Evaluation of the Effects of Nano-Oleocanthal on Histopathological Changes and the Expression of APP and PRNP Genes in an Alzheimer's Rat Model

Evaluation of the Effects of Nano-Oleocanthal on Histopathological Changes and the Expression of APP and PRNP Genes in an Alzheimer's Rat Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Evaluation of the Effects of Nano-Oleocanthal on Histopathological Changes and the Expression of APP and PRNP Genes in an Alzheimer's Rat Model Hooman Ravaei, Mohammad Zaefizadeh, Ali Abedi, Ghasem Fattahzadeh This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7777675/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Jan, 2026 Read the published version in BioNanoScience → Version 1 posted 7 You are reading this latest preprint version Abstract Purpose Alzheimer's disease (AD) is the most common type of dementia. Recently, many studies have shown the effect of natural compounds on this disease. This study aimed to evaluate the effects of nano-oleocanthal on histopathological changes and expression of APP (amyloid precursor protein gene) and PRNP genes in a rat model of AD. Materials and Methods In this experiment, 28 male rats with an average weight of 250 to 280g were divided into four groups: Healthy sham, Alzheimer's control, Oleocanthal-treatment and Nano-Oleocanthal-treatment groups. After Alzheimer's induction by manganese nano-powder for 21 consecutive days, followed by a 7-day rest period, the two treatment groups were treated intraperitoneally with standardized 30mg concentrations of nano oleocanthal and oleocanthal for one week. After one week treatment and one week rest, brain tissue was isolated. Histopathological changes were assessed using hematoxylin and eosin (H&E) staining. RNA was extracted by sampling the hippocampus of the mice. The expression of APP and PRNP genes was evaluated using Real-time PCR. Results Behavioral and MRI tests showed Alzheimer's plaques in the hippocampus. Histopathology results also showed a positive effect of nano-oleocanthal treatment on significant increasing APP and PRNP gene expression in mice treated with nano-oleocanthal. Discussion and Conclusion According to the histopathology and gene expression results, nano-oleocanthal can be used for the prevention and target treatment of Alzheimer's with further research. Alzheimer's APP PRNP PrPC nano-oleocanthal hippocampus Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Alzheimer’s disease (AD) is the most common form of dementia in older adults, accounting for 60–70% of cases worldwide. With the rapid rise in life expectancy, the global prevalence of AD is projected to triple by 2050, representing a major public health challenge [1]. Pathologically, AD is characterized by the abnormal accumulation of amyloid-beta (Aβ) plaques, hyperphosphorylated tau neurofibrillary tangles, widespread neuronal loss, and chronic neuroinflammation. These processes are driven by a complex interplay of genetic, molecular, and environmental factors that ultimately compromise synaptic integrity and cognitive performance [2,3]. Among the genetic contributors, the amyloid precursor protein (APP) occupies a central role. APP is indispensable for neuronal growth, synaptogenesis, and plasticity. Under physiological conditions, APP is processed through the non-amyloidogenic pathway, producing soluble fragments that support neuronal health [4]. However, under pathological conditions, APP undergoes amyloidogenic cleavage, leading to excessive Aβ production and deposition. Interestingly, recent studies suggest that modest upregulation of APP, when coupled with enhanced non-amyloidogenic processing, may actually stabilize neuronal pathways and delay degeneration. This highlights a dual role for APP, where its expression can either sustain neuronal resilience or exacerbate pathological cascades depending on the processing context [5,6]. Similarly, the prion protein (PrPC), encoded by the PRNP gene, has been recognized for its neuroprotective properties. It plays an important role in antioxidant defense, synaptic plasticity, and protection against Aβ toxicity. Nonetheless, under pathological circumstances, PrPC may engage in deleterious interactions with Aβ oligomers, promoting synaptic dysfunction and neuronal death. Furthermore, mutations in PRNP are implicated in inherited prion diseases, which share mechanistic similarities with AD through the accumulation of misfolded proteins [7,8]. Therefore, both APP and PRNP genes exhibit context-dependent, dual effects—acting as protectors in normal states and as potential mediators of neurotoxicity in disease states. Understanding these opposing roles is crucial for developing therapeutic approaches aimed at fine-tuning gene expression and protein processing in AD [9,10]. In the search for effective treatments, natural compounds with multitarget activity are gaining momentum. Among them, oleocanthal, a phenolic compound derived from extra virgin olive oil (EVOO), has drawn significant attention [11]. Oleocanthal exerts strong anti-inflammatory, antioxidant, and anti-amyloidogenic effects. It modulates APP processing toward the non-amyloidogenic pathway, reduces tau aggregation, and promotes the clearance of Aβ through upregulation of transport proteins such as P-glycoprotein (P-gp) and low-density lipoprotein receptor-related protein-1 (LRP1). Additionally, oleocanthal stimulates the expression of amyloid-degrading enzymes including neprilysin (NEP) and insulin-degrading enzyme (IDE), thereby reducing amyloid burden in the brain [12,13]. Beyond AD, oleocanthal has shown broad therapeutic potential. Preclinical studies report its anti-cancer effects, with activity against breast, prostate, and melanoma cells through induction of apoptosis and inhibition of metastasis [14]. Its cardioprotective properties include improvement of endothelial function and reduction of vascular inflammation [15]. Moreover, in metabolic disorders, oleocanthal demonstrates anti-obesity and anti-diabetic effects by modulating insulin sensitivity and lipid metabolism. These pleiotropic activities underscore oleocanthal as a versatile therapeutic agent with applications extending beyond neurodegeneration [16,17]. A major limitation of oleocanthal, however, is its low bioavailability and restricted blood–brain barrier (BBB) penetration. Recent advances in nanotechnology-based drug delivery systems have overcome these challenges [18]. Nano-oleocanthal formulations have shown superior pharmacokinetics, enhanced BBB permeability, and greater therapeutic efficacy in reducing amyloid and tau pathology compared to free oleocanthal. Importantly, nano-formulations improve stability, protect the active compound from degradation, and enable targeted delivery to brain tissue [19]. Given the interplay of APP and PRNP expression in AD pathogenesis, and considering the emerging therapeutic value of oleocanthal and its nano-formulations, investigating their combined impact is highly relevant. The present study aims to evaluate the histopathological changes and gene expression profiles of APP and PRNP in an experimental AD rat model treated with nano-oleocanthal. By addressing both the molecular and histological aspects, this research provides new insights into how oleocanthal-based nano-formulations may modulate the dual roles of APP and PRNP, ultimately contributing to neuroprotection and therapeutic innovation in Alzheimer’s disease. Materials and methods 2.1. Materials and Equipment and Drugs In this study, various chemical reagents, biological kits, laboratory consumables, and analytical instruments were utilized. Oleocanthal and Oleocanthal nano-composite and manganese nano-powder were employed as the main experimental compounds. Injectable physiological serum and formalin were used for biological preparation and tissue fixation. For molecular biology experiments, a cDNA synthesis kit (RT5201, SinaClon, Iran), a Real-Time PCR kit (Sina SYBR Blue HS-qPCRMix, SinaClon, Iran), and an RNA extraction kit (RNX-PLUS-EX6101, SinaClon, Iran) were APPlied. Additional reagents included PCR Master Mix, dNTPs (Fermentas, Canada), and Oligo-dT primers (Fermentas, Canada). Laboratory consumables consisted of RNase-free microtubes (0.2–1.5 mL), standard microtubes (0.2–0.5 mL), RNase-free crystal pipette tips, yellow and blue micropipette tips, tube holders, and 5 mL syringes. Liquid nitrogen was used for rapid freezing procedures. The experimental procedures were supported by a set of advanced instruments. Thermal cycling was conducted using a Denagen Thermoblock machine (Iran), and agitation was performed with a digital shaker (IKA MS 3D, USA). Centrifugation was carried out using a Hanil Combi 514R refrigerated centrifuge, while real-time amplification was analyzed on a QIAGEN PLEX series Real-Time PCR system. Structural and chemical analyses were performed with a BRUKER Tensor 27 FTIR spectrometer and an HPLC system. For histological processing, a microtome device was employed. Storage and incubation conditions were maintained using freezers at –20 °C and –80 °C, a 4 °C refrigerator, and a LabTech incubator set at 37 °C. Additional equipment such as a vortex mixer was used to ensure proper homogenization of samples. 2-2. Experimental Animals All ethical principles regarding the use of laboratory animals were observed in accordance with the protocols of the Ministry of Health and Medical Education of Iran and international guidelines for the care and use of laboratory animals. Male Wistar rats (weighing between 250 and 280g) and aged approximately 12 weeks, were obtained from the animal house of Islamic Azad University, Ardabil Branch. The rats were kept in 4 groups in cages with free access to food and water, under a 12-h light/dark cycle (light on 7 am to 7 pm) and controlled temperature (22 ± 2°C). 2-3. Alzheimer's Disease Induction To induce AD, Manganese nano-powder solution was administered intraperitoneally (i.p.) at a dose of 60 mg/kg for 21 consecutive days to the Alzheimer’s control and treatment groups. Following this 21-day induction period, all rats were given a 7-day rest period to allow for stabilization of the disease effect. 2-4. MRI Confirmation of Alzheimer's Induction To confirm the successful induction of AD in mice, the animals were anesthetized and placed on a flat plastic platform before being placed inside a MRI scanner. MRI imaging of the hippocampus was then performed. As can be seen, Alzheimer's plaques deposited in the hippocampus are clearly visible in MRI sequences of control mice. 2-5. Alzheimer's behavioral test Behavioral evaluation to confirm successful induction of AD in rats was conducted using the Alzheimer’s Mouse Passive Avoidance Test apparatus (Patent No. 659232632225230000). In this device, the rat is placed on a safe platform area that it can comfortably stand on. At a fixed distance from the rat’s starting position, a food reward is positioned. Between the rat’s location and the food, there is an electrified grid connected to a controlled mild electric shock source. When the rat attempts to move towards the food by stepping onto this grid, it receives a mild electric shock that prompts it to return to the initial platform and inhibits further movement towards the food. This experience is encoded in the rat’s memory. Over time, as the rat forgets the aversive stimulus, it attempts to reach the food again, repeating the cycle. The number of approaches toward the food was recorded by a camera over a 5-hour testing period. Rats with AD exhibit impaired memory and therefore fail to remember the electric shock, resulting in a higher number of approaches to the food compared to healthy controls. 2-6. Experimental Groups In this study, 28 male Wistar rats were randomly assigned into four groups (with 7 rats in each group): Group 1: Healthy Sham Group 2: Alzheimer's control Group 3: Oleocanthal-Treatment Group 4: Nano Oleocanthal-Treatment After MRI imaging and behavioral test for confirmation of Alzheimer's induction, treatment with oleocanthal and nano-oleocanthal was initiated in the third and fourth group (treatment groups). Treatment was conducted using 30 mg concentrations of nano-oleocanthal and oleocanthal for one week. Following the treatment phase, the rats were allowed to rest for one week before undergoing behavioral assessments and histopathological analyses. In the subsequent step, hippocampal tissue was collected for RNA extraction. Animals were anesthetized with an intraperitoneal injection of ketamine hydrochloride (90 mg/kg, 10%) and xylazine (13 mg/kg, 2%). To prevent hypothermia, sterile gauze was placed under the animals, and ambient temperature was maintained between 22–25°C. After confirming anesthesia, the rats’ hair was shaved using an electric clipper, and the surgical area was disinfected using povidone-iodine and alcohol under aseptic conditions. The brains were carefully removed, and the hippocampus was dissected under sterile conditions within a short time frame. The extracted hippocampus was divided into two portions: one was fixed in 10% formalin, and the other was immersed in liquid nitrogen and stored at −80°C for molecular analysis. Total RNA was extracted from the hippocampal tissue using the RNX-PLUS reagent, following the manufacturer’s protocol. The RNA quantity and purity were measured using a Nano-Drop spectrophotometer. The sequence of the genes primers was designed with Primer3 software and ordered from Sinaclon which is shown in Table 1. Finally, the expression levels of PRNP and APP genes were evaluated by quantitative Real-Time PCR, using GAPDH as the internal control gene. Table 1: Primer sequences Primer Nucleotide sequence 3'→5’' PRNP Forward GGCCGGTAGATCAGTACAGC CGCTAGATCTTCTCCCATCG PRNP Reverse APP Forward CCTACGAAGAGGCCACAGAG ACATCCGCCGTAAAAGAATG APP Reverse GAPDH2 Forward TGAACATTACCAGCTCCGTG GACTACCACGATATCCAGACC GAPDH2 Reverse 2-7. Histopathological Evaluation of Brain Tissue Tissue samples were evaluated using hematoxylin and eosin (H&E) staining. Tissue sections were prepared using a microtome, and stained slides were graded by a pathologist. The rat brain tissues were fixed and fully embedded in suitable histological paraffin wax through a standard process consisting of fixation, dehydration, clearing, and paraffin infiltration. Finally, the embedded tissues were sectioned using a microtome for further histological analysis. 2-7-1. Tissue Embedding and Sectioning Once the tissue was fully infiltrated with paraffin, it was embedded in a mold to allow proper orientation and facilitate sectioning with a microtome. The embedding mold was partially filled with molten paraffin, and the tissue sample was carefully positioned in the desired orientation. The mold was then completely filled with additional molten paraffin. Proper orientation of the tissue at this stage is critical, as it determines the quality and type of section obtained. If the embedding process is carried out correctly, the resulting paraffin blocks will be stable and can be stored for extended periods. Tissue sectioning was performed using a microtome, and the thickness of the sections in this study was 5 micrometers. 2-7-2. Hematoxylin and Eosin (H&E) Staining Procedure H&E staining is a widely used, non-specific histological staining method. This technique employs two dyes: hematoxylin and eosin. Eosin is an acidic dye with a negative charge that stains basic (or acidophilic) cellular components in shades of pink or red. These structures are often referred to as eosinophilic. Hematoxylin, on the other hand, acts as a basic dye and is used to stain acidic (or basophilic) structures, rendering them in shades of blue to purple. As a result, in H&E staining, the DNA in cell nuclei and RNA in ribosomes APPear purple or dark blue, while most cytoplasmic components take on pink hues. Deparaffinization: Paraffin surrounding the tissue sections prevents penetration of staining dyes; therefore, slides were immersed in three separate xylene baths for 4 minutes each to remove the paraffin completely. Rehydration: Slides were rehydrated by sequential immersion in descending concentrations of ethanol (absolute ethanol, 90%, 80%, and 70%), each for 3 minutes. Hematoxylin staining: Slides were placed in hematoxylin solution for 15 minutes, then rinsed under running tap water for 3–5 minutes. Differentiation: To remove excess stain and improve nuclear contrast, slides were dipped in acid alcohol for 3 seconds, followed by a second rinse under running water for 3–5 minutes. Lithium carbonate treatment: To enhance nuclear stain fixation, slides were immersed in lithium carbonate solution for 3 minutes and rinsed again with tap water. Eosin staining: Slides were then immersed in eosin solution for 5 to 14 minutes and subsequently rinsed under running tap water for 2–3 minutes. Dehydration: Slides were dehydrated through ascending grades of ethanol (70%, 80%, 90%, and absolute ethanol), each step lasting 3 minutes. Clearing: Clearing was performed using three changes of xylene, each for 3 minutes, to prepare the tissue for permanent mounting. Mounting: Finally, stained slides were removed from the rack, excess xylene was drained, and a drop of Entellan mounting medium was placed on the specimen. A coverslip was carefully placed at a 45-degree angle to avoid air bubbles. Gentle pressure was applied with forceps to eliminate trapped air, and the slides were left to dry for microscopic examination. 2-8. Statistical analysis Data were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for between-group comparisons. Additionally, the Kruskal–Wallis test was employed where appropriate. A p-value of less than 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism version 8. Results 3-1. Findings from the behavioral test in the Alzheimer's model The number of entries into the electrified zone reflects the short-term memory performance of the rats, which was assessed in each group. As shown in Table 2 and Figure 1, the mean number of entries in the sham group over 5 hours was approximately 10. This number increased significantly in the control (Alzheimer’s model) group, reaching 35 entries. However, in the treatment group that received oleocanthal and nano-oleocanthal, the number of entries decreased to 16. Statistical analysis confirmed that AD was successfully induced in the control group (P < 0.05). Furthermore, the treatment group showed a significant improvement in memory performance, approaching normal levels. Table 2: Average number of times rats entered the electric shock area over a 5-hour period Groups Average number of entries Standard deviation P-Value Statistical significance Healthy Sham 10 2 P<0.0001 Yes Control Alzheimer 35 2 P<0.0001 Yes Nano Oleocanthal Treatment 16 1 P<0.0001 Yes 3-2. Histopathological changes in hippocampal samples 3-2-1. Healthy Sham group – hippocampal region, no treatment, no Alzheimer’s induction: The hippocampal tissue demonstrates normal histological features. Neuronal density is preserved, with intact pyramidal cell layers and clearly defined cellular architecture. No evidence of neuronal loss, gliosis, or inflammatory infiltration is identified. The neuropil appears unremarkable and consistent with healthy baseline hippocampal morphology . 3-2-2. Alzheimer’s Control group – hippocampal region, Alzheimer’s induction, no treatment: Marked pathological alterations are observed. The hippocampal region shows reduced neuronal density, with prominent loss of pyramidal neurons. Inflammatory changes are evident, including infiltration of inflammatory cells within the neuropil. The tissue demonstrates degenerative changes consistent with Alzheimer’s pathology, including disorganization of cellular layers and overall compromised structural integrity . 3-2-3. Nano-Oleocanthal-treated Alzheimer’s group – hippocampal region: Histological evaluation shows notable improvement compared with the untreated Alzheimer’s group. Neuronal density is increased, with partial restoration of pyramidal cell layers and reduced signs of degeneration. Inflammatory cell infiltration is markedly decreased, and overall tissue architecture more closely resembles that of the sham group. These findings indicate a neuroprotective effect of Nano-oleocanthal in mitigating hippocampal damage associated with Alzheimer’s induction. 3-3. Changes in the expression of PRNP and APP genes in rat hippocampal tissue In the first step, the purity of the extracted RNA was assessed using a Nano-Drop spectrophotometer, with absorbance ratios at 260/280 nm ranging from 1.84 to 2.12. The RNA concentration was measured to be 46 ng/µL (Table 3). Table 3 Summary of results from measuring RNA concentration and purity with the Nanodrop device Average Range RNA concentration 32 ng/μl 26-33 Absorbance ratio 280/260 nm 1.89 1.84-2.12 In the next step, following cDNA synthesis, after synchronized quantitative Real-Time PCR was performed. Each reaction was run in duplicate, and the ΔCt values were averaged. Gene expression levels were normalized to the housekeeping gene GAPDH2. The Alzheimer’s control group was used as the baseline for comparison, and the expression levels of PRNP and APP genes in the sham and treatment groups are presented in Table 4 and Figure 3 and 4. The expression level of the PRNP gene in the healthy sham group was 1.33 times higher than that in the Alzheimer's control group, indicating a reduction in gene expression following Alzheimer’s induction. Treatment with nano-oleocanthal in the experimental group increased PRNP expression to 2.86 times that of the Alzheimer's control group . Similarly, the expression of the APP gene in the healthy sham group was 1.41 times higher compared to the Alzheimer's control group, again demonstrating a decline in expression associated with AD. Administration of nano-oleocanthal led to an increase in APP expression to 1.78 times the level observed in the Alzheimer's control group (Table 4). Table 4: Expression of PRNP and APP genes in the tested groups Groups PRNP APP Health Sham 1.33 1.41 Alzheimer Control Group 1 1 Oleocanthal-Treatment 1.69 1.89 Nano-Oleocanthal Treatment 2.86 1.78 The results of the analysis of variance (ANOVA) for the relative expression levels of PRNP and APP genes are presented in Table 5. The presence of asterisks next to the values for the PRNP gene indicates a statistically significant difference in gene expression between the study groups, with double asterisks representing significance at the 1% level (P < 0.01) **. In contrast, the presence of "ns" (not significant) next to the values for the APP gene indicates that there was no statistically significant difference in expression levels among the groups for this gene. Table 5 Results of analysis of variance (ANOVA) for relative expression of PRNP and APP genes MS Df APP PRNP Treatment 2 1.45ns 2.12** error 12 1.001 0.221 Discussion and Conclusions The findings of the present study provide compelling evidence that nano-oleocanthal treatment exerts neuroprotective effects in an Alzheimer’s disease rat model, as reflected in behavioral, histopathological, and molecular outcomes. Specifically, nano-oleocanthal significantly improved memory performance, preserved hippocampal neuronal integrity, and modulated the expression of the APP and PRNP genes—two critical regulators of protein folding, synaptic function, and neurodegeneration. A central strength and innovation of this study is the simultaneous assessment of APP and PRNP gene expression, which has rarely been investigated in a combined context in AD models. Our data showed that Alzheimer’s induction led to a reduction in the expression of both genes compared to the sham group, highlighting the disruption of neuronal homeostasis. Following treatment, nano-oleocanthal markedly increased PRNP expression (2.86-fold compared with AD controls), while APP expression was moderately restored (1.78-fold) (Table 6). This dual pattern reveals an important biological distinction: whereas APP upregulation must be carefully interpreted due to its potential to favor amyloidogenic processing, PRNP elevation is strongly associated with neurotrophic and protective functions. This supports recent reports that prion protein acts as a molecular chaperone, mitigating oxidative stress and neutralizing the synaptotoxic effects of Aβ oligomers [27]. Table 6 Clinical interpretation of gene expression ratios in groups Group PRNP Expression Clinical Interpretation (PRNP) APP Expression Clinical Interpretation (APP) Healthy Sham ≈ 1 (baseline) Normal condition ≈ 1 (baseline) Normal condition Alzheimer’s Control ≈ 0.75 (decreased) Reduced expression, possibly less neuroprotective capacity ≈ 0.7 (decreased) Reduced expression, linked to impaired APP processing Oleocanthal Treatment ≈ 1.3 (increased) Elevated expression, restoring protective activity ≈ 1.4 (increased) Increased expression, may support non-amyloidogenic processing Nano-Oleocanthal Treatment ≈ 2.2 (strong increase) Strong enhancement of protective and anti-toxic effects ≈ 1.3 – 1.4 (increased) Similar to oleocanthal, with potentially more stable effect The dual role of APP is further emphasized by our findings. APP is essential for neuronal development and synaptic maintenance; however, its pathogenic potential emerges primarily when amyloidogenic cleavage predominates. In our study, although APP expression was not significantly altered among groups (ANOVA: ns), the partial restoration in treated animals suggests that nano-oleocanthal may create a molecular environment more conducive to non-amyloidogenic processing pathways. This aligns with observations that therapeutic strategies aimed at promoting α-secretase cleavage and reducing β-secretase activity can transform APP into a source of neuroprotection rather than pathology [28]. Another important dimension of this study lies in the histopathological results. Untreated AD animals exhibited classical hippocampal alterations, including neuronal loss, inflammation, and structural disorganization, consistent with human AD pathology. In contrast, nano-oleocanthal-treated rats displayed partial restoration of hippocampal architecture, reduced inflammatory infiltration, and improved neuronal density. These morphological improvements parallel the behavioral findings of enhanced short-term memory performance, indicating that molecular changes were translated into functional and structural neuroprotection. The role of nano-formulation technology represents an additional innovative aspect of this research. Although oleocanthal is well recognized for its antioxidant, anti-inflammatory, and anti-amyloidogenic activities, its therapeutic potential has been limited by poor bioavailability and restricted blood–brain barrier (BBB) permeability [29]. The nano-formulation used in this study overcomes these limitations, as demonstrated by its superior efficacy compared to free oleocanthal in restoring neuronal and cognitive functions. This is consistent with contemporary research highlighting the promise of nanotechnology-based delivery systems for natural compounds in AD [30]. Moreover, oleocanthal’s effects extend beyond amyloid clearance. Studies have shown that it enhances the expression of Aβ transporters such as LRP1 and P-gp, activates amyloid-degrading enzymes like neprilysin (NEP) and insulin-degrading enzyme (IDE), and suppresses neuroinflammatory signaling by modulating astrocyte and microglial activation [29]. The present results suggest that these mechanisms may converge with PRNP upregulation, thereby reinforcing neuronal defenses against oxidative and proteotoxic stress. Taken together, the combined outcomes of this study emphasize the therapeutic potential of targeting dual gene pathways (APP and PRNP) alongside amyloid clearance strategies. The pronounced increase in PRNP expression in the treatment group strongly supports its role as a protective mediator, particularly when APP expression remains relatively stable. This suggests that therapeutic interventions designed to selectively enhance PRNP while promoting non-amyloidogenic APP processing may represent an effective approach for neuroprotection in AD. In terms of broader implications, this study demonstrates the feasibility of harnessing nutraceutical-derived nanotherapeutics for complex neurodegenerative disorders. Oleocanthal, beyond its established cardioprotective and anti-cancer properties, shows considerable promise as a modulator of AD pathology. By using a nano-formulation strategy, our research bridges the gap between preclinical efficacy and potential clinical translation, offering a novel direction for future AD therapy development. Nevertheless, limitations should be acknowledged. The study was conducted in an experimental rat model, and gene expression was assessed at the transcriptional level without parallel protein quantification. Further investigations using proteomic approaches, longitudinal behavioral assessments, and clinical validation are required to substantiate these findings. Despite these limitations, the present study provides valuable insight into the gene-specific and histological effects of nano-oleocanthal, underscoring its relevance for future translational research. Abbreviations Alzheimer's disease (AD), APP (amyloid precursor protein), PrPC (prion protein), amyloid-beta (Aβ), neurofibrillary tau tangles (NFTs), Extra virgin olive oil (EVOO), blood–brain barrier (BBB), P-glycoprotein (P-gp), lipoprotein receptor-related protein 1 (LRP1), ATP-binding cassette transporter A1 (ABCA1), hematoxylin and eosin (H&E) Declarations Ethics Approval The present study was approved by the Research Ethics Committees of Islamic Azad University- Ardabil Branch, under the ethical code IR.IAU.ARDABIL.REC.1401.121 on December 20, 2022. Funding The authors declare that no funding was received from any organization or agency in support of this research. References Alzheimer's disease facts and figures. Alzheimer's & Dementia 2024;20(5):3708–821. https://doi.org/10.1002/alz.13809. Alzheimer's disease facts and figures. Alzheimer's & Dementia 2021;17(3):327–406. https://doi.org/10.1002/alz.12328. Scheltens P, Blennow K, Breteler MMB, Strooper B de, Frisoni GB, Salloway S et al. Alzheimer's disease. The Lancet 2016;388(10043):505–17. Reutzel M, Grewal R, Joppe A, Eckert GP. Age-Dependent Alterations of Cognition, Mitochondrial Function, and Beta-Amyloid Deposition in a Murine Model of Alzheimer's Disease-A Longitudinal Study. Front Aging Neurosci 2022;14:875989. https://doi.org/10.3389/fnagi.2022.875989. Urdánoz-Casado A, Sánchez-Ruiz de Gordoa J, Robles M, Roldan M, Macías Conde M, Acha B et al. circRNA from APP Gene Changes in Alzheimer's Disease Human Brain. International Journal of Molecular Sciences 2023;24(5). https://doi.org/10.3390/ijms24054308. Atri A. The Alzheimer's Disease Clinical Spectrum: Diagnosis and Management. Med Clin North Am 2019;103(2):263–93. https://doi.org/10.1016/j.mcna.2018.10.009. Dexter E, Kong Q. Neuroprotective effect and potential of cellular prion protein and its cleavage products for treatment of neurodegenerative disorders part I. a literature review. Expert Rev Neurother 2021;21(9):969–82. https://doi.org/10.1080/14737175.2021.1965881. Falker C, Hartmann A, Guett I, Dohler F, Altmeppen H, Betzel C et al. Exosomal cellular prion protein drives fibrillization of amyloid beta and counteracts amyloid beta-mediated neurotoxicity. J Neurochem 2016;137(1):88–100. https://doi.org/10.1111/jnc.13514. Rezvani Boroujeni E, Hosseini SM, Fani G, Cecchi C, Chiti F. Soluble Prion Peptide 107-120 Protects Neuroblastoma SH-SY5Y Cells against Oligomers Associated with Alzheimer's Disease. International Journal of Molecular Sciences 2020;21(19). https://doi.org/10.3390/ijms21197273. Gavín R, Lidón L, Ferrer I, Del Río JA. The Quest for Cellular Prion Protein Functions in the Aged and Neurodegenerating Brain. Cells 2020;9(3). https://doi.org/10.3390/cells9030591. Zupo R, Castellana F, Panza F, Solfrizzi V, Lozupone M, Tardugno R et al. Alzheimer's Disease May Benefit from Olive Oil Polyphenols: A Systematic Review on Preclinical Evidence Supporting the Effect of Oleocanthal on Amyloid-β Load. United Arab Emirates; 2025. Silva-Soto MÁ, Carrillo-Fernández P, Saez Lancellotti ET, Medina-Jiménez E, Mogaburo Alba JF, Catena-Granados N et al. Extra Virgin Olive Oil Phenolic Compounds: Modulating Mitochondrial Function and Protecting Against Chronic Diseases-A Narrative Review. Nutrients 2025;17(9). https://doi.org/10.3390/nu17091443. Rivero-Pino F. Oleocanthal - Characterization, production, safety, functionality and in vivo evidences. Food Chem 2023;425:136504. https://doi.org/10.1016/j.foodchem.2023.136504. Jannati S, Patel A, Patnaik R, Banerjee Y. Oleocanthal as a Multifunctional Anti-Cancer Agent: Mechanistic Insights, Advanced Delivery Strategies, and Synergies for Precision Oncology. International Journal of Molecular Sciences 2025;26(12). https://doi.org/10.3390/ijms26125521. Christodoulou A, Nikolaou P-E, Symeonidi L, Katogiannis K, Pechlivani L, Nikou T et al. Cardioprotective potential of oleuropein, hydroxytyrosol, oleocanthal and their combination: Unravelling complementary effects on acute myocardial infarction and metabolic syndrome. Redox Biol 2024;76:103311. https://doi.org/10.1016/j.redox.2024.103311. Nikou T, Karampetsou KV, Koutsoni OS, Skaltsounis A-L, Dotsika E, Halabalaki M. Pharmacokinetics and Metabolism Investigation of Oleocanthal. J Nat Prod 2024;87(3):530–43. https://doi.org/10.1021/acs.jnatprod.3c00422. Jack Jr CR, Bennett DA, Blennow K, Carrillo MC, Dunn B, Haeberlein SB et al. NIA‐AA research framework: Toward a biological definition of Alzheimer's disease. Alzheimer's & Dementia 2018;14(4):535–62. Al Rihani SB, Darakjian LI, Kaddoumi A. Oleocanthal-Rich Extra-Virgin Olive Oil Restores the Blood-Brain Barrier Function through NLRP3 Inflammasome Inhibition Simultaneously with Autophagy Induction in TgSwDI Mice. ACS chemical neuroscience 2019;10(8):3543–54. https://doi.org/10.1021/acschemneuro.9b00175. López-Yerena A, Vallverdú-Queralt A, Mols R, Augustijns P, Lamuela-Raventós RM, Escribano-Ferrer E. Absorption and Intestinal Metabolic Profile of Oleocanthal in Rats. Pharmaceutics 2020;12(2). https://doi.org/10.3390/pharmaceutics12020134. Li Q, Wu Y, Chen J, Xuan A, Wang X. Microglia and immunotherapy in Alzheimer’s disease. Acta Neurologica Scandinavica 2022;145(3):273–8. Nieznanska H, Bandyszewska M, Surewicz K, Zajkowski T, Surewicz WK, Nieznanski K. Identification of prion protein-derived peptides of potential use in Alzheimer's disease therapy. Biochim Biophys Acta Mol Basis Dis 2018;1864(6 Pt A):2143–53. https://doi.org/10.1016/j.bbadis.2018.03.023. Grewal R, Reutzel M, Dilberger B, Hein H, Zotzel J, Marx S et al. Purified oleocanthal and ligstroside protect against mitochondrial dysfunction in models of early Alzheimer's disease and brain ageing. Experimental neurology 2020;328:113248. Tajmim A, Cuevas-Ocampo AK, Siddique AB, Qusa MH, King JA, Abdelwahed KS et al. (-)-Oleocanthal nutraceuticals for Alzheimer’s disease amyloid pathology: Novel oral formulations, therapeutic, and molecular insights in 5xFAD transgenic mice model. Nutrients 2021;13(5):1702. Abdallah IM, Al-Shami KM, Alkhalifa AE, Al-Ghraiybah NF, Guillaume C, Kaddoumi A. Comparison of oleocanthal-low EVOO and oleocanthal against amyloid-β and related pathology in a mouse model of Alzheimer’s disease. Molecules 2023;28(3):1249. Yang E, Wang J, Woodie LN, Greene MW, Kaddoumi A. Oleocanthal ameliorates metabolic and behavioral phenotypes in a mouse model of Alzheimer’s disease. Molecules 2023;28(14):5592. Barbalace MC, Freschi M, Rinaldi I, Zallocco L, Malaguti M, Manera C et al. Unraveling the Protective Role of Oleocanthal and Its Oxidation Product, Oleocanthalic Acid, against Neuroinflammation. Antioxidants 2024;13(9):1074. Nieznanska H, Boyko S, Dec R, Redowicz MJ, Dzwolak W, Nieznanski K. Neurotoxicity of oligomers of phosphorylated Tau protein carrying tauopathy-associated mutation is inhibited by prion protein. Biochim Biophys Acta Mol Basis Dis 2021;1867(11):166209. https://doi.org/10.1016/j.bbadis.2021.166209. Amanzadeh Jajin E, Esmaeili A, Rahgozar S, Noorbakhshnia M. Quercetin-Conjugated Superparamagnetic Iron Oxide Nanoparticles Protect AlCl(3)-Induced Neurotoxicity in a Rat Model of Alzheimer's Disease via Antioxidant Genes, APP Gene, and miRNA-101. Front Neurosci 2020;14:598617. https://doi.org/10.3389/fnins.2020.598617. Goud AC, Kozlov I, Skoupilová P, Malina L, Roy S, Das V. Structural and functional insights into the selective inhibition of mutant tau aggregation by purpurin and oleocanthal in frontotemporal dementia. Protein Sci 2025;34(9):e70240. https://doi.org/10.1002/pro.70240. Babylon L, Grewal R, Stahr P-L, Eckert RW, Keck CM, Eckert GP. Hesperetin Nanocrystals Improve Mitochondrial Function in a Cell Model of Early Alzheimer Disease. Antioxidants 2021;10(7). https://doi.org/10.3390/antiox10071003. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 16 Jan, 2026 Read the published version in BioNanoScience → Version 1 posted Editorial decision: Revision requested 20 Nov, 2025 Reviews received at journal 20 Nov, 2025 Reviewers agreed at journal 07 Nov, 2025 Reviewers invited by journal 05 Nov, 2025 Editor assigned by journal 14 Oct, 2025 Submission checks completed at journal 13 Oct, 2025 First submitted to journal 04 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7777675","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":541615560,"identity":"67e4e0c6-d0fb-4819-8fd6-36d37d559339","order_by":0,"name":"Hooman Ravaei","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Hooman","middleName":"","lastName":"Ravaei","suffix":""},{"id":541615561,"identity":"0b0afd28-bc8a-4273-9776-73dbc92bd68c","order_by":1,"name":"Mohammad Zaefizadeh","email":"","orcid":"","institution":"Ardabil University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"","lastName":"Zaefizadeh","suffix":""},{"id":541615562,"identity":"ba53ecd3-ccbd-4560-ab73-72707d767718","order_by":2,"name":"Ali Abedi","email":"","orcid":"","institution":"Ardabil University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ali","middleName":"","lastName":"Abedi","suffix":""},{"id":541615563,"identity":"9f3bcc35-f7fc-4a12-8ed2-d3bc66894180","order_by":3,"name":"Ghasem Fattahzadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYBACeyD+AGIYALEEQwWQZGZuwKvFsIGBcQZDggFUyxmQFkb8WgwOIGthbAOJEdJy+wBjw88ff+TN+Q8/vPFxXm00fztQy4+Kbbi1nEtgbOxJMDDc2XDM2HLmtuO5Mw4zNjD2nLmNW8sZBvYHPAkGjBsONphJ8247ltsA1MLM2IZXC2PjnwQD+w2H2b9J/51zLHc+MVqagbYkbjjGYybN2FCTu4GQFsMexsZmmTTj5A1neIote44dyN0I1HIQn1/seZgPNr6xkbPdcP74xhs/aupy550/fPDBjwrcWtBj4TCYPIBHPQaoI0XxKBgFo2AUjBAAAP36YGvufgP0AAAAAElFTkSuQmCC","orcid":"","institution":"Ardabil University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Ghasem","middleName":"","lastName":"Fattahzadeh","suffix":""}],"badges":[],"createdAt":"2025-10-04 06:08:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7777675/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7777675/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12668-025-02391-7","type":"published","date":"2026-01-16T16:28:41+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":95918847,"identity":"9535071b-95a1-4e1a-a3d6-34e44eba3eeb","added_by":"auto","created_at":"2025-11-14 12:26:00","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1479549,"visible":true,"origin":"","legend":"","description":"","filename":"N.docx","url":"https://assets-eu.researchsquare.com/files/rs-7777675/v1/c11d09c51dad3b124f6731f0.docx"},{"id":95918849,"identity":"723e7350-f9f8-4791-b07a-669b0c6a92d4","added_by":"auto","created_at":"2025-11-14 12:26:00","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5701,"visible":true,"origin":"","legend":"","description":"","filename":"aec1b46f88b24efd9df0fa3932634b99.json","url":"https://assets-eu.researchsquare.com/files/rs-7777675/v1/15333ca9937de880c7141c22.json"},{"id":95918837,"identity":"2275dfd6-fdb1-4660-87ae-5aeef642987e","added_by":"auto","created_at":"2025-11-14 12:26:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":130455,"visible":true,"origin":"","legend":"\u003cp\u003eGraph of the average number of times rats entered the electric shock area.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7777675/v1/a7d5ac892b687ce4fcd11428.png"},{"id":95918845,"identity":"3727e702-9a16-49d7-b173-6ec773fb33ca","added_by":"auto","created_at":"2025-11-14 12:26:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2124400,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 1 Histopathological images related to the hippocampal region of rats\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7777675/v1/dc37561f10c5f6a965ac75e3.png"},{"id":95918846,"identity":"6c7f08a9-e759-4fa1-87d4-ab9a762dcd0f","added_by":"auto","created_at":"2025-11-14 12:26:00","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":146585,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 2 Expression of PRNP gene in the tested groups\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7777675/v1/3d11dd4408758a95a4eb7e3b.png"},{"id":95918848,"identity":"31b56cf9-130e-4025-a145-843b264e772c","added_by":"auto","created_at":"2025-11-14 12:26:00","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":137817,"visible":true,"origin":"","legend":"\u003cp\u003eFigure 3 Expression of APP gene in the tested groups\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7777675/v1/ac72b200429b74a601679fb6.png"},{"id":100615759,"identity":"3313d554-24e2-41f5-be6d-58d155ee3d53","added_by":"auto","created_at":"2026-01-19 17:36:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4215662,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7777675/v1/efbc634c-0d48-40ff-853e-e7ebe0bd0775.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Evaluation of the Effects of Nano-Oleocanthal on Histopathological Changes and the Expression of APP and PRNP Genes in an Alzheimer's Rat Model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlzheimer\u0026rsquo;s disease (AD) is the most common form of dementia in older adults, accounting for 60\u0026ndash;70% of cases worldwide. With the rapid rise in life expectancy, the global prevalence of AD is projected to triple by 2050, representing a major public health challenge\u0026nbsp;[1]. Pathologically, AD is characterized by the abnormal accumulation of amyloid-beta (A\u0026beta;) plaques, hyperphosphorylated tau neurofibrillary tangles, widespread neuronal loss, and chronic neuroinflammation. These processes are driven by a complex interplay of genetic, molecular, and environmental factors that ultimately compromise synaptic integrity and cognitive performance [2,3].\u003c/p\u003e\n\u003cp\u003eAmong the genetic contributors, the amyloid precursor protein (APP) occupies a central role. APP is indispensable for neuronal growth, synaptogenesis, and plasticity. Under physiological conditions, APP is processed through the non-amyloidogenic pathway, producing soluble fragments that support neuronal health [4]. However, under pathological conditions, APP undergoes amyloidogenic cleavage, leading to excessive A\u0026beta; production and deposition. Interestingly, recent studies suggest that modest upregulation of APP, when coupled with enhanced non-amyloidogenic processing, may actually stabilize neuronal pathways and delay degeneration. This highlights a dual role for APP, where its expression can either sustain neuronal resilience or exacerbate pathological cascades depending on the processing context [5,6].\u003c/p\u003e\n\u003cp\u003eSimilarly, the prion protein (PrPC), encoded by the PRNP gene, has been recognized for its neuroprotective properties. It plays an important role in antioxidant defense, synaptic plasticity, and protection against A\u0026beta; toxicity. Nonetheless, under pathological circumstances, PrPC may engage in deleterious interactions with A\u0026beta; oligomers, promoting synaptic dysfunction and neuronal death. Furthermore, mutations in PRNP are implicated in inherited prion diseases, which share mechanistic similarities with AD through the accumulation of misfolded proteins [7,8]. Therefore, both APP and PRNP genes exhibit context-dependent, dual effects\u0026mdash;acting as protectors in normal states and as potential mediators of neurotoxicity in disease states. Understanding these opposing roles is crucial for developing therapeutic approaches aimed at fine-tuning gene expression and protein processing in AD [9,10].\u003c/p\u003e\n\u003cp\u003eIn the search for effective treatments, natural compounds with multitarget activity are gaining momentum. Among them, oleocanthal, a phenolic compound derived from extra virgin olive oil (EVOO), has drawn significant attention [11]. Oleocanthal exerts strong anti-inflammatory, antioxidant, and anti-amyloidogenic effects. It modulates APP processing toward the non-amyloidogenic pathway, reduces tau aggregation, and promotes the clearance of A\u0026beta; through upregulation of transport proteins such as P-glycoprotein (P-gp) and low-density lipoprotein receptor-related protein-1 (LRP1). Additionally, oleocanthal stimulates the expression of amyloid-degrading enzymes including neprilysin (NEP) and insulin-degrading enzyme (IDE), thereby reducing amyloid burden in the brain [12,13].\u003c/p\u003e\n\u003cp\u003eBeyond AD, oleocanthal has shown broad therapeutic potential. Preclinical studies report its anti-cancer effects, with activity against breast, prostate, and melanoma cells through induction of apoptosis and inhibition of metastasis [14]. Its cardioprotective properties include improvement of endothelial function and reduction of vascular inflammation [15]. Moreover, in metabolic disorders, oleocanthal demonstrates anti-obesity and anti-diabetic effects by modulating insulin sensitivity and lipid metabolism. These pleiotropic activities underscore oleocanthal as a versatile therapeutic agent with applications extending beyond neurodegeneration [16,17].\u003c/p\u003e\n\u003cp\u003eA major limitation of oleocanthal, however, is its low bioavailability and restricted blood\u0026ndash;brain barrier (BBB) penetration. Recent advances in nanotechnology-based drug delivery systems have overcome these challenges [18]. Nano-oleocanthal formulations have shown superior pharmacokinetics, enhanced BBB permeability, and greater therapeutic efficacy in reducing amyloid and tau pathology compared to free oleocanthal. Importantly, nano-formulations improve stability, protect the active compound from degradation, and enable targeted delivery to brain tissue [19].\u003c/p\u003e\n\u003cp\u003eGiven the interplay of APP and PRNP expression in AD pathogenesis, and considering the emerging therapeutic value of oleocanthal and its nano-formulations, investigating their combined impact is highly relevant. The present study aims to evaluate the histopathological changes and gene expression profiles of APP and PRNP in an experimental AD rat model treated with nano-oleocanthal. By addressing both the molecular and histological aspects, this research provides new insights into how oleocanthal-based nano-formulations may modulate the dual roles of APP and PRNP, ultimately contributing to neuroprotection and therapeutic innovation in Alzheimer\u0026rsquo;s disease.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.1. Materials and Equipment and Drugs\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, various chemical reagents, biological kits, laboratory consumables, and analytical instruments were utilized. Oleocanthal and Oleocanthal nano-composite and manganese nano-powder were employed as the main experimental compounds. Injectable physiological serum and formalin were used for biological preparation and tissue fixation. For molecular biology experiments, a cDNA synthesis kit (RT5201, SinaClon, Iran), a Real-Time PCR kit (Sina SYBR Blue HS-qPCRMix, SinaClon, Iran), and an RNA extraction kit (RNX-PLUS-EX6101, SinaClon, Iran) were APPlied. Additional reagents included PCR Master Mix, dNTPs (Fermentas, Canada), and Oligo-dT primers (Fermentas, Canada).\u003c/p\u003e\n\u003cp\u003eLaboratory consumables consisted of RNase-free microtubes (0.2–1.5 mL), standard microtubes (0.2–0.5 mL), RNase-free crystal pipette tips, yellow and blue micropipette tips, tube holders, and 5 mL syringes. Liquid nitrogen was used for rapid freezing procedures.\u003c/p\u003e\n\u003cp\u003eThe experimental procedures were supported by a set of advanced instruments. Thermal cycling was conducted using a Denagen Thermoblock machine (Iran), and agitation was performed with a digital shaker (IKA MS 3D, USA). Centrifugation was carried out using a Hanil Combi 514R refrigerated centrifuge, while real-time amplification was analyzed on a QIAGEN PLEX series Real-Time PCR system. Structural and chemical analyses were performed with a BRUKER Tensor 27 FTIR spectrometer and an HPLC system. For histological processing, a microtome device was employed.\u003c/p\u003e\n\u003cp\u003eStorage and incubation conditions were maintained using freezers at –20 °C and –80 °C, a 4 °C refrigerator, and a LabTech incubator set at 37 °C. Additional equipment such as a vortex mixer was used to ensure proper homogenization of samples.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-2. Experimental Animals\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll ethical principles regarding the use of laboratory animals were observed in accordance with the protocols of the Ministry of Health and Medical Education of Iran and international guidelines for the care and use of laboratory animals. Male Wistar rats (weighing between 250 and 280g) and aged approximately 12 weeks, were obtained from the animal house of Islamic Azad University, Ardabil Branch. The rats were kept in 4 groups in cages with free access to food and water, under a 12-h light/dark cycle (light on 7 am to 7 pm) and controlled temperature (22 ± 2°C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-3. Alzheimer's Disease Induction\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo induce AD, Manganese nano-powder solution was administered intraperitoneally (i.p.) at a dose of 60 mg/kg for 21 consecutive days to the Alzheimer’s control and treatment groups. Following this 21-day induction period, all rats were given a 7-day rest period to allow for stabilization of the disease effect.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-4. MRI Confirmation of Alzheimer's Induction\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo confirm the successful induction of AD in mice, the animals were anesthetized and placed on a flat plastic platform before being placed inside a MRI scanner. MRI imaging of the hippocampus was then performed. As can be seen, Alzheimer's plaques deposited in the hippocampus are clearly visible in MRI sequences of control mice.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-5. Alzheimer's behavioral test\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBehavioral evaluation to confirm successful induction of AD in rats was conducted using the Alzheimer’s Mouse Passive Avoidance Test apparatus (Patent No. 659232632225230000). In this device, the rat is placed on a safe platform area that it can comfortably stand on. At a fixed distance from the rat’s starting position, a food reward is positioned. Between the rat’s location and the food, there is an electrified grid connected to a controlled mild electric shock source. When the rat attempts to move towards the food by stepping onto this grid, it receives a mild electric shock that prompts it to return to the initial platform and inhibits further movement towards the food. This experience is encoded in the rat’s memory.\u003c/p\u003e\n\u003cp\u003eOver time, as the rat forgets the aversive stimulus, it attempts to reach the food again, repeating the cycle. The number of approaches toward the food was recorded by a camera over a 5-hour testing period. Rats with AD exhibit impaired memory and therefore fail to remember the electric shock, resulting in a higher number of approaches to the food compared to healthy controls.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-6. Experimental Groups\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, 28 male Wistar rats were randomly assigned into four groups (with 7 rats in each group):\u003c/p\u003e\n\u003cp\u003eGroup\u0026nbsp;1: Healthy Sham\u003c/p\u003e\n\u003cp\u003eGroup\u0026nbsp;2: Alzheimer's control\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGroup\u0026nbsp;3: Oleocanthal-Treatment\u003c/p\u003e\n\u003cp\u003eGroup\u0026nbsp;4: Nano Oleocanthal-Treatment\u003c/p\u003e\n\u003cp\u003eAfter MRI imaging and behavioral test for confirmation of Alzheimer's induction, treatment with oleocanthal and nano-oleocanthal was initiated in the third and fourth group (treatment groups). Treatment was conducted using 30 mg concentrations of nano-oleocanthal and oleocanthal for one week. Following the treatment phase, the rats were allowed to rest for one week before undergoing behavioral assessments and histopathological analyses. In the subsequent step, hippocampal tissue was collected for RNA extraction. Animals were anesthetized with an intraperitoneal injection of ketamine hydrochloride (90 mg/kg, 10%) and xylazine (13 mg/kg, 2%). To prevent hypothermia, sterile gauze was placed under the animals, and ambient temperature was maintained between 22–25°C. After confirming anesthesia, the rats’ hair was shaved using an electric clipper, and the surgical area was disinfected using povidone-iodine and alcohol under aseptic conditions. The brains were carefully removed, and the hippocampus was dissected under sterile conditions within a short time frame. The extracted hippocampus was divided into two portions: one was fixed in 10% formalin, and the other was immersed in liquid nitrogen and stored at −80°C for molecular analysis. Total RNA was extracted from the hippocampal tissue using the RNX-PLUS reagent, following the manufacturer’s protocol. The RNA quantity and purity were measured using a Nano-Drop spectrophotometer. The sequence of the genes primers was designed with Primer3 software and ordered from Sinaclon which is shown in Table 1. Finally, the expression levels of PRNP and APP genes were evaluated by quantitative Real-Time PCR, using GAPDH as the internal control gene.\u003c/p\u003e\n\u003cp\u003eTable 1: Primer sequences\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"384\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd\u003e\n \u003cp\u003e\u003cstrong\u003eNucleotide sequence 3'→5’'\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePRNP Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eGGCCGGTAGATCAGTACAGC\u003c/p\u003e\n \u003cp\u003eCGCTAGATCTTCTCCCATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003ePRNP Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAPP Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eCCTACGAAGAGGCCACAGAG\u003c/p\u003e\n \u003cp\u003eACATCCGCCGTAAAAGAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eAPP Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGAPDH2 Forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\"\u003e\n \u003cp\u003eTGAACATTACCAGCTCCGTG\u003c/p\u003e\n \u003cp\u003eGACTACCACGATATCCAGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd\u003e\n \u003cp\u003eGAPDH2 Reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\u003cspan dir=\"RTL\"\u003e\u003c/span\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-7. Histopathological Evaluation of Brain Tissue\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTissue samples were evaluated using hematoxylin and eosin (H\u0026amp;E) staining. Tissue sections were prepared using a microtome, and stained slides were graded by a pathologist. The rat brain tissues were fixed and fully embedded in suitable histological paraffin wax through a standard process consisting of fixation, dehydration, clearing, and paraffin infiltration. Finally, the embedded tissues were sectioned using a microtome for further histological analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-7-1. Tissue Embedding and Sectioning\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOnce the tissue was fully infiltrated with paraffin, it was embedded in a mold to allow proper orientation and facilitate sectioning with a microtome. The embedding mold was partially filled with molten paraffin, and the tissue sample was carefully positioned in the desired orientation. The mold was then completely filled with additional molten paraffin. Proper orientation of the tissue at this stage is critical, as it determines the quality and type of section obtained. If the embedding process is carried out correctly, the resulting paraffin blocks will be stable and can be stored for extended periods. Tissue sectioning was performed using a microtome, and the thickness of the sections in this study was 5 micrometers.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-7-2. Hematoxylin and Eosin (H\u0026amp;E) Staining Procedure\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH\u0026amp;E staining is a widely used, non-specific histological staining method. This technique employs two dyes: hematoxylin and eosin. Eosin is an acidic dye with a negative charge that stains basic (or acidophilic) cellular components in shades of pink or red. These structures are often referred to as eosinophilic. Hematoxylin, on the other hand, acts as a basic dye and is used to stain acidic (or basophilic) structures, rendering them in shades of blue to purple. As a result, in H\u0026amp;E staining, the DNA in cell nuclei and RNA in ribosomes APPear purple or dark blue, while most cytoplasmic components take on pink hues.\u003c/p\u003e\n\u003cp\u003eDeparaffinization: Paraffin surrounding the tissue sections prevents penetration of staining dyes; therefore, slides were immersed in three separate xylene baths for 4 minutes each to remove the paraffin completely.\u003c/p\u003e\n\u003cp\u003eRehydration: Slides were rehydrated by sequential immersion in descending concentrations of ethanol (absolute ethanol, 90%, 80%, and 70%), each for 3 minutes.\u003c/p\u003e\n\u003cp\u003eHematoxylin staining: Slides were placed in hematoxylin solution for 15 minutes, then rinsed under running tap water for 3–5 minutes.\u003c/p\u003e\n\u003cp\u003eDifferentiation: To remove excess stain and improve nuclear contrast, slides were dipped in acid alcohol for 3 seconds, followed by a second rinse under running water for 3–5 minutes.\u003c/p\u003e\n\u003cp\u003eLithium carbonate treatment: To enhance nuclear stain fixation, slides were immersed in lithium carbonate solution for 3 minutes and rinsed again with tap water.\u003c/p\u003e\n\u003cp\u003eEosin staining: Slides were then immersed in eosin solution for 5 to 14 minutes and subsequently rinsed under running tap water for 2–3 minutes.\u003c/p\u003e\n\u003cp\u003eDehydration: Slides were dehydrated through ascending grades of ethanol (70%, 80%, 90%, and absolute ethanol), each step lasting 3 minutes.\u003c/p\u003e\n\u003cp\u003eClearing: Clearing was performed using three changes of xylene, each for 3 minutes, to prepare the tissue for permanent mounting.\u003c/p\u003e\n\u003cp\u003eMounting: Finally, stained slides were removed from the rack, excess xylene was drained, and a drop of Entellan mounting medium was placed on the specimen. A coverslip was carefully placed at a 45-degree angle to avoid air bubbles. Gentle pressure was applied with forceps to eliminate trapped air, and the slides were left to dry for microscopic examination.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2-8. Statistical analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for between-group comparisons. Additionally, the Kruskal–Wallis test was employed where appropriate. A p-value of less than 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism version 8.\u003c/p\u003e\n"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3-1. Findings from the behavioral test in the Alzheimer\u0026apos;s model\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe number of entries into the electrified zone reflects the short-term memory performance of the rats, which was assessed in each group. As shown in Table 2 and Figure 1, the mean number of entries in the sham group over 5 hours was approximately 10. This number increased significantly in the control (Alzheimer\u0026rsquo;s model) group, reaching 35 entries. However, in the treatment group that received oleocanthal and nano-oleocanthal, the number of entries decreased to 16. Statistical analysis confirmed that AD was successfully induced in the control group (P \u0026lt; 0.05). Furthermore, the treatment group showed a significant improvement in memory performance, approaching normal levels.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2: Average number of times rats entered the electric shock area over a 5-hour period\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"576\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 189px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAverage number of entries\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eStandard deviation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 166px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-Value\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eStatistical significance\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHealthy Sham\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 189px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 166px;\"\u003e\n \u003cp\u003eP\u0026lt;0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl Alzheimer\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 189px;\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 166px;\"\u003e\n \u003cp\u003eP\u0026lt;0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNano Oleocanthal Treatment\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 189px;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 136px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 166px;\"\u003e\n \u003cp\u003eP\u0026lt;0.0001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 166px;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3-2. Histopathological changes in hippocampal samples\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3-2-1. Healthy Sham group \u0026ndash; hippocampal region, no treatment, no Alzheimer\u0026rsquo;s induction:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe hippocampal tissue demonstrates normal histological features. Neuronal density is preserved, with intact pyramidal cell layers and clearly defined cellular architecture. No evidence of neuronal loss, gliosis, or inflammatory infiltration is identified. The neuropil appears unremarkable and consistent with healthy baseline hippocampal morphology\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;3-2-2. Alzheimer\u0026rsquo;s Control group \u0026ndash; hippocampal region, Alzheimer\u0026rsquo;s induction, no\u003c/strong\u003e \u003cstrong\u003etreatment:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMarked pathological alterations are observed. The hippocampal region shows reduced neuronal density, with prominent loss of pyramidal neurons. Inflammatory changes are evident, including infiltration of inflammatory cells within the neuropil. The tissue demonstrates degenerative changes consistent with Alzheimer\u0026rsquo;s pathology, including disorganization of cellular layers and overall compromised structural integrity\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3-2-3. Nano-Oleocanthal-treated Alzheimer\u0026rsquo;s group \u0026ndash; hippocampal region:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHistological evaluation shows notable improvement compared with the untreated Alzheimer\u0026rsquo;s group. Neuronal density is increased, with partial restoration of pyramidal cell layers and reduced signs of degeneration. Inflammatory cell infiltration is markedly decreased, and overall tissue architecture more closely resembles that of the sham group. These findings indicate a neuroprotective effect of Nano-oleocanthal in mitigating hippocampal damage associated with Alzheimer\u0026rsquo;s induction.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003e\u003cem\u003e3-3. Changes in the expression of PRNP and APP genes in rat hippocampal tissue\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the first step, the purity of the extracted RNA was assessed using a Nano-Drop spectrophotometer, with absorbance ratios at 260/280 nm ranging from 1.84 to 2.12. The RNA concentration was measured to be 46 ng/\u0026micro;L (Table 3).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Table 3 Summary of results from measuring RNA concentration and purity with the Nanodrop device\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"480\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAverage\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRange\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRNA concentration\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e32 ng/\u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e26-33\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAbsorbance ratio 280/260 nm\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e1.89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 200px;\"\u003e\n \u003cp\u003e1.84-2.12\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eIn the next step, following cDNA synthesis, after synchronized quantitative Real-Time PCR was performed. Each reaction was run in duplicate, and the \u0026Delta;Ct values were averaged. Gene expression levels were normalized to the housekeeping gene GAPDH2. The Alzheimer\u0026rsquo;s control group was used as the baseline for comparison, and the expression levels of PRNP and APP genes in the sham and treatment groups are presented in Table 4 and Figure 3 and 4. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe expression level of the PRNP gene in the healthy sham group was 1.33 times higher than that in the Alzheimer\u0026apos;s control group, indicating a reduction in gene expression following Alzheimer\u0026rsquo;s induction. Treatment with nano-oleocanthal in the experimental group increased PRNP expression to 2.86 times that of the Alzheimer\u0026apos;s control group\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eSimilarly, the expression of the APP gene in the healthy sham group was 1.41 times higher compared to the Alzheimer\u0026apos;s control group, again demonstrating a decline in expression associated with AD. Administration of nano-oleocanthal led to an increase in APP expression to 1.78 times the level observed in the Alzheimer\u0026apos;s control group (Table 4).\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eTable 4: Expression of PRNP and APP genes in the tested groups\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 201px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePRNP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAPP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 201px;\"\u003e\n \u003cp\u003eHealth Sham\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e1.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e1.41\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 201px;\"\u003e\n \u003cp\u003eAlzheimer Control Group\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 201px;\"\u003e\n \u003cp\u003eOleocanthal-Treatment\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e1.69\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e1.89\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 201px;\"\u003e\n \u003cp\u003eNano-Oleocanthal Treatment\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e2.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 200px;\"\u003e\n \u003cp\u003e1.78\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eThe results of the analysis of variance (ANOVA) for the relative expression levels of PRNP and APP genes are presented in Table 5. The presence of asterisks next to the values for the PRNP gene indicates a statistically significant difference in gene expression between the study groups, with double asterisks representing significance at the 1% level (P \u0026lt; 0.01)\u003cspan dir=\"RTL\"\u003e\u0026nbsp;**.\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eIn contrast, the presence of \u0026quot;ns\u0026quot; (not significant) next to the values for the APP gene indicates that there was no statistically significant difference in expression levels among the groups for this gene.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Table 5 Results of analysis of variance (ANOVA) for relative expression of PRNP and APP genes\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" style=\"width: 300px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 301px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 151px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 149px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDf\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAPP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePRNP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 151px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreatment\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 149px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 150px;\"\u003e\n \u003cp\u003e1.45ns\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 150px;\"\u003e\n \u003cp\u003e2.12**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 151px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eerror\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 149px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 150px;\"\u003e\n \u003cp\u003e1.001\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 150px;\"\u003e\n \u003cp\u003e0.221\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"Discussion and Conclusions","content":"\u003cp\u003eThe findings of the present study provide compelling evidence that nano-oleocanthal treatment exerts neuroprotective effects in an Alzheimer\u0026rsquo;s disease rat model, as reflected in behavioral, histopathological, and molecular outcomes. Specifically, nano-oleocanthal significantly improved memory performance, preserved hippocampal neuronal integrity, and modulated the expression of the APP and PRNP genes\u0026mdash;two critical regulators of protein folding, synaptic function, and neurodegeneration.\u003c/p\u003e\n\u003cp\u003eA central strength and innovation of this study is the simultaneous assessment of APP and PRNP gene expression, which has rarely been investigated in a combined context in AD models. Our data showed that Alzheimer\u0026rsquo;s induction led to a reduction in the expression of both genes compared to the sham group, highlighting the disruption of neuronal homeostasis. Following treatment, nano-oleocanthal markedly increased PRNP expression (2.86-fold compared with AD controls), while APP expression was moderately restored (1.78-fold) (Table 6). This dual pattern reveals an important biological distinction: whereas APP upregulation must be carefully interpreted due to its potential to favor amyloidogenic processing, PRNP elevation is strongly associated with neurotrophic and protective functions. This supports recent reports that prion protein acts as a molecular chaperone, mitigating oxidative stress and neutralizing the synaptotoxic effects of A\u0026beta; oligomers [27].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 6 Clinical interpretation of gene expression ratios in groups\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"480\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 116px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eGroup\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003ePRNP Expression\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eClinical Interpretation (PRNP)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eAPP Expression\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eClinical Interpretation (APP)\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 116px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eHealthy Sham\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 1 (baseline)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eNormal condition\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 1 (baseline)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eNormal condition\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 116px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eAlzheimer\u0026rsquo;s Control\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 0.75 (decreased)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eReduced expression, possibly less neuroprotective capacity\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 0.7 (decreased)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eReduced expression, linked to impaired APP processing\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 116px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eOleocanthal Treatment\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 1.3 (increased)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eElevated expression, restoring protective activity\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 1.4 (increased)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eIncreased expression, may support non-amyloidogenic processing\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 116px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eNano-Oleocanthal Treatment\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 143px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 2.2 (strong increase)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eStrong enhancement of protective and anti-toxic effects\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 123px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026asymp; 1.3 \u0026ndash; 1.4 (increased)\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 137px;\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eSimilar to oleocanthal, with potentially more stable effect\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eThe dual role of APP is further emphasized by our findings. APP is essential for neuronal development and synaptic maintenance; however, its pathogenic potential emerges primarily when amyloidogenic cleavage predominates. In our study, although APP expression was not significantly altered among groups (ANOVA: ns), the partial restoration in treated animals suggests that nano-oleocanthal may create a molecular environment more conducive to non-amyloidogenic processing pathways. This aligns with observations that therapeutic strategies aimed at promoting \u0026alpha;-secretase cleavage and reducing \u0026beta;-secretase activity can transform APP into a source of neuroprotection rather than pathology [28].\u003c/p\u003e\n\u003cp\u003eAnother important dimension of this study lies in the histopathological results. Untreated AD animals exhibited classical hippocampal alterations, including neuronal loss, inflammation, and structural disorganization, consistent with human AD pathology. In contrast, nano-oleocanthal-treated rats displayed partial restoration of hippocampal architecture, reduced inflammatory infiltration, and improved neuronal density. These morphological improvements parallel the behavioral findings of enhanced short-term memory performance, indicating that molecular changes were translated into functional and structural neuroprotection.\u003c/p\u003e\n\u003cp\u003eThe role of nano-formulation technology represents an additional innovative aspect of this research. Although oleocanthal is well recognized for its antioxidant, anti-inflammatory, and anti-amyloidogenic activities, its therapeutic potential has been limited by poor bioavailability and restricted blood\u0026ndash;brain barrier (BBB) permeability [29]. The nano-formulation used in this study overcomes these limitations, as demonstrated by its superior efficacy compared to free oleocanthal in restoring neuronal and cognitive functions. This is consistent with contemporary research highlighting the promise of nanotechnology-based delivery systems for natural compounds in AD [30].\u003c/p\u003e\n\u003cp\u003eMoreover, oleocanthal\u0026rsquo;s effects extend beyond amyloid clearance. Studies have shown that it enhances the expression of A\u0026beta; transporters such as LRP1 and P-gp, activates amyloid-degrading enzymes like neprilysin (NEP) and insulin-degrading enzyme (IDE), and suppresses neuroinflammatory signaling by modulating astrocyte and microglial activation [29]. The present results suggest that these mechanisms may converge with PRNP upregulation, thereby reinforcing neuronal defenses against oxidative and proteotoxic stress.\u003c/p\u003e\n\u003cp\u003eTaken together, the combined outcomes of this study emphasize the therapeutic potential of targeting dual gene pathways (APP and PRNP) alongside amyloid clearance strategies. The pronounced increase in PRNP expression in the treatment group strongly supports its role as a protective mediator, particularly when APP expression remains relatively stable. This suggests that therapeutic interventions designed to selectively enhance PRNP while promoting non-amyloidogenic APP processing may represent an effective approach for neuroprotection in AD.\u003c/p\u003e\n\u003cp\u003eIn terms of broader implications, this study demonstrates the feasibility of harnessing nutraceutical-derived nanotherapeutics for complex neurodegenerative disorders. Oleocanthal, beyond its established cardioprotective and anti-cancer properties, shows considerable promise as a modulator of AD pathology. By using a nano-formulation strategy, our research bridges the gap between preclinical efficacy and potential clinical translation, offering a novel direction for future AD therapy development.\u003c/p\u003e\n\u003cp\u003eNevertheless, limitations should be acknowledged. The study was conducted in an experimental rat model, and gene expression was assessed at the transcriptional level without parallel protein quantification. Further investigations using proteomic approaches, longitudinal behavioral assessments, and clinical validation are required to substantiate these findings. Despite these limitations, the present study provides valuable insight into the gene-specific and histological effects of nano-oleocanthal, underscoring its relevance for future translational research.\u0026nbsp;\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAlzheimer\u0026apos;s disease (AD), APP (amyloid precursor protein), PrPC (prion protein), amyloid-beta (A\u0026beta;), neurofibrillary tau tangles (NFTs), Extra virgin olive oil (EVOO), blood\u0026ndash;brain barrier (BBB), P-glycoprotein (P-gp), lipoprotein receptor-related protein 1 (LRP1), ATP-binding cassette transporter A1 (ABCA1), hematoxylin and eosin (H\u0026amp;E)\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study was approved by the Research Ethics Committees of Islamic Azad University- Ardabil Branch, under the ethical code IR.IAU.ARDABIL.REC.1401.121 on December 20, 2022.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The authors declare that no funding was received from any organization or agency in support of this research.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAlzheimer\u0026apos;s disease facts and figures. Alzheimer\u0026apos;s \u0026amp; Dementia 2024;20(5):3708\u0026ndash;821. https://doi.org/10.1002/alz.13809.\u003c/li\u003e\n\u003cli\u003eAlzheimer\u0026apos;s disease facts and figures. Alzheimer\u0026apos;s \u0026amp; Dementia 2021;17(3):327\u0026ndash;406. https://doi.org/10.1002/alz.12328.\u003c/li\u003e\n\u003cli\u003eScheltens P, Blennow K, Breteler MMB, Strooper B de, Frisoni GB, Salloway S et al. Alzheimer\u0026apos;s disease. The Lancet 2016;388(10043):505\u0026ndash;17.\u003c/li\u003e\n\u003cli\u003eReutzel M, Grewal R, Joppe A, Eckert GP. Age-Dependent Alterations of Cognition, Mitochondrial Function, and Beta-Amyloid Deposition in a Murine Model of Alzheimer\u0026apos;s Disease-A Longitudinal Study. Front Aging Neurosci 2022;14:875989. https://doi.org/10.3389/fnagi.2022.875989.\u003c/li\u003e\n\u003cli\u003eUrd\u0026aacute;noz-Casado A, S\u0026aacute;nchez-Ruiz de Gordoa J, Robles M, Roldan M, Mac\u0026iacute;as Conde M, Acha B et al. circRNA from APP Gene Changes in Alzheimer\u0026apos;s Disease Human Brain. International Journal of Molecular Sciences 2023;24(5). https://doi.org/10.3390/ijms24054308.\u003c/li\u003e\n\u003cli\u003eAtri A. The Alzheimer\u0026apos;s Disease Clinical Spectrum: Diagnosis and Management. Med Clin North Am 2019;103(2):263\u0026ndash;93. https://doi.org/10.1016/j.mcna.2018.10.009.\u003c/li\u003e\n\u003cli\u003eDexter E, Kong Q. Neuroprotective effect and potential of cellular prion protein and its cleavage products for treatment of neurodegenerative disorders part I. a literature review. Expert Rev Neurother 2021;21(9):969\u0026ndash;82. https://doi.org/10.1080/14737175.2021.1965881.\u003c/li\u003e\n\u003cli\u003eFalker C, Hartmann A, Guett I, Dohler F, Altmeppen H, Betzel C et al. Exosomal cellular prion protein drives fibrillization of amyloid beta and counteracts amyloid beta-mediated neurotoxicity. J Neurochem 2016;137(1):88\u0026ndash;100. https://doi.org/10.1111/jnc.13514.\u003c/li\u003e\n\u003cli\u003eRezvani Boroujeni E, Hosseini SM, Fani G, Cecchi C, Chiti F. Soluble Prion Peptide 107-120 Protects Neuroblastoma SH-SY5Y Cells against Oligomers Associated with Alzheimer\u0026apos;s Disease. International Journal of Molecular Sciences 2020;21(19). https://doi.org/10.3390/ijms21197273.\u003c/li\u003e\n\u003cli\u003eGav\u0026iacute;n R, Lid\u0026oacute;n L, Ferrer I, Del R\u0026iacute;o JA. The Quest for Cellular Prion Protein Functions in the Aged and Neurodegenerating Brain. Cells 2020;9(3). https://doi.org/10.3390/cells9030591.\u003c/li\u003e\n\u003cli\u003eZupo R, Castellana F, Panza F, Solfrizzi V, Lozupone M, Tardugno R et al. Alzheimer\u0026apos;s Disease May Benefit from Olive Oil Polyphenols: A Systematic Review on Preclinical Evidence Supporting the Effect of Oleocanthal on Amyloid-\u0026beta; Load. United Arab Emirates; 2025.\u003c/li\u003e\n\u003cli\u003eSilva-Soto M\u0026Aacute;, Carrillo-Fern\u0026aacute;ndez P, Saez Lancellotti ET, Medina-Jim\u0026eacute;nez E, Mogaburo Alba JF, Catena-Granados N et al. Extra Virgin Olive Oil Phenolic Compounds: Modulating Mitochondrial Function and Protecting Against Chronic Diseases-A Narrative Review. Nutrients 2025;17(9). https://doi.org/10.3390/nu17091443.\u003c/li\u003e\n\u003cli\u003eRivero-Pino F. Oleocanthal - Characterization, production, safety, functionality and in vivo evidences. Food Chem 2023;425:136504. https://doi.org/10.1016/j.foodchem.2023.136504.\u003c/li\u003e\n\u003cli\u003eJannati S, Patel A, Patnaik R, Banerjee Y. Oleocanthal as a Multifunctional Anti-Cancer Agent: Mechanistic Insights, Advanced Delivery Strategies, and Synergies for Precision Oncology. International Journal of Molecular Sciences 2025;26(12). https://doi.org/10.3390/ijms26125521.\u003c/li\u003e\n\u003cli\u003eChristodoulou A, Nikolaou P-E, Symeonidi L, Katogiannis K, Pechlivani L, Nikou T et al. Cardioprotective potential of oleuropein, hydroxytyrosol, oleocanthal and their combination: Unravelling complementary effects on acute myocardial infarction and metabolic syndrome. Redox Biol 2024;76:103311. https://doi.org/10.1016/j.redox.2024.103311.\u003c/li\u003e\n\u003cli\u003eNikou T, Karampetsou KV, Koutsoni OS, Skaltsounis A-L, Dotsika E, Halabalaki M. Pharmacokinetics and Metabolism Investigation of Oleocanthal. J Nat Prod 2024;87(3):530\u0026ndash;43. https://doi.org/10.1021/acs.jnatprod.3c00422.\u003c/li\u003e\n\u003cli\u003eJack Jr CR, Bennett DA, Blennow K, Carrillo MC, Dunn B, Haeberlein SB et al. NIA‐AA research framework: Toward a biological definition of Alzheimer\u0026apos;s disease. Alzheimer\u0026apos;s \u0026amp; Dementia 2018;14(4):535\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eAl Rihani SB, Darakjian LI, Kaddoumi A. Oleocanthal-Rich Extra-Virgin Olive Oil Restores the Blood-Brain Barrier Function through NLRP3 Inflammasome Inhibition Simultaneously with Autophagy Induction in TgSwDI Mice. ACS chemical neuroscience 2019;10(8):3543\u0026ndash;54. https://doi.org/10.1021/acschemneuro.9b00175.\u003c/li\u003e\n\u003cli\u003eL\u0026oacute;pez-Yerena A, Vallverd\u0026uacute;-Queralt A, Mols R, Augustijns P, Lamuela-Ravent\u0026oacute;s RM, Escribano-Ferrer E. Absorption and Intestinal Metabolic Profile of Oleocanthal in Rats. Pharmaceutics 2020;12(2). https://doi.org/10.3390/pharmaceutics12020134.\u003c/li\u003e\n\u003cli\u003eLi Q, Wu Y, Chen J, Xuan A, Wang X. Microglia and immunotherapy in Alzheimer\u0026rsquo;s disease. Acta Neurologica Scandinavica 2022;145(3):273\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eNieznanska H, Bandyszewska M, Surewicz K, Zajkowski T, Surewicz WK, Nieznanski K. Identification of prion protein-derived peptides of potential use in Alzheimer\u0026apos;s disease therapy. Biochim Biophys Acta Mol Basis Dis 2018;1864(6 Pt A):2143\u0026ndash;53. https://doi.org/10.1016/j.bbadis.2018.03.023.\u003c/li\u003e\n\u003cli\u003eGrewal R, Reutzel M, Dilberger B, Hein H, Zotzel J, Marx S et al. Purified oleocanthal and ligstroside protect against mitochondrial dysfunction in models of early Alzheimer\u0026apos;s disease and brain ageing. Experimental neurology 2020;328:113248.\u003c/li\u003e\n\u003cli\u003eTajmim A, Cuevas-Ocampo AK, Siddique AB, Qusa MH, King JA, Abdelwahed KS et al. (-)-Oleocanthal nutraceuticals for Alzheimer\u0026rsquo;s disease amyloid pathology: Novel oral formulations, therapeutic, and molecular insights in 5xFAD transgenic mice model. Nutrients 2021;13(5):1702.\u003c/li\u003e\n\u003cli\u003eAbdallah IM, Al-Shami KM, Alkhalifa AE, Al-Ghraiybah NF, Guillaume C, Kaddoumi A. Comparison of oleocanthal-low EVOO and oleocanthal against amyloid-\u0026beta; and related pathology in a mouse model of Alzheimer\u0026rsquo;s disease. Molecules 2023;28(3):1249.\u003c/li\u003e\n\u003cli\u003eYang E, Wang J, Woodie LN, Greene MW, Kaddoumi A. Oleocanthal ameliorates metabolic and behavioral phenotypes in a mouse model of Alzheimer\u0026rsquo;s disease. Molecules 2023;28(14):5592.\u003c/li\u003e\n\u003cli\u003eBarbalace MC, Freschi M, Rinaldi I, Zallocco L, Malaguti M, Manera C et al. Unraveling the Protective Role of Oleocanthal and Its Oxidation Product, Oleocanthalic Acid, against Neuroinflammation. Antioxidants 2024;13(9):1074.\u003c/li\u003e\n\u003cli\u003eNieznanska H, Boyko S, Dec R, Redowicz MJ, Dzwolak W, Nieznanski K. Neurotoxicity of oligomers of phosphorylated Tau protein carrying tauopathy-associated mutation is inhibited by prion protein. Biochim Biophys Acta Mol Basis Dis 2021;1867(11):166209. https://doi.org/10.1016/j.bbadis.2021.166209.\u003c/li\u003e\n\u003cli\u003eAmanzadeh Jajin E, Esmaeili A, Rahgozar S, Noorbakhshnia M. Quercetin-Conjugated Superparamagnetic Iron Oxide Nanoparticles Protect AlCl(3)-Induced Neurotoxicity in a Rat Model of Alzheimer\u0026apos;s Disease via Antioxidant Genes, APP Gene, and miRNA-101. Front Neurosci 2020;14:598617. https://doi.org/10.3389/fnins.2020.598617.\u003c/li\u003e\n\u003cli\u003eGoud AC, Kozlov I, Skoupilov\u0026aacute; P, Malina L, Roy S, Das V. Structural and functional insights into the selective inhibition of mutant tau aggregation by purpurin and oleocanthal in frontotemporal dementia. Protein Sci 2025;34(9):e70240. https://doi.org/10.1002/pro.70240.\u003c/li\u003e\n\u003cli\u003eBabylon L, Grewal R, Stahr P-L, Eckert RW, Keck CM, Eckert GP. Hesperetin Nanocrystals Improve Mitochondrial Function in a Cell Model of Early Alzheimer Disease. Antioxidants 2021;10(7). https://doi.org/10.3390/antiox10071003.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bionanoscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bnsc","sideBox":"Learn more about [BioNanoScience](http://link.springer.com/journal/12668)","snPcode":"12668","submissionUrl":"https://submission.nature.com/new-submission/12668/3","title":"BioNanoScience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Alzheimer's, APP, PRNP, PrPC, nano-oleocanthal, hippocampus","lastPublishedDoi":"10.21203/rs.3.rs-7777675/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7777675/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003ePurpose\u003c/strong\u003e Alzheimer's disease (AD) is the most common type of dementia. Recently, many studies have shown the effect of natural compounds on this disease. This study aimed to evaluate the effects of nano-oleocanthal on histopathological changes and expression of APP (amyloid precursor protein gene) and PRNP genes in a rat model of AD.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and Methods\u003c/strong\u003e In this experiment, 28 male rats with an average weight of 250 to 280g were divided into four groups: Healthy sham, Alzheimer's control, Oleocanthal-treatment and Nano-Oleocanthal-treatment groups. After Alzheimer's induction by manganese nano-powder for 21 consecutive days, followed by a 7-day rest period, the two treatment groups were treated intraperitoneally with standardized 30mg concentrations of nano oleocanthal and oleocanthal for one week. After one week treatment and one week rest, brain tissue was isolated. Histopathological changes were assessed using hematoxylin and eosin (H\u0026amp;E) staining. RNA was extracted by sampling the hippocampus of the mice. The expression of APP and PRNP genes was evaluated using Real-time PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e Behavioral and MRI tests showed Alzheimer's plaques in the hippocampus. Histopathology results also showed a positive effect of nano-oleocanthal treatment on significant increasing APP and PRNP gene expression in mice treated with nano-oleocanthal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDiscussion and Conclusion\u003c/strong\u003e According to the histopathology and gene expression results, nano-oleocanthal can be used for the prevention and target treatment of Alzheimer's with further research.\u003c/p\u003e","manuscriptTitle":"Evaluation of the Effects of Nano-Oleocanthal on Histopathological Changes and the Expression of APP and PRNP Genes in an Alzheimer's Rat Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-14 12:25:55","doi":"10.21203/rs.3.rs-7777675/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-20T10:03:02+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-20T06:36:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"216818060035693908704855348095652426547","date":"2025-11-07T14:24:10+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-11-05T09:28:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-14T07:44:32+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-14T01:01:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"BioNanoScience","date":"2025-10-04T05:56:40+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bionanoscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bnsc","sideBox":"Learn more about [BioNanoScience](http://link.springer.com/journal/12668)","snPcode":"12668","submissionUrl":"https://submission.nature.com/new-submission/12668/3","title":"BioNanoScience","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6503704e-88d4-4c65-ad46-9bcbe6c49758","owner":[],"postedDate":"November 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-19T17:04:45+00:00","versionOfRecord":{"articleIdentity":"rs-7777675","link":"https://doi.org/10.1007/s12668-025-02391-7","journal":{"identity":"bionanoscience","isVorOnly":false,"title":"BioNanoScience"},"publishedOn":"2026-01-16 16:28:41","publishedOnDateReadable":"January 16th, 2026"},"versionCreatedAt":"2025-11-14 12:25:55","video":"","vorDoi":"10.1007/s12668-025-02391-7","vorDoiUrl":"https://doi.org/10.1007/s12668-025-02391-7","workflowStages":[]},"version":"v1","identity":"rs-7777675","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7777675","identity":"rs-7777675","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}