Prevalence of Chlamydia Trachomatis Among Hiv-infected Patients and Pregnant Women in Auchi and Environs

Prevalence of Chlamydia Trachomatis Among Hiv-infected Patients and Pregnant Women in Auchi and Environs | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Prevalence of Chlamydia Trachomatis Among Hiv-infected Patients and Pregnant Women in Auchi and Environs Favour Osazuwa, Osayande Osabuohien This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7633218/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Chlamydia trachomatis is the commonest bacterial sexually transmitted infection, and it is known to increase the risk of acquisition of HIV. Objectives The aim of this study is to determine the prevalence and determinants of Chlamydia trachomatis using polymerase chain reaction among HIV-infected females and pregnant women in Auchi and environs. Methods This cross-sectional descriptive study was carried out between January and July, 2025. One-hundred and nighty subjects (95 HIV-infected women and 95 pregnant women) were included in this study. Endocervical swabs were collected for analysis of C. trachomatis DNA using polymerase chain reaction (PCR). Self-administered questionnaires were used to collect information on participant’s socio-demographics, sexual history and sexual risk behaviours. Results Overall, 25/190 (13.2%) subjects studied were C. trachomatis Positive. C. trachomatis was significantly higher in HIV-infected subjects as compared to Pregnant HIV-Negative women 21.1% vs. 5.3% ((Chi square 10.363, p value = 0.00128). Age of study participants in both study groups did not have effect on distribution pattern of C. trachomatis . HIV-infected subjects with CD 4 + T cells ≤ 200 cells/ul were significantly more infected, with a relative risk of 33% (OR: 0.1889, RR: 0.33, P = 0.031). Other significant risk factors of C. trachomatis infection were early age at first sexual debut, history of STI, employment status and marital status. Conclusions In conclusion, asymptomatic infection with C. trachomatis is highly prevalent among our study subjects in Auchi and environs; routine screening among at risk individuals and education on risk factors is however encouraged. Chlamydia trachomatis HIV Pregnant women PCR Prevalence PLWH Introduction Chlamydia trachomatis ( C. trachomatis ) is an obligate intracellular parasite that replicates within the cytoplasm of host cells [ 1 , 2 ]. C. trachomatis infection is the most common bacterial sexually transmitted disease, which is more common in young people [ 3 , 4 ]. Risk factors of Chlamydia infection includes multiple sexual partners, use of oral contraceptives, and failure to use barrier methods of contraception [ 5 ]. Others include a history of sexually transmitted diseases (STDs), cervical ectopy, low socioeconomic status, HIV sero-positivity, and seroconversion [ 5 ]. Chlamydia trachomatis belongs to the genus Chlamydia [ 6 ]. Chlamydia trachomatis has 15 immunotypes [ 7 ]. Clinical symptoms of C. trachomatis in women include vaginal discharge, dysuria, induced endocervical bleeding, irregular menstruation or intermenstrual bleeding and dyspareunia [ 8 ]. Adverse outcomes associated with C. trachomatis in pregnancy include premature rupture of membranes, postpartum endometrial inflammation, and low birth weight, also chlamydial infection in pregnant women can enhance the risk of preterm labor, and perinatal death [ 9 , 10 ]. C. trachomatis vertical transmission can cause neonatal inclusion conjunctivitis and/or pneumonia [ 11 ]. Chlamydia trachomatis also increases the risk of human immunodeficiency virus (HIV), because Chlamydia triggers an inflammatory response that draws CD 4 + T-cells to the site of the infection [ 12 ]. The dual burden of HIV and Chlamydia trachomatis co-infection presents significant clinical and public health challenges, especially among vulnerable groups such as pregnant women. In semi-urban and rural settings like Auchi, where healthcare infrastructure may be limited, the lack of routine screening and reliable epidemiological data further compounds the problem. Consequently, the actual burden and dynamics of Chlamydia infections among HIV patients and pregnant women remain under-researched and poorly addressed, hindering effective intervention strategies. The aim of this study is to investigate the prevalence of Chlamydia trachomatis among HIV-infected patients and pregnant women in Auchi and environs. Methods Study Design This cross-sectional descriptive study was done among HIV-infected female patients and pregnant women (aged 18 to 70 years) in Auchi and environs. Study participants were recruited from Edo State University Teaching Hospital (EDSUTH) Auchi, Edo State, Nigeria. Structured questionnaires were used to obtain socio-demographic and obstetric information such as educational level, occupation, socio-economic status, gravidity, gestational age, parity status, number of sexual partners in the past 6 months, history of STD’s, age, latest CD 4 + count (for HIV patients). The sample size for this study was determined with the Cochran formula. The minimum sample size was 138; we decided to make it up to 190 participants in the study, to increase the power of the study. Sample Collection For all participant’s endocervical swabs were collected by a trained Clinician/Nurse. The swabs were placed in a sterile tube containing 1ml of phosphate-buffered saline (PBS) and transported to the molecular laboratory on ice within 2 hours of collection. Samples were stored at -70°C until DNA extraction. Sample Processing DNA Extraction Genomic DNA was extracted from the swab samples using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). Stepwise protocols as recommended by the manufacturer's instructions were followed. Real time PCR The extracted DNA was then amplified by PCR in a reaction mixture. Specific primers used in this study included one pair of oligonucleotide primers specific for a conserved 144 region of the Chlamydia trachomatis gene coding for the major outer membrane protein (MOMP). The sequences from 5ʹ to 3ʹ of the forward and reverse oligonucleotide primers are ‘TGAACCAAGCCTTATGATCGACGGA’ and TCTTCGAYTTTACCTTTAGATTGA’. In vitro amplification of DNA was performed in a 0.5ml thin-walled microfuge tubes containing the PCR premix, by adding 1µl each of forward and reverse primers, 1µl of DNA template and 17µl of molecular grade water. Samples were then placed in a Biometra T3 thermocycle (Jena, Germany) and subjected to the following reaction conditions: Pre-Denaturation at 95°C for 5min, Denaturation at 94°C for 1 min, Annealing at 52°C for 1 min, Extension at 72°C for 1 min, 25 cycles and Final extension at 72°C for 7min. A positive control (of C. trachomatis ) and a negative reagent control (distilled water) were included in the PCR run. Statistical analysis: Data was analyzed using SPSS v. 21. Association between socio-demographic characteristics were analyzed using ANOVA, Chi square and significance were inferred if P < 0.05. Results A total of 25 out of 190 subjects sampled were positive for Chlamydia trachomatis , given a prevalence of 13.2% (Table 1). The prevalence of C. trachomatis was found to be significantly higher among HIV-infected subjects as compared to asymptomatic pregnant women 21.1% vs 5.3% ( Table 1 ). With respect to age-related distribution of Chlamydia trachomatis among HIV –infected subjects in this study, C. trachomatis was numerically higher among those in the range ≥ 36 years, but this was found not to be statistically significant (P = 0.227); similarly, age was not a significant factor (P = 0.21123), in the prevalence and distribution of C. trachomatis among pregnant women in our study area. CD 4 + T cell count levels was a significant predictor of a positive Chlamydia trachomatis assay among HIV-infected subjects in this study, the percentage relative risk of C. trachomatis acquisition at CD 4 + cell count < 200 was 33%. C. trachomatis prevalence was found to be statistically higher among HIV-infected subjects with low CD 4 + T cell counts ( Table 2 ). The association between participant’s sexual behaviour and C. trachomatis infection was investigated in this study. Having a past history of sexually transmitted disease/infection and age at first at sexual debut (coitarche) were significant cofounders contributing to acquisition of Chlamydia trachomatis in this study ( Table 3 ). Number of sexual partners was not associated with C. trachomatis acquisition in this study (P = 0.4022). The socio-demographic characteristics of the study population was analysed with respect to their results for Chlamydia trachomatis PCR. Among the pregnant women included in this study, only employment status had a significant association with been positive for Chlamydia trachoma (P value = 0.00011) ( Table 4). Marital status, parity status and educational status were not associated with infection with C. trachomatis . Among the HIV-infected subjects, the analysis of their socio-demographic characteristics/parameters found out that only marital status had association with C. trachomatis , HIV-infected subjects who reported to be single (Unmarried) had a significantly higher prevalence (P = 0.0054) ( Table 5 ). Table 1: Prevalence of Chlamydia trachomatis among the study population Subjects Chlamydia trachomatis status Positive Chi square P value HIV-Infected subjects CT. Positive (n = 95) 20 (21.1) 10.363 0.00128* Pregnant Women CT. Positive (n = 95) 5 (5.3) *. Statistically significant. Table 2: Association between Chlamydia trachomatis infection and CD 4 + cell counts among HIV-Infected subjects. CD 4 + cell Counts C. trachomatis (+) 95% C.I RR OR P value < 200 (n = 22) 2 0.039, 0.900 0.33 0.1889 0.031* ≥ 200 (n = 53) 18 *. Statistically significant Table 3: Association between C. trachomatis positivity and sexual behaviours of all study participants Sexual Behaviors Chlamydia trachomatis Positive (%) P value Age at first sexual debut ≤ 14 (n = 29) 15 (60.0) 25 (n = 6) 0 History of STI Yes (n = 53) 23 (92.0) < 0.0001* No (n = 137) 2 (8.0) Total 25 *. Statistically Significant Table 4: Association between socio-demographic characteristics and Chlamydia trachomatis among pregnant women. Parameter Number studied C. trachomatis (+ ve) Chi Square P value Employment Status Employed 63 (66.3) 1 (20.0) 18.2345 0.0001* Unemployed 30 (31.6) 2 (40.0) Apprentice 2 (2.1) 2 (40.0) Total 5 Table 5: Association between socio-demographic characteristics and Chlamydia trachomatis among HIV-infected subjects. Parameter Frequency. (%) C. trachomatis positive Chi-Square P value Marital Status Married 61 (64.2) 7 (35.0) 10.465 0.0054* Single/Divorced 11(11.6) 8 (40.0) Widowed 23 (24.2) 5 (25.0) Total 95 20 *. Statistically significant Discussion In this very study, the overall prevalence of Chlamydia trachomatis infection among our study subjects as assessed by PCR was 13.2%. This prevalence report is close to study reports of 9.6% and 7.3% reported in Kano [ 13 ] and Ibadan [ 14 ] respectively. Higher prevalence of Chlamydia trachomatis has been reported in Enugu, 35.2% [ 15 ]. This observed differences in Chlamydia trachomatis prevalence shows that its distribution is population specific. The prevalence of Chlamydia trachomatis in HIV-infected subjects was 21.1% while among pregnant women it was 5.3%, when it was analyzed statistically, a significant difference was found at P = 0.00128. This shows that genital Chlamydia asymptomatic carriage was higher among HIV infected subjects than among pregnant women in our study area. Generally, asymptomatic Chlamydia infection has been documented to be more commonly found among HIV-infected and STI clinic subjects than pregnant women and any other subject’s groups [ 16 ]. The incidence of Chlamydia trachomatis found in this study and from other Nigerian studies have been found to be higher than those of developed counties, the current overall prevalence of C. trachomatis among at risk individuals in USA is placed at 5% [ 17 ]. These differences might be due to level of awareness, qualitative and organized screening programs in developed countries. In this study, Age was not a significant risk factor in the acquisition of C. trachomatis in our both subject groups, though some studies before have found a strong association between age and C. trachomatis [ 18 , 19 ]. It is thus arguable to avoid age stratification when organizing screening for at risk individuals in our study area. In other words, all age groups of HIV-infected patients and pregnant women are capable of being infected with C. trachomatis in Auchi and environs and as such there should be age related priority group in Chlamydia and STI screening and control programs. The prevalence of C. trachomatis among the HIV-infected subjects was found to be significantly higher in subjects with CD 4 + T cell count of ≤ 200. It has been well documented that immunosuppression due to HIV may lead to acquisition of Chlamydia trachomatis and also increase in Chlamydial disease condition such as PID in those infected [ 20 ]. Lower CD 4 + has been linked to increased risk of acquisition of Chlamydia trachomatis in HIV infected individuals [ 21 ]. Some relationships have been hypothesized between HIV and Chlamydia trachomatis , majorly that the invasive intracellular pathogenesis of Chlamydia can cause substantial damage to the genital epithelial layer which may facilitate HIV infection [ 22 ]. Also, immunological changes due to HIV infection may favour Chlamydia trachomatis [ 23 ]. Furthermore, epidemiological studies have shown that untreated genital Chlamydia trachomatis infection can lead to an increased risk for heterosexual acquisition of HIV [ 23 ]. Hence we advocate that routing screening for genital Chlamydia should be encouraged in various antenatal clinics, STI clinics and General outpatients ward within Nigeria. Sexual behaviours and sexual risk histories were collected in this study and their association with genital Chlamydia was investigated in this study, Sexual debut (Coitarche) at age ≤ 14 and having a past history of STI were found to be significant risk factors or Chlamydia acquisition. Risky sexual behaviours are primary cofounders and have been reported to account for majority of acquisition of C. trachomatis and other sexually transmitted disease and HIV [ 24 ]. It is however advised that, any individual with symptomatic STI must ensure it is properly diagnosed and treated to prevent the risk of acquisition of other preventable diseases. The socio-demographic characteristics that were found to be associated with asymptomatic Chlamydia trachomatis infection among the pregnant women was their employment s tatus, as the unemployed among the subjects were found to have higher Chlamydia prevalence. I t has be shown that socio-economic status which can be reflected from their employment status has an effect on their sexual health and preponderance among study subjects in this study area. The single (Unmarried) and divorced HIV-infected patients were more infected, this may stem from risky sexual behaviours engaged in by this set of subjects, when they have multiple sexual partners. This finding can be corroborated with the works of Ogedengbe et al . [ 25 ], where it was found that Chlamydia trachomatis infections were higher among HIV-infected subjects that were unmarried and among those with multiple sexual partners. Conclusion This study shows a high prevalence (13.2%) of asymptomatic infection with Chlamydia trachomatis in Auchi and environs. This study also clearly shows that C. trachomatis infection is more prevalent in HIV-infected females as compared to HIV-uninfected pregnant women. This study did not find any age related priority in designing screening and control programs, thus this study encouraged testing for Chlamydia among all age groups as they are capable of being infected. It was also found that, HIV-infected subjects with CD 4 + T cell count ≤ 200 cells/ ml had higher prevalence of asymptomatic genital Chlamydia infection. Common risk factors of Chlamydia acquisition were risky sexual behaviours, unemployment among pregnant women, being unmarried and divorced among HIV-infected subjects. Study limitation This study was a one –center study, future studies may provide better prevalence data by recruiting subjects from many heath care providing centers, this will provide a more realistic prevalence data of C. trachomatis for our region. Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Abbreviations PCR Polymerase chain reaction CT Chlamydia trachomatis Declarations Author Information Department of Medical Laboratory Science, Faculty of Applied Health sciences, Edo State University Iyamho, Nigeria. Contributions FO and OO designed the study, secured laboratory space for sample analysis, conducted the data collection, parts of sample analysis, performed statistical analysis. Both authors wrote and endorsed the final draft of this work. Ethics Declaration. Ethical approval was obtained from Health Research Ethics Committee (HREC) EDSUTH Auchi with the approval number-EDSUREC25/044. Informed consent was obtained from all the participating subjects following the standards of human experimentation and with the Helsinki Declaration of 1975, as revised in 2000. This was done via informed consent forms duly completed by all participants. Funding This study received no special funding, the authors was self-funded or the actualization of graduate thesis or the second author. Author Contribution FO and OO designed the study, secured laboratory space for sample analysis, conducted the data collection, parts of sample analysis, performed statistical analysis. Both authors wrote and endorsed the final draft of this work. Acknowledgements. Sincere thanks to all study participants for providing consent and participation in this study. Special thanks goes to Mrs Aminat Daud, for assistance with laboratory analysis. References Omosigho PO, Ajide TE, Izevbuwa OE et al. Seroprevalence of Chlamydia trachomatis and associated risk factors among HIV-positive women in North Central Nigeria. Le Infezioni in Medicina 2024; 32(1), 52–9. Egbe NE, Bakori BF, Abdulsalam I et al. Molecular screening for Chlamydia trachomatis among pregnant women attending antenatal clinics in Kaduna metropolis, Kaduna State, Nigeria. Nigerian Health J 2017, 24 (4): 1746–52. World Health Organization. Prevalence and incidence of selected sexually transmitted infections: Chlamydia trachomatis, Neisseria gonorrhoeae, syphilis, and Trichomonas vaginalis: Methods and results used by WHO to generate 2005 estimates. Geneva: WHO. 2011. Available on www.who.int. Cited August 15, 2025. Centers for Disease Control and Prevention. (2021). Sexually transmitted infections treatment guidelines, 2021. Atlanta, GA: U.S. Department of Health and Human Services. 2021. Available on www.CDC.com. Cited in July 5, 2025. Rashidi BH, Chamani-Tabriz L, Haghollahi F et al. (2013). Effects of Chlamydia trachomatis infection on fertility: A case-control study. J Repro Infertility. 2013, 14 (2), 67–72. Arif ED. (2023). Chlamydiosis in human. In One Health Triad . 2023.pp. 73–79 Unique Scientific Publishers. Faisalabad, Pakistan. Eashwernath RP. Prevalence of Chlamydia trachomatis infection among women of reproductive age group attending the gynaecology department in a tertiary care centre (Doctoral dissertation). Rajiv Gandhi University of Health Sciences, India. 2017. Muhammad HID, Jatau ED, Olonitola OS et al. Association of Chlamydia serology with HIV in Nigerian women. Nigerian J Basic Appl Sci 2016; 24(2): 15–22. Silva MJP, Florêncio MA, Gabiatti GL, Et. al. Perinatal morbidity and mortality associated with chlamydial infection: A meta-analysis study. Brazilian J Infect Dis.2011; 15(6): 533–9. Osazuwa F, Ifueko OM. Seroprevalence of sexually transmitted diseases (herpes, chlamydia, and syphilis) in pregnant women in Warri, Nigeria. CHRISMED J Health Res. 2017;4(2):155–6. Metallinou D, Nanoe C, Sarantaki A et al. Chlamydial infection. In Primary Health Care. London: 2021; 8 (6): 81–89. O’Connell CM, Ferone ME. 16). Chlamydia trachomatis genital infections. Microbial Cell. 2016; 3(9); 390–403. Nwankwo EO, Magaji SN. Prevalence of Chlamydia trachomatis among patients attending infertility and STI clinic in Kano, North Western Nigeria. Afr Health Sci. 2014;14:672–8. Ajani TA, Oluwasola TAO, Anaedobe CG, et al. Correlates of genital Chlamydia trachomatis in a cohort of women in Ibadan, Nigeria. Int J Reprod. 2017;6:12–6. Nnenda AM, Bob-Manuel M, Lawson SD, et al. Seroprevalence of Chlamydia trachomatis antibodies and associated risk factors among HIV patients seen in Enugu. Greener J Med Sci. 2021;11:116–21. Bhattar S, Bhalla P, Chadha S et al. Chlamydia trachomatis infection in HIV-infected women: Need for screening by a sensitive and specific test. Obstet Gynecol, 2013, Article ID 960769. Centers for Disease Control and Prevention. Chlamydia screening among STI patients. MMWR. 2020;88:312–8. Keshinro B, Crowell TA, Nowak RG, et al. High prevalence of HIV, Chlamydia , and gonorrhea among men who have sex with men and transgender women attending trusted community centres in Abuja and Lagos, Nigeria. Intl J AIDS Soc. 2016;19(1):2127–9. Twarhima R, Rema JO. Cross-sectional determinants of STIs among men who have sex with men and transgender women in Kigali, Rwanda. Sex Trans Infections. 2022;105:342–65. Soper DE. Pelvic inflammatory disease. Obstet Gynecol. 2010;116:419–28. Wodarz D, Hammer DH. Infection dynamics in HIV-specific CD4 T cells: Does a CD4 T cell boost the host or the virus? Math Biosci. 2007;209:14–29. Altes HK, Wodarz D, Jansen VA. The dual role of T helper cells in the infection dynamics of HIV and their importance for vaccination. J Theoretical Biol. 2020;214:633–46. Joyee AC, Thyagarajan SP, Riddy E, et al. Chlamydia infection in patients: Its relation to HIV infection. Indian J Med Micro. 2005;23:37–40. Oharume IM. Knowledge, sexual behaviours, and risk perception of sexually transmitted infections among students of the Polytechnic Ibadan, Oyo State. Afr Health Sci. 2020;20:39–44. Ogedengbe S, Agbah MI, Omosigho PO. Seroprevalence of Chlamydia trachomatis among HIV positive women in Bida, North Central Nigeria. Int J Epid Infect. 2020;10:23–8. Tables Tables are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Tables.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7633218","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":535106170,"identity":"1669f2b1-4be4-4611-b539-0eda68f7cbbb","order_by":0,"name":"Favour Osazuwa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYBAC9gYwxQxGDAwVIDZzA14tPAdQtJwBsRmJ1QICjG1gkoAW9jOGj3n3WMvJt/M+fPhzXm00fztQy4+Kbbi18OQYG/M8Szc2OMxubMy77XjujMOMDYw9Z27j1GLPkJYmzXPgcOIGZjY2acZtx3IbgFqYGdtwa+HhfwbWUj+/mY395885x3LnE9QikXwMpCWB4TAbGwNvQ03uBsJaHh82nHMg3XDDYTZmaZ5jB3I3ArUcxOcXHv7ExgdvDljLy/cfY/z4o6Yud975wwcf/KjArQUdHAaTB4hWDwR1pCgeBaNgFIyCEQIAxIJVix5zMZcAAAAASUVORK5CYII=","orcid":"","institution":"Edo State University","correspondingAuthor":true,"prefix":"","firstName":"Favour","middleName":"","lastName":"Osazuwa","suffix":""},{"id":535106171,"identity":"8d84f6fa-f411-4a88-bc63-523988e9cf7d","order_by":1,"name":"Osayande Osabuohien","email":"","orcid":"","institution":"Edo State University","correspondingAuthor":false,"prefix":"","firstName":"Osayande","middleName":"","lastName":"Osabuohien","suffix":""}],"badges":[],"createdAt":"2025-09-16 18:38:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7633218/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7633218/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94599104,"identity":"88b36139-1487-4f09-9818-4910cbc6e260","added_by":"auto","created_at":"2025-10-28 19:03:04","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":35738,"visible":true,"origin":"","legend":"","description":"","filename":"ChlamydiaWorkR2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7633218/v1/84a1f5bd64cccd3927c06089.docx"},{"id":94598911,"identity":"60846790-6fe6-4d4f-8ebb-70b6141f1cee","added_by":"auto","created_at":"2025-10-28 18:58:23","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4415,"visible":true,"origin":"","legend":"","description":"","filename":"711ce2573068472cb78be01b1f055a66.json","url":"https://assets-eu.researchsquare.com/files/rs-7633218/v1/162d5f076aa58762c58aabb7.json"},{"id":94599106,"identity":"61270a1e-a27d-462d-b2f5-923ef30113d3","added_by":"auto","created_at":"2025-10-28 19:03:04","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60609,"visible":true,"origin":"","legend":"","description":"","filename":"711ce2573068472cb78be01b1f055a661enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7633218/v1/71290e5a50fae6e6d08da4bd.xml"},{"id":94598907,"identity":"16562ec5-337c-44f6-82e8-1b41d4c4e052","added_by":"auto","created_at":"2025-10-28 18:58:17","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57872,"visible":true,"origin":"","legend":"","description":"","filename":"711ce2573068472cb78be01b1f055a661structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7633218/v1/9016d4f5c4fcc2ba0e7657e1.xml"},{"id":94598750,"identity":"825a4a68-d74a-4c75-90e7-52d2aa380dfa","added_by":"auto","created_at":"2025-10-28 18:56:06","extension":"html","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":68697,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7633218/v1/edc7ec480459fc56ce28fe68.html"},{"id":98421582,"identity":"c70f6be7-2624-42f2-b866-4a9ec1c32f89","added_by":"auto","created_at":"2025-12-17 16:28:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":974338,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633218/v1/dce370c9-de52-49db-8f1b-3377f6868e7f.pdf"},{"id":94598920,"identity":"8538224a-73d1-4459-ba5f-992966321ac8","added_by":"auto","created_at":"2025-10-28 18:58:38","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16468,"visible":true,"origin":"","legend":"","description":"","filename":"Tables.docx","url":"https://assets-eu.researchsquare.com/files/rs-7633218/v1/8b3b39d897a3ecb468792158.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003ePrevalence of Chlamydia Trachomatis Among Hiv-infected Patients and Pregnant Women in Auchi and Environs\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u003cem\u003eChlamydia trachomatis\u003c/em\u003e (\u003cem\u003eC. trachomatis\u003c/em\u003e) is an obligate intracellular parasite that replicates within the cytoplasm of host cells [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. \u003cem\u003eC. trachomatis\u003c/em\u003e infection is the most common bacterial sexually transmitted disease, which is more common in young people [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Risk factors of Chlamydia infection includes multiple sexual partners, use of oral contraceptives, and failure to use barrier methods of contraception [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Others include a history of sexually transmitted diseases (STDs), cervical ectopy, low socioeconomic status, HIV sero-positivity, and seroconversion [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cem\u003eChlamydia trachomatis\u003c/em\u003e belongs to the genus Chlamydia [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. \u003cem\u003eChlamydia trachomatis\u003c/em\u003e has 15 immunotypes [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Clinical symptoms of \u003cem\u003eC. trachomatis\u003c/em\u003e in women include vaginal discharge, dysuria, induced endocervical bleeding, irregular menstruation or intermenstrual bleeding and dyspareunia [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Adverse outcomes associated with \u003cem\u003eC. trachomatis\u003c/em\u003e in pregnancy include premature rupture of membranes, postpartum endometrial inflammation, and low birth weight, also chlamydial infection in pregnant women can enhance the risk of preterm labor, and perinatal death [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. \u003cem\u003eC. trachomatis\u003c/em\u003e vertical transmission can cause neonatal inclusion conjunctivitis and/or pneumonia [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. \u003cem\u003eChlamydia trachomatis\u003c/em\u003e also increases the risk of human immunodeficiency virus (HIV), because Chlamydia triggers an inflammatory response that draws CD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003eT-cells to the site of the infection [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe dual burden of HIV and \u003cem\u003eChlamydia trachomatis\u003c/em\u003e co-infection presents significant clinical and public health challenges, especially among vulnerable groups such as pregnant women. In semi-urban and rural settings like Auchi, where healthcare infrastructure may be limited, the lack of routine screening and reliable epidemiological data further compounds the problem. Consequently, the actual burden and dynamics of Chlamydia infections among HIV patients and pregnant women remain under-researched and poorly addressed, hindering effective intervention strategies. The aim of this study is to investigate the prevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e among HIV-infected patients and pregnant women in Auchi and environs.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStudy Design\u003c/h2\u003e\u003cp\u003eThis cross-sectional descriptive study was done among HIV-infected female patients and pregnant women (aged 18 to 70 years) in Auchi and environs. Study participants were recruited from Edo State University Teaching Hospital (EDSUTH) Auchi, Edo State, Nigeria.\u003c/p\u003e\u003cp\u003eStructured questionnaires were used to obtain socio-demographic and obstetric information such as educational level, occupation, socio-economic status, gravidity, gestational age, parity status, number of sexual partners in the past 6 months, history of STD\u0026rsquo;s, age, latest CD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e count (for HIV patients). The sample size for this study was determined with the Cochran formula. The minimum sample size was 138; we decided to make it up to 190 participants in the study, to increase the power of the study.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eSample Collection\u003c/h3\u003e\n\u003cp\u003eFor all participant\u0026rsquo;s endocervical swabs were collected by a trained Clinician/Nurse. The swabs were placed in a sterile tube containing 1ml of phosphate-buffered saline (PBS) and transported to the molecular laboratory on ice within 2 hours of collection. Samples were stored at -70\u0026deg;C until DNA extraction.\u003c/p\u003e\n\u003ch3\u003eSample Processing\u003c/h3\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003eDNA Extraction\u003c/h2\u003e\u003cp\u003eGenomic DNA was extracted from the swab samples using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). Stepwise protocols as recommended by the manufacturer's instructions were followed.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eReal time PCR\u003c/h3\u003e\n\u003cp\u003eThe extracted DNA was then amplified by PCR in a reaction mixture. Specific primers used in this study included one pair of oligonucleotide primers specific for a conserved 144 region of the \u003cem\u003eChlamydia trachomatis\u003c/em\u003e gene coding for the major outer membrane protein (MOMP). The sequences from 5ʹ to 3ʹ of the forward and reverse oligonucleotide primers are \u0026lsquo;TGAACCAAGCCTTATGATCGACGGA\u0026rsquo; and TCTTCGAYTTTACCTTTAGATTGA\u0026rsquo;.\u003c/p\u003e\u003cp\u003eIn vitro amplification of DNA was performed in a 0.5ml thin-walled microfuge tubes containing the PCR premix, by adding 1\u0026micro;l each of forward and reverse primers, 1\u0026micro;l of DNA template and 17\u0026micro;l of molecular grade water. Samples were then placed in a Biometra T3 thermocycle (Jena, Germany) and subjected to the following reaction conditions: Pre-Denaturation at 95\u0026deg;C for 5min, Denaturation at 94\u0026deg;C for 1 min, Annealing at 52\u0026deg;C for 1 min, Extension at 72\u0026deg;C for 1 min, 25 cycles and Final extension at 72\u0026deg;C for 7min. A positive control (of \u003cem\u003eC. trachomatis\u003c/em\u003e) and a negative reagent control (distilled water) were included in the PCR run.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis:\u003c/h2\u003e\u003cp\u003eData was analyzed using SPSS v. 21. Association between socio-demographic characteristics were analyzed using ANOVA, Chi square and significance were inferred if P\u0026thinsp;\u003cem\u003e\u0026lt;\u0026thinsp;0.05.\u003c/em\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eA total of 25 out of 190 subjects sampled were positive for \u003cem\u003eChlamydia trachomatis\u003c/em\u003e, given a prevalence of 13.2% \u003cb\u003e(Table\u0026nbsp;1).\u003c/b\u003e The prevalence of \u003cem\u003eC. trachomatis\u003c/em\u003e was found to be significantly higher among HIV-infected subjects as compared to asymptomatic pregnant women 21.1% vs 5.3% (\u003cb\u003eTable\u0026nbsp;1\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eWith respect to age-related distribution of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e among HIV \u0026ndash;infected subjects in this study, \u003cem\u003eC. trachomatis\u003c/em\u003e was numerically higher among those in the range\u0026thinsp;\u0026ge;\u0026thinsp;36 years, but this was found not to be statistically significant (P\u0026thinsp;=\u0026thinsp;0.227); similarly, age was not a significant factor (P\u0026thinsp;=\u0026thinsp;0.21123), in the prevalence and distribution of \u003cem\u003eC. trachomatis\u003c/em\u003e among pregnant women in our study area.\u003c/p\u003e\u003cp\u003eCD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e T cell count levels was a significant predictor of a positive \u003cem\u003eChlamydia trachomatis\u003c/em\u003e assay among HIV-infected subjects in this study, the percentage relative risk of \u003cem\u003eC. trachomatis\u003c/em\u003e acquisition at CD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e cell count\u0026thinsp;\u0026lt;\u0026thinsp;200 was 33%. \u003cem\u003eC. trachomatis\u003c/em\u003e prevalence was found to be statistically higher among HIV-infected subjects with low CD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e T cell counts (\u003cb\u003eTable\u0026nbsp;2\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eThe association between participant\u0026rsquo;s sexual behaviour and \u003cem\u003eC. trachomatis\u003c/em\u003e infection was investigated in this study. Having a past history of sexually transmitted disease/infection and age at first at sexual debut (coitarche) were significant cofounders contributing to acquisition of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e in this study (\u003cb\u003eTable\u0026nbsp;3\u003c/b\u003e). Number of sexual partners was not associated with \u003cem\u003eC. trachomatis\u003c/em\u003e acquisition in this study (P\u0026thinsp;=\u0026thinsp;0.4022).\u003c/p\u003e\u003cp\u003eThe socio-demographic characteristics of the study population was analysed with respect to their results for \u003cem\u003eChlamydia trachomatis\u003c/em\u003e PCR. Among the pregnant women included in this study, only employment status had a significant association with been positive for \u003cem\u003eChlamydia trachoma\u003c/em\u003e (P \u003cem\u003evalue\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.00011) (\u003cb\u003eTable\u0026nbsp;4).\u003c/b\u003e Marital status, parity status and educational status were not associated with infection with \u003cem\u003eC. trachomatis\u003c/em\u003e. Among the HIV-infected subjects, the analysis of their socio-demographic characteristics/parameters found out that only marital status had association with \u003cem\u003eC. trachomatis\u003c/em\u003e, HIV-infected subjects who reported to be single (Unmarried) had a significantly higher prevalence (P\u0026thinsp;=\u0026thinsp;0.0054) (\u003cb\u003eTable\u0026nbsp;5\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eTable\u0026nbsp;1: Prevalence of\u003c/b\u003e \u003cb\u003eChlamydia trachomatis\u003c/b\u003e \u003cb\u003eamong the study population\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSubjects\u003c/b\u003e \u003cb\u003eChlamydia trachomatis\u003c/b\u003e \u003cb\u003estatus\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003ePositive Chi square P\u003c/b\u003e \u003cb\u003evalue\u003c/b\u003e\u003c/p\u003e\n\u003ch3\u003eHIV-Infected subjects\u003c/h3\u003e\n\u003cp\u003eCT. Positive (n\u0026thinsp;=\u0026thinsp;95) 20 (21.1) 10.363 0.00128*\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003ePregnant Women\u003c/h2\u003e\u003cp\u003eCT. Positive (n\u0026thinsp;=\u0026thinsp;95) 5 (5.3)\u003c/p\u003e\u003cp\u003e\u003cb\u003e*. Statistically significant.\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTable\u0026nbsp;2: Association between\u003c/b\u003e \u003cb\u003eChlamydia trachomatis\u003c/b\u003e \u003cb\u003einfection and CD\u003c/b\u003e\u003csub\u003e\u003cb\u003e4\u003c/b\u003e\u003c/sub\u003e\u0026thinsp;\u003cb\u003e+\u0026thinsp;cell counts among HIV-Infected subjects.\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCD\u003c/b\u003e\u003csub\u003e\u003cb\u003e4\u003c/b\u003e\u003c/sub\u003e\u003csup\u003e\u003cb\u003e+\u003c/b\u003e\u003c/sup\u003e \u003cb\u003ecell Counts\u003c/b\u003e \u003cb\u003eC. trachomatis\u003c/b\u003e \u003cb\u003e(+) 95% C.I RR OR P value\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u0026lt;\u0026thinsp;200 (n\u0026thinsp;=\u0026thinsp;22) 2 0.039, 0.900 0.33 0.1889 0.031*\u003c/p\u003e\u003cp\u003e\u0026ge;\u0026thinsp;200 (n\u0026thinsp;=\u0026thinsp;53) 18\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e*. Statistically significant\u003c/h2\u003e\u003cp\u003e\u003cb\u003eTable\u0026nbsp;3: Association between\u003c/b\u003e \u003cb\u003eC. trachomatis\u003c/b\u003e \u003cb\u003epositivity and sexual behaviours of all study participants\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eSexual Behaviors\u003c/b\u003e \u003cb\u003eChlamydia trachomatis\u003c/b\u003e \u003cb\u003ePositive (%) P\u003c/b\u003e \u003cb\u003evalue\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eAge at first sexual debut\u003c/h2\u003e\u003cp\u003e\u0026le;\u0026thinsp;14 (n\u0026thinsp;=\u0026thinsp;29) 15 (60.0)\u0026thinsp;\u0026lt;\u0026thinsp;0.00001*\u003c/p\u003e\u003cp\u003e15\u0026ndash;19 (n\u0026thinsp;=\u0026thinsp;97) 7 (28.0)\u003c/p\u003e\u003cp\u003e20\u0026ndash;25 (n\u0026thinsp;=\u0026thinsp;58) 3 (12.0)\u003c/p\u003e\u003cp\u003e\u0026gt;\u0026thinsp;25 (n\u0026thinsp;=\u0026thinsp;6) 0\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eHistory of STI\u003c/h2\u003e\u003cp\u003eYes (n\u0026thinsp;=\u0026thinsp;53) 23 (92.0)\u0026thinsp;\u0026lt;\u0026thinsp;0.0001*\u003c/p\u003e\u003cp\u003eNo (n\u0026thinsp;=\u0026thinsp;137) 2 (8.0)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eTotal 25\u003c/h2\u003e\u003cdiv id=\"Sec16\" class=\"Section3\"\u003e\u003ch2\u003e*. Statistically Significant\u003c/h2\u003e\u003cp\u003e\u003cb\u003eTable\u0026nbsp;4: Association between socio-demographic characteristics and\u003c/b\u003e \u003cb\u003eChlamydia trachomatis\u003c/b\u003e \u003cb\u003eamong pregnant women.\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eParameter Number studied\u003c/b\u003e \u003cb\u003eC. trachomatis\u003c/b\u003e \u003cb\u003e(+\u0026thinsp;ve) Chi Square\u003c/b\u003e \u003cb\u003eP\u003c/b\u003e \u003cb\u003evalue\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eEmployment Status\u003c/h2\u003e\u003cp\u003eEmployed 63 (66.3) 1 (20.0) 18.2345 0.0001*\u003c/p\u003e\u003cp\u003eUnemployed 30 (31.6) 2 (40.0)\u003c/p\u003e\u003cp\u003eApprentice 2 (2.1) 2 (40.0)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eTotal 5\u003c/h2\u003e\u003cp\u003e\u003cb\u003eTable\u0026nbsp;5: Association between socio-demographic characteristics and\u003c/b\u003e \u003cb\u003eChlamydia trachomatis\u003c/b\u003e \u003cb\u003eamong HIV-infected subjects.\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eParameter Frequency. (%)\u003c/b\u003e \u003cb\u003eC. trachomatis\u003c/b\u003e \u003cb\u003epositive Chi-Square P value\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eMarital Status\u003c/h2\u003e\u003cp\u003eMarried 61 (64.2) 7 (35.0) 10.465 0.0054*\u003c/p\u003e\u003cp\u003eSingle/Divorced 11(11.6) 8 (40.0)\u003c/p\u003e\u003cp\u003eWidowed 23 (24.2) 5 (25.0)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eTotal 95 20\u003c/h2\u003e\u003cdiv id=\"Sec21\" class=\"Section3\"\u003e\u003ch2\u003e*. Statistically significant\u003c/h2\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this very study, the overall prevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e infection among our study subjects as assessed by PCR was 13.2%. This prevalence report is close to study reports of 9.6% and 7.3% reported in Kano [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and Ibadan [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] respectively. Higher prevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e has been reported in Enugu, 35.2% [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. This observed differences in \u003cem\u003eChlamydia trachomatis\u003c/em\u003e prevalence shows that its distribution is population specific.\u003c/p\u003e\u003cp\u003eThe prevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e in HIV-infected subjects was 21.1% while among pregnant women it was 5.3%, when it was analyzed statistically, a significant difference was found at P\u0026thinsp;=\u0026thinsp;0.00128. This shows that genital Chlamydia asymptomatic carriage was higher among HIV infected subjects than among pregnant women in our study area. Generally, asymptomatic Chlamydia infection has been documented to be more commonly found among HIV-infected and STI clinic subjects than pregnant women and any other subject\u0026rsquo;s groups [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe incidence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e found in this study and from other Nigerian studies have been found to be higher than those of developed counties, the current overall prevalence of \u003cem\u003eC. trachomatis\u003c/em\u003e among at risk individuals in USA is placed at 5% [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. These differences might be due to level of awareness, qualitative and organized screening programs in developed countries.\u003c/p\u003e\u003cp\u003eIn this study, Age was not a significant risk factor in the acquisition of \u003cem\u003eC. trachomatis\u003c/em\u003e in our both subject groups, though some studies before have found a strong association between age and \u003cem\u003eC. trachomatis\u003c/em\u003e [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. It is thus arguable to avoid age stratification when organizing screening for at risk individuals in our study area. In other words, all age groups of HIV-infected patients and pregnant women are capable of being infected with \u003cem\u003eC. trachomatis\u003c/em\u003e in Auchi and environs and as such there should be age related priority group in Chlamydia and STI screening and control programs.\u003c/p\u003e\u003cp\u003eThe prevalence of \u003cem\u003eC. trachomatis\u003c/em\u003e among the HIV-infected subjects was found to be significantly higher in subjects with CD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e T cell count of \u0026le;\u0026thinsp;200. It has been well documented that immunosuppression due to HIV may lead to acquisition of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e and also increase in Chlamydial disease condition such as PID in those infected [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Lower CD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e has been linked to increased risk of acquisition of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e in HIV infected individuals [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSome relationships have been hypothesized between HIV and \u003cem\u003eChlamydia trachomatis\u003c/em\u003e, majorly that the invasive intracellular pathogenesis of Chlamydia can cause substantial damage to the genital epithelial layer which may facilitate HIV infection [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Also, immunological changes due to HIV infection may favour \u003cem\u003eChlamydia trachomatis\u003c/em\u003e [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Furthermore, epidemiological studies have shown that untreated genital \u003cem\u003eChlamydia trachomatis\u003c/em\u003e infection can lead to an increased risk for heterosexual acquisition of HIV [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Hence we advocate that routing screening for genital Chlamydia should be encouraged in various antenatal clinics, STI clinics and General outpatients ward within Nigeria.\u003c/p\u003e\u003cp\u003eSexual behaviours and sexual risk histories were collected in this study and their association with genital Chlamydia was investigated in this study, Sexual debut (Coitarche) at age\u0026thinsp;\u0026le;\u0026thinsp;14 and having a past history of STI were found to be significant risk factors or Chlamydia acquisition. Risky sexual behaviours are primary cofounders and have been reported to account for majority of acquisition of \u003cem\u003eC. trachomatis\u003c/em\u003e and other sexually transmitted disease and HIV [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. It is however advised that, any individual with symptomatic STI must ensure it is properly diagnosed and treated to prevent the risk of acquisition of other preventable diseases.\u003c/p\u003e\u003cp\u003eThe socio-demographic characteristics that were found to be associated with asymptomatic Chlamydia trachomatis infection among the pregnant women was their employment \u003cb\u003es\u003c/b\u003etatus, as the unemployed among the subjects were found to have higher Chlamydia prevalence. I t has be shown that socio-economic status which can be reflected from their employment status has an effect on their sexual health and preponderance among study subjects in this study area. The single (Unmarried) and divorced HIV-infected patients were more infected, this may stem from risky sexual behaviours engaged in by this set of subjects, when they have multiple sexual partners. This finding can be corroborated with the works of Ogedengbe \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], where it was found that \u003cem\u003eChlamydia trachomatis\u003c/em\u003e infections were higher among HIV-infected subjects that were unmarried and among those with multiple sexual partners.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study shows a high prevalence (13.2%) of asymptomatic infection with \u003cem\u003eChlamydia trachomatis\u003c/em\u003e in Auchi and environs. This study also clearly shows that \u003cem\u003eC. trachomatis\u003c/em\u003e infection is more prevalent in HIV-infected females as compared to HIV-uninfected pregnant women. This study did not find any age related priority in designing screening and control programs, thus this study encouraged testing for Chlamydia among all age groups as they are capable of being infected. It was also found that, HIV-infected subjects with CD\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e T cell count\u0026thinsp;\u0026le;\u0026thinsp;200 cells/ ml had higher prevalence of asymptomatic genital Chlamydia infection. Common risk factors of Chlamydia acquisition were risky sexual behaviours, unemployment among pregnant women, being unmarried and divorced among HIV-infected subjects.\u003c/p\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eStudy limitation\u003c/h2\u003e\u003cp\u003eThis study was a one \u0026ndash;center study, future studies may provide better prevalence data by recruiting subjects from many heath care providing centers, this will provide a more realistic prevalence data of \u003cem\u003eC. trachomatis\u003c/em\u003e for our region.\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003ePCR\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ePolymerase chain reaction\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eCT\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003e\u003cem\u003eChlamydia trachomatis\u003c/em\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eAuthor Information\u003c/h2\u003e\u003cp\u003eDepartment of Medical Laboratory Science, Faculty of Applied Health sciences, Edo State University Iyamho, Nigeria.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003cp\u003eFO and OO designed the study, secured laboratory space for sample analysis, conducted the data collection, parts of sample analysis, performed statistical analysis. Both authors wrote and endorsed the final draft of this work.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003e\u003cb\u003eEthics Declaration.\u003c/b\u003e\u003c/h2\u003e\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003cp\u003e was obtained from Health Research Ethics Committee (HREC) EDSUTH Auchi with the approval number-EDSUREC25/044. Informed consent was obtained from all the participating subjects following the standards of human experimentation and with the Helsinki Declaration of 1975, as revised in 2000. This was done via informed consent forms duly completed by all participants.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis study received no special funding, the authors was self-funded or the actualization of graduate thesis or the second author.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eFO and OO designed the study, secured laboratory space for sample analysis, conducted the data collection, parts of sample analysis, performed statistical analysis. Both authors wrote and endorsed the final draft of this work.\u003c/p\u003e\u003ch2\u003eAcknowledgements.\u003c/h2\u003e\u003cp\u003eSincere thanks to all study participants for providing consent and participation in this study. Special thanks goes to Mrs Aminat Daud, for assistance with laboratory analysis.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eOmosigho PO, Ajide TE, Izevbuwa OE et al. Seroprevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e and associated risk factors among HIV-positive women in North Central Nigeria. Le Infezioni in Medicina 2024; 32(1), 52\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEgbe NE, Bakori BF, Abdulsalam I et al. Molecular screening for Chlamydia trachomatis among pregnant women attending antenatal clinics in Kaduna metropolis, Kaduna State, Nigeria. Nigerian Health J 2017, \u003cem\u003e24\u003c/em\u003e(4): 1746\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWorld Health Organization. \u003cem\u003ePrevalence and incidence of selected sexually transmitted infections: Chlamydia trachomatis, Neisseria gonorrhoeae, syphilis, and Trichomonas vaginalis: Methods and results used by WHO to generate 2005 estimates.\u003c/em\u003e Geneva: WHO. 2011. Available on www.who.int. Cited August 15, 2025.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCenters for Disease Control and Prevention. (2021). \u003cem\u003eSexually transmitted infections treatment guidelines, 2021.\u003c/em\u003e Atlanta, GA: U.S. Department of Health and Human Services. 2021. Available on www.CDC.com. Cited in July 5, 2025.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRashidi BH, Chamani-Tabriz L, Haghollahi F et al. (2013). Effects of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e infection on fertility: A case-control study. \u003cem\u003eJ Repro Infertility. 2013, 14\u003c/em\u003e(2), 67\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArif ED. (2023). Chlamydiosis in human. In \u003cem\u003eOne Health Triad\u003c/em\u003e. 2023.pp. 73\u0026ndash;79 Unique Scientific Publishers. Faisalabad, Pakistan.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEashwernath RP. \u003cem\u003ePrevalence of Chlamydia trachomatis infection among women of reproductive age group attending the gynaecology department in a tertiary care centre\u003c/em\u003e (Doctoral dissertation). Rajiv Gandhi University of Health Sciences, India. 2017.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMuhammad HID, Jatau ED, Olonitola OS et al. Association of Chlamydia serology with HIV in Nigerian women. Nigerian J Basic Appl Sci 2016; 24(2): 15\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSilva MJP, Flor\u0026ecirc;ncio MA, Gabiatti GL, Et. al. Perinatal morbidity and mortality associated with chlamydial infection: A meta-analysis study. Brazilian J Infect Dis.2011; 15(6): 533\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOsazuwa F, Ifueko OM. Seroprevalence of sexually transmitted diseases (herpes, chlamydia, and syphilis) in pregnant women in Warri, Nigeria. CHRISMED J Health Res. 2017;4(2):155\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMetallinou D, Nanoe C, Sarantaki A et al. Chlamydial infection. In \u003cem\u003ePrimary Health Care.\u003c/em\u003e London: 2021; 8 (6): 81\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eO\u0026rsquo;Connell CM, Ferone ME. 16). Chlamydia trachomatis genital infections. \u003cem\u003eMicrobial Cell.\u003c/em\u003e 2016; 3(9); 390\u0026ndash;403.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNwankwo EO, Magaji SN. Prevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e among patients attending infertility and STI clinic in Kano, North Western Nigeria. Afr Health Sci. 2014;14:672\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAjani TA, Oluwasola TAO, Anaedobe CG, et al. Correlates of genital \u003cem\u003eChlamydia trachomatis\u003c/em\u003e in a cohort of women in Ibadan, Nigeria. Int J Reprod. 2017;6:12\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNnenda AM, Bob-Manuel M, Lawson SD, et al. Seroprevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e antibodies and associated risk factors among HIV patients seen in Enugu. Greener J Med Sci. 2021;11:116\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBhattar S, Bhalla P, Chadha S et al. \u003cem\u003eChlamydia trachomatis\u003c/em\u003e infection in HIV-infected women: Need for screening by a sensitive and specific test. Obstet Gynecol, 2013, Article ID 960769.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCenters for Disease Control and Prevention. Chlamydia screening among STI patients. MMWR. 2020;88:312\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeshinro B, Crowell TA, Nowak RG, et al. High prevalence of HIV, \u003cem\u003eChlamydia\u003c/em\u003e, and gonorrhea among men who have sex with men and transgender women attending trusted community centres in Abuja and Lagos, Nigeria. Intl J AIDS Soc. 2016;19(1):2127\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTwarhima R, Rema JO. Cross-sectional determinants of STIs among men who have sex with men and transgender women in Kigali, Rwanda. Sex Trans Infections. 2022;105:342\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSoper DE. Pelvic inflammatory disease. Obstet Gynecol. 2010;116:419\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWodarz D, Hammer DH. Infection dynamics in HIV-specific CD4 T cells: Does a CD4 T cell boost the host or the virus? Math Biosci. 2007;209:14\u0026ndash;29.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAltes HK, Wodarz D, Jansen VA. The dual role of T helper cells in the infection dynamics of HIV and their importance for vaccination. J Theoretical Biol. 2020;214:633\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJoyee AC, Thyagarajan SP, Riddy E, et al. Chlamydia infection in patients: Its relation to HIV infection. Indian J Med Micro. 2005;23:37\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOharume IM. Knowledge, sexual behaviours, and risk perception of sexually transmitted infections among students of the Polytechnic Ibadan, Oyo State. Afr Health Sci. 2020;20:39\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOgedengbe S, Agbah MI, Omosigho PO. Seroprevalence of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e among HIV positive women in Bida, North Central Nigeria. Int J Epid Infect. 2020;10:23\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chlamydia trachomatis, HIV, Pregnant women, PCR, Prevalence, PLWH","lastPublishedDoi":"10.21203/rs.3.rs-7633218/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7633218/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003e\u003cem\u003eChlamydia trachomatis\u003c/em\u003e is the commonest bacterial sexually transmitted infection, and it is known to increase the risk of acquisition of HIV.\u003c/p\u003e\u003ch2\u003eObjectives\u003c/h2\u003e\u003cp\u003eThe aim of this study is to determine the prevalence and determinants of \u003cem\u003eChlamydia trachomatis\u003c/em\u003e using polymerase chain reaction among HIV-infected females and pregnant women in Auchi and environs.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eThis cross-sectional descriptive study was carried out between January and July, 2025. One-hundred and nighty subjects (95 HIV-infected women and 95 pregnant women) were included in this study. Endocervical swabs were collected for analysis of \u003cem\u003eC. trachomatis\u003c/em\u003e DNA using polymerase chain reaction (PCR). Self-administered questionnaires were used to collect information on participant\u0026rsquo;s socio-demographics, sexual history and sexual risk behaviours.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eOverall, 25/190 (13.2%) subjects studied were \u003cem\u003eC. trachomatis\u003c/em\u003e Positive. \u003cem\u003eC. trachomatis\u003c/em\u003e was significantly higher in HIV-infected subjects as compared to Pregnant HIV-Negative women 21.1% vs. 5.3% ((Chi square 10.363, \u003cem\u003ep value\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.00128). Age of study participants in both study groups did not have effect on distribution pattern of \u003cem\u003eC. trachomatis\u003c/em\u003e. HIV-infected subjects with CD\u003csub\u003e4\u003c/sub\u003e \u003csup\u003e+\u003c/sup\u003e T cells\u0026thinsp;\u0026le;\u0026thinsp;200 cells/ul were significantly more infected, with a relative risk of 33% (OR: 0.1889, RR: 0.33, P\u0026thinsp;=\u0026thinsp;0.031). Other significant risk factors of \u003cem\u003eC. trachomatis\u003c/em\u003e infection were early age at first sexual debut, history of STI, employment status and marital status.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eIn conclusion, asymptomatic infection with \u003cem\u003eC. trachomatis\u003c/em\u003e is highly prevalent among our study subjects in Auchi and environs; routine screening among at risk individuals and education on risk factors is however encouraged.\u003c/p\u003e","manuscriptTitle":"Prevalence of Chlamydia Trachomatis Among Hiv-infected Patients and Pregnant Women in Auchi and Environs","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-28 18:23:44","doi":"10.21203/rs.3.rs-7633218/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"96574f6a-81b6-4dd1-a3b0-49814664a03b","owner":[],"postedDate":"October 28th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-11T00:38:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-28 18:23:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7633218","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7633218","identity":"rs-7633218","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}