Morphological, Functional, and Molecular Characterization of the Selected Fungal Endophytes from Neolamarckia cadamba (Roxb.) Bosser

Morphological, Functional, and Molecular Characterization of the Selected Fungal Endophytes from Neolamarckia cadamba (Roxb.) Bosser | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Morphological, Functional, and Molecular Characterization of the Selected Fungal Endophytes from Neolamarckia cadamba (Roxb.) Bosser Sumayya Sabira Sirajudeen, Sheena Harinarayanan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7611023/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Higher plants serve as a valuable source of endophytic fungi, which have been shown to produce a wide range of secondary metabolites with therapeutic potential. Despite extensive studies on endophytes from various plant species, there have been no prior reports on the isolation and characterization of endophytic fungi from Neolamarckia cadamba (Roxb.) Bosser is a medicinally important tree native to tropical Asia. This study aimed to isolate and identify endophytic fungi from the leaves and stems of N. cadamba and assess their phytochemical constituents and biological activities, particularly antioxidant and antimicrobial potential. Results A total of eight endophytic fungi were isolated from N. cadamba , with seven from leaves (NKL1 to NKL7) and one from the stem (NKS1). NKL1, NKL3, and NKL4 exhibited rapid growth and distinct morphological features, and were therefore selected for further analysis. Phytochemical screening of fungal extracts revealed the presence of alkaloids, flavonoids, and carbohydrates. The antioxidant activity, assessed via the DPPH assay, showed a concentration-dependent increase in free radical scavenging ability, with NKL1 and NKL3 exhibiting the highest antioxidant potential, comparable to that of the standard ascorbic acid. The crude extracts of endophytic fungi NKL1, NKL3, and NKL4 exhibited concentration-dependent antibacterial activity against Staphylococcus aureus , Klebsiella pneumoniae , and Escherichia coli , with NKL1 and NKL3 demonstrating the highest inhibitory effects, thereby confirming their antimicrobial potential. Morphological characterization and 18S rRNA gene sequence analysis identified NKL1 and NKL3 as Curvularia lunata and Curvularia tropicalis (NCBI GenBank accession numbers PX205205 and PX218454, respectively), both of which belong to the phylum Ascomycota. Conclusion This study provides the first report of Curvularia lunata and Curvularia tropicalis as endophytic fungi associated with Neolamarckia cadamba . The isolates NKL1 and NKL3 exhibited strong antioxidant and antibacterial properties, suggesting their potential as promising sources of bioactive compounds. These findings support further exploration of N. cadamba -associated endophytes for their therapeutic and industrial applications. Endophytes Phytochemicals Antioxidant Secondary metabolites Antibacterial DNA Sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Endophytes are microorganisms, predominantly bacteria and fungi, that colonize the inter- or intracellular spaces of plant tissues without causing apparent disease symptoms (Pimentel et al. 2011 ; Singh and Dubey, 2015 ). These symbionts complete part or all of their life cycle within host plants, forming intricate mutualistic relationships that significantly influence plant physiology. Within the host environment endophytes, particularly fungi and bacteria, produce a wide array of secondary metabolites and signaling molecules that contribute to plant growth, development, and defense (Eid et al. 2021 ; Saxena, 2014 ). The unique environmental conditions inside plant tissues can induce endophytes to synthesize metabolites not typically produced in free-living states, making them valuable in drug discovery and agriculture (Strobel and Daisy, 2003 ). Fungal endophytes also synthesize phytohormones that regulate various stages of plant development (Al-Kahtani et al. 2020 ). Prolonged plant-endophyte interactions facilitate metabolite exchange and may enhance the biosynthesis of unique compounds through symbiotic co-evolution. As Schulz et al. ( 2002 ) noted, these intimate interactions can drive the production of novel metabolites that are rarely found in other microorganisms, offering a promising platform for the discovery of biologically active compounds. Remarkably, some fungal endophytes can produce the same metabolites as their host plants compounds such as digoxin ( Digitalis lanata ), ginkgolides ( Ginkgo biloba ), hypericin ( Hypericum perforatum ), podophyllotoxin ( Juniperus communis ), and paclitaxel ( Taxus baccata ), suggesting either horizontal gene transfer or metabolic mimicry (Kusari et al. 2009 ; 2012 ; 2014 ; Kaul et al. 2013 ; Cui et al. 2012 ; Vigneshwari et al. 2019 ). In some cases, endophytes utilize alternative or induced biosynthetic pathways to produce related or entirely different bioactive compounds (Ludwig-Muller, 2015). These findings underscore the significant biotechnological potential of fungal endophytes as a source of novel chemical scaffolds (Sadrati et al. 2013 ; Gupta et al. 2020 ). Endophytic fungi isolated from diverse plant species have been shown to produce a wide range of bioactive secondary metabolites with antimicrobial, antioxidant, anticancer, and plant growth-promoting properties (Aly et al. 2011; Kusari et al. 2012 ; Verma et al. 2021 ). Some endophytes can even synthesize metabolites structurally similar to those of their host plants, contributing to both plant health and potential pharmaceutical applications. Strobel et al. ( 2004 ) reported the isolation of endophytic fungi from medicinal plants, notably Taxomyces andreanae from Taxus brevifolia , which was capable of synthesizing taxol, an anticancer compound originally attributed to the host plant. This finding highlights the potential of endophytes as alternative sources of pharmaceutically important metabolites. Proper identification and characterization of these endophytes are essential for harnessing their metabolic capabilities in pharmaceutical and agricultural applications (Kharwar et al. 2011 ). In this context, the present study aims to isolate and characterize fungal endophytes from Neolamarckia cadamba , an ecologically and medicinally important yet endangered tree species. Investigating its endophytic microbiota not only enhances our understanding of plant-microbe interactions but also holds great promise for the discovery of novel bioactive compounds. Materials And Methods Plant Material The plant material Neolamarckia cadamba (Roxb.) Bosser was collected from the Botanical Garden of SNGS College, Pattambi. Fresh, healthy, and mature stems and leaves of N. cadamba were meticulously selected for the isolation of endophytes to minimize any risk of contamination. Isolation of Endophytic Fungi Surface-sterilized stem and leaf segments were carefully placed on PDA media containing antibiotics. The plates were then sealed with cling film and incubated at 25–28°C for 5 to 14 days. The Petri plates were monitored frequently to check the growth of endophytic fungal colonies. Hyphal tips that appeared were transferred to fresh PDA plates and slants of PDA for subculture to develop a pure culture (Piska et al. 2015 ). Morphological Identification of Endophytic Fungi The identification of endophytic fungi was based on morphological features of fungal colonies, fruiting bodies, and spores (Alurappa and Chowdappa, 2018 ). For microscopic observation of fungal mycelium, a drop of Lactophenol cotton blue was placed on a clean microscopic slide, and the hyphal thread was placed on it and carefully dissected with needles. The stained slides were then observed under a microscope to study the microscopic characteristics of the fungi. Non-sporulating cultures were differentiated from one another by their cultural characteristics, including colony morphology, hyphal mat characteristics, and pigmentation of the colony in the medium. Mass Cultivation of Endophytic Fungi Endophytic fungal isolates exhibiting distinct morphological characteristics and rapid growth were selected for mass cultivation. Actively growing mycelial plugs (3 mm in diameter) from 7-day-old pure cultures were aseptically transferred into 250 ml Erlenmeyer flasks containing 100 ml of sterile Potato Dextrose Broth (PDB). Cultures were incubated at room temperature (25 ± 2°C) under shaking conditions at 120 rpm in a rotary shaker. After incubation, cultures were filtered through sterile cheesecloth to separate mycelial mats, retaining the culture filtrate for further analysis (Selvi and Balagengatharathilagam, 2014 ). Extraction of Secondary Metabolites from Endophytic Fungi After mass cultivation of endophytic fungi, the fungal metabolites from different endophytic mycelial mats were extracted using ethyl acetate. An equal volume of the filtrate and solvent was taken in a conical flask and shaken vigorously for one hour. The solution was then allowed to stand, the cell mass was separated, and the solvent so obtained was collected. Then the solvent was evaporated to yield the crude extracts (Selvi and Balagengatharathilagam, 2014 ). Phytochemical Analysis of Crude Extract of Endophytic Fungi Test for Alkaloids Dragendroff’s Test: Dragendroff’s reagent was added to a little of the extract dissolved in its solvent. Alkaloid gives an orange-red precipitate (Alurappa and Chowdappa, 2018 ). Test for Flavonoids NaOH Test: To 1 ml sample, add 3 ml of dilute NaOH; the sample turns yellow color which disappears upon adding dilute HCl, indicating the presence of flavonoids (Alurappa and Chowdappa, 2018 ). Test for Terpenoids Salkowski Test: Take 1 ml of the sample in a test tube and add a few drops of Chloroform along the sides of the test tube. A few drops of concentrated Sulphuric acid were added carefully. Reddish brown coloration at the interface indicates the presence of terpenoids (Alurappa and Chowdappa, 2018 ). Test for Saponin Froth Test: To a 1 mL sample in a test tube, add 2 mL of distilled water. The froth appearance on shaking of the mixture shows the presence of saponin (Alurappa and Chowdappa, 2018 ). Test for Phenol FeCl 3 Test: To 5 drops of the sample solution taken in a test tube, add 3 drops of FeCl3 (5%W/V). A dark green color indicates the presence of phenol (Alurappa and Chowdappa,2018). Test for Coumarins NaOH Test: 10% NaOH was added to the extract, and Chloroform was added. The formation of a yellow color shows the presence of coumarins (Vimalkumar et al. 2014 ). Test for Cardiac Glycosides Keller Killani Test: To a 5 ml extract taken in a test tube, add 2 ml of acetic acid, along with one drop of FeCl3 solution and 1 ml of concentrated sulfuric acid. The appearance of a brown ring indicates the presence of cardiac glycosides. DPPH free radical scavenging assay The free radical scavenging activity of fungal organic extracts was assessed by the DPPH assay. 200 µL of 0.1 mM of DPPH solution (prepared by dissolving DPPH in ethanol) was combined with varying concentrations of fungal extracts (20–100 µg/ml), vortexed vigorously, and incubated for 30 minutes in the dark at room temperature. The absorbance was subsequently measured at 517 nm using a microplate reader with ethanol as blank (Dhayanithy et al. 2019 ). Ascorbic acid was used as a positive control The percentage of radical scavenging potential was calculated using the formula % scavenging = (1-(Abs (517 nm) of the sample/ Abs (517 nm) of the control)) × 100. Antibacterial Assay Disc Diffusion Method 20 mg of the fungal crude extract dissolved in 1 ml of DMSO was used to treat the bacteria. Sterilized paper discs of diameter 6 mm were taken and impregnated with 10, 15, 20, and 25 µl endophytic fungal crude extracts (20mg/ml) and allowed to evaporate in air, and then placed on the lawn of bacteria. 25 µL of DMSO was used as a negative control. The plates were incubated at 37°C for 24 hours, and the zone of inhibition was measured (Ramesha and Srinivas, 2014 ). Molecular identification and phylogenetic analysis of endophytic fungi Molecular identification was conducted using the strains on PDA and incubated for 5–7 days at 29°C. The fungal DNA was extracted using a DNA isolation kit, NucleoSpin Plant II Kit (Macherey-Nagel), according to the manufacturer’s protocol. DNA quality was assessed via1% agarose gel electrophoresis. PCR amplified the ITS1 region of the fungus with the primers ITS1F (5’TCCGTAGGTGAACCTGCGG3’) and ITS4R (5’ TCCTCCGCTTATTGATATGC 3’). PCR reaction conditions were 30 sec at 98°C; 40 cycles of 98°C for 5 s, 58°C for 10 s, and 72°C for 15 s; and 72°C for 15 sec. The PCR products were checked in a 1.2% agarose gel. The PCR products were sequenced by using the BigDye Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, USA) following the manufacturer's protocol. Sequence alignment and editing were performed using Geneious Pro v5.1 (Kearse et al. 2012 ). The resulting DNA sequences were analyzed and compared with those obtained from GenBank via a BLAST search. The obtained nucleotide sequence was submitted to GenBank. Each sequence was refined by removing noise and ambiguous peaks, followed by the assembly of forward (5′–3′) and reverse (3′–5′) sequences to produce a high-quality consensus sequence. These consensus sequences were subjected to BLAST analysis to determine the taxonomic identity of the endophytic isolates by comparison with sequences available in the International Nucleotide Sequence Database Collaboration. The most similar INSDC sequences were retrieved and aligned with the query sequences using ClustalW for multiple sequence alignment. Phylogenetic circumscription and analysis have been conducted to determine the evolutionary relationships among the fungal endophytes. Sequence alignments and phylogenetic tree construction were performed using MEGA v6 software (Tamura et al. 2013 ). The neighbor-joining method was employed to reconstruct phylogenetic trees, providing a robust framework for evolutionary inference. The reliability and statistical support for the inferred phylogenies were assessed using bootstrap analysis with 1,000 replicates, a standard test for evaluating the confidence of branching patterns within the tree (Ramesh et al. 2017 ). Result In this study, a total of eight endophytic fungi were isolated from various parts of Neolamarckia cadamba (Roxb.) Bosser. Among these, seven were sourced from the leaves and designated as NKL1 ( Neolamarckia cadamba leaf strain 1), NKL2, NKL3, NKL4, NKL5, NKL6, and NKL7 (Fig. 1 ). Only one isolate was obtained from the stem, named as NKS1 ( Neolamarckia cadamba stem strain 1). The majority of the fungal endophytes isolated from N. cadamba were extremely slow-growing, with a very slow vegetative growth rate on PDA medium. Consequently, from the total of eight fungal endophytes isolated, only three were selected for further studies, including characterization, antioxidant activity, and antimicrobial screening. The chosen fungal isolates were NKL1, NKL3, and NKL4, which demonstrated better growth rates on both PDA and PDB media. Morphological Identification of Endophytic Fungi The identification of the fungi was done by macroscopic and microscopic observations (Fig. 1 and Fig. 2 ). Table 1 provides a summary of the key characteristics of the fungal isolates from the leaf and stem of Neolamarckia cadamba . Colony colour varied among the isolates, ranging from dark green (NKL1, NKL4, NKL7) to light green (NKL2, NKL5), brown (NKL6), a mixed light brown and light green (NKL3), and light yellow (NKS1). Mycelial morphology showed diversity in branching patterns, septation, and cell shape. Heavily branched, anastomosing hyphae were observed in NKL1, NKL3, and NKL7, whereas NKL4 exhibited pointed terminal ends, and NKL5 possessed irregularly sized barrel-shaped cells with rounded ends. Smooth-walled barrel-shaped cells were recorded in NKL6 and NKL7. Table 1 The characteristics of endophytic fungal isolates from Neolamarckia cadamba . Fungal isolates Colony characters Mycelial characters Spore characters NKL1 Dark green colored Heavily branched, anastomosing, septate mycelium with barrel-shaped cells and the tips of terminal cells are somewhat rounded. Spore like-structures produce inside the hyphae. NKL2 Light green colored Branched, septate mycelium having barrel-shaped cells and are anastomosing. Spore like structures produce outside the hyphae. NKL3 A mixture of light brown and light green colored Heavily branched, septate and anastomosing hyphae. Spores are produced at the end of branches which are two and three celled. NKL4 Dark green colored Branched and septate mycelium with barrel shaped cells and the ends are pointed. Spore producing structures were not found. NKL5 Light green colored Branched and septate mycelium and the cells are barrel shaped which are irregular in size with rounded ends. Spore producing structures were not found. NKL6 Brown colored Branched, septate mycelium which are anastomosing and the cells are smooth walled and barrel shaped. Spore like structures produce inside the hyphae. NKL7 Dark green colored Heavily branched and septate mycelium that is anastomosing and the cells with smooth walls Spores are produced which are oval in shape. NKS1 Light yellow colored Branched and septate hyphae. Spore producing structures were not found. Spore production was detected in five isolates, with variations in location and morphology. NKL1 and NKL6 produced spore-like structures within hyphae, NKL2 produced spores externally, NKL3 formed terminal 2 to 3-celled spores, and NKL7 produced oval-shaped spores. NKL4, NKL5, and NKS1 did not exhibit spore-producing structures under the observed conditions. Overall, leaf isolates demonstrated greater morphological complexity and sporulation diversity compared to the single stem isolate. The microscopic investigation of the spores of NKL1 and NKL3 revealed their similarity to Curvularia spp. At the same time, the absence of identifiable spore structures precluded the definitive identification of NKL4. But its morphology and mycelial characters show its resemblance to Aspergillus spp. There was no published record of any endophytic fungi isolated from Neolamarckia cadamba (Roxb.) Bosser. However, several endophytic bacteria have been isolated from this evergreen tree. Phytochemical screening of crude extracts of isolated endophytic fungi Phytochemical screening of crude extracts from three selected endophytic fungal isolates (NKL1, NKL3, NKL4) revealed the presence of various secondary metabolites (Table 2 ). Alkaloids and flavonoids were consistently detected in all three isolates, indicating their widespread occurrence among the tested fungi. Terpenoids were observed only in NKL3, while saponins, phenolics, coumarins, glycosides, and carbohydrates were absent in all isolates. Cardiac glycosides were present in all three isolates, whereas proteins were not detected (Table 2 ). Table 2 Phytochemical screening of fungal extracts Alkaloid Flavonoid Terpenoid Saponin Phenolics Coumarin Glycosides Cardiac Carbohydrate Protein NKL1 + + - - - - - + - NKL3 + + + - - - - + - NKL4 + + - - - - - + - Antioxidant Activity of Crude Extract of Endophytic Fungi The antioxidant potential of the crude extracts of three endophytic fungal isolates NKL1, NKL3, and NKL4, was evaluated using the DPPH free radical scavenging assay (Table 3 ). The antioxidant activity was calculated by plotting the concentration of the extract in µg/ml on the x-axis and the corresponding percentage of inhibition on the y-axis, using ascorbic acid as the standard. It was found that there is a gradual increase in the inhibition percentage when the concentration of the extract is high. Table 3 DPPH free radical scavenging of the fungal extracts Concentration of the extract ( µg/ ml) Inhibition (%) of Ascorbic Acid Inhibition (%) of NKL 4 Inhibition (%) of NKL1 Inhibition (%) of NKL3 20 56.79 ± 1.754 52.01 ± 1.965 67.59 ± 1.757 65.04 ± 1.954 40 78.64 ± 1.904 57.66 ± 1.986 37.98 ± 1.896 75.20 ± 1.895 60 83.23 ± 1.568 58.87 ± 1.688 70.67 ± 1.709 80.48 ± 1.954 80 90.15 ± 1.734 60.48 ± 1.953 76.25 ± 1.998 86.58 ± 1.925 100 95.32 ± 1.756 73.79 ± 1.762 91.89 ± 1.962 89.43 ± 1.627 At the lowest concentration tested (20 µg/ml), NKL1 and NKL3 exhibited high radical scavenging activity (67.59% and 65.04%, respectively), approaching the activity of ascorbic acid (56.79%), whereas NKL4 displayed comparatively lower inhibition (52.01%). The high inhibition values recorded for NKL1 and NKL3 suggest a richer presence or higher activity of antioxidant compounds such as alkaloids, flavonoids, and terpenoids, as supported by the phytochemical screening results. These compounds are known to act as hydrogen donors and free radical quenchers, thus stabilizing reactive oxygen species. Antibacterial Activity of Crude Extract of Endophytic Fungi The antibacterial activity of crude extracts from NKL1, NKL3, and NKL4 was evaluated against Klebsiella pneumoniae , Staphylococcus aureus , and Escherichia coli using the disc diffusion method at concentrations ranging from 10–25 µl/disc (stock: 20 mg/ml) (Table 4 ; Fig. 3 ). Tetracycline was used as a positive control. All three fungal crude extracts remarkably inhibited Staphylococcus aureus. NKL3 demonstrated broad-spectrum antibacterial activity with consistently larger zones of inhibition against all three bacterial strains, particularly K. pneumoniae and E. coli . NKL1 showed moderate, dose-dependent activity against K. pneumoniae and S. aureus . NKL4 was active only against S. aureus and exhibited no effect on the Gram-negative strains tested. Table 4 Antibacterial activity of endophytic fungi NKL1, NKL3, NKL4 Sl. No Dosage (µl/ disc) (Stock: 20 mg/ ml) Zone of Inhibition (mm) Bacterial strains Klebsiella pneumoniae Staphylococcus aureus Escherichia coli NKL1 NKL3 NKL4 NKL1 NKL3 NKL4 NKL1 NKL3 NKL4 1. 10µl - 14 ± 1.76 - 11 ± 1.64 14 ± 1.86 6 ± 1.66 - 11 ± 0.97 - 2. 15 µl 7 ± 1.75 16 ± 0.65 - 13 ± 1.53 15 ± 1.89 12 ± 0.63 - 15 ± 1.38 - 3. 20 µl 8 ± 1.90 16 ± 1.81 - 15 ± 1.00 15 ± 1.08 14 ± 0.64 - 15 ± 1.76 - 4. 25 µl 10 ± 1.20 17 ± 1.99 - 16 ± 1.96 15 ± 1.17 14 ± 0.57 - 16 ± 1.06 - Molecular Characterization and Phylogenetic Analysis Among the three endophytic fungi (NKL1, NKL3, and NKL4), two were chosen (NKL1 and NKL3) for species identification due to their notable antibacterial and antioxidant properties. Morphological characteristics, including spore and mycelial characteristics, allowed the identification of the endophytic fungal isolate NKL1 as Curvularia lunata (NCBI GenBank accession number PX205205). This identification was further corroborated by the sequence analysis of its 18S rRNA gene, which exhibited a more than 99% sequence similarity to those available in the NCBI database for C. lunata . In a similar vein, based on ITS sequences along with morphological and molecular characterization, the endophytic fungus NKL3 is classified as Curvularia tropicalis (NCBI GenBank accession number PX218454). The NKL1 and NKL3 sequences shared 90.59% identity (Fig. 4 ). The high degree of conservation suggests close genetic relatedness between NKL1 and NKL3. Two endophytes, NKL1 and NKL3, isolated from Neolamarckia cadamba were successfully identified as Curvularia lunata and Curvularia tropicalis , respectively, based on their similarity with reference sequences available in the NCBI database. These fungi have been documented as endophytic in various host plant species. To confirm their taxonomic placement and evolutionary relationships, a phylogenetic tree was constructed using reference sequences retrieved from GenBank (Fig. 5 ). The resulting phylogram resolved four major clusters. Cluster II contained NKL1 ( Curvularia lunata , PX205205), which grouped tightly with other C. lunata accessions and C. petersonii , indicating a close evolutionary relationship to C. lunata . Cluster III contained NKL3 ( Curvularia tropicalis , PX218454), which clustered with C. tropicalis sequences and related species ( C. phaenospora , C. chiangmaiensis ), confirming NKL3’s identity as a C. tropicalis isolate. Other clusters comprised Cochliobolus , Sarocladium , Bipolaris , Phoma , Cercospora , and Agaricus , serving as related taxa and outgroups. The distinct separation of NKL1 and NKL3 within the Curvularia clade supports the BLAST results and demonstrates their evolutionary proximity to well-characterized Curvularia species. This is the first report of C. tropicalis being isolated as an endophyte from N. cadamba , suggesting a potentially unique and symbiotic association. Discussion The present study highlights the diverse bioactivities exhibited by endophytic fungal isolates NKL1, NKL3, and NKL4 derived from Neolamarckia cadamba . The phytochemical screening (Table 2 ) revealed a consistent presence of alkaloids, flavonoids, and cardiac glycosides across all isolates, with terpenoids uniquely detected in NKL3. Alkaloids and flavonoids are well-known for their potent antioxidant and antimicrobial properties (e.g., flavonoids acting as hydrogen donors and metal chelators (Rahim et al. 2022 ). This finding aligns with previous studies demonstrating that endophytic fungi often mirror the medicinal plant’s metabolite profile and can synthesize analogous bioactive compounds (Venieraki et al. 2017 ) Previous phytochemical and bioactivity studies on Neolamarckia cadamba provide a valuable framework for interpreting the present findings. Shikha and Kumar ( 2024 ) quantified flavonoid and tannin contents in different parts—leaves, bark, unripe fruits, and ripe fruits—and found that the bark possessed the highest concentrations of both flavonoids and tannins, highlighting its potential contribution to the plant’s medicinal properties. Similarly, Konatham et al. ( 2025 ) demonstrated that aqueous extracts of N. cadamba leaves exhibited notable antibacterial activity against Staphylococcus aureus and Escherichia coli . The phytochemical screening revealed the presence of alkaloids, saponins, phenolic compounds, proteins, and amino acids. In addition, Haritha et al. ( 2025 ) evaluated aqueous, ethanolic, and cyclohexane extracts of N. cadamba leaves and detected alkaloids, tannins, saponins, steroids, and glycosides, with the aqueous extract showing significant antifungal activity against Aspergillus niger . Collectively, these studies highlight the rich phytochemical diversity and broad-spectrum antimicrobial potential of N. cadamba , underscoring the need for further exploration of its endophytic fungal community for novel bioactive metabolites. The antioxidant assays (Table 4 ) underscored a concentration-dependent increase in DPPH radical scavenging activity, with NKL3 and NKL1 achieving inhibition values comparable to those of ascorbic acid (89–92% at 100 µg/ml). NKL4, however, showed significantly lower activity (74% at 100 µg/ml). Such elevated antioxidant capacities are characteristic of endophytic fungi rich in phenolics and flavonoids, as evidenced in prior research where certain ethyl acetate extracts displayed radical scavenging activities on par with vitamin C (Gupta et al. 2020 ). In the assessment of the antioxidant potential of endophytes isolated from Catharanthus roseus and Calotropis procera , it was noted that the total antioxidant activity in the case of the culture filtrate of all the endophytic crude samples was higher than that of the mycelium, of which the highest antioxidant activity in the culture filtrate was noted in Curvularia geniculata (Chowdhury et al. 2018 ). The free radical percentage activity was reported maximum in the aqueous extract of the stem of N. cadamba at 81% with 1.5 ml and the minimum percentage of scavenging activity was reported in its aqueous extract of leaf part 3.33% with 0.5ml, whereas the methanol extract of stem and leaf showed intermediate activity free radical scavenging activity of 60% and 30% with 1.5ml respectively (Kumar et al. 2020 ). The high scavenging potential of NKL1 and NKL3 likely reflects their richer repertoire of phenolic and flavonoid compounds, as observed in other Curvularia endophytes (Pinheiro et al. 2013 ). The antibacterial assay demonstrated that NKL3 exhibited broad-spectrum activity, with the highest inhibition zones across Klebsiella pneumoniae , Staphylococcus aureus , and Escherichia coli . NKL1 showed moderate activity against Gram-positive S. aureus and K. pneumoniae , whereas NKL4 was effective only against S. aureus . These results resonate with numerous reports describing endophytic fungi as prolific sources of antibacterial compounds, particularly alkaloids and terpenoids as part of their ecological role in plant protection (Strobel 2003 ; Wiyakrutta et al. 2004 ). Mensah et al. ( 2016 ) carried out the antibacterial activity of Curvularia lunata, Aspergillus parasiticus , and Mucor spp. against two gram-negative bacteria ( Escherichia coli, Salmonella typhi ), two gram-positive bacteria ( Staphylococcus aureus, Bacillus subtilis), and one fungus ( Candida albicans) by the broth dilution method. For all fungi, the hexane extracts exhibited a more potent microbial inhibitory activity as demonstrated by the low recorded MIC values: 0.10 mg/ml for Curvularia lunata ,0.068 mg/ml for Aspergillus parasiticus , and 0.018mg/ml for Mucor spp. Rani et al. ( 2017 ) studied the endophytic fungal extracts of Aspergillus nidulans, Curvularia tropicalis, Chaetomium aruenum , and Chaetomium atrobrunneum and demonstrated significant microbial controlling capacity. Curvularia is a member of Ascomycota that exhibits a facultative pathogenic and endophytic lifestyle (Mehta et al. 2022 ). Kharwar et al. ( 2011 ) investigated the diversity and antibacterial activity of endophytic fungi isolated from the medicinal plant Adenocalymma alliaceum. Among the isolated fungi, Curvularia lunata was identified and noted for its significant antibacterial properties. Similarly, Al-Mahi et al. ( 2013 ) isolated the endophytic fungi from Kigelia africana and evaluated their antibacterial activity. Curvularia lunata demonstrated notable antibacterial effects against several pathogenic bacteria. Curvularia and Alternaria exhibit similarities in conidial formation and share somewhat similar morphologies. Curvularia also showed similarity with Bipolaris in the sequence structure and conidial features (Manamgoda et al. 2012 ). Identification based on ITS sequence analyses indicated that all the endophytic isolates obtained from N. cadamba belonged to the phylum Ascomycota. The clustering of NKL1 with Curvularia lunata and NKL3 with C. tropicalis corroborates their BLAST-based identification. This finding is consistent with earlier studies that demonstrate the reliability of ITS phylogenies in resolving Curvularia species (Huang et al. 2009 ). Similar phylogenetic approaches have been successfully used to clarify the taxonomic placement of plant-associated endophytic fungi, highlighting ITS sequencing as a robust tool for evolutionary and diversity assessments (Bongiorno et al. 2016 ; Oliveira et al. 2020 ). Diversity of leaf fungal endophytes from two Coffea arabica varieties and antagonism towards coffee leaf rust. Previous studies have also shown that Ascomycota is the most dominant fungal lineage associated with plants as endophytes (Ramos-Garza et al. 2016 ; Gonzalez-Teuber et al. 2017 ). The predominance of this group is often attributed to its adaptive potential, high sporulation capacity, and ability to colonize diverse plant tissues under varying environmental conditions (Arnold and Lutzoni, 2007). The identification of two Curvularia species with strong bioactive potential underscores the ecological and pharmaceutical significance of N. cadamba endophytes. Curvularia spp. are known to produce a range of secondary metabolites, including polyketides, alkaloids, and terpenoids, with documented antimicrobial, antioxidant, and cytotoxic properties (Kharwar et al. 2011 ). For instance, Curvularia lunata isolated from medicinal plants has been shown to possess strong antibacterial properties, even against drug-resistant strains like MRSA, along with notable anti-inflammatory potential (Kaur et al. 2024 ). Similarly, Curvularia tsudae from Cynodon dactylon has been reported to produce coumarin derivatives with potent antioxidant and antimicrobial activities (Nischitha et al. 2020 ). The bioactive potential of Curvularia isolates aligns with the increasing recognition of endophytes as an alternative source for novel natural products (Kusari et al. 2012 ). The discovery of C. lunata and C. tropicalis in this host plant opens new avenues for exploring species–host specificity and the bioprospecting of novel compounds. Conclusion Endophytic fungi, a previously underexplored group of microorganisms, have recently garnered attention for their ability to produce a diverse range of bioactive compounds. As a key component of a plant’s mycobiome, endophytes contribute significantly to host physiology, resilience, and ecological fitness. The identification of Curvularia lunata and Curvularia tropicalis as endophytes from N. cadamba from the present study represents a novel and significant finding, marking the first report of these fungi inhabiting this plant. The presence of such diverse and potentially beneficial fungal endophytes suggests a complex and possibly co-evolved relationship that may contribute to the plant's stress tolerance, pathogen resistance, or overall ecological fitness. Endophytic fungi, particularly Ascomycetes, are known to influence plant health by enhancing nutrient acquisition, producing secondary metabolites, and offering protection against biotic and abiotic stresses. The conservation of N. cadamba should therefore consider not only the plant itself but also its microbial symbionts, which may play crucial roles in its survival and adaptability. The discovery of C. lunata and C. tropicalis as endophytes opens new avenues for understanding the plant’s resilience and supports the broader need for integrated conservation strategies that include microbial biodiversity as a component of endangered plant protection. Further studies are anticipated to carry out the pharmacological profiling of fungal metabolites. This may help in detecting novel pharmacologically active therapeutic molecules that can be used as a lead in the drug discovery process. Declarations Acknowledgement The authors wish to express their sincere gratitude to Dr. Vivek P. J., Head of the Department of Botany, Sree Neelakanta Government Sanskrit College, Pattambi, for his valuable advice, critical revisions of the manuscript and generous support throughout this investigation. We also thank the other teaching staff of the department for their assistance, and the staff of Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, for their timely services and kind cooperation. Their collective support was vital for the successful completion of this project. Authors contributions Dr. Sumayya S. S. conceptualized the study, designed the research framework, and contributed to data interpretation and manuscript preparation. Ms. Sheena carried out data collection, performed preliminary analysis, and assisted in drafting the manuscript. Both authors read and approved the final version of the manuscript. Funding The authors declare that no financial support was received for the research, authorship, and publication of this article. Data availability and materials The authors declare that the data supporting the findings of this study are available within the paper. Sequencing data were deposited in the NCBI database. Conflict of interest The authors declare that the research was conducted in the absence of any financial relationships that could be construed as a potential conflict of interest. Ethics approval and consent to participate This paper does not involve human and animal experiments, so it does not need ethical approval and informed consent. Consent for publication All the authors agree to publish the paper. Competing interests The authors declare that they have no competing interests. Authors details 1 Sabira Sirajudeen Sumayya, Assistant Professor of Botany, Postgraduate and Research Department of Botany, Sree Neelakanta Government Sanskrit College, Palakkad, Kerala state, India; 1 Sheena Harinaraynan, Postgraduate and Research Department of Botany, Sree Neelakanta Government Sanskrit College, Palakkad, Kerala state, India. References Al-Kahtani MDF, Fouda A, Attia KA, Al-Otaibi F, Eid AM, Ewais EED, Hijri M, St-Arnaud M, Hassan SED, Khan N, Hafez YM, Abdelaal KAA (2020) Isolation and characterization of plant growth-promoting endophytic bacteria from desert plants and their application as bioinoculants for sustainable agriculture. Agronomy 10:1325. https://doi.org/10.3390/agronomy10091325 Al-Mahi I, Ietidal Al T, Eihab I (2013) Antibacterial activity of endophytic fungi extracts from the medicinal plant Kigelia africana. Egypt Acad J Biol Sci G Microbiol 5(1):1–9. https://doi.org/10.21608/eajbsg.2013.16639 Alurappa P, Chowdappa P (2018) Isolation and identification of endophytic fungi from Cinnamomum verum and their antifungal activity against Colletotrichum gloeosporioides. Int J Curr Microbiol Appl Sci 7:2712–2722. https://doi.org/10.20546/ijcmas.2018.701.312 Aly AH, Debbab A, Kjer J, Proksch P (2010) Fungal endophytes from higher plants: a prolific source of phytochemicals and other bioactive natural products. Fungal Divers 41:1–16. https://doi.org/10.1007/s13225-010-0034-4 Bennet JW (2010) Statins and other cholesterol-lowering drugs produced by fungi. J Antibiot 63:263–266. https://doi.org/10.1038/ja.2010.40 Bongiorno VA, Rhoden SA, Garcia A, Azevedo JL, Pamphile JA (2016) Genetic diversity of endophytic fungi from Coffea arabica cv. IAPAR-59 in organic crops. Ann Microbiol 66:855–865. https://doi.org/10.1007/s13213-015-1168-0 Chowdhury SP, Hartmann A, Gao X, Medina M, Zappala S, Musa T, Müller DB, Coskun D, Schulze-Lefert P, Höfer CK (2018) Curvularia geniculata isolated from Calotropis procera: endophytic fungus with potential applications. Fungal Biol 122:835–847. https://doi.org/10.1016/j.funbio.2018.05.006 Cui JL, Guo SX, Xiao PG (2012) Ginkgolide B produced by endophytic fungus (Fusarium oxysporum) isolated from Ginkgo biloba. Fitoterapia 83:913–920. https://doi.org/10.1016/j.fitote.2012.04.006 Dhayanithy G, Subban K, Chelliah J (2019) Diversity and biological activities of endophytic fungi associated with Catharanthus roseus. BMC Microbiol 19:22–34. https://doi.org/10.1186/s12866-019-1386-x Eid AM, Fouda A, Abdel-Rahman MA, Salem SS, Elsaied A, Oelmüller R, Hijri M, Bhowmik A, Elkelish A, Hassan SE-D (2021) Harnessing bacterial endophytes for promotion of plant growth and biotechnological applications: an overview. Plants 10:935. https://doi.org/10.3390/plants10050935 Gonzalez-Teuber M, Vilo C, Bascuñán-Godoy L (2017) Molecular characterization of endophytic fungi associated with the roots of Chenopodium quinoa inhabiting the Atacama Desert, Chile. Genomics Data 11:109–112. https://doi.org/10.1016/j.gdata.2016.12.015 Gupta S, Chaturvedi P, Kulkarni MG, Van Staden J (2020) A critical review on exploiting the pharmaceutical potential of plant endophytic fungi. Biotechnol Adv 39:107462. https://doi.org/10.1016/j.biotechadv.2019.107462 Haritha VANV, Geethika A, Krishna RG, Harika B, Saraswathi G, Rajeshwar G (2025) Phytochemical screening & comparative study of different extracts on antifungal activity of Neolamarckia cadamba leaf. Int J Res Pharmacol Pharmacother 14. https://ijrpp.com/ijrpp/article/view/553 Huang WY, Cai YZ, Surveswaran S, Hyde KD, Corke H, Sun M (2009) Molecular phylogenetic identification of endophytic fungi isolated from three Artemisia species. Fungal Divers 36:69–88. https://doi.org/10.1007/s13225-008-0078-x Kaul S, Ahmed M, Zargar K, Sharma P, Dhar MK (2013) Prospecting endophytic fungal assemblage of Digitalis lanata Ehrh. (foxglove) as a novel source of digoxin: a cardiac glycoside. Biotech 3:335–340. https://doi.org/10.1007/s13205-012-0106-0 Kaur M, Mishra RC, Lahane V, Kumari A, Yadav AK, Garg M, Barrow CJ, Goel M (2024) Chemical characterization and biological activity of Curvularia lunata, an endophytic fungus isolated from lemongrass (Cymbopogon citratus). Braz J Micro 55:3261–3267. https://doi.org/10.1007/s42770-024-01503 Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649. https://doi.org/10.1093/bioinformatics/bts199 Kharwar RN, Verma SK, Mishra A, Gond SK, Sharma VK, Afreen T, Kumar A (2011) Assessment of diversity, distribution and antibacterial activity of endophytic fungi isolated from a medicinal plant Adenocalymma alliaceum Miers. Symbiosis 55:39–46. https://doi.org/10.1007/s13199-011-0142-2 Konatham LS, Molleti V, Elugubanti T, Thota S, Volleti M, Arugula K, Begum MHM, Kamala G (2025) Antimicrobial activity and phytochemical evaluation of Neolamarckia cadamba leaf extract. J Pharma Insights Res 3:151–158. https://doi.org/10.69613/hr6yy112 Kumar D, Kumar S, Sahu M, Kumar A (2020) Phytochemical screening and antioxidant activity of Neolamarckia cadamba and Cymbopogon citratus from Durg District of Chhattisgarh, India. Saudi J Biomed Res 5:343–348 Kusari S, Hertweck C, Spiteller M (2012) Chemical ecology of endophytic fungi: origins of secondary metabolites. Nat Prod Rep 29:470–493. https://doi.org/10.1039/c2np20032c Kusari S, Lamshoeft M, Spiteller M (2009) Aspergillus fumigatus Fresenius, an endophytic fungus from Juniperus communis L. Horstmann as a novel source of the anticancer pro-drug deoxypodophyllotoxin. J Appl Microbiol 107:1019–1030. https://doi.org/10.1111/j.1365-2672.2009.04306.x Kusari S, Singh S, Jayabaskaran C (2014) Rethinking production of Taxol (paclitaxel) using endophyte biotechnology. Trends Biotechnol 32:304–311. https://doi.org/10.1016/j.tibtech.2014.03.011 Ludwig-Müller J (2015) Plants and endophytes: equal partners in secondary metabolite production? Biotechnol Lett 37:1325–1334. https://doi.org/10.1007/s10529-015-1814-4 Manamgoda DS, Cai L, Bahkali AH, Chukeatirote E, Hyde KD (2012) A phylogenetic and taxonomic re-evaluation of the Bipolaris–Cochliobolus–Curvularia complex. Fungal Divers 56:131–144. https://doi.org/10.1007/s13225-012-0189-2 Mehta S, Sarma BK, Kumar A, Sharma A (2022) Biology, ecology, and potential applications of genus Curvularia: a review. Mycology 13:12–30. https://doi.org/10.1080/21501203.2021.2003669 Mensah JK, Addo P, Frimpong S, Ofori NO (2016) Antibacterial activity of Curvularia lunata, Aspergillus parasiticus, and Mucor spp. against pathogenic bacteria and fungi. J Mycol Plant Pathol 46:302–310 Nischitha R, Vasanthkumari MM, Kumaraswamy BE, Shivanna MB (2020) Antimicrobial and antioxidant activities and chemical profiling of Curvularia tsudae endophytic in Cynodon dactylon (L.) Pers. Biotech 1:300. https://doi.org/10.1007/s13205-020-02250-0 Oliveira RA, Costa LEO, Santos TT, Araújo EF, Queiroz MV (2020) Diversity of leaf fungal endophytes from two Coffea arabica varieties and antagonism towards coffee leaf rust. Plants 13:814. https://doi.org/10.3390/plants13060814 Pimentel MR, Molina G, Dionísio AP, Marostica Junior MR, Pastore GM (2011) The use of endophytes to obtain bioactive compounds and their application in biotransformation process. Biotechnol Res Int 576286:1–11. https://doi.org/10.4061/2011/576286 Pinheiro EAA, Carvalho JM, dos Santos DCP, Feitosa AO, Marinho PSB, Guilhon GMSP, Marinho AMR (2013) Antibacterial activity of alkaloids produced by endophytic fungus Aspergillus sp. EJC08 isolated from Bauhinia guianensis. Nat Prod Res 27(19):1633–1638. https://doi.org/10.1080/14786419.2012.724405 Piska KB, Bohácsová M, Sláviková E (2015) Isolation and identification of endophytic fungi from Vaccinium myrtillus L. J Microbiol Biotechnol Food Sci 5:278–282. https://doi.org/10.15414/jmbfs.2015.5.4.278-282 Rahim S, Sarmidi MR, Aziz R (2022) Flavonoids: Potent phytochemicals with promising antioxidant and antimicrobial activities. Front Pharmacol 13:967911. https://doi.org/10.3389/fphar.2022.967911 Ramesh V, Arivudainambi USE, Rajendran A (2017) The molecular phylogeny and taxonomy of endophytic fungal species from the leaves of Vitex negundo L. Stud Fungi 2:26–37. https://doi.org/10.5943/sif/2/1/4 Ramesha A, Srinivas C (2014) Antimicrobial activity and phytochemical analysis of crude extracts of endophytic fungi isolated from Plumeria acuminata L. and Plumeria obtusifolia L. Eur J Exp Biol 4:35–43 Ramos-Garza J, Rodríguez-Tovar AV, Flores-Cotera LB et al (2016) Diversity of fungal endophytes from the medicinal plant Dendropanax arboreus in a protected area of Mexico. Ann Microbiol 66:991–1002. https://doi.org/10.1007/s13213-015-1184-0 Rani R, Sharma D, Chaturvedi M, Yadav JP (2017) Antibacterial activity of twenty different endophytic fungi isolated from Calotropis procera and time kill assay. Clin Microbiol 6:280. https://doi.org/10.4172/2327-5073.1000280 Sadrati N, Daoud H, Zerroug A, Dahamna S, Bouharati S (2013) Screening of antimicrobial and antioxidant secondary metabolites from endophytic fungi isolated from wheat (Triticum durum). J Plant Prot Res 53:128–136. https://doi.org/10.2478/jppr-2013-0019 Saxena S (2014) Microbial metabolites for development of ecofriendly agrochemicals. Allelopathy J 33:1–24 Schulz B, Boyle C, Draeger S, Römmert AK, Krohn K (2002) Endophytic fungi: a source of novel biologically active secondary metabolites. Mycol Res 106:996–1004. https://doi.org/10.1017/S0953756202006342 Selvi B, Balagengatharathilagam P (2014) Isolation and screening of endophytic fungi from medicinal plants of Virudhunagar district for antimicrobial activity. Int J Sci Nat 5:147–155 Shikha S, Kumar A (2024) Flavonoid and tannin estimation of Neolamarckia cadamba: A comparative evaluation. Int J Adv Res Eng Sci Manag 12:1 Singh R, Dubey AK (2015) Endophytic actinomycetes as emerging source for therapeutic compounds. Indo Global J Pharm Sci 5:106–116. https://doi.org/10.35652/igjps.2015.11 Strobel G, Daisy B (2003) Bioprospecting for microbial endophytes and their natural products. Microbiol Mol Biol Rev 67:491–502. https://doi.org/10.1128/MMBR.67.4.491-502.2003 Strobel G, Daisy B, Castillo U, Harper J (2004) Natural products from endophytic microorganisms. J Nat Prod 67:257–268. https://doi.org/10.1021/np030397v Strobel GA (2003) Endophytes as sources of bioactive products. Microbes Infect 5(6):535–544. https://doi.org/10.1016/S1286-4579(03)00073-X Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725–2729. https://doi.org/10.1093/molbev/mst197 Venieraki A, Dimou M, Pergalis P, Kefalogianni I, Chatzipavlidis I, Katinakis P (2017) Endophytic fungi from legumes: Diversity and beneficial traits. Symbiosis 72(3):165–175. https://doi.org/10.1007/s13199-016-0459-z Verma VC, Kharwar RN, Strobel G (2021) Chemical diversity and biological potential of fungal endophytes from medicinal plants. Fungal Ecol 48:101006. https://doi.org/10.1016/j.funeco.2020.101006 Vigneshwari A, Rakk D, Németh A, Kocsubé S, Kiss N, Csupor D, Papp T, Škrbić B, Vágvölgyi C, Szekeres A (2019) Host metabolite producing endophytic fungi isolated from Hypericum perforatum. PLoS ONE 14:e0217060. https://doi.org/10.1371/journal.pone.0217060 Vimalkumar CS, Hosagaudar VB, Suja SR, Vilash V, Krishnakumar NM, Latha PG (2014) Comparative preliminary phytochemical analysis of ethanolic extracts of leaves of Olea dioica Roxb., infected with the rust fungus Zaghouania oleae (E.J. Butler) Cummins and non-infected plants. J Pharmacogn Phytochem 3:69–72 Wiyakrutta S, Sriubolmas N, Panphut W, Thongon N, Danwisetkanjana K, Ruangrungsi N, Meevootisom V (2004) Endophytic fungi with antimicrobial, anti-cancer and anti-malarial activities from Thai medicinal plants. World J Microbiol Biotechnol 20(3):265–272. https://doi.org/10.1023/B:WIBI.0000023833.18902.5e Zheng YK, Qiao XG, Miao CP et al (2016) Diversity, distribution and biotechnological potential of endophytic fungi. Ann Microbiol 66:529–542. https://doi.org/10.1007/s13213-015-1153-7 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7611023","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":519440368,"identity":"360e9867-710c-400e-83c5-b9f4270cfcac","order_by":0,"name":"Sumayya Sabira Sirajudeen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/UlEQVRIiWNgGAWjYHADxoYDCRUMDGwMzA1Ea2l88OAMSAsj0VoYmA0ftkGsw6tMfkZ24mfeNjt7g2uH2yQS59VG87EfbGD4UbENpxaDG7mbpXnbkhM33E4Eatl2PLeNJ7GBsefMbdxaJHI3ALUwJxhAtBzLbWNIbGBmbMOtRX5G7ubfvG319hAtc4Ba+B/i18JwI3cb0JbDjECHNRskNtTkAjXi12Jw5u02yznnjifOvJ3Y+CDh2AGglocNB/H5Rb49d/ONN2XV9ny30x8c/FFTlzu/P/nggx8VeBwGBEy8bHD2YTB5AK96IGD88QfOriOkeBSMglEwCkYgAAAf3GMqisKn3QAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0009-0008-1439-3673","institution":"Sree Neelakanta Government Sanskrit College","correspondingAuthor":true,"prefix":"","firstName":"Sumayya","middleName":"Sabira","lastName":"Sirajudeen","suffix":""},{"id":519440369,"identity":"c4963867-2dd3-4a11-9340-59bb68483890","order_by":1,"name":"Sheena Harinarayanan","email":"","orcid":"","institution":"Sree Neelakanta Government Sanskrit College","correspondingAuthor":false,"prefix":"","firstName":"Sheena","middleName":"","lastName":"Harinarayanan","suffix":""}],"badges":[],"createdAt":"2025-09-14 07:23:39","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7611023/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7611023/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92833192,"identity":"a121f24c-f416-4f0b-9f9f-3b2e0104f4fd","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9407359,"visible":true,"origin":"","legend":"","description":"","filename":"FIGURESAnnalsofMicrobiology.docx","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/9c4adc48146eadae96d0ccef.docx"},{"id":92834024,"identity":"cdb64316-d03f-4b93-9ded-e6ef33aa1139","added_by":"auto","created_at":"2025-10-06 07:20:40","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21078,"visible":true,"origin":"","legend":"","description":"","filename":"TablesAnnalsofMicrobiology.docx","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/f7a53a4446a47ee5d1412b64.docx"},{"id":92833182,"identity":"d4f65518-e66f-4986-a5fd-949ac090ca60","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8220,"visible":true,"origin":"","legend":"","description":"","filename":"amoaAMOAD2500181.xml","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/1ca3e013e229eecef35b88b6.xml"},{"id":92834025,"identity":"4d574cee-3872-4512-bb04-66f06664ad5e","added_by":"auto","created_at":"2025-10-06 07:20:40","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1140,"visible":true,"origin":"","legend":"","description":"","filename":"AMOAD25001816696.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/67e5b59f871014ad3d49e628.xml"},{"id":92833190,"identity":"103ec458-7047-4e53-807b-ec97bb78d3c2","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":926,"visible":true,"origin":"","legend":"","description":"","filename":"AMOAD2500181Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/9e54017b95642a0b1a0d20a3.xml"},{"id":92833687,"identity":"10133304-7f2a-43b1-8e46-7ab0bc9fb461","added_by":"auto","created_at":"2025-10-06 07:12:40","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":152070,"visible":true,"origin":"","legend":"","description":"","filename":"AMOAD25001810enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/df62d2dcf14f4d4872004e94.xml"},{"id":92833191,"identity":"f309ef3b-b9fd-4416-9263-cf3ee392142c","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":377716,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/b98c929ed855ade7dee6241a.png"},{"id":92833199,"identity":"57747bf8-cb44-45f1-b0d4-361b0e733a26","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":189963,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/a68a66d5bd54d78e8b931b2a.png"},{"id":92833194,"identity":"86a5f5c2-a050-4a92-9ed8-3fef9943d511","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":548365,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/9c8e81a666ef83714914c1ea.png"},{"id":92833188,"identity":"4e48d611-94ab-46e7-9218-d9c9b4d4fe0a","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102067,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/50137494d4b701b8d525c1d5.png"},{"id":92833198,"identity":"42345489-6094-4857-a1f3-656f098ee00b","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113883,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/204ac49658390604f72853d7.png"},{"id":92833196,"identity":"792103b7-ebe6-4932-8d00-4b42844a6b89","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150170,"visible":true,"origin":"","legend":"","description":"","filename":"AMOAD25001810structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/baf211891b224cbfddfcd139.xml"},{"id":92833197,"identity":"2558426d-75f6-40b9-bb9d-14b462dda180","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":160847,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/ecbfb00a3be0623c1bd68bca.html"},{"id":92833682,"identity":"cdfd7a3d-7ed7-440c-b005-171eba92f707","added_by":"auto","created_at":"2025-10-06 07:12:39","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1250052,"visible":true,"origin":"","legend":"\u003cp\u003eThe pure culture of fungal endophytes isolated from the leaves (NKL 1 to NKL 7) and stem (NKS 1) of \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/39ecc6531729c259ab4e2d21.jpeg"},{"id":92833184,"identity":"71536a25-f7df-4c34-a1aa-724b01f027f1","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1936270,"visible":true,"origin":"","legend":"\u003cp\u003eMycelial characters of endophytic fungi from leaves (NKL1 to NKL7) and stem (NKS1) isolated from \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/db36d644b0c7356b0265d7d2.png"},{"id":92833683,"identity":"09164ee4-9446-4cf2-aa63-758937b45365","added_by":"auto","created_at":"2025-10-06 07:12:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2943050,"visible":true,"origin":"","legend":"\u003cp\u003eAntibacterial activity of the crude extract of NKL3 and NKL4 against \u003cem\u003eKlebsiella pneumoniae, Staphylococcus aureus \u003c/em\u003eand\u003cem\u003eEscherichia coli\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/6f2138fed2eae582dd29aa3c.png"},{"id":92833185,"identity":"9f41cd88-c889-431f-a000-af2e44576860","added_by":"auto","created_at":"2025-10-06 07:04:40","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":289795,"visible":true,"origin":"","legend":"\u003cp\u003eComparative Sequence Alignment of Endophytic Fungal Isolates NKL1 and NKL3 ( Asterisks (*) indicate identical bases, while gaps (–) represent insertions or deletions)\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/62ed9643f5f85c7d2026a0b1.png"},{"id":92833684,"identity":"fdc576db-1126-4683-8c51-eaff6d8a541e","added_by":"auto","created_at":"2025-10-06 07:12:40","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":906145,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogram depicting the relationship between NKL1 and NKL3 endophytic fungal species inferred from ITS nucleotide sequence data.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/39388bc9fa421a13861aab29.png"},{"id":94598499,"identity":"180b011e-5cd2-4554-8357-5ed731b67c3f","added_by":"auto","created_at":"2025-10-28 18:53:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9643378,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7611023/v1/bb6e746c-7649-4be0-a887-435b4035915f.pdf"}],"financialInterests":"","formattedTitle":"Morphological, Functional, and Molecular Characterization of the Selected Fungal Endophytes from Neolamarckia cadamba (Roxb.) Bosser","fulltext":[{"header":"Background","content":"\u003cp\u003eEndophytes are microorganisms, predominantly bacteria and fungi, that colonize the inter- or intracellular spaces of plant tissues without causing apparent disease symptoms (Pimentel et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Singh and Dubey, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). These symbionts complete part or all of their life cycle within host plants, forming intricate mutualistic relationships that significantly influence plant physiology. Within the host environment endophytes, particularly fungi and bacteria, produce a wide array of secondary metabolites and signaling molecules that contribute to plant growth, development, and defense (Eid et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Saxena, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The unique environmental conditions inside plant tissues can induce endophytes to synthesize metabolites not typically produced in free-living states, making them valuable in drug discovery and agriculture (Strobel and Daisy, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFungal endophytes also synthesize phytohormones that regulate various stages of plant development (Al-Kahtani et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Prolonged plant-endophyte interactions facilitate metabolite exchange and may enhance the biosynthesis of unique compounds through symbiotic co-evolution. As Schulz et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2002\u003c/span\u003e) noted, these intimate interactions can drive the production of novel metabolites that are rarely found in other microorganisms, offering a promising platform for the discovery of biologically active compounds. Remarkably, some fungal endophytes can produce the same metabolites as their host plants compounds such as digoxin (\u003cem\u003eDigitalis lanata\u003c/em\u003e), ginkgolides (\u003cem\u003eGinkgo biloba\u003c/em\u003e), hypericin (\u003cem\u003eHypericum perforatum\u003c/em\u003e), podophyllotoxin (\u003cem\u003eJuniperus communis\u003c/em\u003e), and paclitaxel (\u003cem\u003eTaxus baccata\u003c/em\u003e), suggesting either horizontal gene transfer or metabolic mimicry (Kusari et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kaul et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Cui et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Vigneshwari et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In some cases, endophytes utilize alternative or induced biosynthetic pathways to produce related or entirely different bioactive compounds (Ludwig-Muller, 2015). These findings underscore the significant biotechnological potential of fungal endophytes as a source of novel chemical scaffolds (Sadrati et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Gupta et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eEndophytic fungi isolated from diverse plant species have been shown to produce a wide range of bioactive secondary metabolites with antimicrobial, antioxidant, anticancer, and plant growth-promoting properties (Aly et al. 2011; Kusari et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Verma et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Some endophytes can even synthesize metabolites structurally similar to those of their host plants, contributing to both plant health and potential pharmaceutical applications. Strobel et al. (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) reported the isolation of endophytic fungi from medicinal plants, notably \u003cem\u003eTaxomyces andreanae\u003c/em\u003e from \u003cem\u003eTaxus brevifolia\u003c/em\u003e, which was capable of synthesizing taxol, an anticancer compound originally attributed to the host plant. This finding highlights the potential of endophytes as alternative sources of pharmaceutically important metabolites. Proper identification and characterization of these endophytes are essential for harnessing their metabolic capabilities in pharmaceutical and agricultural applications (Kharwar et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). In this context, the present study aims to isolate and characterize fungal endophytes from \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e, an ecologically and medicinally important yet endangered tree species. Investigating its endophytic microbiota not only enhances our understanding of plant-microbe interactions but also holds great promise for the discovery of novel bioactive compounds.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePlant Material\u003c/h2\u003e\u003cp\u003eThe plant material \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e (Roxb.) Bosser was collected from the Botanical Garden of SNGS College, Pattambi. Fresh, healthy, and mature stems and leaves of \u003cem\u003eN. cadamba\u003c/em\u003e were meticulously selected for the isolation of endophytes to minimize any risk of contamination.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eIsolation of Endophytic Fungi\u003c/h3\u003e\n\u003cp\u003eSurface-sterilized stem and leaf segments were carefully placed on PDA media containing antibiotics. The plates were then sealed with cling film and incubated at 25\u0026ndash;28\u0026deg;C for 5 to 14 days. The Petri plates were monitored frequently to check the growth of endophytic fungal colonies. Hyphal tips that appeared were transferred to fresh PDA plates and slants of PDA for subculture to develop a pure culture (Piska et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eMorphological Identification of Endophytic Fungi\u003c/h3\u003e\n\u003cp\u003eThe identification of endophytic fungi was based on morphological features of fungal colonies, fruiting bodies, and spores (Alurappa and Chowdappa, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). For microscopic observation of fungal mycelium, a drop of Lactophenol cotton blue was placed on a clean microscopic slide, and the hyphal thread was placed on it and carefully dissected with needles. The stained slides were then observed under a microscope to study the microscopic characteristics of the fungi. Non-sporulating cultures were differentiated from one another by their cultural characteristics, including colony morphology, hyphal mat characteristics, and pigmentation of the colony in the medium.\u003c/p\u003e\n\u003ch3\u003eMass Cultivation of Endophytic Fungi\u003c/h3\u003e\n\u003cp\u003eEndophytic fungal isolates exhibiting distinct morphological characteristics and rapid growth were selected for mass cultivation. Actively growing mycelial plugs (3 mm in diameter) from 7-day-old pure cultures were aseptically transferred into 250 ml Erlenmeyer flasks containing 100 ml of sterile Potato Dextrose Broth (PDB). Cultures were incubated at room temperature (25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C) under shaking conditions at 120 rpm in a rotary shaker. After incubation, cultures were filtered through sterile cheesecloth to separate mycelial mats, retaining the culture filtrate for further analysis (Selvi and Balagengatharathilagam, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eExtraction of Secondary Metabolites from Endophytic Fungi\u003c/h3\u003e\n\u003cp\u003eAfter mass cultivation of endophytic fungi, the fungal metabolites from different endophytic mycelial mats were extracted using ethyl acetate. An equal volume of the filtrate and solvent was taken in a conical flask and shaken vigorously for one hour. The solution was then allowed to stand, the cell mass was separated, and the solvent so obtained was collected. Then the solvent was evaporated to yield the crude extracts (Selvi and Balagengatharathilagam, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003ePhytochemical Analysis of Crude Extract of Endophytic Fungi\u003c/h2\u003e\u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\u003ch2\u003eTest for Alkaloids\u003c/h2\u003e\u003cp\u003eDragendroff\u0026rsquo;s Test: Dragendroff\u0026rsquo;s reagent was added to a little of the extract dissolved in its solvent. Alkaloid gives an orange-red precipitate (Alurappa and Chowdappa, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\n\u003ch3\u003eTest for Flavonoids\u003c/h3\u003e\n\u003cp\u003eNaOH Test: To 1 ml sample, add 3 ml of dilute NaOH; the sample turns yellow color which disappears upon adding dilute HCl, indicating the presence of flavonoids (Alurappa and Chowdappa, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eTest for Terpenoids\u003c/h2\u003e\u003cp\u003eSalkowski Test: Take 1 ml of the sample in a test tube and add a few drops of Chloroform along the sides of the test tube. A few drops of concentrated Sulphuric acid were added carefully. Reddish brown coloration at the interface indicates the presence of terpenoids (Alurappa and Chowdappa, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eTest for Saponin\u003c/h2\u003e\u003cp\u003eFroth Test: To a 1 mL sample in a test tube, add 2 mL of distilled water. The froth appearance on shaking of the mixture shows the presence of saponin (Alurappa and Chowdappa, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eTest for Phenol\u003c/h2\u003e\u003cp\u003eFeCl\u003csub\u003e3\u003c/sub\u003e Test: To 5 drops of the sample solution taken in a test tube, add 3 drops of FeCl3 (5%W/V). A dark green color indicates the presence of phenol (Alurappa and Chowdappa,2018).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eTest for Coumarins\u003c/h2\u003e\u003cp\u003eNaOH Test: 10% NaOH was added to the extract, and Chloroform was added. The formation of a yellow color shows the presence of coumarins (Vimalkumar et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eTest for Cardiac Glycosides\u003c/h2\u003e\u003cp\u003eKeller Killani Test: To a 5 ml extract taken in a test tube, add 2 ml of acetic acid, along with one drop of FeCl3 solution and 1 ml of concentrated sulfuric acid. The appearance of a brown ring indicates the presence of cardiac glycosides.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eDPPH free radical scavenging assay\u003c/h2\u003e\u003cp\u003eThe free radical scavenging activity of fungal organic extracts was assessed by the DPPH assay. 200 \u0026micro;L of 0.1 mM of DPPH solution (prepared by dissolving DPPH in ethanol) was combined with varying concentrations of fungal extracts (20\u0026ndash;100 \u0026micro;g/ml), vortexed vigorously, and incubated for 30 minutes in the dark at room temperature. The absorbance was subsequently measured at 517 nm using a microplate reader with ethanol as blank (Dhayanithy et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Ascorbic acid was used as a positive control\u003c/p\u003e\u003cp\u003eThe percentage of radical scavenging potential was calculated using the formula\u003c/p\u003e\u003cp\u003e% scavenging = (1-(Abs\u003csub\u003e(517 nm)\u003c/sub\u003e of the sample/ Abs\u003csub\u003e(517 nm)\u003c/sub\u003e of the control)) \u0026times; 100.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eAntibacterial Assay\u003c/h2\u003e\u003cdiv id=\"Sec18\" class=\"Section3\"\u003e\u003ch2\u003eDisc Diffusion Method\u003c/h2\u003e\u003cp\u003e20 mg of the fungal crude extract dissolved in 1 ml of DMSO was used to treat the bacteria. Sterilized paper discs of diameter 6 mm were taken and impregnated with 10, 15, 20, and 25 \u0026micro;l endophytic fungal crude extracts (20mg/ml) and allowed to evaporate in air, and then placed on the lawn of bacteria. 25 \u0026micro;L of DMSO was used as a negative control. The plates were incubated at 37\u0026deg;C for 24 hours, and the zone of inhibition was measured (Ramesha and Srinivas, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eMolecular identification and phylogenetic analysis of endophytic fungi\u003c/h2\u003e\u003cp\u003eMolecular identification was conducted using the strains on PDA and incubated for 5\u0026ndash;7 days at 29\u0026deg;C. The fungal DNA was extracted using a DNA isolation kit, NucleoSpin Plant II Kit (Macherey-Nagel), according to the manufacturer\u0026rsquo;s protocol. DNA quality was assessed via1% agarose gel electrophoresis. PCR amplified the ITS1 region of the fungus with the primers ITS1F (5\u0026rsquo;TCCGTAGGTGAACCTGCGG3\u0026rsquo;) and ITS4R (5\u0026rsquo; TCCTCCGCTTATTGATATGC 3\u0026rsquo;). PCR reaction conditions were 30 sec at 98\u0026deg;C; 40 cycles of 98\u0026deg;C for 5 s, 58\u0026deg;C for 10 s, and 72\u0026deg;C for 15 s; and 72\u0026deg;C for 15 sec. The PCR products were checked in a 1.2% agarose gel. The PCR products were sequenced by using the BigDye Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, USA) following the manufacturer's protocol. Sequence alignment and editing were performed using Geneious Pro v5.1 (Kearse et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The resulting DNA sequences were analyzed and compared with those obtained from GenBank via a BLAST search. The obtained nucleotide sequence was submitted to GenBank. Each sequence was refined by removing noise and ambiguous peaks, followed by the assembly of forward (5\u0026prime;\u0026ndash;3\u0026prime;) and reverse (3\u0026prime;\u0026ndash;5\u0026prime;) sequences to produce a high-quality consensus sequence. These consensus sequences were subjected to BLAST analysis to determine the taxonomic identity of the endophytic isolates by comparison with sequences available in the International Nucleotide Sequence Database Collaboration. The most similar INSDC sequences were retrieved and aligned with the query sequences using ClustalW for multiple sequence alignment. Phylogenetic circumscription and analysis have been conducted to determine the evolutionary relationships among the fungal endophytes. Sequence alignments and phylogenetic tree construction were performed using MEGA v6 software (Tamura et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The neighbor-joining method was employed to reconstruct phylogenetic trees, providing a robust framework for evolutionary inference. The reliability and statistical support for the inferred phylogenies were assessed using bootstrap analysis with 1,000 replicates, a standard test for evaluating the confidence of branching patterns within the tree (Ramesh et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e"},{"header":"Result","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003cp\u003eIn this study, a total of eight endophytic fungi were isolated from various parts of \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e (Roxb.) Bosser. Among these, seven were sourced from the leaves and designated as NKL1 (\u003cem\u003eNeolamarckia cadamba\u003c/em\u003e leaf strain 1), NKL2, NKL3, NKL4, NKL5, NKL6, and NKL7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Only one isolate was obtained from the stem, named as NKS1 (\u003cem\u003eNeolamarckia cadamba\u003c/em\u003e stem strain 1). The majority of the fungal endophytes isolated from \u003cem\u003eN. cadamba\u003c/em\u003e were extremely slow-growing, with a very slow vegetative growth rate on PDA medium. Consequently, from the total of eight fungal endophytes isolated, only three were selected for further studies, including characterization, antioxidant activity, and antimicrobial screening. The chosen fungal isolates were NKL1, NKL3, and NKL4, which demonstrated better growth rates on both PDA and PDB media.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eMorphological Identification of Endophytic Fungi\u003c/h2\u003e\u003cp\u003eThe identification of the fungi was done by macroscopic and microscopic observations (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e provides a summary of the key characteristics of the fungal isolates from the leaf and stem of \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e. Colony colour varied among the isolates, ranging from dark green (NKL1, NKL4, NKL7) to light green (NKL2, NKL5), brown (NKL6), a mixed light brown and light green (NKL3), and light yellow (NKS1). Mycelial morphology showed diversity in branching patterns, septation, and cell shape. Heavily branched, anastomosing hyphae were observed in NKL1, NKL3, and NKL7, whereas NKL4 exhibited pointed terminal ends, and NKL5 possessed irregularly sized barrel-shaped cells with rounded ends. Smooth-walled barrel-shaped cells were recorded in NKL6 and NKL7.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe characteristics of endophytic fungal isolates from \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFungal isolates\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eColony characters\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMycelial characters\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpore characters\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDark green colored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHeavily branched, anastomosing, septate mycelium with barrel-shaped cells and the tips of terminal cells are somewhat rounded.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpore like-structures produce\u003c/p\u003e\u003cp\u003einside the hyphae.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLight green colored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBranched, septate mycelium having barrel-shaped cells\u003c/p\u003e\u003cp\u003eand are anastomosing.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpore like\u003c/p\u003e\u003cp\u003estructures produce\u003c/p\u003e\u003cp\u003eoutside the hyphae.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eA mixture of light\u003c/p\u003e\u003cp\u003ebrown and light green colored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHeavily branched, septate and\u003c/p\u003e\u003cp\u003eanastomosing hyphae.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpores are produced at the end of branches which are two and three celled.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDark green colored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBranched and septate mycelium with barrel shaped cells and the ends are pointed.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpore producing\u003c/p\u003e\u003cp\u003estructures were not\u003c/p\u003e\u003cp\u003efound.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLight green colored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBranched and septate mycelium and the cells are barrel shaped which are irregular in size with rounded ends.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpore producing\u003c/p\u003e\u003cp\u003estructures were not found.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eBrown colored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBranched, septate mycelium which are anastomosing and the cells are smooth walled and barrel shaped.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpore like structures produce\u003c/p\u003e\u003cp\u003einside the hyphae.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDark green colored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHeavily branched and septate\u003c/p\u003e\u003cp\u003emycelium that is anastomosing and the cells with smooth walls\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpores are\u003c/p\u003e\u003cp\u003eproduced which are\u003c/p\u003e\u003cp\u003eoval in shape.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKS1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLight yellow\u003c/p\u003e\u003cp\u003ecolored\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBranched and septate\u003c/p\u003e\u003cp\u003ehyphae.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSpore producing structures were not found.\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eSpore production was detected in five isolates, with variations in location and morphology. NKL1 and NKL6 produced spore-like structures within hyphae, NKL2 produced spores externally, NKL3 formed terminal 2 to 3-celled spores, and NKL7 produced oval-shaped spores. NKL4, NKL5, and NKS1 did not exhibit spore-producing structures under the observed conditions. Overall, leaf isolates demonstrated greater morphological complexity and sporulation diversity compared to the single stem isolate.\u003c/p\u003e\u003cp\u003eThe microscopic investigation of the spores of NKL1 and NKL3 revealed their similarity to \u003cem\u003eCurvularia\u003c/em\u003e spp. At the same time, the absence of identifiable spore structures precluded the definitive identification of NKL4. But its morphology and mycelial characters show its resemblance to \u003cem\u003eAspergillus\u003c/em\u003e spp. There was no published record of any endophytic fungi isolated from \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e (Roxb.) Bosser. However, several endophytic bacteria have been isolated from this evergreen tree.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003ePhytochemical screening of crude extracts of isolated endophytic fungi\u003c/h2\u003e\u003cp\u003ePhytochemical screening of crude extracts from three selected endophytic fungal isolates (NKL1, NKL3, NKL4) revealed the presence of various secondary metabolites (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Alkaloids and flavonoids were consistently detected in all three isolates, indicating their widespread occurrence among the tested fungi. Terpenoids were observed only in NKL3, while saponins, phenolics, coumarins, glycosides, and carbohydrates were absent in all isolates. Cardiac glycosides were present in all three isolates, whereas proteins were not detected (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePhytochemical screening of fungal extracts\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"10\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003csub\u003eAlkaloid\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003csub\u003eFlavonoid\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003csub\u003eTerpenoid\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003csub\u003eSaponin\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003csub\u003ePhenolics\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003csub\u003eCoumarin\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003e\u003csub\u003eGlycosides\u003c/sub\u003e\u003c/p\u003e\u003cp\u003e\u003csub\u003eCardiac\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c9\"\u003e\u003cp\u003e\u003csub\u003eCarbohydrate\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c10\"\u003e\u003cp\u003e\u003csub\u003eProtein\u003c/sub\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c9\"\u003e\u003cp\u003e+\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c10\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNKL3\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003e+\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003e+\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003e-\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c9\"\u003e\u003cp\u003e+\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c10\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eNKL4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e+\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e+\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e\u003cb\u003e+\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e\u003cb\u003e-\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eAntioxidant Activity of Crude Extract of Endophytic Fungi\u003c/h2\u003e\u003cp\u003eThe antioxidant potential of the crude extracts of three endophytic fungal isolates NKL1, NKL3, and NKL4, was evaluated using the DPPH free radical scavenging assay (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The antioxidant activity was calculated by plotting the concentration of the extract in \u0026micro;g/ml on the x-axis and the corresponding percentage of inhibition on the y-axis, using ascorbic acid as the standard. It was found that there is a gradual increase in the inhibition percentage when the concentration of the extract is high.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eDPPH free radical scavenging of the fungal extracts\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eConcentration of the extract\u003c/p\u003e\u003cp\u003e( \u0026micro;g/ ml)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eInhibition\u003c/p\u003e\u003cp\u003e(%) of Ascorbic\u003c/p\u003e\u003cp\u003eAcid\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eInhibition\u003c/p\u003e\u003cp\u003e(%) of\u003c/p\u003e\u003cp\u003eNKL 4\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eInhibition (%) of NKL1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eInhibition (%) of NKL3\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e56.79\u0026thinsp;\u0026plusmn;\u0026thinsp;1.754\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e52.01\u0026thinsp;\u0026plusmn;\u0026thinsp;1.965\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e67.59\u0026thinsp;\u0026plusmn;\u0026thinsp;1.757\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e65.04\u0026thinsp;\u0026plusmn;\u0026thinsp;1.954\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e40\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e78.64\u0026thinsp;\u0026plusmn;\u0026thinsp;1.904\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e57.66\u0026thinsp;\u0026plusmn;\u0026thinsp;1.986\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e37.98\u0026thinsp;\u0026plusmn;\u0026thinsp;1.896\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e75.20\u0026thinsp;\u0026plusmn;\u0026thinsp;1.895\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e83.23\u0026thinsp;\u0026plusmn;\u0026thinsp;1.568\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e58.87\u0026thinsp;\u0026plusmn;\u0026thinsp;1.688\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e70.67\u0026thinsp;\u0026plusmn;\u0026thinsp;1.709\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e80.48\u0026thinsp;\u0026plusmn;\u0026thinsp;1.954\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e80\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e90.15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.734\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e60.48\u0026thinsp;\u0026plusmn;\u0026thinsp;1.953\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e76.25\u0026thinsp;\u0026plusmn;\u0026thinsp;1.998\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e86.58\u0026thinsp;\u0026plusmn;\u0026thinsp;1.925\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e95.32\u0026thinsp;\u0026plusmn;\u0026thinsp;1.756\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e\u003cp\u003e73.79\u0026thinsp;\u0026plusmn;\u0026thinsp;1.762\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e\u003cp\u003e91.89\u0026thinsp;\u0026plusmn;\u0026thinsp;1.962\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e\u003cp\u003e89.43\u0026thinsp;\u0026plusmn;\u0026thinsp;1.627\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eAt the lowest concentration tested (20 \u0026micro;g/ml), NKL1 and NKL3 exhibited high radical scavenging activity (67.59% and 65.04%, respectively), approaching the activity of ascorbic acid (56.79%), whereas NKL4 displayed comparatively lower inhibition (52.01%). The high inhibition values recorded for NKL1 and NKL3 suggest a richer presence or higher activity of antioxidant compounds such as alkaloids, flavonoids, and terpenoids, as supported by the phytochemical screening results. These compounds are known to act as hydrogen donors and free radical quenchers, thus stabilizing reactive oxygen species.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eAntibacterial Activity of Crude Extract of Endophytic Fungi\u003c/h2\u003e\u003cp\u003eThe antibacterial activity of crude extracts from NKL1, NKL3, and NKL4 was evaluated against \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, and \u003cem\u003eEscherichia coli\u003c/em\u003e using the disc diffusion method at concentrations ranging from 10\u0026ndash;25 \u0026micro;l/disc (stock: 20 mg/ml) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Tetracycline was used as a positive control. \u003cem\u003eAll three fungal crude\u003c/em\u003e extracts remarkably inhibited Staphylococcus aureus. NKL3 demonstrated broad-spectrum antibacterial activity with consistently larger zones of inhibition against all three bacterial strains, particularly \u003cem\u003eK. pneumoniae\u003c/em\u003e and \u003cem\u003eE. coli\u003c/em\u003e. NKL1 showed moderate, dose-dependent activity against \u003cem\u003eK. pneumoniae\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e. NKL4 was active only against \u003cem\u003eS. aureus\u003c/em\u003e and exhibited no effect on the Gram-negative strains tested.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAntibacterial activity of endophytic fungi NKL1, NKL3, NKL4\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"11\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSl. No\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDosage\u003c/p\u003e\u003cp\u003e(\u0026micro;l/\u0026nbsp;disc)\u003c/p\u003e\u003cp\u003e(Stock:\u0026nbsp;20 mg/ ml)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"9\" nameend=\"c11\" namest=\"c3\"\u003e\u003cp\u003eZone of Inhibition (mm)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"2\" morerows=\"1\" nameend=\"c2\" namest=\"c1\" rowspan=\"2\"\u003e\u003cp\u003eBacterial strains\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e\u003cp\u003e\u003cem\u003eKlebsiella\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003epneumoniae\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e\u003cp\u003e\u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c11\" namest=\"c9\"\u003e\u003cp\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNKL1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNKL3\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNKL4\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNKL1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eNKL3\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eNKL4\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c9\"\u003e\u003cp\u003eNKL1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c10\"\u003e\u003cp\u003eNKL3\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c11\"\u003e\u003cp\u003eNKL4\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e1.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10\u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.76\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e11 \u0026plusmn;\u003c/p\u003e\u003cp\u003e1.64\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.86\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.66\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e11\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c11\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e15 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.75\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e13\u0026thinsp;\u0026plusmn;\u0026thinsp;1.53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.89\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.63\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.38\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c11\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e3.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e20 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;1.81\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.00\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.64\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.76\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c11\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e4.\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e25 \u0026micro;l\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10 \u0026plusmn;\u003c/p\u003e\u003cp\u003e1.20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e17\u0026thinsp;\u0026plusmn;\u0026thinsp;1.99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;1.96\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e15\u0026thinsp;\u0026plusmn;\u0026thinsp;1.17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.57\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003e16\u0026thinsp;\u0026plusmn;\u0026thinsp;1.06\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c11\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\u003ch2\u003eMolecular Characterization and Phylogenetic Analysis\u003c/h2\u003e\u003cp\u003eAmong the three endophytic fungi (NKL1, NKL3, and NKL4), two were chosen (NKL1 and NKL3) for species identification due to their notable antibacterial and antioxidant properties. Morphological characteristics, including spore and mycelial characteristics, allowed the identification of the endophytic fungal isolate NKL1 as \u003cem\u003eCurvularia lunata\u003c/em\u003e (NCBI GenBank accession number PX205205). This identification was further corroborated by the sequence analysis of its 18S rRNA gene, which exhibited a more than 99% sequence similarity to those available in the NCBI database for \u003cem\u003eC. lunata\u003c/em\u003e. In a similar vein, based on ITS sequences along with morphological and molecular characterization, the endophytic fungus NKL3 is classified as \u003cem\u003eCurvularia tropicalis\u003c/em\u003e (NCBI GenBank accession number PX218454). The NKL1 and NKL3 sequences shared 90.59% identity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The high degree of conservation suggests close genetic relatedness between NKL1 and NKL3. Two endophytes, NKL1 and NKL3, isolated from \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e were successfully identified as \u003cem\u003eCurvularia lunata\u003c/em\u003e and \u003cem\u003eCurvularia tropicalis\u003c/em\u003e, respectively, based on their similarity with reference sequences available in the NCBI database. These fungi have been documented as endophytic in various host plant species. To confirm their taxonomic placement and evolutionary relationships, a phylogenetic tree was constructed using reference sequences retrieved from GenBank (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The resulting phylogram resolved four major clusters. Cluster II contained NKL1 (\u003cem\u003eCurvularia lunata\u003c/em\u003e, PX205205), which grouped tightly with other \u003cem\u003eC. lunata\u003c/em\u003e accessions and \u003cem\u003eC. petersonii\u003c/em\u003e, indicating a close evolutionary relationship to \u003cem\u003eC. lunata\u003c/em\u003e. Cluster III contained NKL3 (\u003cem\u003eCurvularia tropicalis\u003c/em\u003e, PX218454), which clustered with \u003cem\u003eC. tropicalis\u003c/em\u003e sequences and related species (\u003cem\u003eC. phaenospora\u003c/em\u003e, \u003cem\u003eC. chiangmaiensis\u003c/em\u003e), confirming NKL3\u0026rsquo;s identity as a \u003cem\u003eC. tropicalis\u003c/em\u003e isolate. Other clusters comprised \u003cem\u003eCochliobolus\u003c/em\u003e, \u003cem\u003eSarocladium\u003c/em\u003e, \u003cem\u003eBipolaris\u003c/em\u003e, \u003cem\u003ePhoma\u003c/em\u003e, \u003cem\u003eCercospora\u003c/em\u003e, and \u003cem\u003eAgaricus\u003c/em\u003e, serving as related taxa and outgroups. The distinct separation of NKL1 and NKL3 within the \u003cem\u003eCurvularia\u003c/em\u003e clade supports the BLAST results and demonstrates their evolutionary proximity to well-characterized \u003cem\u003eCurvularia\u003c/em\u003e species. This is the first report of \u003cem\u003eC. tropicalis\u003c/em\u003e being isolated as an endophyte from \u003cem\u003eN. cadamba\u003c/em\u003e, suggesting a potentially unique and symbiotic association.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study highlights the diverse bioactivities exhibited by endophytic fungal isolates NKL1, NKL3, and NKL4 derived from \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e. The phytochemical screening (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) revealed a consistent presence of alkaloids, flavonoids, and cardiac glycosides across all isolates, with terpenoids uniquely detected in NKL3. Alkaloids and flavonoids are well-known for their potent antioxidant and antimicrobial properties (e.g., flavonoids acting as hydrogen donors and metal chelators (Rahim et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This finding aligns with previous studies demonstrating that endophytic fungi often mirror the medicinal plant\u0026rsquo;s metabolite profile and can synthesize analogous bioactive compounds (Venieraki et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2017\u003c/span\u003e)\u003c/p\u003e\u003cp\u003ePrevious phytochemical and bioactivity studies on \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e provide a valuable framework for interpreting the present findings. Shikha and Kumar (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) quantified flavonoid and tannin contents in different parts\u0026mdash;leaves, bark, unripe fruits, and ripe fruits\u0026mdash;and found that the bark possessed the highest concentrations of both flavonoids and tannins, highlighting its potential contribution to the plant\u0026rsquo;s medicinal properties. Similarly, Konatham et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) demonstrated that aqueous extracts of \u003cem\u003eN. cadamba\u003c/em\u003e leaves exhibited notable antibacterial activity against \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and \u003cem\u003eEscherichia coli\u003c/em\u003e. The phytochemical screening revealed the presence of alkaloids, saponins, phenolic compounds, proteins, and amino acids. In addition, Haritha et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) evaluated aqueous, ethanolic, and cyclohexane extracts of \u003cem\u003eN. cadamba\u003c/em\u003e leaves and detected alkaloids, tannins, saponins, steroids, and glycosides, with the aqueous extract showing significant antifungal activity against \u003cem\u003eAspergillus niger\u003c/em\u003e. Collectively, these studies highlight the rich phytochemical diversity and broad-spectrum antimicrobial potential of \u003cem\u003eN. cadamba\u003c/em\u003e, underscoring the need for further exploration of its endophytic fungal community for novel bioactive metabolites.\u003c/p\u003e\u003cp\u003eThe antioxidant assays (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) underscored a concentration-dependent increase in DPPH radical scavenging activity, with NKL3 and NKL1 achieving inhibition values comparable to those of ascorbic acid (89\u0026ndash;92% at 100 \u0026micro;g/ml). NKL4, however, showed significantly lower activity (74% at 100 \u0026micro;g/ml). Such elevated antioxidant capacities are characteristic of endophytic fungi rich in phenolics and flavonoids, as evidenced in prior research where certain ethyl acetate extracts displayed radical scavenging activities on par with vitamin C (Gupta et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the assessment of the antioxidant potential of endophytes isolated from \u003cem\u003eCatharanthus roseus\u003c/em\u003e and \u003cem\u003eCalotropis procera\u003c/em\u003e, it was noted that the total antioxidant activity in the case of the culture filtrate of all the endophytic crude samples was higher than that of the mycelium, of which the highest antioxidant activity in the culture filtrate was noted in \u003cem\u003eCurvularia geniculata\u003c/em\u003e (Chowdhury et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The free radical percentage activity was reported maximum in the aqueous extract of the stem of \u003cem\u003eN. cadamba\u003c/em\u003e at 81% with 1.5 ml and the minimum percentage of scavenging activity was reported in its aqueous extract of leaf part 3.33% with 0.5ml, whereas the methanol extract of stem and leaf showed intermediate activity free radical scavenging activity of 60% and 30% with 1.5ml respectively (Kumar et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The high scavenging potential of NKL1 and NKL3 likely reflects their richer repertoire of phenolic and flavonoid compounds, as observed in other \u003cem\u003eCurvularia\u003c/em\u003e endophytes (Pinheiro et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe antibacterial assay demonstrated that NKL3 exhibited broad-spectrum activity, with the highest inhibition zones across \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e, \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, and \u003cem\u003eEscherichia coli\u003c/em\u003e. NKL1 showed moderate activity against Gram-positive \u003cem\u003eS. aureus\u003c/em\u003e and \u003cem\u003eK. pneumoniae\u003c/em\u003e, whereas NKL4 was effective only against \u003cem\u003eS. aureus\u003c/em\u003e. These results resonate with numerous reports describing endophytic fungi as prolific sources of antibacterial compounds, particularly alkaloids and terpenoids as part of their ecological role in plant protection (Strobel \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Wiyakrutta et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Mensah et al. (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) carried out the antibacterial activity of \u003cem\u003eCurvularia lunata, Aspergillus parasiticus\u003c/em\u003e, and \u003cem\u003eMucor\u003c/em\u003e spp. against two gram-negative bacteria (\u003cem\u003eEscherichia coli, Salmonella typhi\u003c/em\u003e), two gram-positive bacteria (\u003cem\u003eStaphylococcus aureus, Bacillus\u003c/em\u003e subtilis), and one fungus (\u003cem\u003eCandida albicans)\u003c/em\u003e by the broth dilution method. For all fungi, the hexane extracts exhibited a more potent microbial inhibitory activity as demonstrated by the low recorded MIC values: 0.10 mg/ml for \u003cem\u003eCurvularia lunata\u003c/em\u003e,0.068 mg/ml for \u003cem\u003eAspergillus parasiticus\u003c/em\u003e, and 0.018mg/ml for \u003cem\u003eMucor\u003c/em\u003e spp. Rani et al. (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) studied the endophytic fungal extracts of \u003cem\u003eAspergillus nidulans, Curvularia tropicalis, Chaetomium aruenum\u003c/em\u003e, and \u003cem\u003eChaetomium atrobrunneum\u003c/em\u003e and demonstrated significant microbial controlling capacity.\u003c/p\u003e\u003cp\u003e\u003cem\u003eCurvularia\u003c/em\u003e is a member of Ascomycota that exhibits a facultative pathogenic and endophytic lifestyle (Mehta et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Kharwar et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) investigated the diversity and antibacterial activity of endophytic fungi isolated from the medicinal plant \u003cem\u003eAdenocalymma alliaceum.\u003c/em\u003e Among the isolated fungi, \u003cem\u003eCurvularia lunata\u003c/em\u003e was identified and noted for its significant antibacterial properties. Similarly, Al-Mahi et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) isolated the endophytic fungi from \u003cem\u003eKigelia africana\u003c/em\u003e and evaluated their antibacterial activity. \u003cem\u003eCurvularia lunata\u003c/em\u003e demonstrated notable antibacterial effects against several pathogenic bacteria. \u003cem\u003eCurvularia\u003c/em\u003e and \u003cem\u003eAlternaria\u003c/em\u003e exhibit similarities in conidial formation and share somewhat similar morphologies. \u003cem\u003eCurvularia\u003c/em\u003e also showed similarity with \u003cem\u003eBipolaris\u003c/em\u003e in the sequence structure and conidial features (Manamgoda et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIdentification based on ITS sequence analyses indicated that all the endophytic isolates obtained from \u003cem\u003eN. cadamba\u003c/em\u003e belonged to the phylum Ascomycota. The clustering of NKL1 with \u003cem\u003eCurvularia lunata\u003c/em\u003e and NKL3 with \u003cem\u003eC. tropicalis\u003c/em\u003e corroborates their BLAST-based identification. This finding is consistent with earlier studies that demonstrate the reliability of ITS phylogenies in resolving \u003cem\u003eCurvularia\u003c/em\u003e species (Huang et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Similar phylogenetic approaches have been successfully used to clarify the taxonomic placement of plant-associated endophytic fungi, highlighting ITS sequencing as a robust tool for evolutionary and diversity assessments (Bongiorno et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Oliveira et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Diversity of leaf fungal endophytes from two Coffea arabica varieties and antagonism towards coffee leaf rust. Previous studies have also shown that Ascomycota is the most dominant fungal lineage associated with plants as endophytes (Ramos-Garza et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Gonzalez-Teuber et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The predominance of this group is often attributed to its adaptive potential, high sporulation capacity, and ability to colonize diverse plant tissues under varying environmental conditions (Arnold and Lutzoni, 2007). The identification of two \u003cem\u003eCurvularia\u003c/em\u003e species with strong bioactive potential underscores the ecological and pharmaceutical significance of \u003cem\u003eN. cadamba\u003c/em\u003e endophytes. \u003cem\u003eCurvularia\u003c/em\u003e spp. are known to produce a range of secondary metabolites, including polyketides, alkaloids, and terpenoids, with documented antimicrobial, antioxidant, and cytotoxic properties (Kharwar et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). For instance, \u003cem\u003eCurvularia lunata\u003c/em\u003e isolated from medicinal plants has been shown to possess strong antibacterial properties, even against drug-resistant strains like MRSA, along with notable anti-inflammatory potential (Kaur et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Similarly, \u003cem\u003eCurvularia tsudae\u003c/em\u003e from \u003cem\u003eCynodon dactylon\u003c/em\u003e has been reported to produce coumarin derivatives with potent antioxidant and antimicrobial activities (Nischitha et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The bioactive potential of \u003cem\u003eCurvularia\u003c/em\u003e isolates aligns with the increasing recognition of endophytes as an alternative source for novel natural products (Kusari et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The discovery of \u003cem\u003eC. lunata\u003c/em\u003e and \u003cem\u003eC. tropicalis\u003c/em\u003e in this host plant opens new avenues for exploring species\u0026ndash;host specificity and the bioprospecting of novel compounds.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eEndophytic fungi, a previously underexplored group of microorganisms, have recently garnered attention for their ability to produce a diverse range of bioactive compounds. As a key component of a plant\u0026rsquo;s mycobiome, endophytes contribute significantly to host physiology, resilience, and ecological fitness. The identification of \u003cem\u003eCurvularia lunata\u003c/em\u003e and \u003cem\u003eCurvularia tropicalis\u003c/em\u003e as endophytes from \u003cem\u003eN. cadamba\u003c/em\u003e from the present study represents a novel and significant finding, marking the first report of these fungi inhabiting this plant. The presence of such diverse and potentially beneficial fungal endophytes suggests a complex and possibly co-evolved relationship that may contribute to the plant's stress tolerance, pathogen resistance, or overall ecological fitness. Endophytic fungi, particularly Ascomycetes, are known to influence plant health by enhancing nutrient acquisition, producing secondary metabolites, and offering protection against biotic and abiotic stresses. The conservation of \u003cem\u003eN. cadamba\u003c/em\u003e should therefore consider not only the plant itself but also its microbial symbionts, which may play crucial roles in its survival and adaptability. The discovery of \u003cem\u003eC. lunata\u003c/em\u003e and \u003cem\u003eC. tropicalis\u003c/em\u003e as endophytes opens new avenues for understanding the plant\u0026rsquo;s resilience and supports the broader need for integrated conservation strategies that include microbial biodiversity as a component of endangered plant protection. Further studies are anticipated to carry out the pharmacological profiling of fungal metabolites. This may help in detecting novel pharmacologically active therapeutic molecules that can be used as a lead in the drug discovery process.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors wish to express their sincere gratitude to Dr. Vivek P. J., Head of the Department of Botany, Sree Neelakanta Government Sanskrit College, Pattambi, for his valuable advice, critical revisions of the manuscript and generous support throughout this investigation. We also thank the other teaching staff of the department for their assistance, and the staff of\u0026nbsp;Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, for their timely services and kind cooperation. Their collective support was vital for the successful completion of this project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDr. Sumayya S. S. conceptualized the study, designed the research framework, and contributed to data interpretation and manuscript preparation. Ms. Sheena carried out data collection, performed preliminary analysis, and assisted in drafting the manuscript. Both authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that no financial support was received for the research, authorship, and publication of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the data supporting the findings of this study are available within the paper. Sequencing data were deposited in the NCBI database.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any financial relationships that could be construed as a potential conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis paper does not involve human and animal experiments, so it does not need ethical approval and informed consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors agree to publish the paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003csup\u003e1\u003c/sup\u003e\u003c/strong\u003e Sabira Sirajudeen Sumayya, Assistant Professor of Botany, Postgraduate and Research Department of Botany, Sree Neelakanta Government Sanskrit College, Palakkad, Kerala state, India; \u003csup\u003e1\u003c/sup\u003eSheena Harinaraynan, Postgraduate and Research Department of Botany, Sree Neelakanta Government Sanskrit College, Palakkad, Kerala state, India.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAl-Kahtani MDF, Fouda A, Attia KA, Al-Otaibi F, Eid AM, Ewais EED, Hijri M, St-Arnaud M, Hassan SED, Khan N, Hafez YM, Abdelaal KAA (2020) Isolation and characterization of plant growth-promoting endophytic bacteria from desert plants and their application as bioinoculants for sustainable agriculture. Agronomy 10:1325. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agronomy10091325\u003c/span\u003e\u003cspan address=\"10.3390/agronomy10091325\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAl-Mahi I, Ietidal Al T, Eihab I (2013) Antibacterial activity of endophytic fungi extracts from the medicinal plant Kigelia africana. Egypt Acad J Biol Sci G Microbiol 5(1):1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21608/eajbsg.2013.16639\u003c/span\u003e\u003cspan address=\"10.21608/eajbsg.2013.16639\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlurappa P, Chowdappa P (2018) Isolation and identification of endophytic fungi from Cinnamomum verum and their antifungal activity against Colletotrichum gloeosporioides. Int J Curr Microbiol Appl Sci 7:2712\u0026ndash;2722. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20546/ijcmas.2018.701.312\u003c/span\u003e\u003cspan address=\"10.20546/ijcmas.2018.701.312\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAly AH, Debbab A, Kjer J, Proksch P (2010) Fungal endophytes from higher plants: a prolific source of phytochemicals and other bioactive natural products. Fungal Divers 41:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13225-010-0034-4\u003c/span\u003e\u003cspan address=\"10.1007/s13225-010-0034-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBennet JW (2010) Statins and other cholesterol-lowering drugs produced by fungi. J Antibiot 63:263\u0026ndash;266. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ja.2010.40\u003c/span\u003e\u003cspan address=\"10.1038/ja.2010.40\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBongiorno VA, Rhoden SA, Garcia A, Azevedo JL, Pamphile JA (2016) Genetic diversity of endophytic fungi from \u003cem\u003eCoffea arabica\u003c/em\u003e cv. IAPAR-59 in organic crops. Ann Microbiol 66:855\u0026ndash;865. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13213-015-1168-0\u003c/span\u003e\u003cspan address=\"10.1007/s13213-015-1168-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChowdhury SP, Hartmann A, Gao X, Medina M, Zappala S, Musa T, M\u0026uuml;ller DB, Coskun D, Schulze-Lefert P, H\u0026ouml;fer CK (2018) Curvularia geniculata isolated from Calotropis procera: endophytic fungus with potential applications. Fungal Biol 122:835\u0026ndash;847. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.funbio.2018.05.006\u003c/span\u003e\u003cspan address=\"10.1016/j.funbio.2018.05.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCui JL, Guo SX, Xiao PG (2012) Ginkgolide B produced by endophytic fungus (Fusarium oxysporum) isolated from Ginkgo biloba. Fitoterapia 83:913\u0026ndash;920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fitote.2012.04.006\u003c/span\u003e\u003cspan address=\"10.1016/j.fitote.2012.04.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDhayanithy G, Subban K, Chelliah J (2019) Diversity and biological activities of endophytic fungi associated with Catharanthus roseus. BMC Microbiol 19:22\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12866-019-1386-x\u003c/span\u003e\u003cspan address=\"10.1186/s12866-019-1386-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEid AM, Fouda A, Abdel-Rahman MA, Salem SS, Elsaied A, Oelm\u0026uuml;ller R, Hijri M, Bhowmik A, Elkelish A, Hassan SE-D (2021) Harnessing bacterial endophytes for promotion of plant growth and biotechnological applications: an overview. Plants 10:935. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants10050935\u003c/span\u003e\u003cspan address=\"10.3390/plants10050935\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGonzalez-Teuber M, Vilo C, Bascu\u0026ntilde;\u0026aacute;n-Godoy L (2017) Molecular characterization of endophytic fungi associated with the roots of \u003cem\u003eChenopodium quinoa\u003c/em\u003e inhabiting the Atacama Desert, Chile. Genomics Data 11:109\u0026ndash;112. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.gdata.2016.12.015\u003c/span\u003e\u003cspan address=\"10.1016/j.gdata.2016.12.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGupta S, Chaturvedi P, Kulkarni MG, Van Staden J (2020) A critical review on exploiting the pharmaceutical potential of plant endophytic fungi. Biotechnol Adv 39:107462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biotechadv.2019.107462\u003c/span\u003e\u003cspan address=\"10.1016/j.biotechadv.2019.107462\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaritha VANV, Geethika A, Krishna RG, Harika B, Saraswathi G, Rajeshwar G (2025) Phytochemical screening \u0026amp; comparative study of different extracts on antifungal activity of Neolamarckia cadamba leaf. Int J Res Pharmacol Pharmacother 14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ijrpp.com/ijrpp/article/view/553\u003c/span\u003e\u003cspan address=\"https://ijrpp.com/ijrpp/article/view/553\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang WY, Cai YZ, Surveswaran S, Hyde KD, Corke H, Sun M (2009) Molecular phylogenetic identification of endophytic fungi isolated from three Artemisia species. Fungal Divers 36:69\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13225-008-0078-x\u003c/span\u003e\u003cspan address=\"10.1007/s13225-008-0078-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKaul S, Ahmed M, Zargar K, Sharma P, Dhar MK (2013) Prospecting endophytic fungal assemblage of Digitalis lanata Ehrh. (foxglove) as a novel source of digoxin: a cardiac glycoside. Biotech 3:335\u0026ndash;340. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13205-012-0106-0\u003c/span\u003e\u003cspan address=\"10.1007/s13205-012-0106-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKaur M, Mishra RC, Lahane V, Kumari A, Yadav AK, Garg M, Barrow CJ, Goel M (2024) Chemical characterization and biological activity of Curvularia lunata, an endophytic fungus isolated from lemongrass (Cymbopogon citratus). Braz J Micro 55:3261\u0026ndash;3267. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s42770-024-01503\u003c/span\u003e\u003cspan address=\"10.1007/s42770-024-01503\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647\u0026ndash;1649. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/bts199\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/bts199\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKharwar RN, Verma SK, Mishra A, Gond SK, Sharma VK, Afreen T, Kumar A (2011) Assessment of diversity, distribution and antibacterial activity of endophytic fungi isolated from a medicinal plant Adenocalymma alliaceum Miers. Symbiosis 55:39\u0026ndash;46. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13199-011-0142-2\u003c/span\u003e\u003cspan address=\"10.1007/s13199-011-0142-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKonatham LS, Molleti V, Elugubanti T, Thota S, Volleti M, Arugula K, Begum MHM, Kamala G (2025) Antimicrobial activity and phytochemical evaluation of Neolamarckia cadamba leaf extract. J Pharma Insights Res 3:151\u0026ndash;158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.69613/hr6yy112\u003c/span\u003e\u003cspan address=\"10.69613/hr6yy112\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumar D, Kumar S, Sahu M, Kumar A (2020) Phytochemical screening and antioxidant activity of Neolamarckia cadamba and Cymbopogon citratus from Durg District of Chhattisgarh, India. Saudi J Biomed Res 5:343\u0026ndash;348\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKusari S, Hertweck C, Spiteller M (2012) Chemical ecology of endophytic fungi: origins of secondary metabolites. Nat Prod Rep 29:470\u0026ndash;493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/c2np20032c\u003c/span\u003e\u003cspan address=\"10.1039/c2np20032c\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKusari S, Lamshoeft M, Spiteller M (2009) Aspergillus fumigatus Fresenius, an endophytic fungus from Juniperus communis L. Horstmann as a novel source of the anticancer pro-drug deoxypodophyllotoxin. J Appl Microbiol 107:1019\u0026ndash;1030. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1365-2672.2009.04306.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2672.2009.04306.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKusari S, Singh S, Jayabaskaran C (2014) Rethinking production of Taxol (paclitaxel) using endophyte biotechnology. Trends Biotechnol 32:304\u0026ndash;311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tibtech.2014.03.011\u003c/span\u003e\u003cspan address=\"10.1016/j.tibtech.2014.03.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLudwig-M\u0026uuml;ller J (2015) Plants and endophytes: equal partners in secondary metabolite production? Biotechnol Lett 37:1325\u0026ndash;1334. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10529-015-1814-4\u003c/span\u003e\u003cspan address=\"10.1007/s10529-015-1814-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eManamgoda DS, Cai L, Bahkali AH, Chukeatirote E, Hyde KD (2012) A phylogenetic and taxonomic re-evaluation of the Bipolaris\u0026ndash;Cochliobolus\u0026ndash;Curvularia complex. Fungal Divers 56:131\u0026ndash;144. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13225-012-0189-2\u003c/span\u003e\u003cspan address=\"10.1007/s13225-012-0189-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMehta S, Sarma BK, Kumar A, Sharma A (2022) Biology, ecology, and potential applications of genus Curvularia: a review. Mycology 13:12\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/21501203.2021.2003669\u003c/span\u003e\u003cspan address=\"10.1080/21501203.2021.2003669\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMensah JK, Addo P, Frimpong S, Ofori NO (2016) Antibacterial activity of Curvularia lunata, Aspergillus parasiticus, and Mucor spp. against pathogenic bacteria and fungi. J Mycol Plant Pathol 46:302\u0026ndash;310\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNischitha R, Vasanthkumari MM, Kumaraswamy BE, Shivanna MB (2020) Antimicrobial and antioxidant activities and chemical profiling of Curvularia tsudae endophytic in Cynodon dactylon (L.) Pers. Biotech 1:300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13205-020-02250-0\u003c/span\u003e\u003cspan address=\"10.1007/s13205-020-02250-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOliveira RA, Costa LEO, Santos TT, Ara\u0026uacute;jo EF, Queiroz MV (2020) Diversity of leaf fungal endophytes from two Coffea arabica varieties and antagonism towards coffee leaf rust. Plants 13:814. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants13060814\u003c/span\u003e\u003cspan address=\"10.3390/plants13060814\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePimentel MR, Molina G, Dion\u0026iacute;sio AP, Marostica Junior MR, Pastore GM (2011) The use of endophytes to obtain bioactive compounds and their application in biotransformation process. Biotechnol Res Int 576286:1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4061/2011/576286\u003c/span\u003e\u003cspan address=\"10.4061/2011/576286\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePinheiro EAA, Carvalho JM, dos Santos DCP, Feitosa AO, Marinho PSB, Guilhon GMSP, Marinho AMR (2013) Antibacterial activity of alkaloids produced by endophytic fungus Aspergillus sp. EJC08 isolated from Bauhinia guianensis. Nat Prod Res 27(19):1633\u0026ndash;1638. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/14786419.2012.724405\u003c/span\u003e\u003cspan address=\"10.1080/14786419.2012.724405\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePiska KB, Boh\u0026aacute;csov\u0026aacute; M, Sl\u0026aacute;vikov\u0026aacute; E (2015) Isolation and identification of endophytic fungi from Vaccinium myrtillus L. J Microbiol Biotechnol Food Sci 5:278\u0026ndash;282. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15414/jmbfs.2015.5.4.278-282\u003c/span\u003e\u003cspan address=\"10.15414/jmbfs.2015.5.4.278-282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRahim S, Sarmidi MR, Aziz R (2022) Flavonoids: Potent phytochemicals with promising antioxidant and antimicrobial activities. Front Pharmacol 13:967911. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphar.2022.967911\u003c/span\u003e\u003cspan address=\"10.3389/fphar.2022.967911\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamesh V, Arivudainambi USE, Rajendran A (2017) The molecular phylogeny and taxonomy of endophytic fungal species from the leaves of Vitex negundo L. Stud Fungi 2:26\u0026ndash;37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5943/sif/2/1/4\u003c/span\u003e\u003cspan address=\"10.5943/sif/2/1/4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamesha A, Srinivas C (2014) Antimicrobial activity and phytochemical analysis of crude extracts of endophytic fungi isolated from Plumeria acuminata L. and Plumeria obtusifolia L. Eur J Exp Biol 4:35\u0026ndash;43\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamos-Garza J, Rodr\u0026iacute;guez-Tovar AV, Flores-Cotera LB et al (2016) Diversity of fungal endophytes from the medicinal plant Dendropanax arboreus in a protected area of Mexico. Ann Microbiol 66:991\u0026ndash;1002. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13213-015-1184-0\u003c/span\u003e\u003cspan address=\"10.1007/s13213-015-1184-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRani R, Sharma D, Chaturvedi M, Yadav JP (2017) Antibacterial activity of twenty different endophytic fungi isolated from Calotropis procera and time kill assay. Clin Microbiol 6:280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4172/2327-5073.1000280\u003c/span\u003e\u003cspan address=\"10.4172/2327-5073.1000280\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSadrati N, Daoud H, Zerroug A, Dahamna S, Bouharati S (2013) Screening of antimicrobial and antioxidant secondary metabolites from endophytic fungi isolated from wheat (Triticum durum). J Plant Prot Res 53:128\u0026ndash;136. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2478/jppr-2013-0019\u003c/span\u003e\u003cspan address=\"10.2478/jppr-2013-0019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSaxena S (2014) Microbial metabolites for development of ecofriendly agrochemicals. Allelopathy J 33:1\u0026ndash;24\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchulz B, Boyle C, Draeger S, R\u0026ouml;mmert AK, Krohn K (2002) Endophytic fungi: a source of novel biologically active secondary metabolites. Mycol Res 106:996\u0026ndash;1004. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0953756202006342\u003c/span\u003e\u003cspan address=\"10.1017/S0953756202006342\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSelvi B, Balagengatharathilagam P (2014) Isolation and screening of endophytic fungi from medicinal plants of Virudhunagar district for antimicrobial activity. Int J Sci Nat 5:147\u0026ndash;155\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShikha S, Kumar A (2024) Flavonoid and tannin estimation of Neolamarckia cadamba: A comparative evaluation. Int J Adv Res Eng Sci Manag 12:1\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSingh R, Dubey AK (2015) Endophytic actinomycetes as emerging source for therapeutic compounds. Indo Global J Pharm Sci 5:106\u0026ndash;116. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.35652/igjps.2015.11\u003c/span\u003e\u003cspan address=\"10.35652/igjps.2015.11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrobel G, Daisy B (2003) Bioprospecting for microbial endophytes and their natural products. Microbiol Mol Biol Rev 67:491\u0026ndash;502. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/MMBR.67.4.491-502.2003\u003c/span\u003e\u003cspan address=\"10.1128/MMBR.67.4.491-502.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrobel G, Daisy B, Castillo U, Harper J (2004) Natural products from endophytic microorganisms. J Nat Prod 67:257\u0026ndash;268. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/np030397v\u003c/span\u003e\u003cspan address=\"10.1021/np030397v\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStrobel GA (2003) Endophytes as sources of bioactive products. Microbes Infect 5(6):535\u0026ndash;544. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1286-4579(03)00073-X\u003c/span\u003e\u003cspan address=\"10.1016/S1286-4579(03)00073-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725\u0026ndash;2729. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/mst197\u003c/span\u003e\u003cspan address=\"10.1093/molbev/mst197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVenieraki A, Dimou M, Pergalis P, Kefalogianni I, Chatzipavlidis I, Katinakis P (2017) Endophytic fungi from legumes: Diversity and beneficial traits. Symbiosis 72(3):165\u0026ndash;175. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13199-016-0459-z\u003c/span\u003e\u003cspan address=\"10.1007/s13199-016-0459-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVerma VC, Kharwar RN, Strobel G (2021) Chemical diversity and biological potential of fungal endophytes from medicinal plants. Fungal Ecol 48:101006. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.funeco.2020.101006\u003c/span\u003e\u003cspan address=\"10.1016/j.funeco.2020.101006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVigneshwari A, Rakk D, N\u0026eacute;meth A, Kocsub\u0026eacute; S, Kiss N, Csupor D, Papp T, Škrbić B, V\u0026aacute;gv\u0026ouml;lgyi C, Szekeres A (2019) Host metabolite producing endophytic fungi isolated from Hypericum perforatum. PLoS ONE 14:e0217060. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0217060\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0217060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVimalkumar CS, Hosagaudar VB, Suja SR, Vilash V, Krishnakumar NM, Latha PG (2014) Comparative preliminary phytochemical analysis of ethanolic extracts of leaves of Olea dioica Roxb., infected with the rust fungus Zaghouania oleae (E.J. Butler) Cummins and non-infected plants. J Pharmacogn Phytochem 3:69\u0026ndash;72\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWiyakrutta S, Sriubolmas N, Panphut W, Thongon N, Danwisetkanjana K, Ruangrungsi N, Meevootisom V (2004) Endophytic fungi with antimicrobial, anti-cancer and anti-malarial activities from Thai medicinal plants. World J Microbiol Biotechnol 20(3):265\u0026ndash;272. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/B:WIBI.0000023833.18902.5e\u003c/span\u003e\u003cspan address=\"10.1023/B:WIBI.0000023833.18902.5e\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng YK, Qiao XG, Miao CP et al (2016) Diversity, distribution and biotechnological potential of endophytic fungi. Ann Microbiol 66:529\u0026ndash;542. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13213-015-1153-7\u003c/span\u003e\u003cspan address=\"10.1007/s13213-015-1153-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Endophytes, Phytochemicals, Antioxidant, Secondary metabolites, Antibacterial, DNA Sequencing","lastPublishedDoi":"10.21203/rs.3.rs-7611023/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7611023/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eHigher plants serve as a valuable source of endophytic fungi, which have been shown to produce a wide range of secondary metabolites with therapeutic potential. Despite extensive studies on endophytes from various plant species, there have been no prior reports on the isolation and characterization of endophytic fungi from \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e (Roxb.) Bosser is a medicinally important tree native to tropical Asia. This study aimed to isolate and identify endophytic fungi from the leaves and stems of \u003cem\u003eN. cadamba\u003c/em\u003e and assess their phytochemical constituents and biological activities, particularly antioxidant and antimicrobial potential.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eA total of eight endophytic fungi were isolated from \u003cem\u003eN. cadamba\u003c/em\u003e, with seven from leaves (NKL1 to NKL7) and one from the stem (NKS1). NKL1, NKL3, and NKL4 exhibited rapid growth and distinct morphological features, and were therefore selected for further analysis. Phytochemical screening of fungal extracts revealed the presence of alkaloids, flavonoids, and carbohydrates. The antioxidant activity, assessed via the DPPH assay, showed a concentration-dependent increase in free radical scavenging ability, with NKL1 and NKL3 exhibiting the highest antioxidant potential, comparable to that of the standard ascorbic acid. The crude extracts of endophytic fungi NKL1, NKL3, and NKL4 exhibited concentration-dependent antibacterial activity against \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e, and \u003cem\u003eEscherichia coli\u003c/em\u003e, with NKL1 and NKL3 demonstrating the highest inhibitory effects, thereby confirming their antimicrobial potential. Morphological characterization and 18S rRNA gene sequence analysis identified NKL1 and NKL3 as \u003cem\u003eCurvularia lunata\u003c/em\u003e and \u003cem\u003eCurvularia tropicalis\u003c/em\u003e (NCBI GenBank accession numbers PX205205 and PX218454, respectively), both of which belong to the phylum Ascomycota.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThis study provides the first report of \u003cem\u003eCurvularia lunata\u003c/em\u003e and \u003cem\u003eCurvularia tropicalis\u003c/em\u003e as endophytic fungi associated with \u003cem\u003eNeolamarckia cadamba\u003c/em\u003e. The isolates NKL1 and NKL3 exhibited strong antioxidant and antibacterial properties, suggesting their potential as promising sources of bioactive compounds. These findings support further exploration of \u003cem\u003eN. cadamba\u003c/em\u003e-associated endophytes for their therapeutic and industrial applications.\u003c/p\u003e","manuscriptTitle":"Morphological, Functional, and Molecular Characterization of the Selected Fungal Endophytes from Neolamarckia cadamba (Roxb.) Bosser","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-06 07:04:35","doi":"10.21203/rs.3.rs-7611023/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bfb64f53-d2af-4850-89e0-894406f78532","owner":[],"postedDate":"October 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-28T18:21:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-06 07:04:35","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7611023","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7611023","identity":"rs-7611023","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}