Study on improving the resistance of indica thermo-sensitive genic male sterile (TGMS) line by using the broad-spectrum blast resistance gene Pi-ja | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Study on improving the resistance of indica thermo-sensitive genic male sterile (TGMS) line by using the broad-spectrum blast resistance gene Pi-ja Ying Zhang, Aifang Zhang, Jianhua Jiang, Xiaojing Dang, Dezheng Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3971421/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract At present, it is one of the common methods to seek and utilize the broad-spectrum resistance genes to improve the resistance of breeding parents to rice blast. In this study, a japonica rice line 7001S containing a broad-spectrum Pi-ja gene resistant to rice blast was used as a female parent to hybridize with five indica thermo-sensitive genic male sterile (TGMS) lines, Guangmo S, Xiner S, WA918S, W226S and W869S, respectively, using SSR marker RM27322 to identify Pi-ja genotypes, five indica TGMS lines containing a broad spectrum Pi-ja resistance gene to rice blast were established. Furthermore, the five indica TGMS lines with a broad-spectrum Pi-ja resistance gene were used to cross with restorer lines R2877, R900 and PR6547, the correlation between rice blast at seedling stage and panicle stage and the increase of plot yield were studied. The results showed that the resistance of TGMS lines and their combinations with and without Pi-ja gene were significantly different. Pi-ja gene could significantly enhance the resistance of TGMS lines to rice blast at seedling stage and panicle stage. Further plot yield tests showed that for combinations with or without Pi-ja gene, the correlation between panicle blast resistance variation and plot yield (r = 0.436, P = 0.157) was significantly higher than that between seedling blast resistance variation and plot yield (r = 0.130, p = 0.687). This study provides a technical basis for the breeding of rice varieties with broad-spectrum resistance to rice blast by molecular marker-assisted selection. Indica rice Thermo-sensitive genic male sterile line Broad-spectrum Blast resistance Pi-ja Figures Figure 1 Introduction Rice blast, caused by fungi, is one of the most destructive diseases, causing major losses in rice yield and even a loss of harvest when the disease is severe (Khan et al., 2014 ). Planting rice varieties resistant to rice blast is the most economical and safe way to control the disease (Sharma et al., 2012 ; Nie et al., 2016 ). In recent years, the resistance to rice blast has been regarded as one of the key indexes in the validation of new rice varieties in China. However, some new rice varieties in the existing production generally lost their resistance after 3–5 years of application. The main reason is that the physiological races of Magnaporthe grisea have high variability, and the resistance gene spectrum carried by rice varieties is narrow. The disease spreads rapidly under suitable environmental conditions (An et al., 2010 ; Jiang et al., 2015 ; Liang et al., 2017 ). Therefore, it is the most efficient way to exploit and utilize broad-spectrum and durable resistant resources to breed varieties with broad-spectrum resistance to rice blast (Liu et al., 2011 ; Ellur et al., 2016 ). According to incomplete statistics, more than 100 rice blast resistance genes have been mapped so far, more than 30 blast resistance genes were cloned from different rice varieties (Zhao and Ma, 2021 ; Zhang et al., 2022 ; Gao et al., 2022 ; Yang et al., 2023 ). However, most of the existing resistance genes, such as Pi1 , Pi9 , Pi25 , Pi50 , Pia , Pib and Pita , have narrow resistance profiles and are not durable (Devi et al., 2015 ; Ni et al., 2015 ) . 7001S is a japonica photoperiod-sensitive genic male sterile line, which was bred by crossing Nongken 58S with 917, a conventional line. It has been planted in the rice blast-stricken areas of Anhui, Sichuan, Yunnan and Guizhou for many years. The results showed that the male sterile line was highly resistant to 22 isolates of Magnaporthe grisea from different rice regions in China, with strong resistance, broad spectrum and long duration (Li et al., 2014 ). Meanwhile, Li Bin et al. (2014) found that the resistance of japonica rice 7001S to Magnaporthe grisea was controlled by a single dominant nuclear gene or a single dominant QTL locus, the gene is located in a range of approximately 310 kb between P21-2415 and RM27322 at the end of the long arm of chromosome 11, and the molecular markers closely linked to the target gene are P21-2415 and RM27322. Furthermore, Li et al. ( 2014 ) named the resistance gene Pi-ja . In this study, 7001S was used as a female parent to hybridize with five indica thermo-sensitive genic male sterile (TGMS) lines, Guangmo S, Xiner S, WA918S, W226S and W869S, respectively, and SSR marker RM27322 of Pi-ja Gene was used for assisted selection, the aim of this study was to construct five indica TGMS lines containing a broad-spectrum Pi-ja gene for blast resistance. On this basis, the five indica rice TGMS lines with Pi-ja gene were crossed with restorers R2877, R900 and PR6547 to study the correlation between rice blast at seedling and panicle stage and the increase of plot yield. This study provides a technical support for the use of broad-spectrum durable blast resistance genes and molecular marker-assisted selection (MAS) to improve the blast resistance of parents of two-line rice genic male sterile lines. Materials and methods Plant materials As shown in Table 1 , the test materials used for Pi-ja donor were 7001S, and five CMS lines used for receptor were Guangmo S, Xiner S, WA918S, W226S and W869S, and three restorer lines (R2877, R900 and PR6547) were used for combination. Table 1 Information of testing materials No. Materials Types Pedigrees Characters Sources S1 7001S Japonica photo-TGMS line Nongken 58S /917 With Pi-ja Rice Research Institute, Anhui Academy of Agricultural Sciences S2 Guangmo S Indica TGMS line Guangzhan 63-4S Molixinzhan Rice Research Institute, Anhui Academy of Agricultural Sciences S3 Xiner S Indica TGMS line XinanS//XinanS/2301S High quality Rice Research Institute, Anhui Academy of Agricultural Sciences S4 WA918S Indica TGMS line 1892S/ Guangmo S Semi-dominant dwarf Rice Research Institute, Anhui Academy of Agricultural Sciences S5 W226S Indica TGMS line P88S/ Guangmo S High combining ability Rice Research Institute, Anhui Academy of Agricultural Sciences S6 W869S Indica TGMS line Y58S/Aizi S Semi-dominant dwarf Rice Research Institute, Anhui Academy of Agricultural Sciences R1 R2877 Indica restorer line --- With Pi2 Institute of Agricultural Sciences of Zhaoqing, Guangdong province R2 R900 Indica-japonica restorer lines with strong heterosis --- High combining ability Hunan Yuan Chuang Super Rice Technology Co., Ltd. R3 PR6547 Indica wide compatibility restorer line --- With Pi9 Institute of Agricultural Sciences of Lixiahe region, Jiangsu province Field planting and character investigation Cross-bred hybrids were planted in Lujiang County, Hefei, in the summer of 2018. The experiment was designed according to random block design and repeated 3 times. The space between plots was 26.7 cm, the space between groups was 40.0 cm, 3–5 rows were planted in each plot, 9 plants in each row, total 27–45 plants. The seeds were sown on May 7 and transplanted per plant on May 7. The density was 16.7 cm × 26.7 cm. Field management as general field. After ripening, 5 plants were taken from the middle of each plot, and plant height, effective panicle number, panicle length, total grains per panicle, filled grains per panicle, blighted grains per panicle (to calculate seed setting rate), 1000-grain weight and grain weight per plant were investigated. Identification of Pi-ja genotypes Total DNA extracted by CTAB method was used as template, and SSR molecular marker RM27322 closely linked to the Pi-ja Gene was used for Pi-ja genotyping: F: AGAGCCCATGTAGCTACGCCTTCG, R: AATCATGCCGGCTGAAATTGTACC (Li Bin et al., 2014) . The PCR system was as follows: DNA template 2 ΜL, primers 2 ΜL, Taq enzyme 10 µl, adding ddH2O to total volume 20 µl. The PCR procedure was as follows: predenaturation at 95 ° C for 5 min, denaturation at 95 ° C for 30 s, annealing at 55 ° C for 30 S, extension at 72 ° C for 1 min, 35 cycles, extension at 72 ° C for 10 min. PCR products were ethidium bromide on 1.5% agarose gel for 1.5 h and photographed under a gel imaging system. Identification of rice blast The identification of seedling blast and leaf blast was carried out by artificial inoculation. Six dominant rice blast strains ZA-0, ZA-1, ZA-2, ZB-1, Zb-2 and Zb-3 from Anhui province were isolated and purified. Single-spore culture was carried out, and conidia were propagated. The seeds of the tested materials were soaked and germinated, then sowed in a seedling-raising tray, and 10–15 seeds were sown in each portion of the materials. When the seedlings were at 3–4 leaf stage, the spores (2 × 105 spores/ml) of the strain were sprayed. After inoculation, the plants were placed in a greenhouse at 24–28°C, and sprayed regularly to keep them moist. The incidence of rice leaf disease was recorded 7 days after inoculation. The identification of panicle blast was carried out by natural induction in the field. The experiment was conducted in Jinzhai County, Anhui province, where the rice blast was most prevalent. The incidence of seedling blast and the rate of panicle loss at maturity were recorded and graded according to the standard of Yang et al. (2005). Results Establishment of indica TGMS lines with Pi-ja blast resistance gene In the spring of 2011, the Pi-ja gene donor material 7001S was crossed with five indica TGMS lines including Guangmo S etc. in Lingshui, Hainan province. In the summer of 2011, F 1 was planted in Hefei and backcrossed with the five parents including Guangmo S etc. to harvest BC 1 F 1 seeds. In the spring of 2012, BC 1 F 1 was planted in Hainan, and the excellent individual plants were selected by visual observation at heading date and then sampled for molecular assistant selection, and then the selected positive plants were backcrossed with the parental receptor to harvest BC 2 F 1 seeds. In the summer of 2012, and 2013, 2014, 2015, the characters were selected systematically in favor of the recipient parent sterile line, and then molecular marker-assisted selection was carried out repeatedly, finally, indica TGMS lines weres obtained which was homozygous for Pi-ja and had stable comprehensive characters. And then through the identification of resistance to rice blast screening methods, five indica TGMS lines resistant to rice blast including Guangmo S J , Xiner S J , WA918S J , W226S J and W869S J (The superscript of J indicated that the material contained Pi-ja gene), which were similar to their parents, were developed with Pi-ja gene (Fig. 1 ) . Resistance of indica TGMS lines without and with Pi-ja gene The seedlings blast resistance of TGMS lines without and with Pi-ja Gene was shown in Table 2 . Without Pi-ja gene, there were three 2-grades, two 4-grades, and three R and two MS resistance types. With Pi-ja Gene, the resistance to blast was four 1 grade, one 3 grade, and the resistance types were four R and one MR. The seedlings blast resistance of W226S increased from 4 to 1, that of Guangmo S, Xiner S and W869S from 2 to 1, and that of WA918S from 4 to 3. The results showed that the Pi-ja resistant gene had a significant effect on rice seedlings blast. Table 2 Blast resistance of indica TGMS lines without and with Pi-ja gene No. Materials Sources Seedlings blast Panicle blast Resistance Types Resistance Change value Resistance Types Resistance change value 1 Guangmo S J Guangmo S 3 /7001S 1 R 1 3 MR 4 2 Guangmo S Guangzhan 63S-4/Molixinzhan 2 R 7 S 3 Xiner S J Xiner S 3 /7001S 1 R 1 3 MR 2 4 Xiner S Xinan S 2 /2301S 2 R 5 MS 5 WA918S J WA918S 3 /7001S 3 MR 1 7 S 0 6 WA918S 1892S/Guangmo S 4 MS 7 S 7 W226S J W226S 3 /7001S 1 R 3 3 MR 4 8 W226S P88S×Guangmo S 4 MS 7 S 9 W869S J W869S 3 /7001S 1 R 1 3 MR 4 10 W869S Y58S×Aizi S 2 R 7 S Note: Resistance Change Value = Resistance grade of materials without Pi-ja gene - Rresistance grade of materials with Pi-ja gene. In addition, the resistance to panicle blast of indica TGMS lines without and with Pi-ja resistance gene can be seen from Table 2 . Without Pi-ja gene, there were four 7-grade and one 5-grade resistance, four S and one MS resistance types. With Pi-ja Gene, the resistance to blast was four 3 grade, one 7 grade, and the resistance types were four MR and one S. The panicle blast resistance of Guangmo S, W226s and W869s increased from grade 7 to Grade 3, Xiner S from grade 5 to Grade 3, and WA918S remained grade 7. The results showed that the Pi-ja resistant gene also had a significant effect on rice panicle blast. Comparative studies on disease resistance and yield of combinations of TGMS lines without and with Pi-ja gene The results of the plot yield test of 12 combinations of indica TGMS lines Guangmo S, Xiner s, WA918S, W226S without and with Pi-ja resistance gene and restorer lines R2877, R900 and PR6547 are shown in Table 3 . Table 3 disease resistance and plot yield of indica TGMS lines without and with Pi-ja gene Combinations Seedlings blast Panicle blast the plot yield(kg/Mu, %) Yield analysis Rice qualities R Types R Change value R Types R change value Yield change Percentage change(%) Guangmo S J /R2877 1 R 2 3 MR 2 756.0/4.8 24.5 3.4 Level 3 Guangmo S/R2877 3 MR 5 MS 731.5/1.4 Level 3 Guangmo S J / R900 1 R 2 3 MR 4 766.8/6.3 28.1 3.9 Level 3 Guangmo S/ R900 3 MR 7 S 738.7/2.4 Level 3 Guangmo S J /PR6547 1 R 0 3 MR 2 794.4/10.1 61.2 8.4 Level 3 Guangmo S/PR6547 1 R 5 MS 733.2/1.7 Level 3 WA918S J /R2877 1 R 0 3 MR 0 725.3/0.6 -55.7 -7.7 Level 3 WA918S/R2877 1 R 3 MR 781.0/8.3 Level 3 WA918 J S/ R900 2 R -1 3 MR 0 740.9/2.7 32.7 4.5 Level 3 WA918S/ R900 1 R 3 MR 708.2/-1.8 Level 3 WA918S J /PR6547 1 R 0 3 MR 0 724.1/0.4 -105.6 -14.6 Level 3 WA918S/PR6547 1 R 3 MR 829.7/15.0 Level 3 Xiner S J /R2877 1 R 3 3 MR 4 768.0/6.5 30.7 4.3 Level 3 Xiner S/R2877 4 MS 7 S 737.3/2.2 Level 3 Xiner S J / R900 1 R 2 3 MR 4 796.8/10.5 24.9 3.5 Level 3 Xiner S/ R900 3 MR 7 S 771.9/7.0 Level 3 Xiner S J /PR6547 1 R 1 3 MR 2 788.4/9.3 41.8 5.8 Level 2 Xiner S/PR6547 2 R 5 MS 746.6/3.5 Level 2 W226S J /R2877 1 R 0 3 MR 2 891.1/23.6 133.2 18.5 Level 3 W226S/R2877 1 R 5 MS 757.9/5.1 Level 3 W226S J / R900 1 R 2 3 MR 2 861.1/19.4 63.3 8.8 Level 3 W226S/ R900 3 MR 5 MS 797.8/10.6 Level 3 W226S J /PR6547 1 R 1 3 MR 2 742.8/3.0 -10.2 -1.4 Level 2 W226S/PR6547 2 R 5 MS 753.0/4.4 Level 2 Note: R Change Value = Resistance without Pi-ja gene - Resistance with Pi-ja gene; Yield change = Yield of combination with Pi-ja gene - yield of combination without Pi-ja gene; Percentage change (%) = Percentage increase in yield (%) of combinations with Pi-ja gene - percentage increase in yield (%) of combinations without Pi-ja gene. The performance of seedling blast can be seen from Table 3 . Without Pi-ja gene, there were five 1-grade, two 2-grades, four 3-grades, one 4-grade resistance, and seven R, four MR and one MS resistance types. With Pi-ja gene, there were eleven 1-grades, one 2-grade, and twelve R resistance types. Among them, two combinations of Guangmo S increased from Grade 3 to Grade 1, and one combination of WA918S decreased from grade 1 to Grade 2, the three combinations of Xiner S were increased from grade 4, Grade 3 and Grade 2 to Grade 1 respectively, and the two combinations of the W226s were increased from Grade 3 and Grade 2 to Grade 1 respectively. The resistance of other combinations did not change. Therefore, the Pi-ja Gene has an effect on the blast resistance of other combinations except WA918S. In addition, the resistance to panicle blast can be seen from Table 3 . Without Pi-ja gene, there were three 3-grades, six 5-grades, three 7grades, and three MR, six MS and three S resistance types. With Pi-ja gene, there were twelve 3-grades, and twelve MR resistance types. Among them, two combinations of Guangmo S increased from grade 5 to Grade 3, one combination increased from grade 7 to Grade 3, and three combinations of WA918S remained unchanged, the two combinations of Xiner S increased from 7 to 3, one from 5 to 3, and the three combinations of the W226s all increased from 5 to 3. Therefore, Pi-ja Gene had a significant effect on the resistance to panicle blast in all combinations except WA918S. The yield of combinations without Pi-ja resistance gene and with Pi-ja resistance gene was compared from plot 12 of Table 3 . The yield increasing range (kg) of the three combinations of Guangmo S were 24.5, 28.1 and 61.2, and the yield changing percentage (%) were 3.4, 3.9 and 8.4, respectively. The yield increases (kg) of three combinations of WA918S were − 55.7, 32.7, -105.6, and the yield change percentages (%) were − 7.7, 4.5, and 14.6, respectively. The yield increasing range (kg) of the three combinations of Xiner S were 30.7, 24.9 and 41.8, and the yield changing percentage (%) were 4.3, 3.5 and 5.8, respectively. The yield increasing range (kg) of three combinations of W226s was 133.2, 63.3, -10.2, and the yield changing percentage (%) was 18.5, 8.8, and-1.4, respectively. Therefore, except two combinations of WA918S and one combination of W226S, the other combinations all increased yield under the influence of Pi-ja resistance gene. The Pearson Correlation analysis between the resistance of 12 combinations without and with Pi-ja resistance gene to seedling blast and panicle blast and the yield increase of the plot was carried out in Table 4 , the correlation between the change of resistance to panicle blast and the increase of yield in the plot (r = 0.436, P = 0.157) was significantly higher than that between the change of resistance to seedling blast and the increase of yield in the plot (r = 0.130, P = 0.687). Table 4 Correlations Change of resistance to seedling blast Change of resistance to panicle blast Yield increases Yield percentage change(%) Change of resistance to seedling blast Pearson Correlation Sig. (2-tailed) N Change of resistance to panicle blast Pearson Correlation .816(**) Sig. (2-tailed) .001 N 12 Yield increases Pearson Correlation .130 .436 Sig. (2-tailed) .687 .157 N 12 12 Yield percentage change(%) Pearson Correlation .132 .437 1.000(**) Sig. (2-tailed) .682 .155 .000 N 12 12 12 ** Correlation is significant at the 0.01 level (2-tailed). Discussion Rice blast is one of the most important diseases of rice, which is characterized by rapid spread, wide occurrence, high outbreak frequency and serious damage. In our country all year round there are different degrees of occurrence, and the yield loss can reach 40% ~ 50%, and some fields even have no grain yield (Hong and Tong, 2006 ). Mining effective resistance genes, introducing disease resistance genes into rice varieties through biotechnology to rapidly develop resistant rice varieties is an important way to solve the problem of rice blast (Chen et al., 2004 ; Liu et al., 2008 ; Zhu et al., 2014 ; Ma et al., 2015 ). In recent years, a great deal of research has been done on the mechanism of rice blast and rice resistance, and a great breakthrough has been made. However, because of the rapid variation of rice blast races and the complexity of the environment, varieties containing a single resistance gene will lose their original resistance after a few years. Therefore, breeding new rice varieties with broad-spectrum resistance becomes the key of rice breeding for disease resistance (Li et al., 2014 ). In this study, a japonica rice line 7001S containing a broad-spectrum Pi-ja gene resistant to rice blast was used as a female parent to hybridize with five indica thermo-sensitive genic male sterile (TGMS) lines, and used SSR marker RM27322 to identify Pi-ja genotypes, five indica TGMS lines containing a broad spectrum Pi-ja resistance gene to rice blast were established (Fig. 1 ). Further research showed that Pi-ja gene could significantly enhance the resistance of TGMS lines to rice blast at seedling stage and panicle stage (Table 2 ), and crossed with restorer lines, the correlation between panicle blast resistance variation and plot yield (r = 0.436, P = 0.157) was significantly higher than that between seedling blast resistance variation and plot yield (r = 0.130, p = 0.687) (Table 3 , Table 4 ). As mentioned above, some of the known blast resistance genes generally have the problems of narrow resistance spectrum and low persistence, and there is little research on the resistance genes with wide resistance spectrum (Li et al., 2014 ). The main highlight of this study is to introduce the broad-spectrum and durable resistance Pi-ja gene into the indica TGMS lines and create indica TGMS lines containing Pi-ja gene. Compared with the indica TGMS line without Pi-ja gene, the yield of corresponding combinations was obviously increased. This study has important reference value for promoting the application of broad-spectrum resistance genes to rice blast. Secondly, in this study, the disease resistance genes of japonica materials were transferred into two-line CMS lines, which could promote the improvement of indica-japonica cross technology. In the previous research, many indica rice resistance genes were introduced into japonica rice, and the ideal effect of disease resistance was obtained and popularized. However, there are few reports about introducing the disease resistance gene from japonica rice into indica rice. In theory, the introduction of a japonica rice resistance gene into indica rice can improve the disease resistance and resist more different races of rice blast, especially those harmful to japonica rice, this is more significant for the hard-hit rice area where indica and japonica rice are planted together. In addition, it should be noted that 7001S is a japonica photo-TGMS line and is crossed with an indica TGMS line, and it is difficult to select an ideal plant because of the severe segregation of its progeny. Multiple backcross screening is required after hybridization. Furthermore, the stigma and exsertion rate of japonica two-line CMS lines were smaller than those of indica two-line CMS lines. The selection of these outcrossing characters should be strengthened during the process of introducing disease resistance genes, so as not to increase resistance and reduce practicality. Declarations Author Declarations Ethics approval and consent to participate Not Applicable. Consent for publication Not Applicable. Availability of data and materials Not Applicable. Funding This study was supported by Key Research and development program of Anhui Province (201904a020016), Talent program of Anhui Academy of Agricultural Sciences (QNYC-201903, QNYC-202103). Authors' contributions Y.Z. and D.W. and J.J. were responsible for Conceptualization, Methodology, Software, Data curation, and wrote the main manuscript text. A.Z. and X.D. were responsible for Software, Validation, and prepared figure 1, table1-4. All authors reviewed the manuscript. Conflicts of interest/Competing interests All authors declare that they have no conflict of interest. References An Z, Liu G, Mei W, Li L, Wang J, Luo L (2010) marker-assisted improvement of rice blast resistance in water-saving and drought-resistant hybrid rice parents. Molecular Plant Breeding, 8(6): 1172–1176 Chen Z, Zheng Y, Wu W, Zhao C (2004) Screening and application of SSR markers tightly linked to rice blast resistance gene Pi-2(t) . Molecular Plant Breeding, 2(3): 321–325 Devi SJSR, Singh K, Umakanth B, Vishalakshi B, Renuka P, Sudhakar KV, Prasad MS, Viraktamath BC, Babu R, Madhav MS (2015) Development and identification of novel rice blast resistant sources and their characterization using molecular markers. Rice Science, 22(6): 300–308 Ellur RK, Khanna A, Yadav A, Pathania S, Rajashekara H, Singh VK, Krishnan SG, Bhowmick PK, Nagarajan M, Vinod KK, Prakash G, Mondal KK, Singh NK, Prabhu KV, Singh AK (2016) Improvement of basmati rice varieties for resistance to blast and bacterial blight diseases using marker assisted backcross breeding. Plant Science, 242: 330–341 Gao Q, Zhang Y, Ge X, Li Y, Ma Y, Jin X (2022) Research progress on rice blast resistance genes. Molecular Plant Breeding, 20(11): 3634–3643 Yang H, Wang L, Li B, Cai J (2023) Research progress on rice blast in Zhejiang province. Chinese rice, 29(3): 46–50 Hong J, Tong X (2006) Rice diseases and their control in China. Shanghai Scientific and Technical Publishers, Shanghai Jiang JF, Mou TM, Yu HH, Zhou FS (2015) Molecular breeding of thermo-sensitive genic male sterile (TGMS) lines of rice for blast resistance using Pi2 gene. Rice, 8(11):1–10 Khan MAI, Bhuiyan MR, Hossain MS, Sen PP, Ara A, Siddique MA, Ali MA (2014) Neck blast disease influences grain yield and quality traits of aromatic rice. Comptes Rendus Biologies, 337: 635–641 Li B, Deng Y, Yan X, Yang Y, Liu P, Du Y, Xie P, Wang D, Deng Q, Li P (2014) Identification, genetic analysis and gene mapping of a blast resistance gene from japonica rice. Acta Agronomica Sinica, 40(1): 54–62 Liang Y, Yan BY, Peng YL, Ji ZJ, Zeng YX, Wu HL, Yang CD (2017) Molecular screening of blast resistance genes in rice germplasms resistant to Magnaporthe oryzae. Rice Science, 24(1): 41–47 Liu P, Wei Y, Chen Y, Zhang J, Xie H (2011) Classification and functional analysis of rice blast resistance genes. Molecular Plant Breeding, 9(2): 128–135 Liu Y, Xu P, Zhang H, Xu J, Wu F, Wu X (2008) Molecular marker-assisted selection and application of rice blast resistance Pib gene. Scientia Agricultura Sinica, 41(1): 9–14 Ma J, Ma X, Zhao Z, Wang S, Wang J, Wang J, Cheng Z, Lei C (2015) Development and application of functional molecular markers for rice blast resistance gene Pi35 [J]. Acta Agronomica Sinica, 41(12): 1779–1790 Murry MG, Thompson WF (1980) Rapid isolation of high-molecular-weight-plant DNA. Nucleic Acids Research, 8(19): 4321–4325 Ni D, Song F, Ni J, Zhang A, Wang C, Zhao K, Yang Y, Wei P, Yang J, Li L (2015) Marker assisted selection of two-line hybrid rice for disease resistance to rice blast and bacterial blight. Field Crops Research, 184: 1–8 Nie Y, Li X, Mao L, Yan M, Yan L, Cai Y (2016) marker-assisted selection for blast resistance improvement in three-line hybrid rice restorer line R225. Chinese rice, 22(3): 60–63 Sharma TR, Rai AK, Gupta SK, Vijayan J, Devanna BN, Ray S (2012) Rice blast management through host-plant resistance: retrospect and prospects. Spanish Journal of Agricultural Research, 1(1): 37–52 Yang S, Liao Q (2005) Rice variety test and approval in China. China Agricultural Science and Technology Press, Beijing, pp 32–35 Zhang Y, Piao R, Chen M, Nan G, Lin X, Jin Y (2022) Advances in molecular mechanism of rice blast resistance and molecular breeding. Molecular Plant Breeding. https://kns.cnki.net/kcms/detail/46 . 1068.s.20220711.1634.006.html Zhao J, Ma Z (2021) Research progress on the application of rice blast resistance genes. Liaoning Agricultural Sciences, (5): 52–56 Zhu J, Wang J, Fan F, Li W, Wang F, Zhong W, Yang J (2014) Identification and application of a new broad-spectrum resistance allele Pi21t to rice blast. Acta Agriculturae Boreali-Sinica, 29(6): 11–15 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3971421","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":274041453,"identity":"d9408dd0-ec55-4ae9-a694-d3cf7e7354fb","order_by":0,"name":"Ying Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYDACCRgpf/jggw8VNgxsxGuRYEs2nHEmjWgtIAaPmjRv22HC7pKf3fzs4dc2izz56B5moC3n7fmkmx8w/KjYhlML45xj5saybRLFhnfOgvxyO7FN5pgBY8+Z2zi1MEskmElLtkkkbmzIA/nldgKbRIIBM2Mbbi1sEunfoFpyzIB+OWcPFPmAVwuPRI6Z5EeglvkSYC0HGNskcvDbIiGRUybNcE4icQPPMZDDkhOBWgoO4vOL/Iz0bZI/yuoS57c3g7xvZw8U2fjgRwVuLeAg4AVGn8EBJJEDOFTCAeOPP0DrGggpGwWjYBSMghELACcPWj7m3aVeAAAAAElFTkSuQmCC","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":true,"prefix":"","firstName":"Ying","middleName":"","lastName":"Zhang","suffix":""},{"id":274041454,"identity":"6238ee0f-7013-422c-b7c8-56e442e065e2","order_by":1,"name":"Aifang Zhang","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Aifang","middleName":"","lastName":"Zhang","suffix":""},{"id":274041455,"identity":"f3ca2cd1-c6d0-4bad-969f-02cfcd1606f5","order_by":2,"name":"Jianhua Jiang","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jianhua","middleName":"","lastName":"Jiang","suffix":""},{"id":274041456,"identity":"863eb50e-9515-4dba-837f-ca3612f6fcd3","order_by":3,"name":"Xiaojing Dang","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xiaojing","middleName":"","lastName":"Dang","suffix":""},{"id":274041457,"identity":"da7963fc-7dd3-43fe-81d1-1f39700b9498","order_by":4,"name":"Dezheng Wang","email":"","orcid":"","institution":"Anhui Academy of Agricultural Sciences","correspondingAuthor":false,"prefix":"","firstName":"Dezheng","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-02-20 02:52:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3971421/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3971421/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":51532046,"identity":"2941eb4a-1c62-433a-ad29-4d1f48c1a7a5","added_by":"auto","created_at":"2024-02-23 08:07:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":43351,"visible":true,"origin":"","legend":"\u003cp\u003eIndica TGMS lines with \u003cem\u003ePi-ja\u003c/em\u003e blast resistance gene were developed by using 7001S\u003c/p\u003e","description":"","filename":"Figure36.png","url":"https://assets-eu.researchsquare.com/files/rs-3971421/v1/d63a0785813b2273e2f17f16.png"},{"id":51917200,"identity":"66b7b103-826e-4db8-8633-0531972f64b7","added_by":"auto","created_at":"2024-03-03 15:45:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":458313,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3971421/v1/7d034f38-58de-4af8-ab0d-719135d958b6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Study on improving the resistance of indica thermo-sensitive genic male sterile (TGMS) line by using the broad-spectrum blast resistance gene Pi-ja","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRice blast, caused by fungi, is one of the most destructive diseases, causing major losses in rice yield and even a loss of harvest when the disease is severe (Khan et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Planting rice varieties resistant to rice blast is the most economical and safe way to control the disease (Sharma et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Nie et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In recent years, the resistance to rice blast has been regarded as one of the key indexes in the validation of new rice varieties in China.\u003c/p\u003e \u003cp\u003eHowever, some new rice varieties in the existing production generally lost their resistance after 3\u0026ndash;5 years of application. The main reason is that the physiological races of Magnaporthe grisea have high variability, and the resistance gene spectrum carried by rice varieties is narrow. The disease spreads rapidly under suitable environmental conditions (An et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Jiang et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Liang et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Therefore, it is the most efficient way to exploit and utilize broad-spectrum and durable resistant resources to breed varieties with broad-spectrum resistance to rice blast (Liu et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Ellur et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAccording to incomplete statistics, more than 100 rice blast resistance genes have been mapped so far, more than 30 blast resistance genes were cloned from different rice varieties (Zhao and Ma, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhang et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Gao et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Yang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). However, most of the existing resistance genes, such as \u003cem\u003ePi1\u003c/em\u003e, \u003cem\u003ePi9\u003c/em\u003e, \u003cem\u003ePi25\u003c/em\u003e, \u003cem\u003ePi50\u003c/em\u003e, \u003cem\u003ePia\u003c/em\u003e, \u003cem\u003ePib\u003c/em\u003e and \u003cem\u003ePita\u003c/em\u003e, have narrow resistance profiles and are not durable (Devi et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Ni et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) .\u003c/p\u003e \u003cp\u003e7001S is a japonica photoperiod-sensitive genic male sterile line, which was bred by crossing Nongken 58S with 917, a conventional line. It has been planted in the rice blast-stricken areas of Anhui, Sichuan, Yunnan and Guizhou for many years. The results showed that the male sterile line was highly resistant to 22 isolates of Magnaporthe grisea from different rice regions in China, with strong resistance, broad spectrum and long duration (Li et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Meanwhile, Li Bin et al. (2014) found that the resistance of japonica rice 7001S to Magnaporthe grisea was controlled by a single dominant nuclear gene or a single dominant QTL locus, the gene is located in a range of approximately 310 kb between P21-2415 and RM27322 at the end of the long arm of chromosome 11, and the molecular markers closely linked to the target gene are P21-2415 and RM27322. Furthermore, Li et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) named the resistance gene \u003cem\u003ePi-ja\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn this study, 7001S was used as a female parent to hybridize with five indica thermo-sensitive genic male sterile (TGMS) lines, Guangmo S, Xiner S, WA918S, W226S and W869S, respectively, and SSR marker RM27322 of \u003cem\u003ePi-ja\u003c/em\u003e Gene was used for assisted selection, the aim of this study was to construct five indica TGMS lines containing a broad-spectrum \u003cem\u003ePi-ja\u003c/em\u003e gene for blast resistance. On this basis, the five indica rice TGMS lines with \u003cem\u003ePi-ja\u003c/em\u003e gene were crossed with restorers R2877, R900 and PR6547 to study the correlation between rice blast at seedling and panicle stage and the increase of plot yield. This study provides a technical support for the use of broad-spectrum durable blast resistance genes and molecular marker-assisted selection (MAS) to improve the blast resistance of parents of two-line rice genic male sterile lines.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials\u003c/h2\u003e \u003cp\u003eAs shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the test materials used for \u003cem\u003ePi-ja\u003c/em\u003e donor were 7001S, and five CMS lines used for receptor were Guangmo S, Xiner S, WA918S, W226S and W869S, and three restorer lines (R2877, R900 and PR6547) were used for combination.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation of testing materials\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMaterials\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTypes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePedigrees\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCharacters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSources\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7001S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJaponica photo-TGMS line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNongken 58S /917\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWith \u003cem\u003ePi-ja\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRice Research Institute, Anhui Academy of Agricultural Sciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGuangmo S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica TGMS line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGuangzhan 63-4S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMolixinzhan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRice Research Institute, Anhui Academy of Agricultural Sciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXiner S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica TGMS line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXinanS//XinanS/2301S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHigh quality\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRice Research Institute, Anhui Academy of Agricultural Sciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWA918S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica TGMS line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1892S/ Guangmo S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSemi-dominant dwarf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRice Research Institute, Anhui Academy of Agricultural Sciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW226S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica TGMS line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP88S/ Guangmo S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHigh combining ability\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRice Research Institute, Anhui Academy of Agricultural Sciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW869S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica TGMS line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eY58S/Aizi S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSemi-dominant dwarf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRice Research Institute, Anhui Academy of Agricultural Sciences\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica restorer line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e---\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWith \u003cem\u003ePi2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eInstitute of Agricultural Sciences of Zhaoqing, Guangdong province\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica-japonica restorer lines with strong heterosis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e---\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHigh combining ability\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHunan Yuan Chuang Super Rice Technology Co., Ltd.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eR3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIndica wide compatibility restorer line\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e---\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWith \u003cem\u003ePi9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eInstitute of Agricultural Sciences of Lixiahe region, Jiangsu province\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eField planting and character investigation\u003c/h2\u003e \u003cp\u003eCross-bred hybrids were planted in Lujiang County, Hefei, in the summer of 2018. The experiment was designed according to random block design and repeated 3 times. The space between plots was 26.7 cm, the space between groups was 40.0 cm, 3\u0026ndash;5 rows were planted in each plot, 9 plants in each row, total 27\u0026ndash;45 plants. The seeds were sown on May 7 and transplanted per plant on May 7. The density was 16.7 cm \u0026times; 26.7 cm. Field management as general field. After ripening, 5 plants were taken from the middle of each plot, and plant height, effective panicle number, panicle length, total grains per panicle, filled grains per panicle, blighted grains per panicle (to calculate seed setting rate), 1000-grain weight and grain weight per plant were investigated.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIdentification of\u003c/b\u003e \u003cb\u003ePi-ja\u003c/b\u003e \u003cb\u003egenotypes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTotal DNA extracted by CTAB method was used as template, and SSR molecular marker RM27322 closely linked to the \u003cem\u003ePi-ja\u003c/em\u003e Gene was used for \u003cem\u003ePi-ja\u003c/em\u003e genotyping: F: AGAGCCCATGTAGCTACGCCTTCG, R: AATCATGCCGGCTGAAATTGTACC (Li Bin et al., 2014) .\u003c/p\u003e \u003cp\u003eThe PCR system was as follows: DNA template 2 ΜL, primers 2 ΜL, Taq enzyme 10 \u0026micro;l, adding ddH2O to total volume 20 \u0026micro;l. The PCR procedure was as follows: predenaturation at 95 \u0026deg; C for 5 min, denaturation at 95 \u0026deg; C for 30 s, annealing at 55 \u0026deg; C for 30 S, extension at 72 \u0026deg; C for 1 min, 35 cycles, extension at 72 \u0026deg; C for 10 min. PCR products were ethidium bromide on 1.5% agarose gel for 1.5 h and photographed under a gel imaging system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of rice blast\u003c/h2\u003e \u003cp\u003eThe identification of seedling blast and leaf blast was carried out by artificial inoculation. Six dominant rice blast strains ZA-0, ZA-1, ZA-2, ZB-1, Zb-2 and Zb-3 from Anhui province were isolated and purified. Single-spore culture was carried out, and conidia were propagated. The seeds of the tested materials were soaked and germinated, then sowed in a seedling-raising tray, and 10\u0026ndash;15 seeds were sown in each portion of the materials. When the seedlings were at 3\u0026ndash;4 leaf stage, the spores (2 \u0026times; 105 spores/ml) of the strain were sprayed. After inoculation, the plants were placed in a greenhouse at 24\u0026ndash;28\u0026deg;C, and sprayed regularly to keep them moist. The incidence of rice leaf disease was recorded 7 days after inoculation. The identification of panicle blast was carried out by natural induction in the field. The experiment was conducted in Jinzhai County, Anhui province, where the rice blast was most prevalent. The incidence of seedling blast and the rate of panicle loss at maturity were recorded and graded according to the standard of Yang et al. (2005).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEstablishment of indica TGMS lines with\u003c/b\u003e \u003cb\u003ePi-ja\u003c/b\u003e \u003cb\u003eblast resistance gene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn the spring of 2011, the \u003cem\u003ePi-ja\u003c/em\u003e gene donor material 7001S was crossed with five indica TGMS lines including Guangmo S etc. in Lingshui, Hainan province. In the summer of 2011, F\u003csub\u003e1\u003c/sub\u003e was planted in Hefei and backcrossed with the five parents including Guangmo S etc. to harvest BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e seeds. In the spring of 2012, BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e was planted in Hainan, and the excellent individual plants were selected by visual observation at heading date and then sampled for molecular assistant selection, and then the selected positive plants were backcrossed with the parental receptor to harvest BC\u003csub\u003e2\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e seeds. In the summer of 2012, and 2013, 2014, 2015, the characters were selected systematically in favor of the recipient parent sterile line, and then molecular marker-assisted selection was carried out repeatedly, finally, indica TGMS lines weres obtained which was homozygous for \u003cem\u003ePi-ja\u003c/em\u003e and had stable comprehensive characters. And then through the identification of resistance to rice blast screening methods, five indica TGMS lines resistant to rice blast including Guangmo S\u003csup\u003eJ\u003c/sup\u003e, Xiner S\u003csup\u003eJ\u003c/sup\u003e, WA918S\u003csup\u003eJ\u003c/sup\u003e, W226S\u003csup\u003eJ\u003c/sup\u003e and W869S\u003csup\u003eJ\u003c/sup\u003e (The superscript of J indicated that the material contained \u003cem\u003ePi-ja\u003c/em\u003e gene), which were similar to their parents, were developed with \u003cem\u003ePi-ja\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) .\u003c/p\u003e \u003cp\u003e \u003cb\u003eResistance of indica TGMS lines without and with\u003c/b\u003e \u003cb\u003ePi-ja\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe seedlings blast resistance of TGMS lines without and with \u003cem\u003ePi-ja\u003c/em\u003e Gene was shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Without \u003cem\u003ePi-ja\u003c/em\u003e gene, there were three 2-grades, two 4-grades, and three R and two MS resistance types. With \u003cem\u003ePi-ja\u003c/em\u003e Gene, the resistance to blast was four 1 grade, one 3 grade, and the resistance types were four R and one MR. The seedlings blast resistance of W226S increased from 4 to 1, that of Guangmo S, Xiner S and W869S from 2 to 1, and that of WA918S from 4 to 3. The results showed that the \u003cem\u003ePi-ja\u003c/em\u003e resistant gene had a significant effect on rice seedlings blast.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBlast resistance of indica TGMS lines without and with \u003cem\u003ePi-ja\u003c/em\u003e gene\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMaterials\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSources\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c6\" namest=\"c4\"\u003e \u003cp\u003eSeedlings blast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003ePanicle blast\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eResistance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eResistance\u003c/p\u003e \u003cp\u003eChange\u003c/p\u003e \u003cp\u003evalue\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eResistance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eResistance\u003c/p\u003e \u003cp\u003echange\u003c/p\u003e \u003cp\u003evalue\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGuangmo S\u003csup\u003eJ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGuangmo S\u003csup\u003e3\u003c/sup\u003e/7001S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGuangmo S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGuangzhan 63S-4/Molixinzhan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXiner S\u003csup\u003eJ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXiner S\u003csup\u003e3\u003c/sup\u003e/7001S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eXiner S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXinan S\u003csup\u003e2\u003c/sup\u003e /2301S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWA918S\u003csup\u003eJ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWA918S\u003csup\u003e3\u003c/sup\u003e/7001S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWA918S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1892S/Guangmo S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW226S\u003csup\u003eJ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eW226S\u003csup\u003e3\u003c/sup\u003e/7001S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW226S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP88S\u0026times;Guangmo S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW869S\u003csup\u003eJ\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eW869S\u003csup\u003e3\u003c/sup\u003e/7001S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eW869S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eY58S\u0026times;Aizi S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003eNote: Resistance Change Value\u0026thinsp;=\u0026thinsp;Resistance grade of materials without \u003cem\u003ePi-ja\u003c/em\u003e gene - Rresistance grade of materials with \u003cem\u003ePi-ja\u003c/em\u003e gene.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIn addition, the resistance to panicle blast of indica TGMS lines without and with \u003cem\u003ePi-ja\u003c/em\u003e resistance gene can be seen from Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Without \u003cem\u003ePi-ja\u003c/em\u003e gene, there were four 7-grade and one 5-grade resistance, four S and one MS resistance types. With \u003cem\u003ePi-ja\u003c/em\u003e Gene, the resistance to blast was four 3 grade, one 7 grade, and the resistance types were four MR and one S. The panicle blast resistance of Guangmo S, W226s and W869s increased from grade 7 to Grade 3, Xiner S from grade 5 to Grade 3, and WA918S remained grade 7. The results showed that the \u003cem\u003ePi-ja\u003c/em\u003e resistant gene also had a significant effect on rice panicle blast.\u003c/p\u003e \u003cp\u003e \u003cb\u003eComparative studies on disease resistance and yield of combinations of TGMS lines without and with\u003c/b\u003e \u003cb\u003ePi-ja\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe results of the plot yield test of 12 combinations of indica TGMS lines Guangmo S, Xiner s, WA918S, W226S without and with \u003cem\u003ePi-ja\u003c/em\u003e resistance gene and restorer lines R2877, R900 and PR6547 are shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003edisease resistance and plot yield of indica TGMS lines without and with Pi-ja gene\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"11\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCombinations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eSeedlings blast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003ePanicle blast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ethe plot yield(kg/Mu, %)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e \u003cp\u003eYield analysis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eRice qualities\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR Change value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eTypes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR\u003c/p\u003e \u003cp\u003echange\u003c/p\u003e \u003cp\u003evalue\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eYield change\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003ePercentage change(%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGuangmo S\u003csup\u003eJ\u003c/sup\u003e/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e756.0/4.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e24.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e3.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGuangmo S/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e731.5/1.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGuangmo S\u003csup\u003eJ\u003c/sup\u003e/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e766.8/6.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e28.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e3.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGuangmo S/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e738.7/2.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGuangmo S\u003csup\u003eJ\u003c/sup\u003e/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e794.4/10.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e61.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e8.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGuangmo S/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e733.2/1.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWA918S\u003csup\u003eJ\u003c/sup\u003e/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e725.3/0.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e-55.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e-7.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWA918S/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e781.0/8.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWA918\u003csup\u003eJ\u003c/sup\u003eS/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e740.9/2.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e32.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWA918S/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e708.2/-1.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWA918S\u003csup\u003eJ\u003c/sup\u003e/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e724.1/0.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e-105.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e-14.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWA918S/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e829.7/15.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXiner S\u003csup\u003eJ\u003c/sup\u003e/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e768.0/6.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e30.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXiner S/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e737.3/2.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXiner S\u003csup\u003eJ\u003c/sup\u003e/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e796.8/10.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e24.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXiner S/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e771.9/7.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXiner S\u003csup\u003eJ\u003c/sup\u003e/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e788.4/9.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e41.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e5.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXiner S/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e746.6/3.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eW226S\u003csup\u003eJ\u003c/sup\u003e/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e891.1/23.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e133.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e18.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eW226S/R2877\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e757.9/5.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eW226S\u003csup\u003eJ\u003c/sup\u003e/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e861.1/19.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e63.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e8.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eW226S/ R900\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e797.8/10.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eW226S\u003csup\u003eJ\u003c/sup\u003e/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e742.8/3.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e-10.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e-1.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eW226S/PR6547\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e753.0/4.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003eLevel 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"11\"\u003eNote: R Change Value\u0026thinsp;=\u0026thinsp;Resistance without \u003cem\u003ePi-ja\u003c/em\u003e gene - Resistance with \u003cem\u003ePi-ja\u003c/em\u003e gene; Yield change\u0026thinsp;=\u0026thinsp;Yield of combination with \u003cem\u003ePi-ja\u003c/em\u003e gene - yield of combination without \u003cem\u003ePi-ja\u003c/em\u003e gene; Percentage change (%)\u0026thinsp;=\u0026thinsp;Percentage increase in yield (%) of combinations with \u003cem\u003ePi-ja\u003c/em\u003e gene - percentage increase in yield (%) of combinations without \u003cem\u003ePi-ja\u003c/em\u003e gene.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe performance of seedling blast can be seen from Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Without \u003cem\u003ePi-ja\u003c/em\u003e gene, there were five 1-grade, two 2-grades, four 3-grades, one 4-grade resistance, and seven R, four MR and one MS resistance types. With \u003cem\u003ePi-ja\u003c/em\u003e gene, there were eleven 1-grades, one 2-grade, and twelve R resistance types. Among them, two combinations of Guangmo S increased from Grade 3 to Grade 1, and one combination of WA918S decreased from grade 1 to Grade 2, the three combinations of Xiner S were increased from grade 4, Grade 3 and Grade 2 to Grade 1 respectively, and the two combinations of the W226s were increased from Grade 3 and Grade 2 to Grade 1 respectively. The resistance of other combinations did not change. Therefore, the \u003cem\u003ePi-ja\u003c/em\u003e Gene has an effect on the blast resistance of other combinations except WA918S.\u003c/p\u003e \u003cp\u003eIn addition, the resistance to panicle blast can be seen from Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Without \u003cem\u003ePi-ja\u003c/em\u003e gene, there were three 3-grades, six 5-grades, three 7grades, and three MR, six MS and three S resistance types. With \u003cem\u003ePi-ja\u003c/em\u003e gene, there were twelve 3-grades, and twelve MR resistance types. Among them, two combinations of Guangmo S increased from grade 5 to Grade 3, one combination increased from grade 7 to Grade 3, and three combinations of WA918S remained unchanged, the two combinations of Xiner S increased from 7 to 3, one from 5 to 3, and the three combinations of the W226s all increased from 5 to 3. Therefore, \u003cem\u003ePi-ja\u003c/em\u003e Gene had a significant effect on the resistance to panicle blast in all combinations except WA918S.\u003c/p\u003e \u003cp\u003eThe yield of combinations without \u003cem\u003ePi-ja\u003c/em\u003e resistance gene and with \u003cem\u003ePi-ja\u003c/em\u003e resistance gene was compared from plot 12 of Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The yield increasing range (kg) of the three combinations of Guangmo S were 24.5, 28.1 and 61.2, and the yield changing percentage (%) were 3.4, 3.9 and 8.4, respectively. The yield increases (kg) of three combinations of WA918S were \u0026minus;\u0026thinsp;55.7, 32.7, -105.6, and the yield change percentages (%) were \u0026minus;\u0026thinsp;7.7, 4.5, and 14.6, respectively. The yield increasing range (kg) of the three combinations of Xiner S were 30.7, 24.9 and 41.8, and the yield changing percentage (%) were 4.3, 3.5 and 5.8, respectively. The yield increasing range (kg) of three combinations of W226s was 133.2, 63.3, -10.2, and the yield changing percentage (%) was 18.5, 8.8, and-1.4, respectively. Therefore, except two combinations of WA918S and one combination of W226S, the other combinations all increased yield under the influence of \u003cem\u003ePi-ja\u003c/em\u003e resistance gene.\u003c/p\u003e \u003cp\u003eThe Pearson Correlation analysis between the resistance of 12 combinations without and with \u003cem\u003ePi-ja\u003c/em\u003e resistance gene to seedling blast and panicle blast and the yield increase of the plot was carried out in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the correlation between the change of resistance to panicle blast and the increase of yield in the plot (r\u0026thinsp;=\u0026thinsp;0.436, P\u0026thinsp;=\u0026thinsp;0.157) was significantly higher than that between the change of resistance to seedling blast and the increase of yield in the plot (r\u0026thinsp;=\u0026thinsp;0.130, P\u0026thinsp;=\u0026thinsp;0.687).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCorrelations\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eChange of resistance to seedling blast\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eChange of resistance to panicle blast\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eYield increases\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eYield percentage change(%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eChange of resistance to seedling blast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePearson Correlation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSig. (2-tailed)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eChange of resistance to panicle blast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePearson Correlation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e.816(**)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSig. (2-tailed)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eYield increases\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePearson Correlation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e.130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e.436\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSig. (2-tailed)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e.687\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e.157\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eYield percentage change(%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePearson Correlation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e.132\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e.437\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.000(**)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSig. (2-tailed)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e.682\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e.155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e.000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e** Correlation is significant at the 0.01 level (2-tailed).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eRice blast is one of the most important diseases of rice, which is characterized by rapid spread, wide occurrence, high outbreak frequency and serious damage. In our country all year round there are different degrees of occurrence, and the yield loss can reach 40% ~ 50%, and some fields even have no grain yield (Hong and Tong, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Mining effective resistance genes, introducing disease resistance genes into rice varieties through biotechnology to rapidly develop resistant rice varieties is an important way to solve the problem of rice blast (Chen et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Liu et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Zhu et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Ma et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn recent years, a great deal of research has been done on the mechanism of rice blast and rice resistance, and a great breakthrough has been made. However, because of the rapid variation of rice blast races and the complexity of the environment, varieties containing a single resistance gene will lose their original resistance after a few years. Therefore, breeding new rice varieties with broad-spectrum resistance becomes the key of rice breeding for disease resistance (Li et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, a japonica rice line 7001S containing a broad-spectrum \u003cem\u003ePi-ja\u003c/em\u003e gene resistant to rice blast was used as a female parent to hybridize with five indica thermo-sensitive genic male sterile (TGMS) lines, and used SSR marker RM27322 to identify \u003cem\u003ePi-ja\u003c/em\u003e genotypes, five indica TGMS lines containing a broad spectrum \u003cem\u003ePi-ja\u003c/em\u003e resistance gene to rice blast were established (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Further research showed that \u003cem\u003ePi-ja\u003c/em\u003e gene could significantly enhance the resistance of TGMS lines to rice blast at seedling stage and panicle stage (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), and crossed with restorer lines, the correlation between panicle blast resistance variation and plot yield (r\u0026thinsp;=\u0026thinsp;0.436, P\u0026thinsp;=\u0026thinsp;0.157) was significantly higher than that between seedling blast resistance variation and plot yield (r\u0026thinsp;=\u0026thinsp;0.130, p\u0026thinsp;=\u0026thinsp;0.687) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs mentioned above, some of the known blast resistance genes generally have the problems of narrow resistance spectrum and low persistence, and there is little research on the resistance genes with wide resistance spectrum (Li et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The main highlight of this study is to introduce the broad-spectrum and durable resistance \u003cem\u003ePi-ja\u003c/em\u003e gene into the indica TGMS lines and create indica TGMS lines containing \u003cem\u003ePi-ja\u003c/em\u003e gene. Compared with the indica TGMS line without \u003cem\u003ePi-ja\u003c/em\u003e gene, the yield of corresponding combinations was obviously increased. This study has important reference value for promoting the application of broad-spectrum resistance genes to rice blast.\u003c/p\u003e \u003cp\u003eSecondly, in this study, the disease resistance genes of japonica materials were transferred into two-line CMS lines, which could promote the improvement of indica-japonica cross technology. In the previous research, many indica rice resistance genes were introduced into japonica rice, and the ideal effect of disease resistance was obtained and popularized. However, there are few reports about introducing the disease resistance gene from japonica rice into indica rice. In theory, the introduction of a japonica rice resistance gene into indica rice can improve the disease resistance and resist more different races of rice blast, especially those harmful to japonica rice, this is more significant for the hard-hit rice area where indica and japonica rice are planted together.\u003c/p\u003e \u003cp\u003eIn addition, it should be noted that 7001S is a japonica photo-TGMS line and is crossed with an indica TGMS line, and it is difficult to select an ideal plant because of the severe segregation of its progeny. Multiple backcross screening is required after hybridization. Furthermore, the stigma and exsertion rate of japonica two-line CMS lines were smaller than those of indica two-line CMS lines. The selection of these outcrossing characters should be strengthened during the process of introducing disease resistance genes, so as not to increase resistance and reduce practicality.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Declarations\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Key Research and development program of Anhui Province (201904a020016), Talent program of Anhui Academy of Agricultural Sciences (QNYC-201903, QNYC-202103).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.Z. and D.W. and J.J. were responsible for Conceptualization, Methodology, Software, Data curation, and wrote the main manuscript text. A.Z. and X.D. were responsible for Software, Validation, and prepared figure 1, table1-4. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest/Competing interests\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAn Z, Liu G, Mei W, Li L, Wang J, Luo L (2010) marker-assisted improvement of rice blast resistance in water-saving and drought-resistant hybrid rice parents. Molecular Plant Breeding, 8(6): 1172\u0026ndash;1176\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Z, Zheng Y, Wu W, Zhao C (2004) Screening and application of SSR markers tightly linked to rice blast resistance gene \u003cem\u003ePi-2(t)\u003c/em\u003e. Molecular Plant Breeding, 2(3): 321\u0026ndash;325\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDevi SJSR, Singh K, Umakanth B, Vishalakshi B, Renuka P, Sudhakar KV, Prasad MS, Viraktamath BC, Babu R, Madhav MS (2015) Development and identification of novel rice blast resistant sources and their characterization using molecular markers. Rice Science, 22(6): 300\u0026ndash;308\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEllur RK, Khanna A, Yadav A, Pathania S, Rajashekara H, Singh VK, Krishnan SG, Bhowmick PK, Nagarajan M, Vinod KK, Prakash G, Mondal KK, Singh NK, Prabhu KV, Singh AK (2016) Improvement of basmati rice varieties for resistance to blast and bacterial blight diseases using marker assisted backcross breeding. Plant Science, 242: 330\u0026ndash;341\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Q, Zhang Y, Ge X, Li Y, Ma Y, Jin X (2022) Research progress on rice blast resistance genes. Molecular Plant Breeding, 20(11): 3634\u0026ndash;3643\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H, Wang L, Li B, Cai J (2023) Research progress on rice blast in Zhejiang province. Chinese rice, 29(3): 46\u0026ndash;50\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong J, Tong X (2006) Rice diseases and their control in China. Shanghai Scientific and Technical Publishers, Shanghai\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang JF, Mou TM, Yu HH, Zhou FS (2015) Molecular breeding of thermo-sensitive genic male sterile (TGMS) lines of rice for blast resistance using Pi2 gene. Rice, 8(11):1\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan MAI, Bhuiyan MR, Hossain MS, Sen PP, Ara A, Siddique MA, Ali MA (2014) Neck blast disease influences grain yield and quality traits of aromatic rice. Comptes Rendus Biologies, 337: 635\u0026ndash;641\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi B, Deng Y, Yan X, Yang Y, Liu P, Du Y, Xie P, Wang D, Deng Q, Li P (2014) Identification, genetic analysis and gene mapping of a blast resistance gene from japonica rice. Acta Agronomica Sinica, 40(1): 54\u0026ndash;62\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, Yan BY, Peng YL, Ji ZJ, Zeng YX, Wu HL, Yang CD (2017) Molecular screening of blast resistance genes in rice germplasms resistant to Magnaporthe oryzae. Rice Science, 24(1): 41\u0026ndash;47\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu P, Wei Y, Chen Y, Zhang J, Xie H (2011) Classification and functional analysis of rice blast resistance genes. Molecular Plant Breeding, 9(2): 128\u0026ndash;135\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Xu P, Zhang H, Xu J, Wu F, Wu X (2008) Molecular marker-assisted selection and application of rice blast resistance \u003cem\u003ePib\u003c/em\u003e gene. Scientia Agricultura Sinica, 41(1): 9\u0026ndash;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa J, Ma X, Zhao Z, Wang S, Wang J, Wang J, Cheng Z, Lei C (2015) Development and application of functional molecular markers for rice blast resistance gene \u003cem\u003ePi35\u003c/em\u003e [J]. Acta Agronomica Sinica, 41(12): 1779\u0026ndash;1790\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurry MG, Thompson WF (1980) Rapid isolation of high-molecular-weight-plant DNA. Nucleic Acids Research, 8(19): 4321\u0026ndash;4325\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNi D, Song F, Ni J, Zhang A, Wang C, Zhao K, Yang Y, Wei P, Yang J, Li L (2015) Marker assisted selection of two-line hybrid rice for disease resistance to rice blast and bacterial blight. Field Crops Research, 184: 1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNie Y, Li X, Mao L, Yan M, Yan L, Cai Y (2016) marker-assisted selection for blast resistance improvement in three-line hybrid rice restorer line R225. Chinese rice, 22(3): 60\u0026ndash;63\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma TR, Rai AK, Gupta SK, Vijayan J, Devanna BN, Ray S (2012) Rice blast management through host-plant resistance: retrospect and prospects. Spanish Journal of Agricultural Research, 1(1): 37\u0026ndash;52\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang S, Liao Q (2005) Rice variety test and approval in China. China Agricultural Science and Technology Press, Beijing, pp 32\u0026ndash;35\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Piao R, Chen M, Nan G, Lin X, Jin Y (2022) Advances in molecular mechanism of rice blast resistance and molecular breeding. Molecular Plant Breeding. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://kns.cnki.net/kcms/detail/46\u003c/span\u003e\u003cspan address=\"https://kns.cnki.net/kcms/detail/46\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 1068.s.20220711.1634.006.html\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J, Ma Z (2021) Research progress on the application of rice blast resistance genes. Liaoning Agricultural Sciences, (5): 52\u0026ndash;56\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu J, Wang J, Fan F, Li W, Wang F, Zhong W, Yang J (2014) Identification and application of a new broad-spectrum resistance allele \u003cem\u003ePi21t\u003c/em\u003e to rice blast. Acta Agriculturae Boreali-Sinica, 29(6): 11\u0026ndash;15\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Indica rice, Thermo-sensitive genic male sterile line, Broad-spectrum, Blast resistance, Pi-ja","lastPublishedDoi":"10.21203/rs.3.rs-3971421/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3971421/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAt present, it is one of the common methods to seek and utilize the broad-spectrum resistance genes to improve the resistance of breeding parents to rice blast. In this study, a japonica rice line 7001S containing a broad-spectrum \u003cem\u003ePi-ja\u003c/em\u003e gene resistant to rice blast was used as a female parent to hybridize with five indica thermo-sensitive genic male sterile (TGMS) lines, Guangmo S, Xiner S, WA918S, W226S and W869S, respectively, using SSR marker RM27322 to identify \u003cem\u003ePi-ja\u003c/em\u003e genotypes, five indica TGMS lines containing a broad spectrum \u003cem\u003ePi-ja\u003c/em\u003e resistance gene to rice blast were established. Furthermore, the five indica TGMS lines with a broad-spectrum \u003cem\u003ePi-ja\u003c/em\u003e resistance gene were used to cross with restorer lines R2877, R900 and PR6547, the correlation between rice blast at seedling stage and panicle stage and the increase of plot yield were studied. The results showed that the resistance of TGMS lines and their combinations with and without \u003cem\u003ePi-ja\u003c/em\u003e gene were significantly different. \u003cem\u003ePi-ja\u003c/em\u003e gene could significantly enhance the resistance of TGMS lines to rice blast at seedling stage and panicle stage. Further plot yield tests showed that for combinations with or without \u003cem\u003ePi-ja\u003c/em\u003e gene, the correlation between panicle blast resistance variation and plot yield (r\u0026thinsp;=\u0026thinsp;0.436, P\u0026thinsp;=\u0026thinsp;0.157) was significantly higher than that between seedling blast resistance variation and plot yield (r\u0026thinsp;=\u0026thinsp;0.130, p\u0026thinsp;=\u0026thinsp;0.687). This study provides a technical basis for the breeding of rice varieties with broad-spectrum resistance to rice blast by molecular marker-assisted selection.\u003c/p\u003e","manuscriptTitle":"Study on improving the resistance of indica thermo-sensitive genic male sterile (TGMS) line by using the broad-spectrum blast resistance gene Pi-ja","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-23 08:07:08","doi":"10.21203/rs.3.rs-3971421/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5023b317-d28c-4c74-a63a-5a44ae2485c8","owner":[],"postedDate":"February 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-03T15:45:38+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-23 08:07:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3971421","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3971421","identity":"rs-3971421","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.