN . PTN and its domains were produced following previously reported protocols (Feng et al., 2021). Briefly, the mature PTN open reading frame was cloned into a pET-15b vector using NcoI and Xho I restriction sites and transformed into OrigamiB(DE3) cells. The transformed cells were grown under conditions similar to the Q163C/Q309C mutant of the αMI-domain. To extract the protein, cell pellets were resuspended in 20 mM Tris, 0.2 M NaCl, pH 8.0, 1 mg/mL of lysozyme and incubated for 20 minutes at room temperature. After sonication and centrifugation to remove insoluble material, the protein is extrac ted from the supernatant using a 5- mL HiTrap SP HP column (Cytiva) and eluted with a 0.1-1.5 M NaCl gradient. To produce PTN domains, a pHUE vector(Catanzariti et al., 2004) containing PTN ORF coding either residues G1 to C5 7 (PTN-NTD), residues N58 to K114 ( PTN-CTD Δtail), or residues N58 to D136 (PTN-CTD) at the 3 ’ end of the ubiquitin ORF was transformed into OrigamiB(DE3) cells. Cells were grown in M9 media at 37 °C to an OD 600 of 0.8. 0.25 mM IPTG was added to the culture and incubated overnight at 23°C. Purifications of PTN domains and various mutants were similar to that of α MI-domain except no size exclusion chromatography was used. NMR Data Acquisition. NMR data were collected on either Bruker AVANCE 600 MHz equipped with a Prodigy probe, a Bruker Avance II 850 MHz equipped with a cryoprobe, or an Agilent Inova 800 MHz equipped with a cold probe. All data were collected at 25 °C. Backbone assignments of PTN and Q163C/Q309C αMI-domain were carried out previously (Ryan et al., 2016; Nguyen et al., 2023). For PTN .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 29 domain backbone and side chain assignment, CACBCONH, HNCACB, and HCCCONH were collected on 13C, 15N-labeled PTN-NTD and PTN- CTD. The parameter was set with 1024 complex points in 1H dimension, 30 complex points in 15N dimension, 50 complex points in 13C dimension for 3D experiment. 2D 15N-HSQC experiments were acquired with 1024 complex points in 1H dimension and 50 complex points in the 15N dimension with the spectrum widths are 15 ppm for 1H dimension and 35 ppm for 15N dimension with carrier at 4.7 and 119ppm, respectively. Intermolecular NOEs between PTN-NTD and inactive αMI-domain were obtained using F1-13C-edited/F3- 13C,15N-filtered HSQCNOESY experiments. The sample used to collect these data contained 0.2 mM 13C- labeled inactive αMI-domain and 1 mM unlabeled PTN -NTD. To confirm the assignments of PTN -NTD atoms at the interface, we acquired F1 -13C,15N-filtered /F3 -13C-edited NOESYHSQC data on samples containing 0.2 mM unlabeled inactive α MI-domain and 0.5 m M 13C, 15N-labeled PTN -NTD. To obtain intermolecular NOE between PTN -CTD and active α MI-domain, we collected 2D projections of the 13C HSQC - NOESY-15N HMQC experiment on a sample containing 0.25 m M of 2H,15N-labeled Q163C/Q309C αMI-domain and 1 mM 13C PTN-CTD in 20 mM HEPES, 0.1 M NaCl, pH 7.0. The NOE mixing time is 0.2s. Each titration of active α MI-domain with PTN mutants w as performed with a series of six samples. All samples in the series contained ~ 90 µM of 15N-labeled active αMI-domain. The PTN ligand concentrations in the samples are 0, 0.3 0.6, 0.9, 1.2 and 1.5 mM. 15N-HSQC of each sample was acquired with the parameters described above. To measure the α MI-domain-induced chemical shift changes on PTN -NTD, 15N HSQC spectra were acquired on a sample containing 0.1 mM of 15N-labeled PTN-NTD and 0.8 mM of unlabeled inactive αMI- domain or Q163C/Q309C α MI-domain. The sample buffer is 20 mM HEPES, 0.1 M NaCl, pH 7.0. The chemical shift change of each signal was quantified using the equation δ=[ΔδH2 + (0.17 ΔδN)2]1/2, where ΔδH is the chemical shift change of amide hydrogen and ΔδN is the chemical shift change of amide nitrogen. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 30 To confirm that PTN does not induce significant changes in the structure of inactive αMI-domain, an aligned sample of 0.1 mM 15N αMI-domain in a 6% neutral polyacrylamide gel (Cierpicki and Bushweller, 2004) was used to obtain HN residual dipolar coupling (RDC). The RDC of αMI-domain were measured in the presence and absence of 0.8 mM unlabeled PTN-NTD. To measure the pseudocontact shift (PCS) of αMI-domain in the presence and absence of PTN -NTD and PTN-CTD, we collected 15N-HSQC, HNCACB and CBCACONH spectra of Co2+-saturated inactive αMI- domain in the presence of unlabeled PTN-NTD and of Co2+-saturated active αMI-domain in the presence of unlabeled PTN-CTD. The NMR samples used to collect these data contained 0.2 mM 13C, 15N αMI-domain, 1 mM unlabeled PTN-CTD or PTN-NTD, 2 mM of either CoCl2 or MgCl2, 20 mM HEPES, 0.1 M NaCl, pH 7.0. The amide hydrogen and nitrogen chemical shift assignments of α MI-domain residues in the presence of Co2+ were obtained by comparing H, N, CA, CB chemical shifts of each spin system with the corresponding chemical shifts from residues in the Mg2+ sample. A match is made if the four chemical shifts from a spin system in the Co 2+ data match the four chemical shifts from an assigned residue in the Mg2+ sample while taking into consideration the PCS on each atom as a result of the Co 2+. PCS tensors were calculated using the software Paramagpy (Orton et al., 2020) using only the PCS measured from amide hydrogens and PDB structures 1JLM (inactive αMI-domain) or 1IDO (active αMI-domain). Modeling of PTN-αMI-domain complexes. The model between αMI-domain and PTN domains was generated using HADDOCK (Dominguez et al., 2003). Unambiguous contacts between αMI-domain and PTN-NTD’s residues obtained from F1- 13C-edited/F3-13C,15N-filtered HSQCNOESY spectra were used as constraints for the model (Table S4). For the complex between active α MI-domain and PTN-CTD, contacts observed in the 4D 13C-HSQC-NOESY-15N-HMQC spectrum were used as constraints (Table S5) . The crystal structure of inactive αMI-domain (PDB accession number 1JLM) and the solution structure of PTN -NTD (PDB accession number 2N6F) were used as the starting structures to model the Mg 2+-independent interactions between α MI-domain and PTN -NTD. The crystal structure of the active αMI-domain (PDB accession number 1IDO) w as used as the starting α MI-domain structure to model the Mg 2+-dependent .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 31 interaction. During docking, we allowed the protein segments containing residues involved in binding to be fully flexible. For the modeling of Mg 2+-independent interaction, these residues include D260 to R266 and I287 to V296 from αMI-domain, as well as P25 to S27, L32 to R34, and Q46 to R52 from PTN-NTD. For the modeling of Mg2+-dependent interaction, flexible residues include G141 to I145 and L206 to R208 in αMI-domain, and A93 to E98 in PTN -CTD. The docking followed the default protocol with an explicit solvent refinement for the last cycle. The best models were chosen based on HADDOCK energy scores and agreement with the constraints. Molecular dynamics (MD) simulations of the models were carried out using the top-scoring model from each docking study as the starting structure. For each simulation, the starting structure was first energy minimized. This was followed by a gradual heating to 300 K and then equilibration at 300 K with a 50 ps simulation. The production run was conducted with constant pressure and simulated with 1 fs step for 500 ns. Resource Availability Lead contact: Further information and requests for resources and reagents should be directed to and will be fulfilled by Xu Wang ([email protected]).

Materials

availability: All unique reagents generated in this study are available from the lead contact without restriction. Data availability: HADDOCK models of the inactive αMI-domain-PTN-NTD complex have been deposited as PDB entry 8VOH. HADDOCK models of the active α MI-domain-PTN-CTD complex have been deposited as 8VOI. Restraints and chemical shifts used in the modeling have been deposited as BMRB entry 31138 for the inactive α MI-domain-PTN-NTD complex and as BRMB entry 31139 for the active αMI- domain-PTN-CTD complex.

Acknowledgements

.CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 32 We thank the staff of the Magnetic Resonance Research Center at Arizona State University for the maintenance of the NMR instrument s. The study was funded by NIH grants R01 GM118518 (to X.W.) and R01HL063199 (to T.U.). Author Contribution X.W. and T. U. conceived the project. X. W. and H. N. designed and conducted the experiments. X. W., H.N., N. P., and T. U. wrote the paper. Declaration of interests The authors have no competing interests. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 33

Reference

Altieri, D.C., Agbanyo, F.R., Plescia, J., Ginsberg, M.H., Edgington, T.S., and Plow, E.F. (1990). A unique recognition site mediates the interaction of fibrinogen with the leukocyte integrin Mac-1 (CD11b/CD18). The Journal of biological chemistry 265, 12119-12122. Bajic, G., Yatime, L., Sim, R.B., Vorup-Jensen, T., and Andersen, G.R. (2013). Structural insight on the recognition of surface-bound opsonins by the integrin I domain of complement receptor 3. Proceedings of the National Academy of Sciences of the United States of America 110, 16426-16431. Cai, T.Q., and Wright, S.D. (1996). Human leukocyte elastase is an endogenous ligand for the integrin CRR3 (CD11b/CD18, Mac-1, αMβ2 ) and modulates polymorphonuclear leukocyte adhesion. Journal of Experimental Medicine 184, 1213-1223. Case, D.A., Cheatham, T.E., 3rd, Darden, T., Gohlke, H., Luo, R., Merz, K.M., Jr., Onufriev, A., Simmerling, C., Wang, B., and Woods, R.J. (2005). The Amber biomolecular simulation programs. Journal of computational chemistry 26, 1668-1688. Catanzariti, A.M., Soboleva, T.A., Jans, D.A., Board, P.G., and Baker, R.T. (2004). An efficient system for high-level expression and easy purification of authentic recombinant proteins. Protein Science 13, 1331- 1339. Cierpicki, T., and Bushweller, J.H. (2004). Charged gels as orienting media for measurement of residual dipolar couplings in soluble and integral membrane proteins. Journal of the American Chemical Society 126, 16259-16266. Coxon, A., Rieu, P., Barkalow, F.J., Askari, S., Sharpe, A.H., Von Andrian, U.H., Arnaout, M.A., and Mayadas, T.N. (1996). A novel role for the beta 2 integrin CD11b/CD18 in neutrophil apoptosis: a homeostatic mechanism in inflammation. Immunity 5, 653-666. Davis, G.E. (1992). The Mac-1 and p150,95 beta 2 integrins bind denatured proteins to mediate leukocyte cell-substrate adhesion. Experimental Cell Research 200, 242-252. Diamond, M.S., Staunton, D.E., de Fougerolles, A.R., Stacker, S.A., Garcia-Aguilar, J., Hibbs, M.L., and Springer, T.A. (1990). ICAM-1 (CD54)-a counter-receptor for MAC-1 (CD11b/CD18). Journal of Cell Biology 111, 3129-3139. Diamond, M.S., Staunton, D.E., Marlin, S.D., and Springer, T.A. (1991). Binding of the integrin Mac-1 (CD11b/CD18) to the third immunoglobulin-like domain of ICAM-1 (CD54) and its regulation by glycosylation. Cell 65, 961-971. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 34 Ding, Z.M., Babensee, J.E., Simon, S.I., Lu, H.F., Perrard, J.L., Bullard, D.C., Dai, X.Y., Bromley, S.K., Dustin, M.L., Entman, M.L., et al. (1999). Relative contribution of LFA-1 and Mac-1 to neutrophil adhesion and migration. Journal of Immunology 163, 5029-5038. Dominguez, C., Boelens, R., and Bonvin, A.M. (2003). HADDOCK: a protein-protein docking approach based on biochemical or biophysical information. Journal of the American Chemical Society 125, 1731- 1737. Feng, W., Nguyen, H., Shen, D., Deng, H., Jiang, Z., Podolnikova, N., Ugarova, T., and Wang, X. (2021). Structural Characterization of the Interaction between the alphaMI-Domain of the Integrin Mac-1 (alphaMbeta2) and the Cytokine Pleiotrophin. Biochemistry 60, 182-193. Fernandez-Calle, R., Vicente-Rodriguez, M., Gramage, E., Pita, J., Perez-Garcia, C., Ferrer-Alcon, M., Uribarri, M., Ramos, M.P., and Herradon, G. (2017). Pleiotrophin regulates microglia-mediated neuroinflammation. Journal of neuroinflammation 14, 46. Fernandez, F.J., Santos-Lopez, J., Martinez-Barricarte, R., Querol-Garcia, J., Martin-Merinero, H., Navas- Yuste, S., Savko, M., Shepard, W.E., Rodriguez de Cordoba, S., and Vega, M.C. (2022). The crystal structure of iC3b-CR3 alphaI reveals a modular recognition of the main opsonin iC3b by the CR3 integrin receptor. Nature communications 13, 1955. Goldsmith, J.A., DiVenere, A.M., Maynard, J.A., and McLellan, J.S. (2022). Structural basis for non- canonical integrin engagement by Bordetella adenylate cyclase toxin. Cell reports 40, 111196. Jensen, M.R., Bajic, G., Zhang, X., Laustsen, A.K., Koldsø, H., Skeby, K.K., Schiøtt, B., Andersen, G.R., and Vorup-Jensen, T. (2016). Structural Basis for Simvastatin Competitive Antagonism of Complement Receptor 3*. Journal of Biological Chemistry 291, 16963-16976. Johansson, M.W., Patarroyo, M., Oberg, F., Siegbahn, a., and Nilsson, K. (1997). Myeloperoxidase mediates cell adhesion via the αMβ2 integrin (Mac-1, CD11b/CD18). Journal of Cell Science 110, 1133- 1139. Lamers, C., Pluss, C.J., and Ricklin, D. (2021). The Promiscuous Profile of Complement Receptor 3 in Ligand Binding, Immune Modulation, and Pathophysiology. Frontiers in immunology 12, 662164. Lee, J.O., Bankston, L.A., Arnaout, M.A., and Liddington, R.C. (1995). Two conformations of the integrin A-domain (I-domain): a pathway for activation? Structure 3, 1333-1340. Linnerbauer, M., Losslein, L., Farrenkopf, D., Vandrey, O., Tsaktanis, T., Naumann, U., and Rothhammer, V. (2021). Astrocyte-Derived Pleiotrophin Mitigates Late-Stage Autoimmune CNS Inflammation. Frontiers in immunology 12, 800128. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 35 Lishko, V.K., Moreno, B., Podolnikova, N.P., and Ugarova, T.P. (2016). Identification of Human Cathelicidin Peptide LL-37 as a Ligand for Macrophage Integrin alphaMbeta2 (Mac-1, CD11b/CD18) that Promotes Phagocytosis by Opsonizing Bacteria. The Journal of biological chemistry 2016, 39-55. Lishko, V.K., Novokhatny, V., Yakubenko, V.P., Skomorovska-Prokvolit, H., and Ugarova, T.P. (2004). Characterization of plasminogen as an adhesive ligand for integrins αMβ2 (Mac-1) and α5β1 (VLA-5). Blood 104, 719-726. Lishko, V.K., Yakubenko, V.P., Ugarova, T.P., and Podolnikova, N.P. (2018). Leukocyte integrin Mac-1 (CD11b/CD18, alphaMbeta2, CR3) acts as a functional receptor for platelet factor 4. The Journal of biological chemistry 293, 6869-6882. Lu, C.F., and Springer, T.A. (1997). The α subunit cytoplasmic domain regulates the assembly and adhesiveness of integrin lymphocyte function-associated antigen-1. Journal of Immunology 159, 268- 278. Mao, D., Lu, S., Li, N., Zhang, Y., and Long, M. (2011). Conformational stability analyses of alpha subunit I domain of LFA-1 and Mac-1. PloS one 6, e24188. Miao, J., Wang, F., Wang, R., Zeng, J., Zheng, C., and Zhuang, G. (2019). Pleiotrophin regulates functional heterogeneity of microglia cells in EAE animal models of multiple sclerosis by activating CCr-7/CD206 molecules and functional cytokines. American journal of translational research 11, 2013-2027. Michishita, M., Videm, V., and Arnaout, M.A. (1993). A novel divalent cation-binding site in the A domain of the beta 2 integrin CR3 (CD11b/CD18) is essential for ligand binding. Cell 72, 857-867. Morgan, J., Saleem, M., Ng, R., Armstrong, C., Wong, S.S., Caulton, S.G., Fickling, A., Williams, H.E.L., Munday, A.D., López, J.A., et al. (2019). Structural basis of the leukocyte integrin Mac-1 I-domain interactions with the platelet glycoprotein Ib. Blood advances 3, 1450-1459. Nguyen, H., Jing, T., and Wang, X. (2023). The Q163C/Q309C mutant of alphaMI-domain is an active variant suitable for NMR characterization. PloS one 18, e0280778. Nitsche, C., and Otting, G. (2017). Pseudocontact shifts in biomolecular NMR using paramagnetic metal tags. Prog Nucl Magn Reson Spectrosc 98-99, 20-49. Orton, H.W., Huber, T., and Otting, G. (2020). Paramagpy: software for fitting magnetic susceptibility tensors using paramagnetic effects measured in NMR spectra. Magn. Reson. 1, 1-12. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 36 Podolnikova, N.P., Brothwell, J.A., and Ugarova, T.P. (2015a). The opioid peptide dynorphin A induces leukocyte responses via integrin Mac-1 (alphaMbeta2, CD11b/CD18). Molecular pain 11, 33. Podolnikova, N.P., Hlavackova, M., Wu, Y., Yakubenko, V.P., Faust, J., Balabiyev, A., Wang, X., and Ugarova, T.P. (2019). Interaction between the integrin Mac-1 and signal regulatory protein alpha (SIRPalpha) mediates fusion in heterologous cells. The Journal of biological chemistry 294, 7833-7849. Podolnikova, N.P., Podolnikov, A.V., Haas, T.A., Lishko, V.K., and Ugarova, T.P. (2015b). Ligand recognition specificity of leukocyte integrin alphaMbeta2 (Mac-1, CD11b/CD18) and its functional consequences. Biochemistry 54, 1408-1420. Prince, J.E., Brayton, C.F., Fosset, M.C., Durand, J.A., Kaplan, S.L., Smith, C.W., and Ballantyne, C.M. (2001). The differential roles of LFA-1 and Mac-1 in host defense against systemic infection with Streptococcus pneumoniae. Journal of Immunology 166, 7362-7369. Rosetti, F., and Mayadas, T.N. (2016). The many faces of Mac-1 in autoimmune disease. Immunological reviews 269, 175-193. Ryan, E., Shen, D., and Wang, X. (2016). Structural studies reveal an important role for the pleiotrophin C-terminus in mediating interactions with chondroitin sulfate. The FEBS journal 283, 1488-1503. San Sebastian, E., Mercero, J.M., Stote, R.H., Dejaegere, A., Cossio, F.P., and Lopez, X. (2006). On the affinity regulation of the metal-ion-dependent adhesion sites in integrins. Journal of the American Chemical Society 128, 3554-3563. Santoso, S., Sachs, U.J., Kroll, H., Linder, M., Ruf, A., Preissner, K.T., and Chavakis, T. (2002). The junctional adhesion molecule 3 (JAM-3) on human platelets is a counterreceptor for the leukocyte integrin Mac-1. J.Exp.Med 196, 679-691. Schober, J.M., Lau, L.F., Ugarova, T.P., and Lam, S.C. (2003). Identification of a Novel Integrin αMβ2 Binding Site in CCN1 (CYR61), a Matricellular Protein Expressed in Healing Wounds and Atherosclerotic Lesions. Journal of Biological Chemistry 278, 25808-25815. Shappell, S.B., Toman, C., Anderson, D.C., Taylor, A.A., Entman, M.L., and Smith, C.W. (1990). Mac-1 (CD11b/CD18) mediates adherence-dependent hydrogen peroxide production by human and canine neutrophils. Journal of Immunology 144, 2702-2711. Shen, D., Podolnikova, N.P., Yakubenko, V.P., Ardell, C.L., Balabiyev, A., Ugarova, T.P., and Wang, X. (2017). Pleiotrophin, a multifunctional cytokine and growth factor, induces leukocyte responses through the integrin Mac-1. The Journal of biological chemistry 292, 18848-18861. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 37 Shimaoka, M., Lu, C., Salas, A., Xiao, T., Takagi, J., and Springer, T.A. (2002). Stabilizing the integrin αM inserted domain in alternative conformations with a range of engineered disulfide bonds. Proceedings of the National Academy of Sciences 99, 16737-16741. Shimaoka, M., Xiao, T., Liu, J.H., Yang, Y., Dong, Y., Jun, C.D., McCormack, A., Zhang, R., Joachimiak, A., Takagi, J., et al. (2003). Structures of the alpha L I domain and its complex with ICAM-1 reveal a shape- shifting pathway for integrin regulation. Cell 112, 99-111. Simon, D.I., Chen, Z.P., Xu, H., Li, C.Q., Dong, J.F., McIntire, L.V., Ballantyne, C.M., Zhang, L., Furman, M.I., Berndt, M.C., et al. (2000). Platelet glycoprotein Ibα is a counterreceptor for the leukocyte integrin Mac-1 (CD11b/CD18). Journal of Experimental Medicine 192, 193-204. Smith, C.W., Marlin, S.D., Rothlein, R., Toman, C., and Anderson, D.C. (1989). Cooperative interactions of LFA-1 and Mac-1 with intercellular adhesion molecule-1 in facilitating adherence and transendothelial migration of human neutrophils in vitro. The Journal of clinical investigation 83, 2008-2017. Trstenjak, N., Milic, D., Graewert, M.A., Rouha, H., Svergun, D., Djinovic-Carugo, K., Nagy, E., and Badarau, A. (2020). Molecular mechanism of leukocidin GH-integrin CD11b/CD18 recognition and species specificity. Proceedings of the National Academy of Sciences of the United States of America 117, 317-327. Ugarova, T.P., Solovjov, D.A., Zhang, L., Loukinov, D.I., Yee, V.C., Medved, L.V., and Plow, E.F. (1998). Identification of a novel recognition sequence for integrin α M β 2 within the gamma-chain of fibrinogen. Journal of Biological Chemistry 273, 22519-22527. Vorup-Jensen, T., Carman, C.V., Shimaoka, M., Schuck, P., Svitel, J., and Springer, T.A. (2005). Exposure of acidic residues as a danger signal for recognition of fibrinogen and other macromolecules by integrin alphaXbeta2. Proceedings of the National Academy of Sciences of the United States of America 102, 1614-1619. Vorup-Jensen, T., and Jensen, R.K. (2018). Structural Immunology of Complement Receptors 3 and 4. Frontiers in immunology 9, 2716. Wang, X. (2020). Pleiotrophin: Activity and mechanism. Advances in clinical chemistry 98, 51-89. Wishart, D.S., and Sykes, B.D. (1994). The 13C chemical-shift index: a simple method for the identification of protein secondary structure using 13C chemical-shift data. Journal of biomolecular NMR 4, 171-180. Wishart, D.S., Sykes, B.D., and Richards, F.M. (1991). Relationship between nuclear magnetic resonance chemical shift and protein secondary structure. Journal of molecular biology 222, 311-333. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint 38 Wishart, D.S., Sykes, B.D., and Richards, F.M. (1992). The chemical shift index: a fast and simple method for the assignment of protein secondary structure through NMR spectroscopy. Biochemistry 31, 1647- 1651. Wolf, D., Hohmann, J.D., Wiedemann, A., Bledzka, K., Blankenbach, H., Marchini, T., Gutte, K., Zeschky, K., Bassler, N., Hoppe, N., et al. (2011). Binding of CD40L to Mac-1's I-domain involves the EQLKKSKTL motif and mediates leukocyte recruitment and atherosclerosis--but does not affect immunity and thrombosis in mice. Circulation research 109, 1269-1279. Xiong, J.P., Li, R., Essafi, M., Stehle, T., and Arnaout, M.A. (2000). An isoleucine-based allosteric switch controls affinity and shape shifting in integrin CD11b A-domain. The Journal of biological chemistry 275, 38762-38767. Xu, J., and Van Doren, S.R. (2016). Binding Isotherms and Time Courses Readily from Magnetic Resonance. Analytical chemistry 88, 8172-8178. Yakubenko, V.P., Solovjov, D.A., Zhang, L., Yee, V.C., Plow, E.F., and Ugarova, T.P. (2001). Identification of the binding site for fibrinogen recognition peptide g 383-395 within the αM I-domain of integrin αMβ2 Journal of Biological Chemistry 275, 13995-14003. Zhang, L., and Plow, E.F. (1996). Overlapping, but not identical, sites are involved in the recognition of C3bi, neutrophil inhibitory factor, and adhesive ligands by the alphaMbeta2 integrin. The Journal of biological chemistry 271, 18211-18216. Zhang, X., Bajic, G., Andersen, G.R., Christiansen, S.H., and Vorup-Jensen, T. (2016). The cationic peptide LL-37 binds Mac-1 (CD11b/CD18) with a low dissociation rate and promotes phagocytosis. Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics 1864, 471-478. .CC-BY-ND 4.0 International licenseavailable under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made The copyright holder for this preprintthis version posted February 2, 2024. ; https://doi.org/10.1101/2024.02.01.578455doi: bioRxiv preprint

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: oa-pdf

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00
unpaywall
last seen: 2026-05-20T11:00:21.680559+00:00
License: CC-BY-ND-4.0