Visualizing the Dominant GPCR Coupling of Pathogenic Gαo Mutants in GNAO1 -Related Disorders

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 72,499 characters · extracted from preprint-html · click to expand
Visualizing the Dominant GPCR Coupling of Pathogenic Gαo Mutants in GNAO1-Related Disorders | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Visualizing the Dominant GPCR Coupling of Pathogenic Gαo Mutants in GNAO1 -Related Disorders View ORCID Profile Yonika A. Larasati , View ORCID Profile Camille Rabesahala de Meritens , View ORCID Profile Miriam Stoeber , View ORCID Profile Vladimir L. Katanaev , View ORCID Profile Gonzalo P. Solis doi: https://doi.org/10.1101/2025.06.19.660437 Yonika A. Larasati 1 Translational Research Center in Oncohaematology, Department of Cell Physiology and Metabolism, Faculty of Medicine, University of Geneva , Geneva, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Yonika A. Larasati Camille Rabesahala de Meritens 1 Translational Research Center in Oncohaematology, Department of Cell Physiology and Metabolism, Faculty of Medicine, University of Geneva , Geneva, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Camille Rabesahala de Meritens Miriam Stoeber 2 Department of Cell Physiology and Metabolism, Faculty of Medicine, University of Geneva , Geneva, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Miriam Stoeber Vladimir L. Katanaev 1 Translational Research Center in Oncohaematology, Department of Cell Physiology and Metabolism, Faculty of Medicine, University of Geneva , Geneva, Switzerland 3 Translational Oncology Research Center, Qatar Biomedical Research Institute (QBRI), College of Health and Life Sciences, Hamad Bin Khalifa University (HBKU), Qatar Foundation , Doha, Qatar Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Vladimir L. Katanaev For correspondence: vladimir.katanaev{at}unige.ch gonzalo.solis{at}unige.ch Gonzalo P. Solis 1 Translational Research Center in Oncohaematology, Department of Cell Physiology and Metabolism, Faculty of Medicine, University of Geneva , Geneva, Switzerland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Gonzalo P. Solis For correspondence: vladimir.katanaev{at}unige.ch gonzalo.solis{at}unige.ch Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Heterozygous mutations in the GNAO1 gene, which encodes the Gαo subunit of heterotrimeric G proteins, cause a spectrum of rare neurodevelopmental disorders ranging from early-onset epileptic encephalopathy to milder dystonia phenotypes. Disease dominance of Gαo mutants appears to arise from multiple functional disruptions, including impaired guanine nucleotide handling, failure to adopt the active conformation, and neomorphic interactions with Ric8A/B chaperones. In parallel, several Gαo variants have been independently reported to dominantly engage G protein-coupled receptors (GPCRs) or to sequester Gβγ, two mechanistically distinct behaviors. These conclusions were inferred from different indirect biosensor assays, likely contributing to the apparent contradiction in their proposed mechanisms. To overcome this, we developed a split-YFP-based bimolecular fluorescence complementation (BiFC) assay to visualize receptor-Go protein complexes at the plasma membrane. Using this system, we found that severe Gαo variants (S47G, G203R, R209C, E246K) fail to disengage from activated Gi/o-coupled GPCRs, thereby preventing downstream receptor phosphorylation and endocytosis. By contrast, milder dystonia-linked mutants (C215Y and T241_N242insPQ) showed near-normal receptor internalization and only minor phosphorylation defects. These findings establish dominant GPCR coupling as a molecular hallmark of severe GNAO1 -related disorders and point to split-YFP BiFC as a robust platform for probing mutant G protein behavior in genetic disease. Introduction G protein-coupled receptors (GPCRs) represent the largest and most diverse family of membrane receptors in metazoans 1 – 3 . From neurotransmission and hormonal signaling to sensory perception and immune responses, GPCRs are essential for proper animal development and physiology 4 , 5 . Signal transduction by GPCRs is mediated by heterotrimeric G proteins, composed of three subunits: α, β, and γ, with the Gα subunit conferring receptor specificity 6 , 7 . In the inactive state, Gα is bound to GDP and associates tightly with the Gβγ dimer. Upon ligand binding, the GPCR undergoes a conformational change that catalyzes the exchange of GDP for GTP on Gα. This process activates the heterotrimeric G protein, causing Gα-GTP and Gβγ to dissociate and signal independently to downstream effectors. The signal is terminated when Gα hydrolyzes GTP to GDP through its intrinsic GTPase activity and associates with Gβγ, reforming the heterotrimer 8 , 9 . Given their central role in GPCR signaling, it is perhaps unsurprising that mutations affecting heterotrimeric G protein subunits have been implicated in a variety of human diseases. Historically, gain-of-function mutations in genes encoding Gα subunits have drawn most of the attention due to their role as drivers in various cancers 10 , 11 . These mutations produce constitutively active Gα proteins, resulting in persistent stimulation of oncogenic signaling pathways. More recently, however, a growing number of rare genetic disorders have been attributed to alternative mutations in Gα subunits 12 – 17 . Among these, mutations in GNAO1 – the gene encoding for Gαo – have been implicated in a broad spectrum of neurodevelopmental disorders, collectively referred to as GNAO1 -related disorders 13 , 18 – 20 . The most severe conditions were originally classified as Developmental and Epileptic Encephalopathy 17 (DEE17; OMIM #615473) and Neurodevelopmental Disorder with Involuntary Movements (NEDIM; OMIM #617493) 21 , 22 . In recent years, GNAO1 mutations have also been associated with milder conditions, including autism and intellectual disability, parkinsonism, and dystonia 23 – 25 . More than 250 patients have been reported worldwide, the vast majority carrying missense mutations, with only a few cases of deletions, frameshifts, duplications, short indels, and splice-site mutations described 18 . Treatment responses among GNAO1 patients are highly variable and typically poor, particularly in cases involving epilepsy and/or movement disorders. This underscores the urgent need for more effective therapies for these severe conditions. At the molecular level, Gαo mutants associated with severe phenotypes display a set of interconnected pathogenic mechanisms, including severely impaired guanine nucleotide handling, misfolding in the GTP-bound active state, and neomorphic binding to Ric8A/B chaperones, all of which converge to perturb the broader GPCR signaling network 26 – 30 . By contrast, variants on the milder end of the GNAO1 -related disorder spectrum exhibited only mild biochemical defects, with some mutants lacking the neomorphic property entirely, while others retained trapping of Ric8A but not Ric8B 24 , 25 , 28 , 31 . Furthermore, the most severe DEE17 Gαo variants tend to lose plasma membrane (PM) localization and Gβγ binding, whereas mutants linked to NEDIM or milder phenotypes retain near-normal association with both PM and Gβγ 26 – 28 . Another emerging feature of several pathogenic GNAO1 mutations is their apparent dominant coupling to GPCRs. A study using a bioluminescence resonance energy transfer (BRET)-based assay to measures free Gβγ during GPCR stimulation showed that clinically severe Gαo variants partially inhibit activation of the wild-type protein, acting in a dominant- negative (DN) manner 26 . These Gαo mutants displayed poor disengagement from Gβγ despite normal (or even enhanced) coupling to activated GPCRs – the latter determined indirectly by a split-NanoLuc assay measuring Gβγ proximity to the receptor. Based on this, the authors proposed that the DN effect arises from nonproductive interactions between the mutant Gαo and GPCRs. Along the same lines, we found that many clinically severe Gαo mutants exhibit normal or even enhanced GPCR coupling despite poor binding to Gβγ, using a different BRET-based assay that directly monitors GPCR engagement by Gα 28 . This dominant coupling mechanism was recently confirmed for the epileptic Gαo K46E variant, which forms a nonproductive complex with both Gβγ and the activated GPCR, as revealed by cryo-electron microscopy 32 . By contrast, an earlier study using yet another BRET-based assay that directly measures Gβγ disengagement from Gα described an alternative DN mechanism for some of the same Gαo mutants: sequestration of Gβγ, due to impaired adoption of the active conformation required for their dissociation, without sequestering the GPCR 27 . Thus, dominant GPCR coupling by pathogenic Gαo mutants can currently only be inferred using a combination of optical biosensors, leading to apparent mechanistic contradictions. To resolve this, we developed a novel assay to directly visualize the dominant GPCR coupling behavior of Gαo variants. We employed bimolecular fluorescence complementation (BiFC), a method based on the structural reassembly of two non-fluorescent N- and C-terminal fragments of a fluorescent protein into a functional fluorophore when both fragments are in close proximity 33 . Using the split-YFP-based BiFC approach, we show that GNAO1 mutations associated with the most severe phenotypes result in dominant GPCR coupling by the mutant Gαo, likely caused by a defective receptor-Gα uncoupling. Results Dominant GPCR coupling by pathogenic Gαo mutants blocks receptor endocytosis To determine whether pathogenic Gαo mutants indeed engage in dominant coupling with GPCRs, we sought to develop a single assay capable of visualizing this process. However, microscopic visualization of plasma membrane (PM)-localized GPCRs can be challenging, as exogenous expression often leads to their accumulation in the endoplasmic reticulum and Golgi apparatus, due to saturation of the cellular folding and trafficking machinery 34 , 35 . Consistent with this, expression of an N-terminal GFP fusion of the M 2 muscarinic acetylcholine receptor (GFP-M 2 R) in HEK293T cells results in prominent intracellular retention (Fig. S1A). We selected M 2 R for this study because it is a prototypical Gi/o-coupled GPCR 36 , 37 and because we previously observed that severe Gαo mutants exhibit enhanced coupling to this receptor 28 , consistent with dominant GPCR engagement. To overcome this limitation, we employed a split-YFP-based BiFC assay (hereafter split- YFP), previously used to visualize the PM interaction between the chemokine GPCR CCR7 and the Src tyrosine kinase 38 . Like Src, Gα subunits associate with the membrane via lipid modifications 39 , 40 , which target Gαo to the PM and Golgi in HEK293T cells (Fig. S1B) 41 . Based on these observations, we reasoned that a split-YFP assay combining M 2 R and Gαo would enable selective visualization of the PM-localized receptor pool. We further speculated that the irreversible nature of the split-YFP complementation would bias M 2 R toward coupling with Gαo over endogenous Gα subunits, thereby enhancing both the specificity and sensitivity of the assay. We first generated M 2 R and Gαo constructs carrying each of the YFP fragments – N-terminal (YN) or C-terminal (YC) – fusing them to the intracellular C-terminus of the receptor and internally at Gly92 in Gαo ( Fig 1A ). One of the two possible combinations – M 2 R-YN and Gαo-YC (M 2 R-YFP-Gαo; Fig. 1B ) – produced a much stronger fluorescence signal than the opposite configuration (not shown), confirming that the orientation of the YFP halves is critical for efficient complementation 42 . As speculated, the M 2 R-YFP-Gαo complex was strongly visualized at the PM of HEK293T cells, with only a few intracellular structures visible ( Fig. 1B ). Notably, acetylcholine (ACh) stimulation for 10 min led to the prominent appearance of vesicles/endosomes and a marked reduction in PM signal, suggesting endocytosis of the M 2 R-YFP-Gαo complex ( Fig. 1C ). Although Gαo typically remains at PM following GPCR stimulation 41 , 43 , the irreversibility of split-YFP complementation likely drives its co-internalization with the receptor 33 . Download figure Open in new tab Figure 1. Clinically severe Gαo mutants disrupt M 2 R endocytosis ( A ) Illustration of the split-YFP assay applied to M 2 R and heterotrimeric Gαoβγ. ( B , C ) Representative confocal images of HEK293T cells expressing the M 2 R-YFP-Gαo complex at steady state ( B ) and after 10 min of acetylcholine (ACh) stimulation ( C ). ( D - I ) Confocal images of ACh-stimulated HEK293T cells expressing the M 2 R-YFP-Gαo complex containing the Gαo mutants S47G ( D ), G203R ( E ), R209C ( F ), C215Y ( G ), E246K ( H ), and insPQ ( I ). Scale bars, 10 µm. ( J ) Quantification of ACh-mediated M 2 R internalization, expressed as the surface level of M 2 R normalized to total M 2 R-YFP-Gαo signal. Gαo mutant associations with DEE17, NEDIM and DYT phenotypes are color-coded. Box plot indicate median (middle line), 25th, 75th percentile (box), and lowest, highest value (whiskers); two-three independent experiments (wild-type, n = 78; wild-type +ACh, n = 85; S47G, n = 55; S47G + ACh, n = 51; G203R, n = 59; G203R + ACh, n = 69; R209C, n = 78; R209C + ACh, n = 76; C215Y, n = 59; C215Y + ACh, n = 74; E246K, n = 63; E264K + ACh, n = 65; insPQ, n = 54; insPQ + ACh, n = 63). Statistical analysis was performed using one-way ANOVA followed by Šídák’s multiple comparisons test; *** p < 0.001, **** p < 0.0001, and ns: not significant. Next, we performed the split-YFP assay for M 2 R and several pathogenic Gαo mutants. We selected three of the most recurrent Gαo variants – G203R, R209C, and E246K – that may act as DN, either through nonproductive GPCR coupling 26 , 28 or via Gβγ sequestration 27 . We also included the S47G mutant, which shows normal to high GPCR coupling but poor Gβγ dissociation 26 , 28 , and has alternatively been described as non-functional 27 . Among these, Gαo S47G and G203R are associated with the most severe DEE17 phenotype, while R209C and E246K are linked to NEDIM. Two Gαo mutants associated with a milder dystonia (DYT) phenotype were also analyzed: C215Y and the recurrent splice-site variant c.724-8G>A, which results in an in-frame insertion of two additional residues (Pro-Gln) at position T241 (T241_N242insPQ; hereafter insPQ) 23 , 28 , 31 , 44 . As shown in Figure 1 , split-YFP complementation was achieved for all pathogenic Gαo mutants. However, ACh stimulation revealed striking differences, with DEE17 and NEDIM variants strongly impairing internalization of the M 2 R-YFP-Gαo complex and DYT mutants showing no apparent defects ( Fig. 1D-I ). To quantify endocytosis, we analyzed the PM localization of M 2 R-YN before and after ACh stimulation using immunostaining – under non- permeabilizing conditions – against an extracellular HA-epitope at the N-terminus of the construct (Fig. S2A-G). The extracellular HA-signal was normalized to the intrinsic fluorescence of the M 2 R-YFP-Gαo complex to account for variability in expression levels across cell populations. As expected, a significant reduction of the relative PM pool of M 2 R was observed only for wild-type Gαo and the mild DYT variants C215Y and insPQ ( Fig. 1J ). For these Gαo mutants, we noticed that the HA-derived M 2 R signal was strongly reduced upon ACh stimulation in some cells, but not in others – particularly those with higher expression levels (Fig. S2A-G). This variability may reflect saturation of the receptor endocytic pathway due to overexpression 45 . We also noticed that the overall YFP signal in cells expressing M 2 R-YFP-Gαo complexes was reduced for some of the pathogenic variants compared to wild-type. Quantification revealed that the DEE17 S47G, NEDIM E246K, and DYT insPQ variants formed significantly lower levels of M 2 R-YFP-Gαo complexes (Fig. S2H). This is likely the outcome of reduced expression of the corresponding Gαo-YC constructs (Fig. S2I and J), consistent with the known tendency of many pathogenic Gαo mutants to express at lower levels 27 , 28 . These expression differences, however, do not account for the defective internalization observed for DEE17 and NEDIM variants, as the DYT insPQ variant – despite a similar reduction in M 2 R-YFP-Gαo formation – underwent robust internalization. The most straightforward explanation for the failure of M 2 R-YFP-Gαo complexes formed by DEE17/NEDIM variants to undergo endocytosis is a defect in receptor-Gαo uncoupling, which prevents progression toward receptor internalization. However, we cannot exclude the possibility that these severe Gαo mutants may impair endocytosis more broadly. To address this, we examined the internalization of an unrelated receptor, epidermal growth factor receptor (EGFR), using fluorescently labelled EGF-Rhodamine as readout 46 . EGF- Rhodamine uptake in HEK293T cells expressing the M 2 R-YFP-Gαo complex was comparable to that in non-transfected neighboring cells (Fig. S3A-G). Furthermore, quantification of internalized EGF-Rhodamine in cells expressing M 2 R-YFP-Gαo revealed no significant differences among the various Gαo variants (Fig. S3H). These results suggest that expression of DEE17/NEDIM Gαo mutants does not broadly interfere with receptor endocytosis. Next, we tested the specificity of the split-YFP assay using different GPCRs. We selected the µ-opioid receptor (MOR; Fig. S4A), which is known to engage Gαo, and the β 2 - adrenoceptor (β 2 AR; Fig. S5A), which signals primarily through Gαs 47 , 48 . Notably, split-YFP complementation was effectively achieved between wild-type Gαo-YC and either MOR-YN or β 2 AR-YN, with MOR-YFP-Gαo (Fig. S4B) and β 2 AR-YFP-Gαo (Fig. S5B) complexes localized primarily at the PM of HEK293T cells. These results indicate that split-YFP complementation with Gαo is not selective for Gi/o-coupled receptors. Recapitulating the pattern observed with M 2 R, stimulation with fentanyl for 10 min induced internalization of the wild-type MOR-YFP-Gαo complex into vesicles/endosomes (Fig. S4C), a pattern also observed for the DYT variants, but not for the mutants associated with DEE17/NEDIM (Fig. S4D-I). Conversely, isoproterenol treatment induced the endocytosis of the β 2 AR-YFP-Gαo complex formed by the wild-type protein and all pathogenic variants alike (Fig. S5C-I), suggesting that the dominant GPCR coupling of Gαo mutants is specific for Gi/o-coupled receptors. This finding further implies that split-YFP complementation between β 2 AR and Gαo does not block the ability of the receptor to couple with endogenous G proteins. ACh-mediated M 2 R phosphorylation is blocked by dominant Gαo variants in the split- YFP assay Following the dissociation of G proteins from activated GPCRs, a cascade of molecular events is initiated. GPCR kinases (GRKs) are recruited to the receptors, where they bind to the same intracellular pocket previously occupied by the Gα subunit 49 . GRK recruitment enables phosphorylation of multiple residues within the intracellular loops and/or C-terminus of the GPCR. This promotes the subsequent recruitment of β-arrestins, which act as scaffolds for the clathrin-mediated endocytic machinery, ultimately driving receptor internalization 50 . Our findings support the notion that the most severe pathogenic Gαo variants fail to disengage from activated GPCRs, remaining dominantly coupled and thereby preventing GRK recruitment and subsequent receptor phosphorylation. To test this prediction, we analyzed M 2 R phosphorylation using the split-YFP assay. We used a non-pathogenic Gαo construct carrying a four-alanine insertion in the C-terminal α5-helix (ins4A) as control, which is known to abolish G protein release from activated receptors 51 , 52 . As expected, Gαo ins4A prevented ligand-mediated internalization of both M 2 R (Fig. S6A-C) and MOR (Fig. S6D-F) in the split-YFP assay. GRK-mediated phosphorylation of M 2 R targets several Ser/Thr residues in the third intracellular loop ( Fig. 2A ) 53 . We immunostained HEK293T cells expressing the M 2 R-YFP- Gαo complex using a specific antibody that recognizes dual phosphorylation at Thr307 and Ser309 (pT307/pS309). In unstimulated cells, the anti-pT307/pS309 signal was minimal in both transfected and non-transfected cells ( Fig. 2B ). However, following 7 min of ACh stimulation, robust anti-pT307/pS309 staining appeared and closely colocalized with endocytic M 2 R-YFP-Gαo–positive vesicles ( Fig. 2C ). Neighboring untransfected cells showed no increase in the pT307/pS309 signal after stimulation, consistent with the absence of endogenous M 2 R expression in the parental HEK293 line 54 . Download figure Open in new tab Figure 2. Inhibition of ACh-mediated phosphorylation of M 2 R by pathogenic Gαo variants ( A ) Schematic representation of the molecular events following ACh stimulation that lead to M 2 R phosphorylation, as illustrated using the split-YFP assay. ( B , C ) Representative confocal images of HEK293T cells expressing the M 2 R-YFP-Gαo complex at steady state ( B ) and after 7 min of acetylcholine (ACh) stimulation ( C ). Cells were immunostained with a specific antibody recognizing dual phosphorylation at T307 and S309 of M 2 R (M 2 R-pT307/pS309), and counterstained with DAPI to visualize nuclei. A boxed region in ( C ) is shown at higher magnification in the lower panels. ( D - J ) ACh-stimulated HEK293T cells expressing the M 2 R- YFP-Gαo complex with the Gαo mutants S47G ( D ), G203R ( E ), R209C ( F ), C215Y ( G ), E246K ( H ), insPQ ( I ), and the control ins4A ( J ). Cells were prepared as in ( C ). Scale bars, 10 µm. ( K ) Quantification of ACh-mediated endocytic events, expressed as the number of vesicle-like structures positive for both M 2 R-YFP-Gαo and anti-pT307/pS309 staining, normalized to cell area. Associations of Gαo mutants with DEE17, NEDIM, and DYT phenotypes are color-coded. Box plot indicate median (middle line), 25th, 75th percentile (box), and lowest, highest value (whiskers); two-three independent experiments (wild-type, n = 46; S47G, n = 43; G203R, n = 46; R209C, n = 44; C215Y, n = 48; E246K, n = 47; insPQ, n = 50; ins4A, n = 46). Statistical analysis was performed using one-way ANOVA followed by Dunnett’s multiple comparisons test; **** p < 0.0001 and ns: not significant. Notably, the Gαo variants associated with the severe DEE17/NEDIM phenotypes exhibited weak pT307/pS309 staining following ACh stimulation ( Fig. 2D-F and H). Since the ins4A construct produced an equivalent effect ( Fig. 2J ), this result supports the notion that Gαo mutants dominantly couple to M 2 R, thereby preventing GRK recruitment. In contrast, the DYT-associated mutants retained robust phospho-M 2 R staining, similar to wild-type Gαo ( Fig. 2G and I ). To quantify endocytic events, we counted the number of vesicle-like structures positive for both M 2 R-YFP-Gαo and pT307/pS309, and normalized to the cell area ( Fig. 2K ). A marked reduction in phospho-M 2 R-YFP-Gαo–positive vesicles was observed for the DEE17/NEDIM variants and ins4A, whereas DYT mutants exhibited values comparable to wild-type. To confirm the defects in ACh-mediated M 2 R phosphorylation, we took advantage of an anti- GFP nanobody 55 that enables specific immunoprecipitation (IP) of the reconstituted split- YFP, but not the individual YN and YC fragments (Fig. S7). In Western blots following IPs, four distinct protein species can be detected using M2R- and Gαo-specific antibodies: the M 2 R-YN and Gαo-YC monomers, a monomeric M 2 R-YFP-Gαo complex, and a higher molecular weight species, possibly corresponding to a M 2 R-YFP-Gαo dimer (Fig. S7). This likely reflects the known tendency of M 2 R to form dimers and higher-order oligomers 56 . Corroborating the cell imaging data, IP of split-YFP complexes containing wild-type Gαo showed no detectable anti-pT307/pS309 signal for M 2 R at steady state, whereas strong signals emerged following 5 min of ACh stimulation in three species: M 2 R-YN, and the monomeric and dimeric forms of the M 2 R-YFP-Gαo complex ( Fig. 3A ). In contrast, M 2 R- YFP-Gαo complexes formed by the most severe DEE17/NEDIM mutants exhibited a marked reduction in anti-pT307/pS309 reactivity. Unexpectedly, both DYT-associated Gαo variants showed a modest reduction in M 2 R phosphorylation. Quantification revealed a 60-85% reduction for the DEE17/NEDIM variants, and over 90% for Gαo ins4A ( Fig. 3B ). DYT mutants, on the other hand, showed a significant but smaller 20-25% decrease, suggesting that these variants partially impair GRK recruitment – although not to a degree that prevents receptor endocytosis. Download figure Open in new tab Figure 3. Immunoprecipitation of the M 2 R-YFP-Gαo complex confirms impaired phosphorylation by pathogenic Gαo variants ( A ) HEK293T cells expressing the split-YFP constructs M 2 R-YN and Gαo-YC (wild-type, pathogenic mutants, and the ins4A control) were stimulated with 100 µM acetylcholine (ACh) for 5 min and subjected to immunoprecipitation (IP) using an anti-GFP nanobody. Western blotting and immunodetection were performed with antibodies against phosphorylated (pT307/pS309) and total M 2 R. Arrowheads indicate M 2 R-YN, and the monomeric and dimeric forms of the M 2 R-YFP-Gαo complex. ( B ) Quantification of M 2 R phosphorylation levels relative to total receptor ( n = 4). Gαo mutant associations with DEE17, NEDIM, and DYT phenotypes are color-coded. Data represent mean ± SEM. Statistical analysis was performed using one-way ANOVA followed by Dunnett’s multiple comparisons test; **** p < 0.0001. Untagged Gαo mutants recapitulate M 2 R endocytosis and phosphorylation defects While the split-YFP assay provides a powerful tool to visualize these interactions, it relies on internally tagged Gαo constructs, which could theoretically introduce artifacts not present in native, untagged proteins. To address this, we next tested whether the observed effects also occur with untagged Gαo variants. We first employed the split-YFP assay for M 2 R and Gγ3 ( Fig. 4A ), and found that the combination of M 2 R-YC and YN-Gγ3 produced a much stronger fluorescence signal than the reverse configuration (not shown). To test dominant GPCR coupling and receptor endocytosis, we expressed different construct sets in two separate HEK293T cell populations – M 2 R-YC and YN-Gγ3 with or without untagged Gαo – and then co-cultured them. After 7 min of ACh treatment, cells were immunostained for Gαo and pT307/pS309. Download figure Open in new tab Figure 4. Split-YFP assay with M 2 R and Gγ3 recapitulates phosphorylation and endocytosis defects caused by Gαo mutants ( A ) Depiction of the split-YFP assay applied to M 2 R and Gγ3. ( B - F ) Confocal images of co- culture of HEK293T cells expressing the M 2 R-YFP-Gγ3 complex, with or without co-expression of Gαo wild-type ( B ), S47G ( C ), G203R ( D ), R209C ( E ), and E246K ( F ). Cells were stimulated with 100 µM acetylcholine (ACh) for 7 min, then immunostained with anti- pT307/pS309, anti-Gαo, and counterstained with DAPI to visualize nuclei. Magenta and white arrowheads indicate Gαo-expressing and non-expressing cells, respectively. Scale bars, 10 µm. Anti-Gαo signal was absent in non-transfected HEK293T cells, consistent with the lack of Gαo expression in the parental HEK293 line 54 . ACh stimulation triggered robust internalization of the M 2 R-YFP-Gγ3 complex in the presence or absence of wild-type Gαo expression, suggesting that endogenous Gα subunits were sufficient to engage the receptor ( Fig. 4B ). Notably, co-expression of the DEE17/NEDIM variants markedly inhibited both M 2 R phosphorylation and endocytosis, contrasting with the normal response observed in adjacent Gαo-negative cells ( Fig. 4C-F ). Finally, we moved beyond the split-YFP assay and analyzed ACh-mediated phosphorylation of GFP-M 2 R upon co-expression of untagged Gαo variants ( Fig. 5A ). We selected the GFP- M 2 R construct because it lacks intracellular tags, thereby avoiding potential artifacts originating from the receptor. We first examined whether the PM localization of GFP-M 2 R was affected by any Gαo variant. To this end, we immunostained the extracellular M 2 R pool under non-permeabilizing conditions using an anti-GFP antibody, and normalized the signal to the total GFP fluorescence to account for differences in expression (Fig. S8A-H). Quantification showed that GFP-M 2 R surface targeting was unaffected by co-expression of Gαo variants (Fig. S8I). Download figure Open in new tab Figure 5. Immunoprecipitation of GFP-M 2 R validates dominant GPCR coupling by pathogenic Gαo variants ( A ) Diagram of the GFP-M 2 R construct and heterotrimeric Gαoβγ, illustrating the lack of intracellular tagging in the proteins. ( B ) HEK293T cells co-expressing GFP-M 2 R and Gαo wild-type, pathogenic mutants, or the ins4A control were stimulated with 100 µM acetylcholine (ACh) for 5 min and subjected to immunoprecipitation (IP) using an anti-GFP nanobody. Western blotting and immunodetection were performed with antibodies against pT307/pS309 and GFP. ( C ) Quantification of M 2 R phosphorylation levels relative to total receptor ( n = 6). Gαo mutant associations with DEE17, NEDIM, and DYT phenotypes are color-coded. Data represent mean ± SEM. Statistical analysis was performed using one-way ANOVA followed by Dunnett’s multiple comparisons test; ** p < 0.005 and **** p < 0.0001. As expected, IP analysis revealed no detectable phosphorylation of GFP-M 2 R at steady state, whereas a strong anti-pT307/pS309 signal was observed following 5 min of ACh stimulation ( Fig. 5B ). Remarkably, all pathogenic Gαo mutants reduced GFP-M 2 R phosphorylation, following a pattern closely resembling that observed with the split-YFP assay. Quantification revealed a pronounced 65-80% reduction in M 2 R phosphorylation upon co-expression of the DEE17/NEDIM variants, and ∼95% reduction for the Gαo ins4A mutant ( Fig. 5C ). In contrast, co-expression of the DYT variants C215Y and insPQ led to more modest reductions of 20% and 30%, respectively. Altogether, this study indicates that pathogenic Gαo variants remain persistently and dominantly coupled to activated GPCRs. These findings highlight a critical pathogenic mechanism in GNAO1 -related disorders and establish a robust split-YFP assay for its detection and potential therapeutic targeting. Discussion Pathogenic GNAO1 mutations disrupt multiple aspects of Gαo function 26 – 28 . Two distinct mechanisms – nonproductive GPCR coupling and Gβγ sequestration – have been independently reported for several Gαo variants 26 – 28 . This apparent contradiction, together with the absence of a unified biosensor approach, prompted us to develop a split-YFP assay to directly visualize the dominant GPCR coupling behavior of Gαo mutants. Using this system, we found that persistent, dominant coupling to activated GPCRs is a common feature among pathogenic Gαo variants. The most severe mutants failed to disengage from activated receptors, thereby blocking GRK-mediated phosphorylation and subsequent endocytosis. In contrast, less severe mutants only partially impaired GPCR phosphorylation without preventing internalization. BiFC assays have been widely used to analyze protein–protein interactions in living cells 33 , including studies on GPCRs, where most applications have focused on receptor homo- and heteromerization 38 , 57 – 59 . Other BiFC-based approaches have visualized Gβγ dimer formation and localization 60 , Src association with GPCRs 38 , and β-arrestin recruitment following receptor activation 61 , 62 . To our knowledge, this study represents the first BiFC system specifically designed to monitor GPCR coupling by a Gα subunit in mammalian cells. In this assay, YFP complementation at the PM between GPCRs and the Gα appears to be nonselective, as Gαo was able to efficiently tether to the Gs-coupled β 2 AR. Upon stimulation, however, the assay appears highly specific, since pathogenic Gαo variants disrupted internalization of Gi/o-coupled GPCRs, but had no effect on β 2 AR endocytosis. In addition to its functional specificity, another advantage of this system is that the complemented split- YFP can be readily isolated using an anti-GFP nanobody 55 , 63 . This enables not only biochemical analysis of the GPCR-YFP-Gα complex, but also opens possibilities for structural studies of dominant GPCR coupling by pathogenic Gαo variants. Dominant GPCR coupling by Gα subunits has long been recognized in the GPCR field 51 , 52 , 64 – 66 . Studies using engineered, non-pathogenic Gα mutations have proposed two mechanistic modes: sequestration of the activated GPCR by the heterotrimeric G protein, or by nucleotide-free Gα subunits. Although our split-YFP assay cannot discriminate between these mechanisms, insight can be drawn from the distinct behaviors of Gαo variants in previous BRET-based assays. For example, the S47G mutant likely traps the receptor – and Gβγ – in an open, intermediate activation state of the heterotrimeric complex, as it was reported to retain near-normal association with Gβγ but shows markedly impaired dissociation upon GPCR activation 26 – 28 . In contrast, the recurrent G203R, R209C, and E246K variants exhibit significant Gβγ dissociation upon stimulation 26 – 28 , 67 , consistent with receptor trapping by nucleotide-free Gαo following Gβγ dissociation ( Fig. 6 ). Nevertheless, distinguishing between these two modes will require further mechanistic studies. Download figure Open in new tab Figure 6. Proposed mechanisms of dominant GPCR coupling by pathogenic Gαo mutants ( A ) Under physiological conditions, acetylcholine (ACh) activates the M 2 muscarinic acetylcholine receptor (M₂R), promoting GDP-GTP exchange on wild-type Gαo (blue) within the heterotrimeric G protein. This activation triggers dissociation of Gαo-GTP and Gβγ subunits, initiating downstream signaling and allowing receptor phosphorylation and endocytosis. ( B - D ) Pathogenic Gαo variants (red) engage activated GPCRs leading to GDP release ( B ). The failure of Gαo mutants to adopt the active GTP-bound conformation results in dominant GPCR coupling through two distinct mechanisms. In one mode, the mutant Gαo remains in an open, intermediate activation state that retains both the GPCR and Gβγ within a persistent heterotrimeric complex ( C ). In the second mode, mutant Gαo remains tightly bound to the activated receptor in a nucleotide-free state after Gβγ dissociation ( D ). Both mechanisms impair receptor phosphorylation and block endocytosis, potentially leading to signaling defects. In addition to Gαo, dominant GPCR coupling has thus far been implicated only in pathogenic Gαi3 mutations 68 . However, several residues homologous to the Gαo positions analyzed here – Ser47, Gly203, Arg209, and Glu246 – are also mutated in other Gα subunits linked to rare genetic conditions: Gαi2 G203R and R209W 69 , Gαolf E255A 70 , Gαs R231C/H and E268K/G 71 , and Gαi3 S47R, which was shown to dominantly couple to the endothelin type A receptor 68 . These observations support the possibility that dominant GPCR coupling may extend beyond Gαo and Gαi3, as many disease-associated mutations affect additional highly conserved residues shared across Gα subunits 12 – 17 . Thus, we envision that this simple split-YFP approach could be adapted for routine testing of Gαo and potentially other pathogenic Gα variants implicated in a growing number of rare genetic disorders. Beyond mechanistic insights, the robustness and scalability of the split-YFP system lay a foundation for drug discovery or repositioning efforts aimed at restoring normal GPCR coupling dynamics. Such applications could accelerate the identification of therapeutic compounds that reverse receptor trapping or promote dissociation of Gαo mutants, offering new avenues for targeted therapies in GNAO1 -related disorders. Methods Antibodies and reagents Primary antibodies (Abs) for immunofluorescence (IF) and Western blots (WBs): monoclonal Abs (mAbs) anti-Gαo (clone A2, sc-13532; IF: 1:50) and anti-Gαo (clone E1, sc-393874; WB: 1:250) were from Santa Cruz Biotechnology; mAb anti-HA-tag (11867423001; IF: 1/500) was from Roche. Polyclonal antibodies (pAbs) anti-M 2 R (7TM0014N; WB: 1/1000) and anti- pT307/pS309 (7TM0014D; IF: 1:500, WB: 1:1000) were from 7TM Antibodies; pAbs anti- GFP (PABG1; IF: 1/1000) and anti-GFP (50430-2-AP; WB: 1:5000) were from Proteintech. All secondary Abs for immunofluorescence (IF) and Western blots (WBs) were from Jackson ImmunoResearch: anti-Mouse Cy5-conjugated (715-175-151; IF: 1/500), anti-Rabbit Cy3- conjugated (711-165-152; IF: 1/500), anti-Rat Cy3-conjugated (112-165-143; IF: 1/500), anti- mouse HRP-conjugated (115-035-146; WB: 1:5000), and anti-rabbit HRP-conjugated (111-035-144; WB: 1:5000). Acetylcholine (A2661), isoproterenol (I6504), and DAPI (32670) were from Sigma-Aldrich, and EGF-Rhodamine (E3481) was from Thermo Fisher Scientific. Fentanyl (CAS no. 1443- 54-5) were obtained from the University Hospital of Geneva with Département de la sécurité, de la population et de la santé (DSPS) authorization from the Canton of Geneva. Plasmids and molecular cloning Plasmids encoding for the untagged Gαo wild-type and pathogenic mutants were published earlier 28 , 31 , 41 . Untagged Gαo ins4A was kindly provided by Nevin A. Lambert (Augusta University, GA, USA). To generate the mRFP internal tagging of Gαo (at Gly92; Gαo-mRFP), the mRFP sequence was amplified by PCR from pmRFP-C1 41 using the oligonucleotide primers For: 5’–GTCGCCGGGCCCGCCTCCTCCGAGGAC–3’ and Rev: 5’–TTTAAAGCAAGTAAAACCTC–3’. The PCR-product was cloned in-frame into the PspOMI/BsrGI sites of Gαo-GFP 63 . The sequences for the split-YFP fragments YN (aa 1- 158) and YC (aa 159-239) containing a flexible 10-amino acid (GGGGSGGGGS) linker were kindly provided by Daniel F. Legler (Institute of Cell Biology and Immunology Thurgau, Switzerland). To produce the Gαo-YC constructs (internal YC insertion at Gly92), the YC sequence was amplified by PCR using the primers For: 5’– GGATCCACCGGTCCTCACCGGGCCCGGTGGCGGTGGCTCTGG–3’ and Rev: 5’–AGATCTGAGTCCGGACTTGTACACGGACCC–3’. The resulting product was cloned in-frame into the PspOMI/BsrGI sites of Gαo-GFP wild-type and mutants 28 , 31 . The Gαo-YC for ins4A was obtained by replacing the AgeI/PspOMI fragment in Gαo-YC wild-type with the AgeI/NotI fragment from untagged Gαo ins4A. The GFP-M 2 R construct was generated by cloning in-frame the fragment blunted-EcoRI/XhoI from the untagged M 2 R plasmid (MAR0200000; cDNA Resource Center) into the Eco53KI/SalI sites of the PrP-leader-GFP plasmid 72 . To produce the M 2 R-YN construct, we first PCR-amplified the YN sequence with the primers For: 5’–AGCCCGGACCGGTCCTCACCATGGATGGTGGCGGTGGCTC–3’ and Rev: 5’–TTTAGGTGGCGGCCGCGAATAGGACCCTCTAGATTAC–3’. The PCR-product was digested with AgeI/NotI and ligated in-frame into the AgeI/NotI sites of M 2 R-NLuc 28 . The sequence for a signal peptide-HA-tag was generated by the primers For: 5’– TCGACCACCATGAAGACGATCATCGCCCTGAGCTACATCTTCTGCCTGGTATTCGCCTAC CCATACGATGTTCCTGACTATGCGG–3’ and Rev: 5’– AATTCCGCATAGTCAGGAACATCGTATGGGTAGGCGAATACCAGGCAGAAGATGTAGCT CAGGGCGATGATCGTCTTCATGGTGG–3’ and cloned in-frame into the XhoI/EcoRI sites upstream of the M 2 R. For the M 2 R-YC plasmid, the YC fragment was amplified by PCR using the primers For: 5’–ACTATGAACCGGTACTCACCATGGATGGTGGCGGTGGCTC–3’ and Rev: 5’–GCAACTAGAAGGCACAGTCGAGG–3’, and cloned in-frame into the AgeI/NotI sites of the final M 2 R-YN. The β 2 AR-YN plasmid was obtained by cutting the NheI/AgeI coding fragment from β 2 AR-mCFP 73 (Addgene plasmid 38260) and insertion into the same sites of M 2 R-YN. The MOR-YN construct was produced by cutting the XhoI/XmaI coding sequence from the MOR-GFP plasmid 74 (provided by Miriam Stoeber; University of Geneva, Switzerland), and ligation into the XhoI/AgeI sites of M 2 R-YN. The T2A-based bicistronic Gβ3-YN-Gγ3 construct – referred to as YN-Gγ3 for simplicity – was generated through a two-step cloning. First, the single YN-Gγ3 plasmid was cloned by PCR amplification of the YN sequence using the primers For: 5’– CTATAGGACCGGTCAAGACCATGGTGAGCAAGGGCGAGGA–3’ and Rev: 5’– TGCTCGAGTGTACACGGACCCACCACCTCCAGAGC–3’, and the YN fragment was cloned in-frame into the AgeI/BsrGI sites of GFP-Gγ3 41 . Then, a T2A-based bicistronic Gβ3- cpVenus-Gγ9 plasmid was created by cutting the NheI/SalI insert from Go1-CASE 75 (provided by Gunnar Schulte; Karolinska Institutet, Sweden) and ligation of the fragment into the same sites of pEGFP-C1 (Clontech). The final YN-Gγ3 construct was generated by cutting the YN-Gγ3 coding sequence with AfeI/PspOMI, and ligation of this fragment into the blunted-AgeI/PspOMI of Gβ3-cpVenus-Gγ9. A T2A-based bicistronic untagged Gβ3-Gγ9 plasmid (referred to as Gβ3γ9) was generated by cutting out the cpVenus sequence from Gβ3-cpVenus-Gγ9 with AgeI/BspEI, and religation to produce an in-frame Gβ3-T2A-Gγ9 construct. Cell lines and culture conditions Human HEK293T (CRL-3216, ATCC) cells were grown in DMEM, supplemented with 10% FCS, 2 mM L-glutamine, and 1% penicillin-streptomycin (all from Thermo Fisher Scientific) at 37°C and 5% CO 2 . All vector transfections were carried out with X-tremeGENE HP (XTGHP- RO, Roche) according to the manufacturer’s instructions. Split-YFP-based BiFC assay and microscopy For the split-YFP assay between GPCRs and Gαo, HEK293T cells were co-transfected with GPCR-YN constructs (M 2 R, MOR, or β 2 AR), Gαo-YC (wild-type, pathogenic mutants, or the control ins4A), and Gβ3γ9 at a plasmid ratio of 2.5:2.5:1. For the split-YFP assay between M 2 R and Gγ3, cells were co-transfected with M 2 R-YC, YN-Gγ3, and untagged Gαo variants or empty plasmid at the same ratio. After for 6 h, cells were trypsinized, seeded onto poly-L- lysine-coated coverslips, and cultured – or co-cultured, in the case of the M 2 R-Gγ3 split-YFP assay – for an additional 15 h in complete DMEM. For endocytosis analysis of GPCR-YFP-Gαo complexes, cells were stimulated for 10 min with 100 µM acetylcholine (ACh) for M 2 R, 1 µM fentanyl for MOR, or 10 µM isoproterenol for β 2 AR. To determine M 2 R phosphorylation, cells were stimulated with 100 µM ACh for 7 min. To evaluate EGF-uptake, cells were treated with 10 ng/ml EGF-Rhodamine for 10 min as previously described 46 . After treatments, cells were fixed with 4% PFA in PBS for 20 min and permeabilized with ice- cold 0.1% Triton X-100 in PBS for 1 min – this step was omitted under non-permeabilizing conditions. Cells were then blocked for 1 h in PBS supplemented with 1% BSA (810533; Millipore), incubated with primary antibodies in blocking buffer for 2 h at room temperature (RT), washed, and subsequently incubated with fluorescently labelled secondary antibodies and DAPI in blocking buffer for 2 h at RT. Coverslips were mounted with VECTASHIELD (H- 1700; Vector Laboratories) on microscope slides. For immunostaining against phosphorylated M 2 R, all steps were performed in TBS instead of PBS. Samples were recorded using a Plan-Apochromat 63x/1.4 oil objective on an LSM800 confocal microscope with ZEN 3.7 software (all from Zeiss). When quantification was required, all images were acquired using identical confocal settings across all channels. Mean fluorescence intensities, cell area, and vesicle-like structure counts were determined from confocal images either manually or semi-automatically using in-house scripts, all with ImageJ v1.54p (National Institutes of Health). PM targeting of GFP-M 2 R HEK293T cells were co-transfected with GFP-M 2 R, untagged Gαo variants (wild-type, pathogenic mutants, or the control ins4A), and Gβ3γ9 at a plasmid ratio of 2.5:2.5:1. Samples were immunostained under non-permeabilizing conditions, and image acquisition and quantification were performed as described above. Immunoprecipitation The recombinant GST-tagged nanobody against GFP 55 was expressed in Escherichia coli Rosettagami (71351; Novagen) and purified using Glutathione Sepharose 4B beads according to the manufacturer’s instructions. Protein purity was confirmed by SDS-PAGE and Coomassie blue staining. HEK293T cells were co-transfected with the split-YFP constructs for M 2 R, Gαo, and Gβ3γ9, or with GFP-M 2 R, untagged Gαo variants, and Gβ3γ9, using the same plasmid ratio described above. After 24 h of transfection, cells were stimulated with 100 µM ACh for 5 min, then immediately resuspended in ice-cold TBS-lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol) supplemented with protease (04693132001) and phosphatase (04906837001) inhibitor cocktails from Roche. Lysates were passed 15 times through a 25-G needle and cleared by centrifugation at 15,000xg for 15 min at 4°C. Supernatants were incubated with 2 μg of purified anti-GFP nanobody for 30 min on ice, followed by addition of 20 μL of Glutathione Sepharose 4B beads (17075601; Cytiva) and rotation for 3 h at 4°C. Beads were washed repeatedly with TBS-lysis buffer and resuspended in Laemmli sample buffer. Inputs and beads were heated at 50°C for 30 min and analyzed by SDS-PAGE Western blotting using Abs against phospho-M 2 R (pT307/pS309), total M 2 R, Gαo, and GFP. HRP-conjugated secondary antibodies were used for detection, with all antibody incubations performed in TBS containing 1% BSA. Signal was visualized using enhanced chemiluminescence (ECL) on a Fusion FX6 Edge system (Vilber). Quantification of all WBs was performed using ImageJ v1.54p. Final image preparation was done in EvolutionCapt v18.11 (Vilber) and CorelDRAW 2020. Data availability All data supporting the findings of the study are included within the article. Competing interests The authors declare no competing interests. Figure S1. Subcellular localization of M 2 R and Gαo in HEK293T cells ( A , B ) Confocal images of HEK293T cells expressing N-terminally GFP-tagged M 2 R (GFP- M 2 R; A ) and Gαo internally tagged with mRFP (Gαo-mRFP; B ). GFP-M 2 R-expressing cells were immunostained with anti-GFP under non-permeabilizing conditions to label surface GFP. Boxed regions are shown at higher magnification in the lower panels. Scale bars, 10 µm. Figure S2. ACh-mediated Stimulation HEK293T cells expressing the M 2 R-YFP-Gαo complex ( A - G ) Representative confocal images of HEK293T cells expressing the M 2 R-YFP-Gαo complex containing the indicated Gαo variants. Cells were immunostained under non- permeabilizing conditions to label surface M 2 R at steady state (left panels) and after 10 min of acetylcholine (ACh) stimulation (right panels). Scale bars, 10 µm. ( H ) Quantification of M 2 R-YFP-Gαo complex formation across different Gαo variants. Gαo mutant associations with DEE17, NEDIM and DYT phenotypes are color-coded. Box plot indicate median (middle line), 25th, 75th percentile (box), and lowest, highest value (whiskers); two-three independent experiments (wild-type, n = 78; S47G, n = 55; G203R, n = 59; R209C, n = 78; C215Y, n = 59; E246K, n = 63; insPQ, n = 54). ( I ) HEK293T cells expressing the split-YFP Gαo-YC construct (wild-type and pathogenic mutants) were analyzed by Western blot using an anti-Gαo antibody. ( J ) Quantification of Gαo-YC mutant expression levels relative to wild- type ( n = 3). Data represent mean ± SEM. Statistical analyses were performed using one- way ANOVA followed by Dunnett’s multiple comparisons test; * p < 0.05, *** p < 0.001, **** p < 0.0001, and ns: not significant. Figure S3. EGF-Rhodamine uptake by HEK293T cells expressing the M 2 R-YFP-Gαo complex ( A - G ) Representative confocal images of HEK293T cells expressing the M 2 R-YFP-Gαo complex with the indicated Gαo variants. Cells were incubated with 10 ng/ml of EGF- Rhodamine for 10 min. Nuclei were visualized by DAPI staining. Cyan lines demarcate cells expressing M 2 R-YFP-Gαo. Scale bars, 10 µm. ( H ) Quantification of EGF-Rhodamine uptake. Gαo mutant associations with DEE17, NEDIM and DYT phenotypes are color-coded. Box plot indicate median (middle line), 25th, 75th percentile (box), and lowest, highest value (whiskers); two independent experiments (wild-type, n = 51; S47G, n = 56; G203R, n = 51; R209C, n = 52; C215Y, n = 57; E246K, n = 52; insPQ, n = 55). Statistical analysis was done using one-way ANOVA followed by Dunnett’s multiple comparisons test; ns: not significant. Figure S4. Clinically severe Gαo mutants disrupt µ-opioid receptor (MOR) endocytosis ( A ) Illustration of the split-YFP assay applied to MOR and heterotrimeric Gαoβγ. ( B , C ) Representative confocal images of HEK293T cells expressing the MOR-YFP-Gαo complex at steady state ( B ) and after 10 min of 1 µM fentanyl stimulation ( C ). ( D - I ) Confocal images of fentanyl-stimulated HEK293T cells expressing the MOR-YFP-Gαo complex with the indicated pathogenic Gαo variants. Scale bars, 10 µm. Figure S5. Pathogenic Gαo variants do not affect β 2 -adrenoceptor (β 2 AR) endocytosis ( A ) Depiction of the split-YFP assay applied to β 2 AR and heterotrimeric Gαoβγ. ( B , C ) Representative confocal images of HEK293T cells expressing the β 2 AR-YFP-Gαo complex at steady state ( B ) and after 10 min of 10 µM isoproterenol stimulation ( C ). ( D - I ) Confocal images of isoproterenol-stimulated HEK293T cells expressing the β 2 AR-YFP-Gαo complex assembled with the indicated Gαo mutants. Scale bars, 10 µm. Figure S6. The non-pathogenic Gαo ins4A construct blocks M 2 R and MOR endocytosis ( A - F ) Representative confocal images of HEK293T cells expressing the M 2 R-YFP-Gαo ( A - C ) and MOR-YFP-Gαo ( D - F ) complexes assembled with either Gαo wild-type ( A , B , D , E ) and the non-pathogenic ins4A variant ( C , F ). Cells were analyzed at steady state ( A , D ) and after 10 min stimulation with 100 µM acetylcholine (ACh; B , C ) or 1 µM fentanyl ( E , F ). Scale bars, 10 µm. Figure S7. Immunoprecipitation of the M 2 R-YFP-Gαo complex ( A ) HEK293T cells expressing the split-YFP constructs M 2 R-YN and Gαo-YC, either individually or in combination as indicated, were subjected to immunoprecipitation (IP) using an anti-GFP nanobody. Western blotting and immunodetection were performed with antibodies against M 2 R and Gαo. Arrowheads indicate M 2 R-YN, Gαo-YC, and the monomeric and dimeric forms of the M 2 R-YFP-Gαo complex. Figure S8. Plasma membrane localization of GFP-M 2 R in HEK293T cells ( A - H ) Confocal images of HEK293T cells expressing N-terminally GFP-tagged M 2 R (GFP- M 2 R) along with untagged Gαo variants, as indicated. Cells were immunostained with anti- GFP under non-permeabilizing conditions to label extracellular GFP, and counterstained with DAPI to visualize nuclei. Scale bars, 10 µm. ( I ) Quantification of surface M 2 R levels, measured as the ratio of surface to total GFP-M 2 R signal. Gαo mutant associations with DEE17, NEDIM and DYT phenotypes are color-coded. Box plot indicate median (middle line), 25th, 75th percentile (box), and lowest, highest value (whiskers); two independent experiments (wild-type, n = 66; S47G, n = 67; G203R, n = 60; R209C, n = 63; C215Y, n = 69; E246K, n = 64; insPQ, n = 65; ins4A, n = 64). Statistical analysis was done using one-way ANOVA followed by Dunnett’s multiple comparisons test; ns: not significant. Acknowledgements This study was supported by Famiglie GNAO1 Association grant to GPS. We are very thankful to Arthur Radoux-Mergault for the valuable discussions and insightful input throughout the development of this project. We thank Sabina Troccaz for her excellent technical assistance. We are grateful to all members of the Bioimaging core facility at the CMU for their expert assistance with microscopy. References 1. ↵ Fredriksson , R. , Lagerstrom , M.C. , Lundin , L.G. & Schioth , H.B . The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints . Mol Pharmacol 63 , 1256 – 1272 ( 2003 ). OpenUrl Abstract / FREE Full Text 2. Vassilatis , D.K. et al. The G protein-coupled receptor repertoires of human and mouse . Proc Natl Acad Sci U S A 100 , 4903 – 4908 ( 2003 ). OpenUrl Abstract / FREE Full Text 3. ↵ Bjarnadottir , T.K. et al. Comprehensive repertoire and phylogenetic analysis of the G protein- coupled receptors in human and mouse . Genomics 88 , 263 – 273 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 4. ↵ Pierce , K.L. , Premont , R.T. & Lefkowitz , R.J . Seven-transmembrane receptors . Nat Rev Mol Cell Biol 3 , 639 – 650 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 5. ↵ Marinissen , M.J. & Gutkind , J.S . G-protein-coupled receptors and signaling networks: emerging paradigms . Trends Pharmacol Sci 22 , 368 – 376 ( 2001 ). OpenUrl CrossRef PubMed Web of Science 6. ↵ Flock , T. et al. Selectivity determinants of GPCR-G-protein binding . Nature 545 , 317 – 322 ( 2017 ). OpenUrl CrossRef PubMed 7. ↵ Wess , J . Molecular basis of receptor/G-protein-coupling selectivity . Pharmacol Ther 80 , 231 – 264 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 8. ↵ Neves , S.R. , Ram , P.T. & Iyengar , R . G protein pathways . Science 296 , 1636 – 1639 ( 2002 ). OpenUrl Abstract / FREE Full Text 9. ↵ Oldham , W.M. & Hamm , H.E . Heterotrimeric G protein activation by G-protein-coupled receptors . Nat Rev Mol Cell Biol 9 , 60 – 71 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 10. ↵ Dwyer , M.B. , Aumiller , J.L. & Wedegaertner , P.B . Going Rogue: Mechanisms, Regulation, and Roles of Mutationally Activated Galpha in Human Cancer . Mol Pharmacol 106 , 198 – 215 ( 2024 ). OpenUrl Abstract / FREE Full Text 11. ↵ O’Hayre , M. et al. The emerging mutational landscape of G proteins and G-protein-coupled receptors in cancer . Nat Rev Cancer 13 , 412 – 424 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 12. ↵ Bonkowski , E. , Fathi , E. & Mefford , H.C . GNAI1-Related Neurodevelopmental Disorder , in GeneReviews((R)) . (eds. M.P. Adam et al. ) ( Seattle (WA) ; 1993 ). 13. ↵ Briere , L. , Thiel , M. , Sweetser , D.A. , Koy , A. & Axeen , E . GNAO1-Related Disorder , in GeneReviews((R)) . (eds. M.P. Adam et al. ) ( Seattle (WA) ; 1993 ). 14. Deutschlander , A.B. & Wszolek , Z.K . Dyt-Gnal , in GeneReviews((R)) . (eds. M.P. Adam et al. ) ( Seattle (WA) ; 1993 ). 15. Haldeman-Englert , C.R. , Hurst , A.C.E. & Levine , M.A . Disorders of GNAS Inactivation , in GeneReviews((R)) . (eds. M.P. Adam et al. ) ( Seattle (WA) ; 1993 ). 16. Miric , A. , Vechio , J.D. & Levine , M.A . Heterogeneous mutations in the gene encoding the alpha-subunit of the stimulatory G protein of adenylyl cyclase in Albright hereditary osteodystrophy . J Clin Endocrinol Metab 76 , 1560 – 1568 ( 1993 ). OpenUrl CrossRef PubMed Web of Science 17. ↵ Weinstein , L.S. , Chen , M. , Xie , T. & Liu , J . Genetic diseases associated with heterotrimeric G proteins . Trends Pharmacol Sci 27 , 260 – 266 ( 2006 ). OpenUrl CrossRef PubMed 18. ↵ Saez Gonzalez , M. , Kloosterhuis , K. , van de Pol , L. , Baas , F. & Mikkers , H . Phenotypic Diversity in GNAO1 Patients: A Comprehensive Overview of Variants and Phenotypes . Hum Mutat 2023 , 6628283 ( 2023 ). OpenUrl PubMed 19. Novelli , M. et al. GNAO1-related movement disorder: An update on phenomenology, clinical course, and response to treatments . Parkinsonism Relat Disord 111 , 105405 ( 2023 ). 20. ↵ Katanaev , V.L. , Valnohova , J. , Silachev , D.N. , Larasati , Y.A. & Koval , A . Pediatric GNAO1 encephalopathies: from molecular etiology of the disease to drug discovery . Neural Regen Res 18 , 2188 – 2189 ( 2023 ). OpenUrl CrossRef PubMed 21. ↵ Nakamura , K. et al. De Novo mutations in GNAO1, encoding a Galphao subunit of heterotrimeric G proteins, cause epileptic encephalopathy . Am J Hum Genet 93 , 496 – 505 ( 2013 ). OpenUrl CrossRef PubMed 22. ↵ Menke , L.A. et al. Recurrent GNAO1 Mutations Associated With Developmental Delay and a Movement Disorder . J Child Neurol 31 , 1598 – 1601 ( 2016 ). OpenUrl CrossRef PubMed 23. ↵ Wirth , T. et al. Highlighting the Dystonic Phenotype Related to GNAO1 . Mov Disord 37 , 1547 – 1554 ( 2022 ). OpenUrl CrossRef PubMed 24. ↵ Solis , G.P. et al. GNAO1 Mutations Affecting the N-Terminal alpha-Helix of Galphao Lead to Parkinsonism . Mov Disord 39 , 601 – 606 ( 2024 ). OpenUrl CrossRef PubMed 25. ↵ Solis , G.P. et al. Clinical-molecular profiling of atypical GNAO1 patients: Novel pathogenic variants, unusual manifestations, and severe molecular dysfunction . Genes Dis 12 , 101522 ( 2025 ). 26. ↵ Muntean , B.S. et al. Galphao is a major determinant of cAMP signaling in the pathophysiology of movement disorders . Cell Rep 34 , 108718 ( 2021 ). 27. ↵ Knight , K.M. et al. Molecular annotation of G protein variants in a neurological disorder . Cell Rep 42 , 113462 ( 2023 ). 28. ↵ Solis , G.P. et al. Neomorphic Galphao mutations gain interaction with Ric8 proteins in GNAO1 encephalopathies . J Clin Invest 134 , e172057 ( 2024 ). OpenUrl CrossRef PubMed 29. Katanaev , V.L. & Valnohova , J . Molecular biomarkers in GNAO1 encephalopathies . Neural Regen Res ( 2025 ). 30. ↵ Dominguez-Carral , J. et al. Severity of GNAO1-Related Disorder Correlates with Changes in G-Protein Function . Ann Neurol 94 , 987 – 1004 ( 2023 ). OpenUrl CrossRef PubMed 31. ↵ Koval , A. et al. In-depth molecular profiling of an intronic GNAO1 mutant as the basis for personalized high-throughput drug screening . Med 4 , 311 – 325 e317 ( 2023 ). OpenUrl CrossRef PubMed 32. ↵ Knight , K.M. et al. A neurodevelopmental disorder mutation locks G proteins in the transitory pre-activated state . Nat Commun 15 , 6643 ( 2024 ). OpenUrl CrossRef PubMed 33. ↵ Romei , M.G. & Boxer , S.G . Split Green Fluorescent Proteins: Scope, Limitations, and Outlook . Annu Rev Biophys 48 , 19 – 44 ( 2019 ). OpenUrl CrossRef PubMed 34. ↵ Tarasova , N.I. et al. Visualization of G protein-coupled receptor trafficking with the aid of the green fluorescent protein. Endocytosis and recycling of cholecystokinin receptor type A . J Biol Chem 272 , 14817 – 14824 ( 1997 ). OpenUrl Abstract / FREE Full Text 35. ↵ Dong , C. , Filipeanu , C.M. , Duvernay , M.T. & Wu , G . Regulation of G protein-coupled receptor export trafficking . Biochim Biophys Acta 1768 , 853 – 870 ( 2007 ). OpenUrl CrossRef PubMed 36. ↵ Maeda , S. , Qu , Q. , Robertson , M.J. , Skiniotis , G. & Kobilka , B.K . Structures of the M1 and M2 muscarinic acetylcholine receptor/G-protein complexes . Science 364 , 552 – 557 ( 2019 ). OpenUrl Abstract / FREE Full Text 37. ↵ Xu , J. et al. Structural and dynamic insights into supra-physiological activation and allosteric modulation of a muscarinic acetylcholine receptor . Nat Commun 14 , 376 ( 2023 ). 38. ↵ Hauser , M.A. et al. Inflammation-Induced CCR7 Oligomers Form Scaffolds to Integrate Distinct Signaling Pathways for Efficient Cell Migration . Immunity 44 , 59 – 72 ( 2016 ). OpenUrl CrossRef PubMed 39. ↵ Gottlieb-Abraham , E. , Gutman , O. , Pai , G.M. , Rubio , I. & Henis , Y.I . The residue at position 5 of the N-terminal region of Src and Fyn modulates their myristoylation, palmitoylation, and membrane interactions . Mol Biol Cell 27 , 3926 – 3936 ( 2016 ). OpenUrl Abstract / FREE Full Text 40. ↵ Solis , G.P. et al. Local and substrate-specific S-palmitoylation determines subcellular localization of Galphao . Nat Commun 13 , 2072 ( 2022 ). OpenUrl CrossRef PubMed 41. ↵ Solis , G.P. et al. Golgi-Resident Galphao Promotes Protrusive Membrane Dynamics . Cell 170 , 939 – 955 e924 ( 2017 ). OpenUrl CrossRef PubMed 42. ↵ Kudla , J. & Bock , R . Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses . Plant Cell 28 , 1002 – 1008 ( 2016 ). OpenUrl Abstract / FREE Full Text 43. ↵ Akgoz , M. , Kalyanaraman , V. & Gautam , N . Receptor-mediated reversible translocation of the G protein betagamma complex from the plasma membrane to the Golgi complex . J Biol Chem 279 , 51541 – 51544 ( 2004 ). OpenUrl Abstract / FREE Full Text 44. ↵ Miyamoto , S. , Nakashima , M. , Fukumura , S. , Kumada , S. & Saitsu , H . An intronic GNAO1 variant leading to in-frame insertion cause movement disorder controlled by deep brain stimulation . Neurogenetics 23 , 129 – 135 ( 2022 ). OpenUrl CrossRef PubMed 45. ↵ Weinberg , Z.Y. & Puthenveedu , M.A . Regulation of G protein-coupled receptor signaling by plasma membrane organization and endocytosis . Traffic 20 , 121 – 129 ( 2019 ). OpenUrl CrossRef PubMed 46. ↵ Solis , G.P. et al. Reggies/flotillins regulate E-cadherin-mediated cell contact formation by affecting EGFR trafficking . Mol Biol Cell 23 , 1812 – 1825 ( 2012 ). OpenUrl Abstract / FREE Full Text 47. ↵ Masuho , I. et al. Rules and mechanisms governing G protein coupling selectivity of GPCRs . Cell Rep 42 , 113173 ( 2023 ). 48. ↵ Radoux-Mergault , A. , Oberhauser , L. , Aureli , S. , Gervasio , F.L. & Stoeber , M . Subcellular location defines GPCR signal transduction . Sci Adv 9 , eadf6059 ( 2023 ). 49. ↵ Duan , J. et al. GPCR activation and GRK2 assembly by a biased intracellular agonist . Nature 620 , 676 – 681 ( 2023 ). OpenUrl CrossRef PubMed 50. ↵ Ranjan , R. , Dwivedi , H. , Baidya , M. , Kumar , M. & Shukla , A.K . Novel Structural Insights into GPCR-beta-Arrestin Interaction and Signaling . Trends Cell Biol 27 , 851 – 862 ( 2017 ). OpenUrl CrossRef PubMed 51. ↵ Jang , W. , Lu , S. , Xu , X. , Wu , G. & Lambert , N.A . The role of G protein conformation in receptor-G protein selectivity . Nat Chem Biol 19 , 687 – 694 ( 2023 ). OpenUrl CrossRef PubMed 52. ↵ Kaya , A.I. et al. A Conserved Hydrophobic Core in Galphai1 Regulates G Protein Activation and Release from Activated Receptor . J Biol Chem 291 , 19674 – 19686 ( 2016 ). OpenUrl Abstract / FREE Full Text 53. ↵ Pals-Rylaarsdam , R. & Hosey , M.M . Two homologous phosphorylation domains differentially contribute to desensitization and internalization of the m2 muscarinic acetylcholine receptor . J Biol Chem 272 , 14152 – 14158 ( 1997 ). OpenUrl Abstract / FREE Full Text 54. ↵ Atwood , B.K. , Lopez , J. , Wager-Miller , J. , Mackie , K. & Straiker , A . Expression of G protein- coupled receptors and related proteins in HEK293, AtT20, BV2, and N18 cell lines as revealed by microarray analysis . BMC Genomics 12 , 14 ( 2011 ). OpenUrl CrossRef PubMed 55. ↵ Katoh , Y. , Nozaki , S. , Hartanto , D. , Miyano , R. & Nakayama , K . Architectures of multisubunit complexes revealed by a visible immunoprecipitation assay using fluorescent fusion proteins . J Cell Sci 128 , 2351 – 2362 ( 2015 ). OpenUrl Abstract / FREE Full Text 56. ↵ Marsango , S. , Ward , R.J. , Alvarez-Curto , E. & Milligan , G . Muscarinic receptor oligomerization . Neuropharmacology 136 , 401 – 410 ( 2018 ). OpenUrl CrossRef PubMed 57. ↵ Ciruela , F. , Vilardaga , J.P. & Fernandez-Duenas , V . Lighting up multiprotein complexes: lessons from GPCR oligomerization . Trends Biotechnol 28 , 407 – 415 ( 2010 ). OpenUrl CrossRef PubMed 58. Ejendal , K.F. , Conley , J.M. , Hu , C.D. & Watts , V.J . Bimolecular fluorescence complementation analysis of G protein-coupled receptor dimerization in living cells . Methods Enzymol 521 , 259 – 279 ( 2013 ). OpenUrl CrossRef PubMed 59. ↵ Liang , J. et al. The beta2-adrenergic receptor associates with CXCR4 multimers in human cancer cells . Proc Natl Acad Sci U S A 121 , e2304897121 ( 2024 ). OpenUrl CrossRef PubMed 60. ↵ Hynes , T.R. , Yost , E.A. , Yost , S.M. & Berlot , C.H . Multicolor BiFC analysis of G protein betagamma complex formation and localization . Methods Mol Biol 756 , 229 – 243 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 61. ↵ Kilpatrick , L.E. , Briddon , S.J. , Hill , S.J. & Holliday , N.D . Quantitative analysis of neuropeptide Y receptor association with beta-arrestin2 measured by bimolecular fluorescence complementation . Br J Pharmacol 160 , 892 – 906 ( 2010 ). OpenUrl CrossRef PubMed 62. ↵ Song , Y.B. , Park , C.O. , Jeong , J.Y. & Huh , W.K . Monitoring G protein-coupled receptor activation using an adenovirus-based beta-arrestin bimolecular fluorescence complementation assay . Anal Biochem 449 , 32 – 41 ( 2014 ). OpenUrl CrossRef PubMed 63. ↵ Solis , G.P. et al. Pediatric Encephalopathy: Clinical, Biochemical and Cellular Insights into the Role of Gln52 of GNAO1 and GNAI1 for the Dominant Disease . Cells 10 , 2749 ( 2021 ). OpenUrl CrossRef 64. ↵ Barren , B. & Artemyev , N.O . Mechanisms of dominant negative G-protein alpha subunits . J Neurosci Res 85 , 3505 – 3514 ( 2007 ). OpenUrl CrossRef PubMed 65. Ramachandran , S. & Cerione , R.A . A dominant-negative Galpha mutant that traps a stable rhodopsin-Galpha-GTP-betagamma complex . J Biol Chem 286 , 12702 – 12711 ( 2011 ). OpenUrl Abstract / FREE Full Text 66. ↵ Liang , Y.L. et al. Dominant Negative G Proteins Enhance Formation and Purification of Agonist-GPCR-G Protein Complexes for Structure Determination . ACS Pharmacol Transl Sci 1 , 12 – 20 ( 2018 ). OpenUrl CrossRef PubMed 67. ↵ Larasati , Y.A. et al. Restoration of the GTPase activity and cellular interactions of Galpha(o) mutants by Zn(2+) in GNAO1 encephalopathy models . Sci Adv 8 , eabn9350 ( 2022 ). 68. ↵ Marivin , A. et al. Dominant-negative Galpha subunits are a mechanism of dysregulated heterotrimeric G protein signaling in human disease . Sci Signal 9 , ra37 ( 2016 ). 69. ↵ Ham , H. et al. Germline mutations in a G protein identify signaling cross-talk in T cells . Science 385 , eadd8947 ( 2024 ). 70. ↵ LeDoux , M.S. et al. Clinical and genetic features of cervical dystonia in a large multicenter cohort . Neurol Genet 2 , e69 ( 2016 ). OpenUrl Abstract / FREE Full Text 71. ↵ Lemos , M.C. & Thakker , R.V . GNAS mutations in Pseudohypoparathyroidism type 1a and related disorders . Hum Mutat 36 , 11 – 19 ( 2015 ). OpenUrl CrossRef PubMed 72. ↵ Malaga-Trillo , E. et al. Regulation of embryonic cell adhesion by the prion protein . PLoS Biol 7 , e55 ( 2009 ). OpenUrl CrossRef PubMed 73. ↵ Violin , J.D. , Ren , X.R. & Lefkowitz , R.J . G-protein-coupled receptor kinase specificity for beta- arrestin recruitment to the beta2-adrenergic receptor revealed by fluorescence resonance energy transfer . J Biol Chem 281 , 20577 – 20588 ( 2006 ). OpenUrl Abstract / FREE Full Text 74. ↵ Stoeber , M. et al. A Genetically Encoded Biosensor Reveals Location Bias of Opioid Drug Action . Neuron 98 , 963 – 976 e965 ( 2018 ). OpenUrl CrossRef PubMed 75. ↵ Schihada , H. , Shekhani , R. & Schulte , G . Quantitative assessment of constitutive G protein- coupled receptor activity with BRET-based G protein biosensors . Sci Signal 14 , eabf1653 ( 2021 ). View the discussion thread. Back to top Previous Next Posted June 22, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Visualizing the Dominant GPCR Coupling of Pathogenic Gαo Mutants in GNAO1-Related Disorders Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Visualizing the Dominant GPCR Coupling of Pathogenic Gαo Mutants in GNAO1 -Related Disorders Yonika A. Larasati , Camille Rabesahala de Meritens , Miriam Stoeber , Vladimir L. Katanaev , Gonzalo P. Solis bioRxiv 2025.06.19.660437; doi: https://doi.org/10.1101/2025.06.19.660437 Share This Article: Copy Citation Tools Visualizing the Dominant GPCR Coupling of Pathogenic Gαo Mutants in GNAO1 -Related Disorders Yonika A. Larasati , Camille Rabesahala de Meritens , Miriam Stoeber , Vladimir L. Katanaev , Gonzalo P. Solis bioRxiv 2025.06.19.660437; doi: https://doi.org/10.1101/2025.06.19.660437 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Cell Biology Subject Areas All Articles Animal Behavior and Cognition (7617) Biochemistry (17633) Bioengineering (13856) Bioinformatics (41841) Biophysics (21399) Cancer Biology (18529) Cell Biology (25422) Clinical Trials (138) Developmental Biology (13352) Ecology (19860) Epidemiology (2067) Evolutionary Biology (24281) Genetics (15582) Genomics (22461) Immunology (17700) Microbiology (40295) Molecular Biology (17140) Neuroscience (88413) Paleontology (666) Pathology (2823) Pharmacology and Toxicology (4813) Physiology (7632) Plant Biology (15107) Scientific Communication and Education (2042) Synthetic Biology (4284) Systems Biology (9808) Zoology (2267)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00