Maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus

Maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus Zhihong Liu, Youjuan Fu, Ting Liu, Can Liu, Rui Wang, Ye Li, Jiashu Zhu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3828353/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Maternal chronic unpredictable mild stress (CUMS) is associated with neuropsychiatric disorders in offspring, including anxiety, depression, and autism spectrum disorders. There is mounting evidence that these behavioral phenotypes have origins in utero, which provided that corticosterone, as a stress hormone, penetrates the placental barrier and enters the fetal body and reprograms the early neural development. Notch signaling pathway is involved in the entire life cycle from embryonic development to birth to death, and mainly regulates neural stem cell proliferation and differentiation, synaptic plasticity and neuronal damage repair, and it has been intensively involved in emotional functioning. However, the role of Notch signaling pathway in affective behaviors of offspring has not been determined. In the present study, the function of Notch signaling pathway in affective behaviors was investigated in open field test (OFT) and sucrose preference test (SPT) in offspring. The results showed that maternal chronic unpredictable mild stress alters affective behaviors in offspring. We examined HPA axis related hormones, hippocampal neuronal cell apoptosis and Notch signaling pathway in offspring. Maternal CUMS damage hippocampal pathology structure and synaptic plasticity in childhood and adolescence offspring, suggesting Notch signaling pathway in the hippocampus was activated. Furthermore, we explored the role and mechanism of Notch signaling pathway in HT22 cell damage after high corticosterone exposure in vitro. Taken together, these results indicate that maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus. Biological sciences/Neuroscience/Learning and memory/Hippocampus Biological sciences/Neuroscience/Molecular neuroscience chronic unpredictable mild stress affective behaviors Notch signaling pathway offspring Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Pregnancy is accompanied by a physiologic, mental and emotional changes. Therefore, women are highly susceptible to psychological distress, including anxiety, depression, and stress [ 1 ] . A large-scale community study showed that about 30% of pregnant women face a variety of stresses associated with psychological stress during pregnancy [ 2 ] . Exposure to these stresses during pregnancy not only causes negative emotions such as anxiety, stress and depression, but also alters the intrauterine environment. In this complex and dynamic stage of change, fetal organs and the emerging organ system are positively and negatively affected, also known as fetal programming [ 3 ] . The formulation of this theory has prompted scholars at home and abroad to pay more attention to perinatal maternal and child health. Previous studies have shown that maternal stress during pregnancy affects 10–35% of children worldwide and is recognized as a major global public health problem currently affecting maternal and child health [ 4 ] . The emerging Developmental Origins of Health and Disease (DOHaD) hypothesis reveals that adverse factors in the early stages of development, especially changes in the intrauterine environment, can permanently affect on the development of neurodevelopmental and psychiatric disorders in the offspring [ 5 ] . Nature states that the critical period for brain development is between 17 weeks and 3 years of age after conception, with an increase in brain volume of about 70% [ 6 ] , which is medically recognized as the critical period for brain development [ 7 ] . During the critical period of brain development, whether it is due to negative physiological, psychological, or social factors of the mother [ 8 – 10 ] , or factors such as genetics, nutrition, and environment of the fetus [ 11 , 12 ] , it may cause abnormalities in brain structure or function. Abnormal neurobehavioral development is the most common brain injury. These early neural developmental damages are early warning signs of mental health problems during growth. Assuming that if we can take precautionary measures in the early stage of the emergence of children's mental health problems, pay more attention to the period of neurodevelopmental vulnerability, which can be the direction of development of the prevention of neurodevelopmental damage. Maternal stress during pregnancy is considered a teratogen, and exposure to excessive stress during pregnancy has a negative impact on the growth and development of offspring. A number of epidemiological and case-control studies in different regions show that maternal stress has an impact on the neural development, cognitive development, emotions, temperament, and mental illness of offspring, such as leading to intellectual development disorders, low language ability, delayed mental and psychological development [ 13 – 15 ] . Worst of all, these harmful effects can even continue until adulthood of offspring [ 16 ] . It is evident that chronic stress exposure during pregnancy can have long-term effects on the behavioral development of the offspring. Prenatal stress releases excess glucocorticoids that affect many aspects of fetal biology, from placental biology to Hypothalamus-Hypophysis-Adrenal (HPA) axis programming, neurodevelopment and epigenetic landscape [ 17 ] . Our research also found that chronic stress during pregnancy activates the maternal HPA axis releasing excessive corticosterone, which passing through the placental barrier, and ultimately caused anxiety and depression like behavioral changes in offspring rats [ 18 ] . Previous studies had shown that the mechanisms of the effects of maternal stress on the neurobehavioral development of offspring have been studied through rodent experiments, mainly focus on affecting neuronal and synaptic development, including the limbic system (hippocampus, amygdala) and prefrontal cortex [ 19 ] . Maternal stress exposure alters the excitation-inhibition balance of hippocampal or cortical neurons, resulting in damage to hippocampal neural stem cells in the offspring [ 20 ] . The current research cannot accurately explain the mechanisms of maternal chronic stress exposure by which way caused the structure, function, and behavioral development disorder of offspring. In the nervous system, the Notch signaling pathway is involved in the entire life cycle from embryonic development to birth to death, and mainly regulates neural stem cell proliferation and differentiation, axon and dendritic growth, synaptic plasticity, neuronal damage repair, and neuronal death [ 21 ] . Notch signaling pathway is mainly composed of Notch receptors, Notch ligands and intracellular effector molecules, among which there are four highly homologous Notch receptors (Notch1 ~ Notch4), including extracellular, transmembrane and intracellular regions (NICD). In adjacent cells, Notch ligand binds to its receptor, and under the action of γ-secretase, the transmembrane region protein of Notch receptor is sheared, and the NICD is released from the inner side of the cell membrane and binds to the transcription factor CSL complex in the nucleus, which activates the transcription of downstream specific Notch target genes, such as Hes, Hey, cMyc, cyclin D1 and other genes that control cell proliferation, differentiation and apoptosis [ 22 ] . It has recently been found that NSCs in embryos express Notch receptors and active signaling is evident based on the expression of the canonical Notch target Hes5 [ 21 , 23 ] , and Notch regulates neurogenesis in the DG area of the adult hippocampus in adult [ 24 ] . Numerous animal studies confirmed that the expression level of Notch1 is downregulated in the hippocampus of mice with chronic unpredictable mild stress [ 25 ] and rats with post-stroke depression [ 26 ] . In addition, the Notch1 signaling pathway is also involved in the behavioral changes of middle-aged female rats after chronic restraint stress [ 27 ] . The mechanism of these changes may be related with Notch1 mediated neural plasticity. In our previous study, iTRAQ proteomics technology was used to screen for differentially expressed proteins and signaling pathways in the hippocampus of offspring. KEGG enrichment analysis revealed abnormal expression of the Notch signaling pathway [ 28 ] . Based on the above findings, we deduce that maternal stress may induce emotional dysfunction in offspring, which may be related to abnormal differentiation of hippocampal neural stem cells mediated by the Notch signaling pathway. Herein, we firstly investigate whether maternal stress exposure during pregnancy can induce abnormal differentiation of hippocampal neural stem cells and emotional disorders in offspring rats. Subsequently, we detected changes in the expression of key genes and proteins in the Notch signaling pathway. Finally, we further explore the role and mechanism of Notch signaling pathway in neuronal cell damage after high corticosterone exposure in vitro. Materials and methods Reagents Sucrose was from Tianjin Kermel Chemical Reagent Co., Ltd. CORT (HY-B1618).and DAPT (HY-13027) were from Medchem Express (MCE). 131 I cortisol radioimmunoassay (RIA) kit was provided from Beijing North Institute of Biotechnology. CRH (JL12541), ACTH (JL44439) and GC (JL27073) were from Shanghai Jianglai Biotechnology Co., Ltd. Primary antibody against BDNF (ab108319), Bax(ab32503), GFAP (ab4648) were from Abcam (Cambridge, MA). Primary antibody against Caspase3 (9662), Bcl2 (4223), Notch1 (3608), Notch2 (4530), Hes1 (11988) and NICD (4147) were from Cell Signaling Technology (Beverley, MA). Primary antibody against PSD95 (AF7839) was from Affinity Biosciences Technology. NeuN (26975-1-AP) and β-Actin (81115-1-RR) was from Proteintech (Chicago, USA). HRP-labeled goat anti-rabbit IgG (A23620) was provided from Abbkine. Animals 18 female adult Sprague Dawley (SD) rats [specific-pathogen-free grade, weight, (220 ± 20) g] and 9 SD male rats [specific-pathogen-free grade, weight, (280 ± 20) g] were obtained from the Animal Laboratory Center of Ningxia Medical University [experimental animal certificate number: SCXK (Ning) 2015–0001]. All rats were raised under strictly controlled conditions (humidity of 50%−60%, temperature of (21 ± 1) ℃, light/dark alternate for 12 h) and had free access to food and water. After a week of acclimatization, eighteen female rats were randomly divided into the prenatal control group (PC group) and prenatal stress model group (PS group) (n = 9 per group). All animal experimental operations were reviewed and approved by the Laboratory Animal Ethical and Welfare Committees for Laboratory Animal Center of Ningxia Medical University (Approval No. IACUC-NYLAC-2021-121). Cell culture and treatment HT22 mouse hippocampal neuronal cell line was purchased from Yipu Biotechnology Co., Ltd, Wuhan China. HT22 cells were cultured with DMEM/high glucose medium (Biological Industries, Israel) mixed with 10% fetal bovine serum (Biological Industries, Israel) in a 37 ℃ incubator with 5% CO 2 . To establish hippocampal neuronal injury model in vitro, HT22 cells were administrated with high concentration CORT, commonly used to simulate neuronal damage caused by elevated glucocorticoids in the body under external stress. To determine the optimal concentration for the in vitro model of CORT induced HT22 cell injury, different concentrations of CORT (0 µM, 25 µM, 50 µM, 100 µM, 200 µM, 400 µM) were used to treat HT22 cells. By observing the survival rate, LDH leakage rate and cell morphology changes, the optimal concentration was determined to use 100 µM CORT for 24 h. To further investigate whether the Notch signaling pathway is involved in neuronal damage caused by CORT exposure, γ-secretase inhibitor DAPT (10 µM) was applied to observe Notch signaling pathway and synaptic plasticity in vitro. The experiment was divided into 5 groups: Control group, DMSO group, CORT group, DAPT group and DAPT + CORT group. Maternal CUMS model The CUMS procedures were based on the Willner‘s’ previously described method of with minor amendments and supplements [ 29 ] . The female rats of PS group were randomly exposed to the ten stressors, with 1 ~ 2 stressors at 10:00–13:00 lasting for 21 days. The whole experimental process was shown in the Table 1 . During the third day of CUMS stimulation, two female rats were mated with a male rat (2:1) in one cage overnight. Next morning, the female rats found the vaginal walls of sperm positivity, regarded as gestational day 0 (GD 0). The female rats were raised to the original environment. If the female rat fails to conceive were not pregnant within 4 days, it will be euthanized. PC rats were housed 2 every cage (1 per cage after 18 days of gestation), while PS rats were housed individually (1 per cage). When the rats were mating, the PS group didn’t suspend stress of CUMS every day. Table 1 CUMS model procedure Week 1 2 3 Monday humid environment (60–70% humidity, 24 h) crowded environment (10 rats in each cage), forced squeezing tail (2 min) 42℃ hot stress (5 min) Tuesday behavioral restriction (1 h), forced squeezing tail (2 min) Food deprivation (12 h) shaking stress (one time per second, 30 min) Wednesday crowded environment (10 rats in each cage), tilted cage 30 ◦ (24 h) humid environment (60–70% humidity, 24 h), 42℃ hot stress (5 min) crowded environment (10 rats in each cage), humid environment (60–70% humidity, 24 h) Thursday shaking stress (one time per second, 30 min), food deprivation (12 h) shaking stress (one time per second, 30 min) behavioral restriction (1 h), food deprivation (12 h) Friday behavioral restriction (1 h) behavioral restriction (1 h) 4℃water swimming (5 min) Saturday tilted cage 30 ◦ (24 h), water deprivation (12 h) 4℃water swimming (5 min), water deprivation (12 h) 42℃ hot stress (5 min), water deprivation (12 h) Sunday 42℃ hot stress (5 min) forced squeezing tail (2 min) forced squeezing tail (2 min) Maternal evaluation Maternal plasma corticosterone To explore whether the CUMS female model successfully established, the plasma corticosterone content, body weight and behavioral experiments were measured on the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress. Blood (1 mL) from inner canthus vein were collected from all the female rats and body weight were measured on the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress. Blood samples were centrifuged for 12, 000× g for 5 min at 4 ℃, and the obtained plasma was used to measure the corticosterone by 131 I cortisol radioimmunoassay (RIA) kit according to the provided instructions of the manufacturing kit. The plasma corticosterone levels were determined from the measured cortisol content by the following conversion formula: Corticosterone concentration = Cortisol concentration× 50 [ 30 ] . Maternal behavior assessment On the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress at 8:00–12:00 am (N = 8 / group) was conducted open field test (OFT) and sucrose preference test (SPT) to observe the behavior changes of maternal female rats. OFT was observed following the standard protocol as previously described [ 28 ] . The horizontal and vertical movement scores of rats were recorded within 5 minutes and used 75% alcohol to clean the open field thoroughly. SPT was performed to mainly reflect the lack of pleasure in experimental animals [ 31 ] . Before the test, female rats were trained to adapt to drinking the sucrose water. During the formal experiment, food and water restriction for 12 h before the test. One bottle of 1% sucrose water and the other bottle of pure water were given to each cage at the same time. After free drinking for 1 h, the two bottles were removed and measured. The pure water consumption, sucrose water consumption, total fluid consumption and 1% sucrose preference (1% sucrose preference percentage = sugar water consumption/total fluid consumption x 100%) were calculated. The whole experimental process was shown in the Fig. 1 . Offspring evaluation The day of birth was designated postnatal day 1 (PND 1). All offspring rats were weaned on PND 21. At least two female and male offspring were randomly selected from per female rat, 32 offspring rats of PC group (OPC, N = 32, n male =16, n female =16) and 32 offspring rats of PS group (OPS, N = 32, n male =16, n female =16. All male and female offspring were separated and housed four in each cage respectively with ad libitum food/water. The emotional behavior was determined by SPT and OFT. Offspring rats were subjected to OFT and SPT on PND28 and PND42, respectively. The SPT concrete protocol was the same as the female rats. The OFT of offspring rats was different from that of female rats. The open field box was 50 cm in length, width and height. The offspring were recorded 5 minutes in the open field. The smart 3.0 system captured video, recorded and analyzed the time of entering the central area, the distance across the central area, and the average speed of movement. Each rat recorded 5 minutes. After the emotional behavior test, the offspring rats were euthanized with injected 20% urethan (6 ml/Kg) on PND28 and PND42. After anesthesia, the plasma of offspring rats was collected into 5 mL anticoagulant blood collection vessels by apical blood collection. After standing at room temperature for 1 h, 12, 000 × g centrifugation for 10 min, the plasma from the upper was collected. The brain was immediately stripped on ice. The right hippocampus was placed in liquid nitrogen, and then moved to − 80 ℃ for molecular biological analysis. The left hippocampus was fixed with 4% paraformaldehyde, and the changes of hippocampal CA1, CA3 and DG were observed by microscope. The left hippocampus was fixed with 2% glutaraldehyde for 2 hours, and the changes of neuron cells and synapses were observed under electron microscope. Hematoxylin eosin (HE) staining The fixed left hippocampus were trimmed, dehydrated in gradient alcohol, transparent in xylene and then paraffin embedded, the thickness of the section was 5 µm, dried at 37 ℃ and dewaxed in xylene. Then, two slides were selected from each sample and were stained. Gradient alcohol dehydration, preparation for hematoxylin and eosin (HE) staining, hematoxylin staining for 3 min, ethanol fractionation with hydrochloric acid for 10 seconds, eosin staining for 3 min, conventional dehydration, transparency, blocking and light microscopy to observe the CA1, CA3 and DG area of hippocampal. The morphology and structure of normal and abnormal neuronal cells in the hippocampal CA1, CA3 and DG region of each slide were investigated under a light microscope (Leica, Germany) at 400 × magnification. Electron microscopy Transmission electron microscope images were prepared by the Electron Microscope Center. Tissue pieces of the hippocampus were fixed with 2% glutaraldehyde for 2 h and washed three times with 0.1 M phosphate-buffered saline (PBS) for 10 min each time. After rinsing, the samples were placed into 1% osmium acid fixative solution and fixed again for 2 h. Then, the samples were rinsed with 0.1 M PBS for 15 min each time. The tissues were dehydrated with graded alcohol series (30, 50,70%, 80%, and 90%), and 100% alcohol and propylene oxide were used to dehydrate 15 min twice. And the embedded in a mixture of propylene oxide and acetone (1:1), propylene oxide resin and acetone (2:1), and pure propylene oxide, respectively, and placed overnight at room temperature. Then, these were sliced into serial coronal 50 ~ 60 nm thick sections using an ultra- thin slicing machine and dyed in saturated uranium dioxide acetate solution for 20 min. After rinsing and drying, the sections were observed and photographed by transmission electron microscopy. Enzyme-linked immunosorbent assays (ELISA) On PND28 and PND42, the plasma CORT concentration of offspring was measured using the same method as that of female rats. At the same time, the corticotropin releasing hormone (CRH), adrenocorticotropic hormone (ACTH), and glucocorticoid (GC) in the plasma of offspring were determined using an enzyme-linked immunosorbent assay kit. Finally, the concentrations were calculated. Immunofluorescence (IFC) The expression of BDNF and PSD95 synaptic proteins in HT22 cell was detected by IFC staining. HT22 cells were seeded with 1000 cells per well in cell crawling, cultured for 12 hours, and treated with different experimental groups. The cells were incubated for 24 hours at 37 ℃ and 5% CO 2 conditions, and then were perfused with 4% paraformaldehyde (PFA) 30 min. For IFC staining, the cell crawling was washed 3 times with PBS and incubated with 0.3% Triton for 5 min, blocked with BSA (3%) for 1 h at room temperature. The slides were incubated overnight at 4°C with 100 µL corresponding primary antibody for BDNF and PSD95 (1:100). On the next day, the slides were recovered at room temperature for 1h and washed with PBST 5 min for 3 times. The slides were incubating with the Alexa Fluor™ Plus 488-conjugated goat anti-rabbit antibody (1:100) at room temperature 1h. The slides were washed with PBST for 3 times and stained with DAPI (Servicebio, Wuhan, China, G1012) for 6 min. The results were observed and photographed using a Nikon fluorescence microscope. Quantitative RT-PCR Total RNAs of HT22 cells and offspring rat hippocampus were extracted using RNA simple Extraction Kit (Tiangen Biochemical Technology, Beijing, DP419) and were transformed into cDNA by using PrimeScriptTM RT Reagent Kit (Tiangen Biochemical Technology, Beijing, RR037A). Next, the RNA was reverse transcribed into cDNA and fluorescence quantification was performed using the CFX 96 PCR detection system. The operating steps were performed according to TB Green ® Premium Ex Taq™ (Tiangen Biochemical Technology, Beijing, RR420A). Finally, the target mRNA levels were obtained through comparative CT method. The primer sequences used for amplifying the indicated genes are listed in Table 2 . Table 2 Primers for real-time RT-PCR Genes forward primer sequences (5'→3') reverse primer sequences (3'→5') GAPDH GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT BDNF TGGAACTCGCAATGCCGAACTAC TCCTTATGAACCGCCAGCCAATTC PSD95 TCCAGTCTGTGCGAGAGGTAGC GGACGGATGAAGATGGCGATGG Caspase3 AGGGTTTCGCTTGGGAGAGGAC AGGGAGGCAGACACCTGATGAAG Bcl-2 TGGAGGAACTCTTCAGGGATGGG CACAGAGCGATGTTGTCCACCAG Bax ACTTGTTATCGTGAGTGCTGCTGTC CCTGCATTCTGTAGGAACCGCTATC Notch1 GCCAGCAAGAAGAAGCGGAGAG CCACTCGTTCTGATTGTCGTCCATC Notch2 ATTCTGATCCGCAACCGAGTAACG GCTCTGCCACCATTCCTTCCAC Hes1 CTAACGCAGTGTCGCCTTCCAG AGAGAGGTGGGCTAGGGAGTTTATG NICD CGCTGCCTCTGCTGCTGTTG CGTCTCCGCTTTACTCACCAGTTC Western blotting Western blotting was used to determine the expression content of synaptic plasticity related proteins, neuron apoptosis and differentiation proteins, and Notch signal proteins in the hippocampus of the offspring and HT22 cells. The total protein of hippocampal and HT22 cells was quantified using a bicinchonini acid (BCA) test (KeyGEN BioTECH, China). Each hippocampus added into 700 µL and each tissue culture dish was added into 300 µL cold lysis buffer and homogenized. The centrifuge tube was centrifuged at 12,000 x g for 5 min, then the BCA method was used for protein concentration detection. After added 200 µL BCA working solution and a total volume of 20 µL to each well and mixed thoroughly. The 96 well plate was incubated at 37 ℃ for 30 min, and the absorbance value was measured at 562 nm. Total hippocampal extracts (50 µg) and HT22 cell extracts (10 µg) were electrophoresed using 10% Tris-glycine sodium dodecyl sulfate polyacrylamide gels. Then, the gels were transferred to PVDF membranes and blocked using 5% skimmed milk powder at room temperature for 1 h. The primary rabbit antibodies BDNF, Bax, Caspase3, GFAP, Bcl2, Notch1, Notch2, Hes1 and NICD diluted 1:1000 were added, and PSD95 and NeuN were diluted 1:800. The primary rabbit antibody of β-actin was diluted 1:3000. And then the bands were incubated with primary antibody overnight at 4℃, rinsed 3 times with TBST. Primary antibodies were visualized with HRP-conjugated anti-rabbit IgG (1:5000) at room temperature for 1 h and rinsed 3 times with TBST. The luminescent solution was developed and placed in a chemiluminescent instrument for detection and photography, and the target protein bands were analysed by using Image J. Finally, the density value ratio of protein and β-actin were calculated. Statistical analysis The analysis of the experimental date was performed by using the Statistical Package for the Social Sciences 23.0, and all graphs were constructed in GraphPad Prism 7.0. All data were expressed as mean ± SEM. Repeated measures ANOVA and correlation analysis were used to analyze the differences of plasma corticosterone levels between the PC and PS group. Two independent sample t-tests were used to compare the statistical differences. The comparison of data indicators between multiple groups was conducted using one-way analysis of variance, and further comparison between two groups is conducted using LSD test. P ≤ 0.05 was considered statistically significant. Results Maternal CUMS impacts maternal plasma corticosterone and emotional behavior with anxiety and depression To determine whether maternal CUMS model was successfully established, we firstly investigated the effects of maternal weight and plasma corticosterone. As shown in Fig. 2 A, the female rats in the two groups had similar body weights before exposure to stress. However, in the late stages of stress, the females in the PS group were lower than those of PC group ( P < 0.05). In the Fig. 2 B, on the 7th and 14th day of stress, the plasma corticosterone levels in PS group were significantly higher than those in PC group during the same period ( P < 0.05), which proved the CUMS model was established successfully. To further observe changes in maternal emotional behavior, open field test and sucrose preference test were conducted. For the OFT results (Fig. 2 C ~ F), the repeated measures ANOVA displayed that maternal stress played a significant impact on both horizontal movement scores ( P < 0.05) and vertical movement scores ( P < 0.05). An interaction was found between stimulation time and group( P < 0.05)in term of horizontal movement scores. On the 14th and 21st day of stress, the horizontal movement scores and vertical movement scores in PS group were significantly lower than those in PC group during the same period. These results suggested prenatal stress reduced animal activity and curiosity about the novel environment. The repeated measurement analysis of variance showed that chronic stress had a significant impact on pure water consumption ( P < 0.05, Fig. 2 G), 1% sucrose consumption ( P < 0.05, Fig. 2 H), total fluid consumption ( P < 0.05, Fig. 2 I) and 1% sucrose preference percentage ( P < 0.05, Fig. 2 J), and those values in the PS rats were significantly less than those in the PC rats ( P < 0.05). These results suggested that stress stimulation during pregnancy reduced the ability of rats to respond to happy events. Maternal CUMS exposure during pregnancy induce emotional behavior deficits in childhood and adolescence offspring By conducting OFT experiments to observe the changes in motor ability of offspring on PND28 and PND42, representing juvenile and adolescent stages respectively, and the impact of chronic stress during pregnancy on offspring motor ability and anxiety like behavior can be evaluated. After analysis, the exploration time and distance in the central area of the OPS group on PND 28 were significantly reduced compared to the OPC group ( P < 0.05, Fig. 3 B ~ C), while on PND 42, the exploration time and distance in the central area of the OPS group were not significantly changed compared to the OPC group. This suggests that chronic stress during pregnancy can increase the fear and anxiety like behavior on PND28 towards the open environment in the central area, while having no effect on PND42. In addition, the average motor speed of the OPS group decreased at PND28 and PND42 ( P < 0.05, Fig. 3 D). The above results indicate that chronic stress during pregnancy can reduce the motor ability of offspring in both juvenile and adolescent rats, and increase anxiety behavior in juvenile rats. In addition, this study detected the depressive like behavior of pleasure loss in offspring on PND28 and PND42 through SPT. Through statistical analysis, it was found that the sucrose consumption, total liquid consumption, and 1% sucrose preference percentage of the OPS group decreased at PND28 ( P < 0.05, Fig. 3 F ~ H), and there was also a downward trend in sucrose consumption and 1% sucrose preference percentage at PND42. In addition, the pure water consumption of OPS group was higher than that of OPC group at PND28 ( P < 0.05, Fig. 3 E), and also showed an increasing trend at PND42 ( P < 0.05, Fig. 3 E). From all above results, it can be concluded that chronic stress during pregnancy can cause depressive like behavior with loss of pleasure at different age groups in offspring. Maternal CUMS damage hippocampal pathology structure and synaptic structure plasticity in childhood and adolescence offspring In HE staining, the nuclei of normal neurons are circular and centered, with clear and orderly cell layers and uniform cytoplasmic staining. When neuronal cells are damaged, the most obvious manifestation is nuclear pyknosis and irregular cells. The nuclear pyknotic neurons in the CA1, CA3, and DG regions of the hippocampus were uneven cytoplasmic staining and less clear cellular hierarchical structure in OPS group on PND28. The morphology was irregular, the cell body became smaller and the spacing increased, and some cells showed vacuolar like changes. At PND42, the nuclei of neurons in the CA1, CA3, and DG regions of the OPS group rats were spindle shaped, and the cytoplasm became lighter in staining, with significant vacuolar like changes. The staining results were shown in Fig. 4 A, which showed the number of pyknotic neurons in different hippocampal subregions of each group of both PND28 and PND42 shown in Fig. 4 B-D. The number of pyknotic neurons in the OPS group was higher than that in the OPC group ( P < 0.05). The above experimental results indicate that chronic stress during pregnancy in female rats can aggravate the damage to neuronal cells in various hippocampal regions of offspring rats, and this damage will worsen with age in the CA1 region. The synapses of neurons in the hippocampus are the basic structure of the brain for learning memory, and many basic experiments have shown that synaptic structural plasticity is manifested by changes in the number of synapses, dendritic spine density, average area, gap distance, postsynaptic dense matter, synaptic interface curvature and the formation of new synapses [ 32 ] . In order to further observe the effects of chronic stress during pregnancy on synaptic plasticity in the cerebral hippocampus of offspring, we observed the changes of synaptic structural plasticity in offspring rats by electron microscopy, counting the number of synapses, thickness of postsynaptic membrane density, and width of synaptic gaps. At PND28 and PND42, the synaptic boundaries in different regions of the hippocampus of OPC group were clear, with complete contours and dense and uniform distribution of round synaptic vesicles on the presynaptic membrane. The presynaptic membrane of the hippocampal CA1 and CA3 regions in the OPS group was unclear, the distribution area of synaptic vesicles was reduced, and the synaptic space was blurred. Statistical analysis was conducted on the number of synapses, synaptic gap width, and postsynaptic membrane density thickness in different hippocampal regions of offspring. The results showed that the synaptic gap in the hippocampal CA3 region of offspring in the OPS group was narrower than that in the OPC group at PND28 ( P < 0.05), and the postsynaptic density in the hippocampal CA1, CA3, and DG regions of offspring in the OPS group was thicker than that in the OPC group ( P < 0.05). Compared with the OPC group on PND42, the number of synapses in the hippocampal CA1 and CA3 regions of the OPS group decreased ( P < 0.05), the synaptic gap in the CA1 region widened ( P < 0.05), and the postsynaptic dense matter in the CA1 and DG regions thickened ( P < 0.05) were administered. The results indicate that chronic stress during pregnancy in female rats can cause changes in the number and structure of synapses in different hippocampal regions of offspring rats, ultimately leading to neuronal damage. Maternal CUMS exposure during pregnancy induce HPA axis related hormones and hippocampal neuronal cell apoptosis abnormal activation and synaptic plasticity reduced in childhood and adolescence offspring To further understand the impact of maternal stress during pregnancy on the HPA axis in offspring, we detected changes in hormone content in the plasma of offspring using ELISA. The results showed that the CRH content in the OPS group was higher than that in the OPC group at PND28 and PND42 ( P < 0.05), as shown in Fig. 6 A, suggesting that chronic stress during pregnancy may cause an increase in CRH content in offspring at different stages. The change in ACTH content is consistent with the change in CRH ( P < 0.05, Fig. 6 B). Excessive ACTH can stimulate the adrenal cortex to secrete glucocorticoids. After an increase in GC content, it is regulated by negative feedback through glucocorticoid receptors, inhibiting the activity of the HPA axis to restore glucocorticoid levels. After measuring the GC content using ELISA, it was found that the GC content in the OPS group as higher than that in the OPC group at PND28 and PND42 ( P < 0.05, Fig. 6 C), consistent with the changes in CORT (Fig. 6 D). To further investigate the effect of chronic stress during pregnancy on apoptosis of hippocampal neurons in offspring, this study measured the expression levels of apoptosis related genes and proteins in hippocampal neurons of offspring on PND28 and PND42. The q-PCR results showed that the expression of Caspase-3 and Bax mRNA in the hippocampus of the OPS group increased compared to the OPC group at PND28 ( P < 0.05, Fig. 6 .E ~ H), while the expression of Bcl-2 and Bcl-2/Bax mRNA decreased. The same trend of change was also observed on PND42 ( P < 0.05). The expression of Caspase-3 and Bax proteins in the hippocampus of the OPS group was higher than that of the OPC group at PND28 ( P < 0.05, Fig. 6 .K ~ M), while the expression of Bcl-2 and Bcl-2/Bax proteins was lower ( P < 0.05). At PND42, only a decrease in Bcl-2/Bax protein expression was found ( P < 0.05), and the protein changes in the hippocampus of the offspring were basically consistent with the gene expression trend at the same period. From the above results, it can be concluded that maternal chronic stress during pregnancy can induce increased apoptosis in hippocampal neurons of offspring at different ages. To detect whether the synaptic plasticity changes, BDNF and PSD95 genes and proteins expression levels were detected by q-PCR and Western blotting. After analysis, it was found that the mRNA levels of BDNF and PSD95 in the hippocampus of the OPS group were lower than those in the OPC group at PND28 and PND42 ( P < 0.05, Fig. 6 .N ~ O), and the changes in protein expression levels were consistent with the changes in gene expression ( P < 0.05. Figure 6 .Q ~ R). The all above results suggest that chronic stress during pregnancy can cause abnormal expression of synaptic plasticity related proteins in offspring of different ages, ultimately leading to cognitive impairment in offspring. Maternal CUMS exposure during pregnancy induce Notch signaling pathway abnormal activation and hippocampal neural stem cells abnormal differentiation in childhood and adolescence offspring Based on the results of previous proteomic testing, we focused on observing the changes in the Notch signaling pathway that played a crucial role in embryonic and adult neurogenesis. The q-PCR results showed that the mRNA expression of Hes1, Notch1, NICD, and Notch2 in the hippocampus of OPS group rats was higher than that of OPC group at PND28, ( P < 0.05, Fig. 7 A ~ D). At PND42, only increased mRNA expression of Notch1, NICD, and Notch2 was found ( P < 0.05). The trend of protein expression changes were consistent with gene expression ( P < 0.05, Fig. 7 F ~ I). The Notch signaling pathway is involved in the neurogenesis process of immature neurons. After a series of processes such as proliferation and differentiation, neurons differentiate into mature neuronal cells and glial cells. Among them, neuronal nuclei (NeuN) is a specific marker for mature neurons, while glial fibrillary acidic protein (GFAP) is a specific marker for astrocytes. Western Blotting was used to detect the protein expression of GFAP and NeuN in the hippocampal of offspring on PND28 and PND42. As shown in Fig. 7 K ~ L, the expression of NeuN protein in the hippocampus of the OPS group decreased compared to the OPC group at PND28 ( P < 0.05), while the expression of GFAP protein increased ( P < 0.05). At PND42, only a decrease in NeuN protein expression level was observed ( P < 0.05). The above results suggest that chronic stress during pregnancy in female can reduce neuronal differentiation and promote astrocyte proliferation. This abnormal neuronal differentiation may be related with abnormal activation of the Notch signaling pathway. CORT exacerbates HT22 neuronal cell damage in vitro In order to further verify the effects of chronic stress hormone (CORT) on HT22 neuronal cells in vitro models, this study selected HT22 cell lines for relevant experiments. Observing the effect of CORT on the activity of HT22 cells for 24 hours, CCK8 results showed that it was compared with the 0 µM CORT group, the survival rate of HT22 cells decreased with increasing CORT concentration ( P < 0.05), and the cell survival rate of 100 µM CORT intervention was (57.50 ± 3.76)% (Fig. 8 A). Simultaneously, 100 µM CORT treating HT22 cells with for different times, the results showed that the cell survival rate significantly decreased after 24 hours of treatment ( P < 0.05, Fig. 8 B). According to the CCK8 experiment, the conditions for establishing a CORT induced HT22 cell injury model may be a CORT concentration of 100 µM. To further determine the optimal concentration of CORT induced HT22 cell injury in vitro model, HT22 cells were treated with different concentrations of CORT for 24 hours in subsequent experiments. LDH leakage rate and cell morphology changes were comprehensively evaluated. Compared with the 0 µM CORT group, the leakage rate of LDH in HT22 cells at 100 µM CORT began to increase ( P < 0.05, Fig. 8 C). Under an optical microscope, it was observed that the number of HT22 cells was decreased, the cells changed from plump to wrinkled, the synaptic shape shortened and became thinner, and no tight network structure was formed at 100 µM CORT intervention for 24 hours. In order to further observe the effect of CORT exposure on apoptosis of hippocampal neurons HT22 cells, q-PCR and Western Blotting were used to detect the changes of apoptosis related genes and proteins in HT22 cells. At the genetic level, we found that the expression of apoptosis related genes Caspase3 and Bax significantly increased after CORT intervention ( P < 0.05, Fig. 8 G), while the expression levels of Bcl-2 and Bcl-2/Bax decreased ( P < 0.05). At the protein level, the expression levels of Bcl-2 and Bcl-2/Bax were consistent with the gene level changes ( P < 0.05). The above results suggest that CORT exposure can increase apoptosis of hippocampal neurons. We also investigated the effect of CORT on the proliferation ability of HT22 cells, and flow cytometry was used to detect changes in cell cycle. It was found that compared with the Control group, the percentage of HT22 cells in the CORT group increased in the G1 phase ( P < 0.05 Fig. 8 I), while the percentage decreased in the S phase ( P < 0.05). The above results indicate that CORT exposure causes cell arrest in G1 phase and decrease in S phase during the proliferation of HT22 cells, ultimately leading to cell damage. The Notch signaling pathway promotes CORT induced synaptic plasticity damage in HT22 neuronal cells in vitro In vivo studies, we have found that maternal chronic stress during pregnancy can activate the Notch signaling pathway. To explore the molecular mechanisms of the Notch signaling pathway in CORT induced proliferation, differentiation, and synaptic formation of HT22 cells, this study mainly examined the changes in key components of the Notch signaling pathway (Hes1, Notch1, Notch2, and NICD) at the gene and protein levels. As shown in Fig. 9 A and C, CORT significantly activated the Notch signaling pathway, which found that the expression of Hes1, Notch1, Notch2, and NICD mRNA were increased in CORT group ( P < 0.05). The protein expression trend was consistent with the mRNA expression trend. Meanwhile, the expression levels of BDNF and PSD95 mRNA decreased compared to the Control group ( P < 0.05), but only the expression of the PSD95 protein decreased in the CORT group ( P < 0.05). In order to further explore the role of the Notch signaling pathway in neuronal damage caused by CORT exposure, we selected the Notch signaling pathway inhibitor 10 µM DAPT to inhibite the Notch signaling pathway in vitro model to observed the synaptic plasticity changes of HT22 neuronal cells. As expected, it was found that DAPT intervention significantly inhibited the expression of the Notch signaling pathway key genes Hes1, Notch1, Notch2, and NICD mRNA and proteins levels ( P < 0.05). Furthermore, DAPT markedly reversed the changes in synaptic related genes and proteins in CORT group ( P < 0.05). To sum up, our results indicate that maternal chronic unpredictable mild stress exposure cause affective behaviors disorder in offspring rats via persistent activation of Notch signaling pathway in the hippocampus Discussion In the real environment, women are inevitably exposed to multiple environmental risk factors during pregnancy, such as natural disasters, negative life events, or psychological stress. Many population studies and animal experiments had shown that maternal stressors can increase the risk of mental illness in generation [ 33 – 35 ] . Increasing evidence suggested that maternal chronic stress exposure impaired the neurobehavioral development of offspring [ 14 , 36 ] . However, the effect of maternal chronic stress on offspring affective function and its underlying mechanism remain largely unknown, warranting further studies. In the present study, we chose the CUMS model originally created by Paul Willner and colleagues [ 29 ] , which has been widely used to establish chronic stress models in rodents. In order to verify the scientific and rational establishment of CUMS model, we comprehensively evaluated the plasma corticosterone levels, weight changes, OFT and SPT behavioral performance of female SD rats on the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress. In the present study, our results indicated that the PS group showed an increase in plasma corticosterone content, slow weight gain, decreased scores in both horizontal and vertical movements in OFT, and a decrease in the 1% sugar water preference percentage in SPT. Thus, the data suggested that the CUMS pregnant rat model was successfully established, allowing for further research on the offspring. To clarify the impact of chronic stress during pregnancy on the emotional behavior of offspring at different stages, the results OFT and SPT showed that the exploration ability of offspring decreased and anxiety like behavior increased during childhood and adolescence. There is a consensus that the hippocampus is essential in the stress response and in the pathophysiology of mood-related disorders [ 37 , 38 ] . A previous animal experiment indicated that prenatal stress caused various degrees of damage to neurons cell, mitochondria and synaptic structure in the hippocampus [ 39 , 40 ] . In the current study, the H&E staining results showed that maternal stress exposure could significantly increase the damage to neuronal cells in various regions of the hippocampus of offspring rats, and this damage will worsen with age in the CA1 region. In addition to the hippocampal neuron structure, the results of electron microscope showed that the number of synapses in different hippocampal subregions decreased, synaptic gaps widened, and postsynaptic dense matter thickened of OPS group at different ages, even the adverse effects can be sustained until adolescence. These findings are consistent with previous findings on synaptic structure and function abnormalities in offspring caused by exposure to adverse environments during pregnancy [ 41 , 42 ] . Stress exposure induced maternal release of excessive cortisol (corticosterone in rodents) has been regarded as an important mediator of prenatal stress [ 43 , 44 ] . Moreover, epidemiological investigations have also found that excessive cortisol in the fetus from placental barrier can reprogram the HPA axis, and dysfunction of the HPA axis has adverse effects on the morphology structure, physiological function, and behavioral performance of the brain [ 45 ] . Corticosterone, as the final product secreted after abnormal activation of the HPA axis by prenatal stress, may have an impact on the proliferation and differentiation of offspring hippocampal neurons [ 46 ] . Consistent with the study, we found that maternal exposure to chronic stress during pregnancy can cause an increase in plasma levels of CRH and ACTH in offspring at PND28 and PND42, ultimately leading to an increase in GC levels. CORT, as the most potent glucocorticoid in the body, also increases in content. As mentioned above, chronic stress during pregnancy can cause abnormal activation of the HPA axis in childhood and adolescence offspring. There was a rich literature available suggesting that the synaptic-related proteins, such as PSD95 and BDNF, promoted synaptic plasticity and were the biomolecular basis of emotional function [ 47 , 48 ] . It has been reported that BDNF is a member of the neurotrophin family, involved in structural regulation of synaptic generation, maintenance, expansion, and modification, as well as functional regulation of neural conduction and receptor activity, and promoting dendritic and axonal growth [ 49 ] . Postsynaptic dense-95 (PSD95) is mainly expressed on the cell bodies and dendrites of pyramidal neurons and granulosa cells [ 50 ] . Rodent studies have found that reduced expression levels of PSD-95 and BDNF can cause loss of hippocampal synapses and dendritic spines, ultimately leading to significant changes in the morphology of neurons and their synapses [ 51 ] . The present results revealed that the gene and protein levels of BDNF and PSD95 in the hippocampus of OPS group decreased at PND28 and PND42. Thus, chronic stress during pregnancy can cause synaptic related proteins abnormal expression in offspring of hippocampus and might further impair offspring emotional ability. Overwhelming evidence substantiated that during the development of the hippocampus, external environmental stress can cause morphological changes in hippocampal neurons, increased neuronal apoptosis, decreased synaptic plasticity, thereby impairing offspring neurodevelopment [ 52 ] . Neuron apoptosis is considered the most typical pathological feature in immature brain injury. In order to further investigate the effect of chronic stress during pregnancy on neuronal apoptosis in the hippocampus of offspring at different developmental stages, this study also conducted molecular level related experiments. The results of q-PCR and Western Blotting detection showed that the expression levels of Bcl-2/Bax gene and protein in the hippocampus of OPS group decreased at PND28 and PND42, while the expression levels of Caspase-3 gene increased. Several studies indicated that as the damage worsen during hippocampal development, Caspase3 and Bax were overexpressed, while Bcl-2 expression was inhibited, ultimately leading to an imbalance in the proportion of Bcl-2/Bax and an increase in neuronal apoptosis [ 53 ] . In summary, maternal CUMS exposure can cause increased apoptosis of hippocampal neurons in offspring at different stages, ultimately leading to neurobehavioral developmental damage in offspring. A more important class of molecules in the development of the hippocampus from fetus to adult is the Notch signaling pathway and its key factors [ 54 ] . Research has found that Notch receptors and their ligands are expressed at all stages of hippocampal development [ 55 , 56 ] . Notch signaling regulates the dendritic morphology of newly formed neurons, and it is necessary for hippocampal synaptic plasticity and emotional behavior [ 57 , 58 ] . This study focused on the role of Notch signaling pathway in the neurobehavioral development damage of offspring caused by chronic stress during pregnancy. The results showed that chronic stress during pregnancy can cause an increase in the expression of Hes1, Notch1 and NICD genes and proteins in the hippocampus of offspring at PND28, and an increase in the expression levels of Notch1, NICD and Notch2 genes and proteins at PND42. Therefore, we speculate that the emotional damage of offspring at different ages caused by chronic stress during pregnancy may be related to abnormal activation of the Notch signaling pathway. In addition to Notch signaling pathway regulates the dendritic morphology of newly formed neurons and synaptic plasticity, it is also involved in regulation of neural stem cell proliferation and differentiation during embryonic and adult development [ 59 ] . It had been established that Notch pathway is a highly conserved mediator of cell fate determination [ 60 ] . The Notch pathway in the neuronal lineage is involved in regulating processes such as cell proliferation, differentiation, and apoptosis [ 61 ] . Neural stem cells in the brain mainly differentiate into NeuN and GFAP [ 62 ] , among which NeuN is a protein specifically expressed in neurons and is considered a specific marker of mature neurons [ 63 ] . NeuN has two subtypes: 46 kD and 48 kD, expressed in the nucleus and cytoplasm, respectively. When brain tissue is exposed to adverse factors such as ischemia and hypoxia, the expression of NeuN will decrease, ultimately inducing an increase in neuronal apoptosis [ 64 ] . GFAP is a skeletal protein synthesized by astrocytes, commonly used to label astrocytes, and is also a marker of astrocyte activation [ 65 ] . Under physiological conditions, the number of astrocytes in the hippocampus is relatively small, but a large number of reactive proliferative astrocytes will appear after being subjected to adverse environment. In addition to causing morphological changes such as swelling and increased protrusions in the cell body, excessive proliferation of astrocytes may also secrete a large amount of toxic cytokines, promote the formation of glial scars, and ultimately affect neuronal axon regeneration, exacerbating neuronal damage [ 66 ] . The present results revealed that the expression of NeuN protein decreased in the hippocampus of OPS group at PND28 and PND42, while the expression of GFAP protein increased during PND28. In the current study, chronic stress exposure during pregnancy leads to abnormal neuronal differentiation in the hippocampus of offspring, which may lead to axonal regeneration, exacerbate neuronal apoptosis, and ultimately cause changes in hippocampal synaptic plasticity. This series of damages may be related to abnormal activation of the Notch signaling pathway. It is worth noting that corticosterone (CORT) has important roles in normal maturation of the developing brain, such as maturation of nerve terminal, remodeling axons and dendrites, and the cell survival [ 67 , 68 ] . CORT is a steroid hormone secreted and synthesized by the adrenal cortex after stress stimulation in the body. Elevated plasma cortisol levels can cause damage to the morphology or function of the hippocampus [ 69 ] . In order to simulate the dysfunction of neuronal plasticity caused by elevated glucocorticoids when the body is subjected to external stress, CORT was pretreated in HT22 cells. Observation of HT22 cell damage through morphological and apoptosis related detection, detection of Notch signaling pathway. We found that compared with the control group, the protein levels of CyclinD1 and Bcl-2 were markedly reduced in HT22 cells treated with CORT. The levels of Caspase3 and Bax proteins significantly increased, which is consistent with the results of the animal in vivo model in this study. Previous studies have also found that corticosterone exposure can reduce the survival rate of neuronal cells and significantly reduce the expression of PSD95 protein [ 70 ] . Furthermore, DAPT also obviously decreased the expression of apoptotic proteins Bax and Caspase3, and downregulate the expression of Notch related proteins in damaged HT22 cells. Further research showed that inhibiting Notch signaling pathway significantly alleviated maternal stress exposure-caused hippocampal neuronal demage and emotion deficits in offspring. As mentioned above, maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus. Conclusion Overall, our work provides strong in vitro and in vivo evidence supporting the important role of the Notch signaling pathway in the regulation of maternal chronic unpredictable stress on the occurrence and development of emotional behavior in offspring rats. Our data uncovered novel molecular mechanisms regulating the development of offspring neurobehavioral damage provided effective intervention strategies for early life and proposed a new insight into preventing and controlling for maternal originated diseases. Declarations Acknowledgements This study was supported by the National Natural Science Foundation of China (No: 82260647, 81960591), Key R&D projects in Ningxia (No:2023BEG02005), Key Project of Ningxia Natural Science Foundation (No:2022AAC02030), Chinese Academy of Sciences "Light of the West" talent training program. Ningxia Medical University scientific research project （XZ2023001）. Author Contributions Youjuan Fu and Ting Liu conceived and designed the study. Youjuan Fu, Can Liu, Ye Li performed the experiments and acquired the data. Rui Wang and Jiashu Zhu interpreted the data. Suzhen Guan and Zhihong Liu drafted the paper and revised it. All authors reviewed and approved the final version. Conflict of interest The authors declare that they have no conflict of interest. Data Availability Statement The data that support the findings of this study will be available from the corresponding author upon reasonable request. References Nath A, Murthy G, Babu G R, et al. Effect of prenatal exposure to maternal cortisol and psychological distress on infant development in Bengaluru, southern India: a prospective cohort study[J]. BMC Psychiatry,2017,17(1):255. Londono T A, Diaz S A, Ross D A, et al. Effects of Maternal Prenatal Stress: Mechanisms, Implications, and Novel Therapeutic Interventions[J]. Biol Psychiatry,2016,80(11):e85-e87. Barker D J. The developmental origins of chronic adult disease[J]. Acta Paediatr Suppl,2004,93(446):26-33. Van den Bergh B, van den Heuvel M I, Lahti M, et al. Prenatal developmental origins of behavior and mental health: The influence of maternal stress in pregnancy[J]. Neurosci Biobehav Rev,2020,117:26-64. Velazquez M A, Fleming T P, Watkins A J. Periconceptional environment and the developmental origins of disease[J]. J Endocrinol,2019,242(1):T33-T49. Bethlehem R, Seidlitz J, White S R, et al. Brain charts for the human lifespan[J]. Nature,2022,604(7906):525-533. Kim D R, Bale T L, Epperson C N. Prenatal programming of mental illness: current understanding of relationship and mechanisms[J]. Curr Psychiatry Rep,2015,17(2):5. Burgess D J, Moritz K M. Prenatal alcohol exposure and developmental programming of mental illness[J]. J Dev Orig Health Dis,2020,11(3):211-221. Monk C, Lugo-Candelas C, Trumpff C. Prenatal Developmental Origins of Future Psychopathology: Mechanisms and Pathways[J]. Annu Rev Clin Psychol,2019,15:317-344. Aris I M, Fleisch A F, Oken E. Developmental Origins of Disease: Emerging Prenatal Risk Factors and Future Disease Risk[J]. Curr Epidemiol Rep,2018,5(3):293-302. Senn V, Bassler D, Choudhury R, et al. Microbial Colonization From the Fetus to Early Childhood-A Comprehensive Review[J]. Front Cell Infect Microbiol,2020,10:573735. Feyaerts D, Urbschat C, Gaudilliere B, et al. Establishment of tissue-resident immune populations in the fetus[J]. Semin Immunopathol,2022,44(6):747-766. Kinney D K, Munir K M, Crowley D J, et al. Prenatal stress and risk for autism[J]. Neurosci Biobehav Rev,2008,32(8):1519-1532. Mbiydzenyuy N E, Hemmings S, Qulu L. Prenatal maternal stress and offspring aggressive behavior: Intergenerational and transgenerational inheritance[J]. Front Behav Neurosci,2022,16:977416. Cardenas A, Faleschini S, Cortes H A, et al. Prenatal maternal antidepressants, anxiety, and depression and offspring DNA methylation: epigenome-wide associations at birth and persistence into early childhood[J]. Clin Epigenetics,2019,11(1):56. Plant D T, Pawlby S, Sharp D, et al. Prenatal maternal depression is associated with offspring inflammation at 25 years: a prospective longitudinal cohort study[J]. Transl Psychiatry,2016,6(11):e936. Krontira A C, Cruceanu C, Binder E B. Glucocorticoids as Mediators of Adverse Outcomes of Prenatal Stress[J]. Trends Neurosci,2020,43(6):394-405. Guan S Z, Fu Y J, Zhao F, et al. The mechanism of enriched environment repairing the learning and memory impairment in offspring of prenatal stress by regulating the expression of activity-regulated cytoskeletal-associated and insulin-like growth factor-2 in hippocampus[J]. Environ Health Prev Med,2021,26(1):8. Wei S, Li Z, Ren M, et al. Social defeat stress before pregnancy induces depressive-like behaviours and cognitive deficits in adult male offspring: correlation with neurobiological changes[J]. BMC Neurosci,2018,19(1):61. Diz-Chaves Y, Baquedano E, Frago L M, et al. Maternal stress alters the developmental program of embryonic hippocampal neurons growing in vitro[J]. Psychoneuroendocrinology,2013,38(3):455-459. Basak O, Taylor V. Identification of self-replicating multipotent progenitors in the embryonic nervous system by high Notch activity and Hes5 expression[J]. Eur J Neurosci,2007,25(4):1006-1022. Zhang R, Engler A, Taylor V. Notch: an interactive player in neurogenesis and disease[J]. Cell Tissue Res,2018,371(1):73-89. Engler A, Zhang R, Taylor V. Notch and Neurogenesis[J]. Adv Exp Med Biol,2018,1066:223-234. Giachino C, Barz M, Tchorz J S, et al. GABA suppresses neurogenesis in the adult hippocampus through GABAB receptors[J]. Development,2014,141(1):83-90. Guo Y J, Zhang Z J, Wang S H, et al. Notch1 signaling, hippocampal neurogenesis and behavioral responses to chronic unpredicted mild stress in adult ischemic rats[J]. Prog Neuropsychopharmacol Biol Psychiatry,2009,33(4):688-694. Shang X, Shang Y, Fu J, et al. Nicotine Significantly Improves Chronic Stress-Induced Impairments of Cognition and Synaptic Plasticity in Mice[J]. Mol Neurobiol,2017,54(6):4644-4658. Shen J, Lin L, Liao L, et al. The involvement of Notch1 signaling pathway in mid-aged female rats under chronic restraint stress[J]. Neurosci Lett,2020,738:135313. Fu Y, Liu H, He L, et al. Prenatal chronic stress impairs the learning and memory ability via inhibition of the NO/cGMP/PKG pathway in the Hippocampus of offspring[J]. Behav Brain Res,2022,433:114009. Willner P. The chronic mild stress (CMS) model of depression: History, evaluation and usage[J]. Neurobiol Stress,2017,6:78-93. Liu X H, Qian L J, Gong J B, et al. Proteomic analysis of mitochondrial proteins in cardiomyocytes from chronic stressed rat[J]. Proteomics,2004,4(10):3167-3176. Guan L, Jia N, Zhao X, et al. The involvement of ERK/CREB/Bcl-2 in depression-like behavior in prenatally stressed offspring rats[J]. Brain Res Bull,2013,99:1-8. Batool S, Raza H, Zaidi J, et al. Synapse formation: from cellular and molecular mechanisms to neurodevelopmental and neurodegenerative disorders[J]. J Neurophysiol,2019,121(4):1381-1397. Weinstock M. Prenatal stressors in rodents: Effects on behavior[J]. Neurobiol Stress,2017,6:3-13. Alves R L, Portugal C C, Lopes I M, et al. Maternal stress and vulnerability to depression: coping and maternal care strategies and its consequences on adolescent offspring[J]. Transl Psychiatry,2022,12(1):463. van Rooij S, Powers A. Maternal Stress and Vulnerability in Offspring: Hippocampal Mechanisms of Resilience[J]. Biol Psychiatry,2024,95(1):3-5. Sivasangari K, Sivamaruthi B S, Chaiyasut C, et al. Maternal stress-induced changes in adolescent and adult offspring: Neurobehavioural improvement and telomere maintenance[J]. Heliyon,2023,9(10):e20385. Lisman J, Buzsaki G, Eichenbaum H, et al. Viewpoints: how the hippocampus contributes to memory, navigation and cognition[J]. Nat Neurosci,2017,20(11):1434-1447. Jeffery K J. The Hippocampus: From Memory, to Map, to Memory Map[J]. Trends Neurosci,2018,41(2):64-66. Li Y J, Yang L P, Hou J L, et al. Prenatal Stress Impairs Postnatal Learning and Memory Development via Disturbance of the cGMP-PKG Pathway and Oxidative Phosphorylation in the Hippocampus of Rats[J]. Front Mol Neurosci,2020,13:158. Zhang H, Shang Y, Xiao X, et al. Prenatal stress-induced impairments of cognitive flexibility and bidirectional synaptic plasticity are possibly associated with autophagy in adolescent male-offspring[J]. Exp Neurol,2017,298(Pt A):68-78. Hao Y, Guo X, Wang X, et al. Maternal exposure to triclosan during lactation alters social behaviors and the hippocampal ultrastructure in adult mouse offspring[J]. Toxicol Appl Pharmacol,2022,449:116131. Popova E N. Maternal alcohol consumption before pregnancy and ultrastructure of neurons and interneuronal connections in rat offspring[J]. Int J Neurosci,1993,73(1-2):37-45. Capron L E, Glover V, Pearson R M, et al. Associations of maternal and paternal antenatal mood with offspring anxiety disorder at age 18 years[J]. J Affect Disord,2015,187:20-26. Braeken M A, Jones A, Otte R A, et al. Potential benefits of mindfulness during pregnancy on maternal autonomic nervous system function and infant development[J]. Psychophysiology,2017,54(2):279-288. Harris A, Seckl J. Glucocorticoids, prenatal stress and the programming of disease[J]. Horm Behav,2011,59(3):279-289. Van den Hove D L, Steinbusch H W, Scheepens A, et al. Prenatal stress and neonatal rat brain development[J]. Neuroscience,2006,137(1):145-155. Farajdokht F, Vatandoust S M, Hosseini L, et al. Sericin protects against acute sleep deprivation-induced memory impairment via enhancement of hippocampal synaptic protein levels and inhibition of oxidative stress and neuroinflammation in mice[J]. Brain Res Bull,2021,174:203-211. Lu B, Nagappan G, Lu Y. BDNF and synaptic plasticity, cognitive function, and dysfunction[J]. Handb Exp Pharmacol,2014,220:223-250. Edlow A G. Maternal obesity and neurodevelopmental and psychiatric disorders in offspring[J]. Prenat Diagn,2017,37(1):95-110. Li K, Shen S, Ji Y T, et al. Melatonin Augments the Effects of Fluoxetine on Depression-Like Behavior and Hippocampal BDNF-TrkB Signaling[J]. Neurosci Bull,2018,34(2):303-311. Jakaria M, Park S Y, Haque M E, et al. Neurotoxic Agent-Induced Injury in Neurodegenerative Disease Model: Focus on Involvement of Glutamate Receptors[J]. Front Mol Neurosci,2018,11:307. O'Connor D B, Thayer J F, Vedhara K. Stress and Health: A Review of Psychobiological Processes[J]. Annu Rev Psychol,2021,72:663-688. Mohammad A E, Mahdavi M, Jenani F F, et al. Metformin protects PC12 cells against oxygen-glucose deprivation/reperfusion injury[J]. Toxicol Mech Methods,2018,28(8):622-629. Gomez-Pinedo U, Galan L, Matias-Guiu J A, et al. Notch Signalling in the Hippocampus of Patients With Motor Neuron Disease[J]. Front Neurosci,2019,13:302. Pleasure S J, Collins A E, Lowenstein D H. Unique expression patterns of cell fate molecules delineate sequential stages of dentate gyrus development[J]. J Neurosci,2000,20(16):6095-6105. Ding X F, Gao X, Ding X C, et al. Postnatal dysregulation of Notch signal disrupts dendrite development of adult-born neurons in the hippocampus and contributes to memory impairment[J]. Sci Rep,2016,6:25780. Breunig J J, Silbereis J, Vaccarino F M, et al. Notch regulates cell fate and dendrite morphology of newborn neurons in the postnatal dentate gyrus[J]. Proc Natl Acad Sci U S A,2007,104(51):20558-20563. Hitoshi S, Alexson T, Tropepe V, et al. Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells[J]. Genes Dev,2002,16(7):846-858. Sood C, Justis V T, Doyle S E, et al. Notch signaling regulates neural stem cell quiescence entry and exit in Drosophila[J]. Development,2022,149(4). Sprinzak D, Blacklow S C. Biophysics of Notch Signaling[J]. Annu Rev Biophys,2021,50:157-189. Tanveer R, Gowran A, Noonan J, et al. The endocannabinoid, anandamide, augments Notch-1 signaling in cultured cortical neurons exposed to amyloid-beta and in the cortex of aged rats[J]. J Biol Chem,2012,287(41):34709-34721. Wang J, Ye Z, Zheng S, et al. Lingo-1 shRNA and Notch signaling inhibitor DAPT promote differentiation of neural stem/progenitor cells into neurons[J]. Brain Res,2016,1634:34-44. Duan W, Zhang Y P, Hou Z, et al. Novel Insights into NeuN: from Neuronal Marker to Splicing Regulator[J]. Mol Neurobiol,2016,53(3):1637-1647. Xiong L L, Tan Y X, Du RL, et al. Effect of Sutellarin on Neurogenesis in Neonatal Hypoxia-Ischemia Rat Model: Potential Mechanisms of Action[J]. Am J Chin Med,2021,49(3):677-703. Hossain M M, Belkadi A, Al-Haddad S, et al. Deltamethrin Exposure Inhibits Adult Hippocampal Neurogenesis and Causes Deficits in Learning and Memory in Mice[J]. Toxicol Sci,2020,178(2):347-357. De Luca C, Virtuoso A, Korai S A, et al. Altered Spinal Homeostasis and Maladaptive Plasticity in GFAP Null Mice Following Peripheral Nerve Injury[J]. Cells,2022,11(7). Jutapakdeegul N, Afadlal S, Polaboon N, et al. Repeated restraint stress and corticosterone injections during late pregnancy alter GAP-43 expression in the hippocampus and prefrontal cortex of rat pups[J]. Int J Dev Neurosci,2010,28(1):83-90. Korte S M. Corticosteroids in relation to fear, anxiety and psychopathology[J]. Neurosci Biobehav Rev,2001,25(2):117-142. Kott J M, Mooney-Leber S M, Shoubah F A, et al. Effectiveness of different corticosterone administration methods to elevate corticosterone serum levels, induce depressive-like behavior, and affect neurogenesis levels in female rats[J]. Neuroscience,2016,312:201-214. Liu Y, Zou G J, Tu B X, et al. Corticosterone Induced the Increase of proBDNF in Primary Hippocampal Neurons Via Endoplasmic Reticulum Stress[J]. Neurotox Res,2020,38(2):370-384. Additional Declarations The authors have declared there is NO conflict of interest to disclose Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3828353","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":267694985,"identity":"d5462f07-77f1-4c9c-b5da-eb9ae71029cf","order_by":0,"name":"Zhihong Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIie3RIQ7CMBSA4dcsKaZQuwbSG5CULEEtO8sakp5hsqqYJdOcY8mC3DKBGWAnUSgMbmKCOmSLQ/RTFf3z+lKAIPhDKyAA7zklFJD2S7BN0EkrzvQvSbTUfSJa34dhem1heVayvvfmMUHGt65hGG45sCGVzSiPuxIOyd41DqNSgMDKJsjEBFrZOJOICMhxL+uqM2z2SrBNOmPXB2nWflMIEUgPisejTTbCYxdKBxHNhf3K6vJkryLjzsRaTN+zcF8PgiAIPHwAJzk8erSrqUcAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-0012-8437","institution":"Ningxia Medical University","correspondingAuthor":true,"prefix":"","firstName":"Zhihong","middleName":"","lastName":"Liu","suffix":""},{"id":267694986,"identity":"8afb208f-122e-48ed-bfa2-fd49c5cba08d","order_by":1,"name":"Youjuan Fu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Youjuan","middleName":"","lastName":"Fu","suffix":""},{"id":267694987,"identity":"22fc59a4-7a0b-4b7e-8a8c-c72ea6b52587","order_by":2,"name":"Ting Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Liu","suffix":""},{"id":267694988,"identity":"063b186f-69a3-4923-a894-17d1106db745","order_by":3,"name":"Can Liu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Can","middleName":"","lastName":"Liu","suffix":""},{"id":267694989,"identity":"8d7186c5-787b-4dd9-9f72-003cec8d5699","order_by":4,"name":"Rui Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Wang","suffix":""},{"id":267694990,"identity":"4afaca0f-aff6-45cc-8fc5-2dfba0c11871","order_by":5,"name":"Ye Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ye","middleName":"","lastName":"Li","suffix":""},{"id":267694991,"identity":"4bad373a-ce7a-4f99-a154-40c8ea7db98b","order_by":6,"name":"Jiashu Zhu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jiashu","middleName":"","lastName":"Zhu","suffix":""},{"id":267694992,"identity":"22527032-f052-483b-b900-160a053a042e","order_by":7,"name":"Suanzhen Guan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Suanzhen","middleName":"","lastName":"Guan","suffix":""}],"badges":[],"createdAt":"2024-01-02 02:35:34","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3828353/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3828353/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49854062,"identity":"c71436ca-7593-4f90-9121-d00f40dc266a","added_by":"auto","created_at":"2024-01-19 06:48:14","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":204072,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverview of the animal experimental design in vivo.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, chronic unpredictable mild stress (CUMS) was used to establish prenatal maternal stress model for 21 days. All the female rats on the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day were measured the maternal plasma corticosterone concentration and body weight changes. At the same time, the behavioral changes were measured. by using open field test (OFT) and sucrose preference test (SPT) between prenatal control group (PC group) and prenatal stress group (PS group) . The day of birth was designated postnatal day 1 (PND 1). All offspring were reared to 21 days of weaning and separated and housed four in each cage respectively male and female offspring. After weaning, all female rats were euthanized by intraperitoneal injection of 20% urethan 6 mL/Kg. On PND28 and PND42, the plasma corticosterone level and HPA axis related hormones of offspring were measured. At the same time, the emotional function was determined using SPT and OFT on PND28 and PND42. After the behavioral test, all offspring were euthanized and collected the hippocampus analysing by pathological staining and other molecular experiment.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/8031db9cd6ec4fd121b604c1.png"},{"id":49853634,"identity":"b455347c-3def-4671-81ec-c6ed1194bda3","added_by":"auto","created_at":"2024-01-19 06:40:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":211041,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMaternal CUMS impacts maternal plasma corticosterone and emotional behavior with anxiety and depression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA: The changes of body weight between the two groups. B: The changes of plasma corticosterone concentration between PC group and PS group during chronic stress stimulation. The results of pregnant rats in the OFT were presented as C~F, which respectively displayed the horizontal movement scores, vertical movement scores, the number of faeces and cleaning between the PC group and PS group. The SPT results were showed as G~J, which respectively exhibited pure water consumption, 1% sucrose solution consumption, total fluid consumption and 1% sucrose preference percentage between the two groups. All values were represented as means ± SEM. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 versus respective PC group (repeated measures ANOVA followed by Least-Significant-Difference test). N = 8 / group.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/64962eab15c3cd3c0d839416.png"},{"id":49853631,"identity":"9ad759d2-87c5-4ae3-a6bf-c221315b1e4c","added_by":"auto","created_at":"2024-01-19 06:40:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":168339,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMaternal CUMS exposure during pregnancy induce emotional behavior deficits in infancy and adolescence offspring\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA: The movement Trajectory in the OFT of offspring. B: The exploration time in the central area of offspring on PND28 and PND42. C: The exploration distance in the central area of offspring on PND28 and PND42. D: The average speed in OFT of offspring on PND28 and PND42. The sucrose preference test results were showed as E~H, which respectively exhibited pure water consumption (ml), 1% sucrose solution consumption, total fluid consumption and 1% sucrose preference percentage between the two groups. N = 16 / group. All values were represented as means ± SEM. * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 versus respective OPC group (two independent samples \u003cem\u003et\u003c/em\u003e test).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/79bb7efacbb119ab4df5aa6d.png"},{"id":49853633,"identity":"61644e10-1e48-4652-9b27-36b556ddf00c","added_by":"auto","created_at":"2024-01-19 06:40:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1034682,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMaternal CUMS exposure damage hippocampal pathology structure by using HE staining in infancy and adolescence offspring\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA: HE microscopic image. a and b showed the results of HE staining at 400x for OPC and OPS groups on PND28 and PND42 respectively. No remarkable neuronal abnormalities in the hippocampus of OPC group were observed, while the OPS group rat showed neuropathological changes characterized by shrunken cytoplasm, irregular morphology, loose arrangement, smaller cells and increased spacing (arrowhead). B~D: Statistics of the number of pyknotic neurons in the CA1, CA3 and DG region of the hippocampus of each group (n=6 / group). * Compared with the same period OPC group, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/f3cd31163b0d0fc51d463a1a.png"},{"id":49853635,"identity":"b6cd2dc4-4149-4d70-9191-27289a732b9a","added_by":"auto","created_at":"2024-01-19 06:40:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1440538,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMaternal CUMS damage hippocampal pathology structure by using electron microscopy in infancy and adolescence offspring\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA: The ultrastructure of the neurons and synapses were observed by electron microscopy, represented the neurons of the synaptic structure at 30,000 × magnification and at 1 μ m scale. The red arrow represents PSD, a represents presynaptic membrane, and b represents postsynaptic membrane. B: The number of synapses in the CA1, CA3, and DG regions of the hippocampus. C: The width of synaptic gaps in the hippocampal CA1, CA3, and DG regions of offspring. D: The thickness of postsynaptic membrane density in the CA1, CA3, and DG regions of the hippocampus of offspring. N = 6 / group. * Compared with the same period OPC group, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/a04d383fdca7b86e1e80fb8c.png"},{"id":49853639,"identity":"0968395c-de4a-4358-aae4-fd2345ca89b8","added_by":"auto","created_at":"2024-01-19 06:40:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":339813,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMaternal CUMS exposure during pregnancy induce HPA axis related hormones, hippocampal neuronal cell apoptosis abnormal activation and synaptic plasticity reduced in infancy and adolescence offspring\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA~D: Changes of HPA axis related hormones in the plasma of PND28 and PND42 in each group, namely CRH, ACTH, GC, CORT (N = 12 / group). E~H indicated respectively the levels of Caspase3, Bcl-2, Bax and Bcl-2/Bax genes detected by q-PCR in the hippocampus of offspring (N = 4 / group). I: Electrophoresis results of apoptosis related protein expression by western blotting. J~M indicated respectively the levels of Caspase3, Bcl-2, Bax and Bcl-2/Bax proteins detected by western blotting in the hippocampus of offspring (N =3 / group). N~O: The levels of BDNF and PSD95 genes were detected by q-PCR in the hippocampus of offspring (N = 4 / group). P: Electrophoresis results of synaptic plasticity related protein expression by western blotting. J~M indicated respectively the levels of BDNF and PSD95 proteins detected by western blotting in the hippocampus of offspring (N = 3 / group). * Compared with the same period OPC group, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/4705caa7095735acffd67666.png"},{"id":49853636,"identity":"7279f152-9af3-4fd9-810d-6af949a68c79","added_by":"auto","created_at":"2024-01-19 06:40:14","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":231206,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMaternal CUMS exposure during pregnancy induce Notch signaling pathway abnormal activation and hippocampal neural stem cells abnormal differentiation in infancy and adolescence offspring\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA~D: The levels of Notch signaling pathway related genes detected by q-PCR in the hippocampus of offspring. E: Electrophoresis results of Notch signaling pathway related proteins expression by western blotting. F~I: The levels of Notch signaling pathway related protein detected by western blotting in the hippocampus of offspring. J: Electrophoresis results of neural stem cell differentiation expression by western blotting. K~L: The levels of NeuN and GFAP proteins detected by western blotting in the hippocampus of offspring . (N =3~4 / group) * Compared with the same period OPC group, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/698ad1c9f5be851d093b5262.png"},{"id":49854247,"identity":"c07bd83d-e77f-4b14-ad97-e8f4c8138127","added_by":"auto","created_at":"2024-01-19 06:56:14","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":710612,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCORT exacerbates HT22 neuronal cell damage in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA: The cell viability of HT22 cells after exposure different concentrations of CORT for 24 hours was determined by CCK8. B: The cell viability of HT22 cells after 100 μM CORT exposure for different times was determined by CCK8. C: The cell leakage rate of HT22 cells after exposure different concentrations of CORT was tested. D: The effect of different concentrations of CORT under microscope on the morphology of HT22 cells. E: Changes of HT22 cell apoptosis related genes expression after exposure 100 CORT. F:Electrophoresis results of HT22 cell apoptosis related genesby western blotting. G: Changes of HT22 cell apoptosis related proteins expression. H: Flow cytometry cell cycle detection results. I: Statistics of cell cycle detection results. * Compared with Control group, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/a90e187dc57806851420941f.png"},{"id":49854063,"identity":"fe46b9ac-0876-407a-94bd-bca74b7c7887","added_by":"auto","created_at":"2024-01-19 06:48:14","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1079451,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Notch signaling pathway promotes CORT induced synaptic plasticity damage in HT22 neuronal cells in vitro\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA: The levels of Notch signaling pathway related genes were detected by q-PCR in HT22 cells. B: Electrophoresis results of Notch signaling pathway related proteins expression were by western blotting. C: The levels of Notch signaling pathway related protein detected by western blotting in HT22 cells (N =3 / group). D: The levels of synaptic plasticity related protein expression by q-PCR in HT22 cells. E~F indicated respectively the levels of BDNF and PSD95 proteins detected by Immunofluorescence staining. G: The Fluorescence density analysis results of synaptic plasticity related proteins were measured. * Compared with the Control group, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05. # Compared with the CORT group, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/730fb19e7d25161e99702183.png"},{"id":49853640,"identity":"b3f65a2d-327e-4238-bc15-7a4a31478d44","added_by":"auto","created_at":"2024-01-19 06:40:14","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":333180,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIllustration of the hypothetical mechanism of Maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/bcfa75d615cdfb03a62ef4c8.png"},{"id":68911893,"identity":"01fa7f90-ea4f-41c6-99d6-5dd15a70a9a9","added_by":"auto","created_at":"2024-11-13 11:55:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7534492,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3828353/v1/7a22bc7a-9d89-406b-a22e-1cb6ddae48d9.pdf"}],"financialInterests":"The authors have declared there is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose","formattedTitle":"Maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePregnancy is accompanied by a physiologic, mental and emotional changes. Therefore, women are highly susceptible to psychological distress, including anxiety, depression, and stress\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. A large-scale community study showed that about 30% of pregnant women face a variety of stresses associated with psychological stress during pregnancy\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. Exposure to these stresses during pregnancy not only causes negative emotions such as anxiety, stress and depression, but also alters the intrauterine environment. In this complex and dynamic stage of change, fetal organs and the emerging organ system are positively and negatively affected, also known as fetal programming\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. The formulation of this theory has prompted scholars at home and abroad to pay more attention to perinatal maternal and child health. Previous studies have shown that maternal stress during pregnancy affects 10\u0026ndash;35% of children worldwide and is recognized as a major global public health problem currently affecting maternal and child health\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe emerging Developmental Origins of Health and Disease (DOHaD) hypothesis reveals that adverse factors in the early stages of development, especially changes in the intrauterine environment, can permanently affect on the development of neurodevelopmental and psychiatric disorders in the offspring\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. Nature states that the critical period for brain development is between 17 weeks and 3 years of age after conception, with an increase in brain volume of about 70%\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e, which is medically recognized as the critical period for brain development\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. During the critical period of brain development, whether it is due to negative physiological, psychological, or social factors of the mother\u003csup\u003e[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e, or factors such as genetics, nutrition, and environment of the fetus\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e, it may cause abnormalities in brain structure or function. Abnormal neurobehavioral development is the most common brain injury. These early neural developmental damages are early warning signs of mental health problems during growth. Assuming that if we can take precautionary measures in the early stage of the emergence of children's mental health problems, pay more attention to the period of neurodevelopmental vulnerability, which can be the direction of development of the prevention of neurodevelopmental damage.\u003c/p\u003e \u003cp\u003eMaternal stress during pregnancy is considered a teratogen, and exposure to excessive stress during pregnancy has a negative impact on the growth and development of offspring. A number of epidemiological and case-control studies in different regions show that maternal stress has an impact on the neural development, cognitive development, emotions, temperament, and mental illness of offspring, such as leading to intellectual development disorders, low language ability, delayed mental and psychological development\u003csup\u003e[\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Worst of all, these harmful effects can even continue until adulthood of offspring\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. It is evident that chronic stress exposure during pregnancy can have long-term effects on the behavioral development of the offspring.\u003c/p\u003e \u003cp\u003ePrenatal stress releases excess glucocorticoids that affect many aspects of fetal biology, from placental biology to Hypothalamus-Hypophysis-Adrenal (HPA) axis programming, neurodevelopment and epigenetic landscape\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Our research also found that chronic stress during pregnancy activates the maternal HPA axis releasing excessive corticosterone, which passing through the placental barrier, and ultimately caused anxiety and depression like behavioral changes in offspring rats\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Previous studies had shown that the mechanisms of the effects of maternal stress on the neurobehavioral development of offspring have been studied through rodent experiments, mainly focus on affecting neuronal and synaptic development, including the limbic system (hippocampus, amygdala) and prefrontal cortex\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Maternal stress exposure alters the excitation-inhibition balance of hippocampal or cortical neurons, resulting in damage to hippocampal neural stem cells in the offspring\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. The current research cannot accurately explain the mechanisms of maternal chronic stress exposure by which way caused the structure, function, and behavioral development disorder of offspring.\u003c/p\u003e \u003cp\u003eIn the nervous system, the Notch signaling pathway is involved in the entire life cycle from embryonic development to birth to death, and mainly regulates neural stem cell proliferation and differentiation, axon and dendritic growth, synaptic plasticity, neuronal damage repair, and neuronal death\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Notch signaling pathway is mainly composed of Notch receptors, Notch ligands and intracellular effector molecules, among which there are four highly homologous Notch receptors (Notch1\u0026thinsp;~\u0026thinsp;Notch4), including extracellular, transmembrane and intracellular regions (NICD). In adjacent cells, Notch ligand binds to its receptor, and under the action of γ-secretase, the transmembrane region protein of Notch receptor is sheared, and the NICD is released from the inner side of the cell membrane and binds to the transcription factor CSL complex in the nucleus, which activates the transcription of downstream specific Notch target genes, such as Hes, Hey, cMyc, cyclin D1 and other genes that control cell proliferation, differentiation and apoptosis\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. It has recently been found that NSCs in embryos express Notch receptors and active signaling is evident based on the expression of the canonical Notch target Hes5 \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e, and Notch regulates neurogenesis in the DG area of the adult hippocampus in adult\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Numerous animal studies confirmed that the expression level of Notch1 is downregulated in the hippocampus of mice with chronic unpredictable mild stress\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e and rats with post-stroke depression\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. In addition, the Notch1 signaling pathway is also involved in the behavioral changes of middle-aged female rats after chronic restraint stress\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. The mechanism of these changes may be related with Notch1 mediated neural plasticity. In our previous study, iTRAQ proteomics technology was used to screen for differentially expressed proteins and signaling pathways in the hippocampus of offspring. KEGG enrichment analysis revealed abnormal expression of the Notch signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Based on the above findings, we deduce that maternal stress may induce emotional dysfunction in offspring, which may be related to abnormal differentiation of hippocampal neural stem cells mediated by the Notch signaling pathway.\u003c/p\u003e \u003cp\u003eHerein, we firstly investigate whether maternal stress exposure during pregnancy can induce abnormal differentiation of hippocampal neural stem cells and emotional disorders in offspring rats. Subsequently, we detected changes in the expression of key genes and proteins in the Notch signaling pathway. Finally, we further explore the role and mechanism of Notch signaling pathway in neuronal cell damage after high corticosterone exposure in vitro.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eSucrose was from Tianjin Kermel Chemical Reagent Co., Ltd. CORT (HY-B1618).and DAPT (HY-13027) were from Medchem Express (MCE). \u003csup\u003e131\u003c/sup\u003eI cortisol radioimmunoassay (RIA) kit was provided from Beijing North Institute of Biotechnology. CRH (JL12541), ACTH (JL44439) and GC (JL27073) were from Shanghai Jianglai Biotechnology Co., Ltd. Primary antibody against BDNF (ab108319), Bax(ab32503), GFAP (ab4648) were from Abcam (Cambridge, MA). Primary antibody against Caspase3 (9662), Bcl2 (4223), Notch1 (3608), Notch2 (4530), Hes1 (11988) and NICD (4147) were from Cell Signaling Technology (Beverley, MA). Primary antibody against PSD95 (AF7839) was from Affinity Biosciences Technology. NeuN (26975-1-AP) and β-Actin (81115-1-RR) was from Proteintech (Chicago, USA). HRP-labeled goat anti-rabbit IgG (A23620) was provided from Abbkine.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003e18 female adult Sprague Dawley (SD) rats [specific-pathogen-free grade, weight, (220\u0026thinsp;\u0026plusmn;\u0026thinsp;20) g] and 9 SD male rats [specific-pathogen-free grade, weight, (280\u0026thinsp;\u0026plusmn;\u0026thinsp;20) g] were obtained from the Animal Laboratory Center of Ningxia Medical University [experimental animal certificate number: SCXK (Ning) 2015\u0026ndash;0001]. All rats were raised under strictly controlled conditions (humidity of 50%\u0026minus;60%, temperature of (21\u0026thinsp;\u0026plusmn;\u0026thinsp;1) ℃, light/dark alternate for 12 h) and had free access to food and water. After a week of acclimatization, eighteen female rats were randomly divided into the prenatal control group (PC group) and prenatal stress model group (PS group) (n\u0026thinsp;=\u0026thinsp;9 per group). All animal experimental operations were reviewed and approved by the Laboratory Animal Ethical and Welfare Committees for Laboratory Animal Center of Ningxia Medical University (Approval No. IACUC-NYLAC-2021-121).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and treatment\u003c/h2\u003e \u003cp\u003eHT22 mouse hippocampal neuronal cell line was purchased from Yipu Biotechnology Co., Ltd, Wuhan China. HT22 cells were cultured with DMEM/high glucose medium (Biological Industries, Israel) mixed with 10% fetal bovine serum (Biological Industries, Israel) in a 37 ℃ incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. To establish hippocampal neuronal injury model in vitro, HT22 cells were administrated with high concentration CORT, commonly used to simulate neuronal damage caused by elevated glucocorticoids in the body under external stress. To determine the optimal concentration for the in vitro model of CORT induced HT22 cell injury, different concentrations of CORT (0 \u0026micro;M, 25 \u0026micro;M, 50 \u0026micro;M, 100 \u0026micro;M, 200 \u0026micro;M, 400 \u0026micro;M) were used to treat HT22 cells. By observing the survival rate, LDH leakage rate and cell morphology changes, the optimal concentration was determined to use 100 \u0026micro;M CORT for 24 h. To further investigate whether the Notch signaling pathway is involved in neuronal damage caused by CORT exposure, γ-secretase inhibitor DAPT (10 \u0026micro;M) was applied to observe Notch signaling pathway and synaptic plasticity in vitro. The experiment was divided into 5 groups: Control group, DMSO group, CORT group, DAPT group and DAPT\u0026thinsp;+\u0026thinsp;CORT group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMaternal CUMS model\u003c/h2\u003e \u003cp\u003eThe CUMS procedures were based on the Willner\u0026lsquo;s\u0026rsquo; previously described method of with minor amendments and supplements\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. The female rats of PS group were randomly exposed to the ten stressors, with 1\u0026thinsp;~\u0026thinsp;2 stressors at 10:00\u0026ndash;13:00 lasting for 21 days. The whole experimental process was shown in the Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. During the third day of CUMS stimulation, two female rats were mated with a male rat (2:1) in one cage overnight. Next morning, the female rats found the vaginal walls of sperm positivity, regarded as gestational day 0 (GD 0). The female rats were raised to the original environment. If the female rat fails to conceive were not pregnant within 4 days, it will be euthanized. PC rats were housed 2 every cage (1 per cage after 18 days of gestation), while PS rats were housed individually (1 per cage). When the rats were mating, the PS group didn\u0026rsquo;t suspend stress of CUMS every day.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCUMS model procedure\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWeek\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMonday\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehumid environment (60\u0026ndash;70% humidity, 24 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003ecrowded environment\u003c/p\u003e \u003cp\u003e(10 rats in each cage), forced squeezing tail (2 min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e42℃ hot stress (5 min)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTuesday\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ebehavioral restriction (1 h), forced squeezing tail (2 min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFood deprivation (12 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eshaking stress (one time per second, 30 min)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWednesday\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecrowded environment (10 rats in each cage), tilted cage 30\u003csup\u003e◦\u003c/sup\u003e (24 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ehumid environment (60\u0026ndash;70% humidity, 24 h), 42℃ hot stress (5 min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003ecrowded environment\u003c/p\u003e \u003cp\u003e(10 rats in each cage), humid environment (60\u0026ndash;70% humidity, 24 h)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eThursday\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eshaking stress (one time per second, 30 min), food\u003c/p\u003e \u003cp\u003edeprivation (12 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eshaking stress (one time per second, 30 min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003ebehavioral restriction (1 h), food deprivation (12 h)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFriday\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ebehavioral restriction (1 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ebehavioral restriction (1 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e4℃water swimming (5 min)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSaturday\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etilted cage 30\u003csup\u003e◦\u003c/sup\u003e (24 h), water deprivation (12 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4℃water swimming (5 min), water deprivation (12 h)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e42℃ hot stress (5 min), water deprivation (12 h)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSunday\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e42℃ hot stress (5 min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforced squeezing tail (2 min)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eforced squeezing tail (2 min)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eMaternal evaluation\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003eMaternal plasma corticosterone\u003c/h2\u003e \u003cp\u003eTo explore whether the CUMS female model successfully established, the plasma corticosterone content, body weight and behavioral experiments were measured on the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress. Blood (1 mL) from inner canthus vein were collected from all the female rats and body weight were measured on the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress. Blood samples were centrifuged for 12, 000\u0026times;\u003cem\u003eg\u003c/em\u003e for 5 min at 4 ℃, and the obtained plasma was used to measure the corticosterone by \u003csup\u003e131\u003c/sup\u003eI cortisol radioimmunoassay (RIA) kit according to the provided instructions of the manufacturing kit. The plasma corticosterone levels were determined from the measured cortisol content by the following conversion formula: Corticosterone concentration\u0026thinsp;=\u0026thinsp;Cortisol concentration\u0026times; 50\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMaternal behavior assessment\u003c/h2\u003e \u003cp\u003eOn the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress at 8:00\u0026ndash;12:00 am (N\u0026thinsp;=\u0026thinsp;8 / group) was conducted open field test (OFT) and sucrose preference test (SPT) to observe the behavior changes of maternal female rats. OFT was observed following the standard protocol as previously described\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. The horizontal and vertical movement scores of rats were recorded within 5 minutes and used 75% alcohol to clean the open field thoroughly. SPT was performed to mainly reflect the lack of pleasure in experimental animals\u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Before the test, female rats were trained to adapt to drinking the sucrose water. During the formal experiment, food and water restriction for 12 h before the test. One bottle of 1% sucrose water and the other bottle of pure water were given to each cage at the same time. After free drinking for 1 h, the two bottles were removed and measured. The pure water consumption, sucrose water consumption, total fluid consumption and 1% sucrose preference (1% sucrose preference percentage\u0026thinsp;=\u0026thinsp;sugar water consumption/total fluid consumption x 100%) were calculated. The whole experimental process was shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eOffspring evaluation\u003c/h2\u003e \u003cp\u003eThe day of birth was designated postnatal day 1 (PND 1). All offspring rats were weaned on PND 21. At least two female and male offspring were randomly selected from per female rat, 32 offspring rats of PC group (OPC, N\u0026thinsp;=\u0026thinsp;32, n \u003csub\u003emale\u003c/sub\u003e =16, n \u003csub\u003efemale\u003c/sub\u003e =16) and 32 offspring rats of PS group (OPS, N\u0026thinsp;=\u0026thinsp;32, n \u003csub\u003emale\u003c/sub\u003e=16, n \u003csub\u003efemale\u003c/sub\u003e=16. All male and female offspring were separated and housed four in each cage respectively with ad libitum food/water.\u003c/p\u003e \u003cp\u003eThe emotional behavior was determined by SPT and OFT. Offspring rats were subjected to OFT and SPT on PND28 and PND42, respectively. The SPT concrete protocol was the same as the female rats. The OFT of offspring rats was different from that of female rats. The open field box was 50 cm in length, width and height. The offspring were recorded 5 minutes in the open field. The smart 3.0 system captured video, recorded and analyzed the time of entering the central area, the distance across the central area, and the average speed of movement. Each rat recorded 5 minutes.\u003c/p\u003e \u003cp\u003eAfter the emotional behavior test, the offspring rats were euthanized with injected 20% urethan (6 ml/Kg) on PND28 and PND42. After anesthesia, the plasma of offspring rats was collected into 5 mL anticoagulant blood collection vessels by apical blood collection. After standing at room temperature for 1 h, 12, 000 \u0026times; \u003cem\u003eg\u003c/em\u003e centrifugation for 10 min, the plasma from the upper was collected. The brain was immediately stripped on ice. The right hippocampus was placed in liquid nitrogen, and then moved to \u0026minus;\u0026thinsp;80 ℃ for molecular biological analysis. The left hippocampus was fixed with 4% paraformaldehyde, and the changes of hippocampal CA1, CA3 and DG were observed by microscope. The left hippocampus was fixed with 2% glutaraldehyde for 2 hours, and the changes of neuron cells and synapses were observed under electron microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin eosin (HE) staining\u003c/h2\u003e \u003cp\u003eThe fixed left hippocampus were trimmed, dehydrated in gradient alcohol, transparent in xylene and then paraffin embedded, the thickness of the section was 5 \u0026micro;m, dried at 37 ℃ and dewaxed in xylene. Then, two slides were selected from each sample and were stained. Gradient alcohol dehydration, preparation for hematoxylin and eosin (HE) staining, hematoxylin staining for 3 min, ethanol fractionation with hydrochloric acid for 10 seconds, eosin staining for 3 min, conventional dehydration, transparency, blocking and light microscopy to observe the CA1, CA3 and DG area of hippocampal. The morphology and structure of normal and abnormal neuronal cells in the hippocampal CA1, CA3 and DG region of each slide were investigated under a light microscope (Leica, Germany) at 400 \u0026times; magnification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eElectron microscopy\u003c/h2\u003e \u003cp\u003eTransmission electron microscope images were prepared by the Electron Microscope Center. Tissue pieces of the hippocampus were fixed with 2% glutaraldehyde for 2 h and washed three times with 0.1 M phosphate-buffered saline (PBS) for 10 min each time. After rinsing, the samples were placed into 1% osmium acid fixative solution and fixed again for 2 h. Then, the samples were rinsed with 0.1 M PBS for 15 min each time. The tissues were dehydrated with graded alcohol series (30, 50,70%, 80%, and 90%), and 100% alcohol and propylene oxide were used to dehydrate 15 min twice. And the embedded in a mixture of propylene oxide and acetone (1:1), propylene oxide resin and acetone (2:1), and pure propylene oxide, respectively, and placed overnight at room temperature. Then, these were sliced into serial coronal 50\u0026thinsp;~\u0026thinsp;60 nm thick sections using an ultra- thin slicing machine and dyed in saturated uranium dioxide acetate solution for 20 min. After rinsing and drying, the sections were observed and photographed by transmission electron microscopy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assays (ELISA)\u003c/h2\u003e \u003cp\u003eOn PND28 and PND42, the plasma CORT concentration of offspring was measured using the same method as that of female rats. At the same time, the corticotropin releasing hormone (CRH), adrenocorticotropic hormone (ACTH), and glucocorticoid (GC) in the plasma of offspring were determined using an enzyme-linked immunosorbent assay kit. Finally, the concentrations were calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IFC)\u003c/h2\u003e \u003cp\u003eThe expression of BDNF and PSD95 synaptic proteins in HT22 cell was detected by IFC staining. HT22 cells were seeded with 1000 cells per well in cell crawling, cultured for 12 hours, and treated with different experimental groups. The cells were incubated for 24 hours at 37 ℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e conditions, and then were perfused with 4% paraformaldehyde (PFA) 30 min. For IFC staining, the cell crawling was washed 3 times with PBS and incubated with 0.3% Triton for 5 min, blocked with BSA (3%) for 1 h at room temperature. The slides were incubated overnight at 4\u0026deg;C with 100 \u0026micro;L corresponding primary antibody for BDNF and PSD95 (1:100). On the next day, the slides were recovered at room temperature for 1h and washed with PBST 5 min for 3 times. The slides were incubating with the Alexa Fluor\u0026trade; Plus 488-conjugated goat anti-rabbit antibody (1:100) at room temperature 1h. The slides were washed with PBST for 3 times and stained with DAPI (Servicebio, Wuhan, China, G1012) for 6 min. The results were observed and photographed using a Nikon fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative RT-PCR\u003c/h2\u003e \u003cp\u003eTotal RNAs of HT22 cells and offspring rat hippocampus were extracted using RNA simple Extraction Kit (Tiangen Biochemical Technology, Beijing, DP419) and were transformed into cDNA by using PrimeScriptTM RT Reagent Kit (Tiangen Biochemical Technology, Beijing, RR037A). Next, the RNA was reverse transcribed into cDNA and fluorescence quantification was performed using the CFX 96 PCR detection system. The operating steps were performed according to TB Green \u0026reg; Premium Ex Taq\u0026trade; (Tiangen Biochemical Technology, Beijing, RR420A). Finally, the target mRNA levels were obtained through comparative CT method. The primer sequences used for amplifying the indicated genes are listed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for real-time RT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eforward primer sequences (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse primer sequences (3'\u0026rarr;5')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACATGCCGCCTGGAGAAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCCCAGGATGCCCTTTAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBDNF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAACTCGCAATGCCGAACTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTTATGAACCGCCAGCCAATTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePSD95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCAGTCTGTGCGAGAGGTAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGACGGATGAAGATGGCGATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGGTTTCGCTTGGGAGAGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGGAGGCAGACACCTGATGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBcl-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAGGAACTCTTCAGGGATGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACAGAGCGATGTTGTCCACCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBax\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTTGTTATCGTGAGTGCTGCTGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGCATTCTGTAGGAACCGCTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNotch1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAGCAAGAAGAAGCGGAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACTCGTTCTGATTGTCGTCCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNotch2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTCTGATCCGCAACCGAGTAACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCTGCCACCATTCCTTCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHes1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTAACGCAGTGTCGCCTTCCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAGAGGTGGGCTAGGGAGTTTATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNICD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCTGCCTCTGCTGCTGTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTCTCCGCTTTACTCACCAGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eWestern blotting was used to determine the expression content of synaptic plasticity related proteins, neuron apoptosis and differentiation proteins, and Notch signal proteins in the hippocampus of the offspring and HT22 cells. The total protein of hippocampal and HT22 cells was quantified using a bicinchonini acid (BCA) test (KeyGEN BioTECH, China). Each hippocampus added into 700 \u0026micro;L and each tissue culture dish was added into 300 \u0026micro;L cold lysis buffer and homogenized. The centrifuge tube was centrifuged at 12,000 x \u003cem\u003eg\u003c/em\u003e for 5 min, then the BCA method was used for protein concentration detection. After added 200 \u0026micro;L BCA working solution and a total volume of 20 \u0026micro;L to each well and mixed thoroughly. The 96 well plate was incubated at 37 ℃ for 30 min, and the absorbance value was measured at 562 nm. Total hippocampal extracts (50 \u0026micro;g) and HT22 cell extracts (10 \u0026micro;g) were electrophoresed using 10% Tris-glycine sodium dodecyl sulfate polyacrylamide gels. Then, the gels were transferred to PVDF membranes and blocked using 5% skimmed milk powder at room temperature for 1 h. The primary rabbit antibodies BDNF, Bax, Caspase3, GFAP, Bcl2, Notch1, Notch2, Hes1 and NICD diluted 1:1000 were added, and PSD95 and NeuN were diluted 1:800. The primary rabbit antibody of β-actin was diluted 1:3000. And then the bands were incubated with primary antibody overnight at 4℃, rinsed 3 times with TBST. Primary antibodies were visualized with HRP-conjugated anti-rabbit IgG (1:5000) at room temperature for 1 h and rinsed 3 times with TBST. The luminescent solution was developed and placed in a chemiluminescent instrument for detection and photography, and the target protein bands were analysed by using Image J. Finally, the density value ratio of protein and β-actin were calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe analysis of the experimental date was performed by using the Statistical Package for the Social Sciences 23.0, and all graphs were constructed in GraphPad Prism 7.0. All data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Repeated measures ANOVA and correlation analysis were used to analyze the differences of plasma corticosterone levels between the PC and PS group. Two independent sample t-tests were used to compare the statistical differences. The comparison of data indicators between multiple groups was conducted using one-way analysis of variance, and further comparison between two groups is conducted using LSD test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eMaternal CUMS impacts maternal plasma corticosterone and emotional behavior with anxiety and depression\u003c/h2\u003e \u003cp\u003eTo determine whether maternal CUMS model was successfully established, we firstly investigated the effects of maternal weight and plasma corticosterone. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the female rats in the two groups had similar body weights before exposure to stress. However, in the late stages of stress, the females in the PS group were lower than those of PC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, on the 7th and 14th day of stress, the plasma corticosterone levels in PS group were significantly higher than those in PC group during the same period (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), which proved the CUMS model was established successfully. To further observe changes in maternal emotional behavior, open field test and sucrose preference test were conducted. For the OFT results (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u0026thinsp;~\u0026thinsp;F), the repeated measures ANOVA displayed that maternal stress played a significant impact on both horizontal movement scores (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and vertical movement scores (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). An interaction was found between stimulation time and group(\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05)in term of horizontal movement scores. On the 14th and 21st day of stress, the horizontal movement scores and vertical movement scores in PS group were significantly lower than those in PC group during the same period. These results suggested prenatal stress reduced animal activity and curiosity about the novel environment. The repeated measurement analysis of variance showed that chronic stress had a significant impact on pure water consumption (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG), 1% sucrose consumption (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH), total fluid consumption (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI) and 1% sucrose preference percentage (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ), and those values in the PS rats were significantly less than those in the PC rats (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results suggested that stress stimulation during pregnancy reduced the ability of rats to respond to happy events.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eMaternal CUMS exposure during pregnancy induce emotional behavior deficits in childhood and adolescence offspring\u003c/h2\u003e \u003cp\u003eBy conducting OFT experiments to observe the changes in motor ability of offspring on PND28 and PND42, representing juvenile and adolescent stages respectively, and the impact of chronic stress during pregnancy on offspring motor ability and anxiety like behavior can be evaluated. After analysis, the exploration time and distance in the central area of the OPS group on PND 28 were significantly reduced compared to the OPC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB\u0026thinsp;~\u0026thinsp;C), while on PND 42, the exploration time and distance in the central area of the OPS group were not significantly changed compared to the OPC group. This suggests that chronic stress during pregnancy can increase the fear and anxiety like behavior on PND28 towards the open environment in the central area, while having no effect on PND42. In addition, the average motor speed of the OPS group decreased at PND28 and PND42 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). The above results indicate that chronic stress during pregnancy can reduce the motor ability of offspring in both juvenile and adolescent rats, and increase anxiety behavior in juvenile rats. In addition, this study detected the depressive like behavior of pleasure loss in offspring on PND28 and PND42 through SPT. Through statistical analysis, it was found that the sucrose consumption, total liquid consumption, and 1% sucrose preference percentage of the OPS group decreased at PND28 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF\u0026thinsp;~\u0026thinsp;H), and there was also a downward trend in sucrose consumption and 1% sucrose preference percentage at PND42. In addition, the pure water consumption of OPS group was higher than that of OPC group at PND28 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE), and also showed an increasing trend at PND42 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). From all above results, it can be concluded that chronic stress during pregnancy can cause depressive like behavior with loss of pleasure at different age groups in offspring.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eMaternal CUMS damage hippocampal pathology structure and synaptic structure plasticity in childhood and adolescence offspring\u003c/h2\u003e \u003cp\u003eIn HE staining, the nuclei of normal neurons are circular and centered, with clear and orderly cell layers and uniform cytoplasmic staining. When neuronal cells are damaged, the most obvious manifestation is nuclear pyknosis and irregular cells. The nuclear pyknotic neurons in the CA1, CA3, and DG regions of the hippocampus were uneven cytoplasmic staining and less clear cellular hierarchical structure in OPS group on PND28. The morphology was irregular, the cell body became smaller and the spacing increased, and some cells showed vacuolar like changes. At PND42, the nuclei of neurons in the CA1, CA3, and DG regions of the OPS group rats were spindle shaped, and the cytoplasm became lighter in staining, with significant vacuolar like changes. The staining results were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, which showed the number of pyknotic neurons in different hippocampal subregions of each group of both PND28 and PND42 shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-D. The number of pyknotic neurons in the OPS group was higher than that in the OPC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The above experimental results indicate that chronic stress during pregnancy in female rats can aggravate the damage to neuronal cells in various hippocampal regions of offspring rats, and this damage will worsen with age in the CA1 region.\u003c/p\u003e \u003cp\u003eThe synapses of neurons in the hippocampus are the basic structure of the brain for learning memory, and many basic experiments have shown that synaptic structural plasticity is manifested by changes in the number of synapses, dendritic spine density, average area, gap distance, postsynaptic dense matter, synaptic interface curvature and the formation of new synapses\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. In order to further observe the effects of chronic stress during pregnancy on synaptic plasticity in the cerebral hippocampus of offspring, we observed the changes of synaptic structural plasticity in offspring rats by electron microscopy, counting the number of synapses, thickness of postsynaptic membrane density, and width of synaptic gaps. At PND28 and PND42, the synaptic boundaries in different regions of the hippocampus of OPC group were clear, with complete contours and dense and uniform distribution of round synaptic vesicles on the presynaptic membrane. The presynaptic membrane of the hippocampal CA1 and CA3 regions in the OPS group was unclear, the distribution area of synaptic vesicles was reduced, and the synaptic space was blurred. Statistical analysis was conducted on the number of synapses, synaptic gap width, and postsynaptic membrane density thickness in different hippocampal regions of offspring. The results showed that the synaptic gap in the hippocampal CA3 region of offspring in the OPS group was narrower than that in the OPC group at PND28 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the postsynaptic density in the hippocampal CA1, CA3, and DG regions of offspring in the OPS group was thicker than that in the OPC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Compared with the OPC group on PND42, the number of synapses in the hippocampal CA1 and CA3 regions of the OPS group decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), the synaptic gap in the CA1 region widened (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the postsynaptic dense matter in the CA1 and DG regions thickened (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were administered. The results indicate that chronic stress during pregnancy in female rats can cause changes in the number and structure of synapses in different hippocampal regions of offspring rats, ultimately leading to neuronal damage.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMaternal CUMS exposure during pregnancy induce HPA axis related hormones and hippocampal neuronal cell apoptosis abnormal activation and synaptic plasticity reduced in childhood and adolescence offspring\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo further understand the impact of maternal stress during pregnancy on the HPA axis in offspring, we detected changes in hormone content in the plasma of offspring using ELISA. The results showed that the CRH content in the OPS group was higher than that in the OPC group at PND28 and PND42 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, suggesting that chronic stress during pregnancy may cause an increase in CRH content in offspring at different stages. The change in ACTH content is consistent with the change in CRH (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Excessive ACTH can stimulate the adrenal cortex to secrete glucocorticoids. After an increase in GC content, it is regulated by negative feedback through glucocorticoid receptors, inhibiting the activity of the HPA axis to restore glucocorticoid levels. After measuring the GC content using ELISA, it was found that the GC content in the OPS group as higher than that in the OPC group at PND28 and PND42 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), consistent with the changes in CORT (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003eTo further investigate the effect of chronic stress during pregnancy on apoptosis of hippocampal neurons in offspring, this study measured the expression levels of apoptosis related genes and proteins in hippocampal neurons of offspring on PND28 and PND42. The q-PCR results showed that the expression of Caspase-3 and Bax mRNA in the hippocampus of the OPS group increased compared to the OPC group at PND28 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.E\u0026thinsp;~\u0026thinsp;H), while the expression of Bcl-2 and Bcl-2/Bax mRNA decreased. The same trend of change was also observed on PND42 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The expression of Caspase-3 and Bax proteins in the hippocampus of the OPS group was higher than that of the OPC group at PND28 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.K\u0026thinsp;~\u0026thinsp;M), while the expression of Bcl-2 and Bcl-2/Bax proteins was lower (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). At PND42, only a decrease in Bcl-2/Bax protein expression was found (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the protein changes in the hippocampus of the offspring were basically consistent with the gene expression trend at the same period. From the above results, it can be concluded that maternal chronic stress during pregnancy can induce increased apoptosis in hippocampal neurons of offspring at different ages.\u003c/p\u003e \u003cp\u003eTo detect whether the synaptic plasticity changes, BDNF and PSD95 genes and proteins expression levels were detected by q-PCR and Western blotting. After analysis, it was found that the mRNA levels of BDNF and PSD95 in the hippocampus of the OPS group were lower than those in the OPC group at PND28 and PND42 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.N\u0026thinsp;~\u0026thinsp;O), and the changes in protein expression levels were consistent with the changes in gene expression (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.Q\u0026thinsp;~\u0026thinsp;R). The all above results suggest that chronic stress during pregnancy can cause abnormal expression of synaptic plasticity related proteins in offspring of different ages, ultimately leading to cognitive impairment in offspring.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMaternal CUMS exposure during pregnancy induce Notch signaling pathway abnormal activation and hippocampal neural stem cells abnormal differentiation in childhood and adolescence offspring\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBased on the results of previous proteomic testing, we focused on observing the changes in the Notch signaling pathway that played a crucial role in embryonic and adult neurogenesis. The q-PCR results showed that the mRNA expression of Hes1, Notch1, NICD, and Notch2 in the hippocampus of OPS group rats was higher than that of OPC group at PND28, (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u0026thinsp;~\u0026thinsp;D). At PND42, only increased mRNA expression of Notch1, NICD, and Notch2 was found (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The trend of protein expression changes were consistent with gene expression (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF\u0026thinsp;~\u0026thinsp;I). The Notch signaling pathway is involved in the neurogenesis process of immature neurons. After a series of processes such as proliferation and differentiation, neurons differentiate into mature neuronal cells and glial cells. Among them, neuronal nuclei (NeuN) is a specific marker for mature neurons, while glial fibrillary acidic protein (GFAP) is a specific marker for astrocytes. Western Blotting was used to detect the protein expression of GFAP and NeuN in the hippocampal of offspring on PND28 and PND42. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eK\u0026thinsp;~\u0026thinsp;L, the expression of NeuN protein in the hippocampus of the OPS group decreased compared to the OPC group at PND28 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while the expression of GFAP protein increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). At PND42, only a decrease in NeuN protein expression level was observed (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The above results suggest that chronic stress during pregnancy in female can reduce neuronal differentiation and promote astrocyte proliferation. This abnormal neuronal differentiation may be related with abnormal activation of the Notch signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eCORT exacerbates HT22 neuronal cell damage in vitro\u003c/h2\u003e \u003cp\u003eIn order to further verify the effects of chronic stress hormone (CORT) on HT22 neuronal cells in vitro models, this study selected HT22 cell lines for relevant experiments. Observing the effect of CORT on the activity of HT22 cells for 24 hours, CCK8 results showed that it was compared with the 0 \u0026micro;M CORT group, the survival rate of HT22 cells decreased with increasing CORT concentration (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and the cell survival rate of 100 \u0026micro;M CORT intervention was (57.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.76)% (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Simultaneously, 100 \u0026micro;M CORT treating HT22 cells with for different times, the results showed that the cell survival rate significantly decreased after 24 hours of treatment (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). According to the CCK8 experiment, the conditions for establishing a CORT induced HT22 cell injury model may be a CORT concentration of 100 \u0026micro;M. To further determine the optimal concentration of CORT induced HT22 cell injury in vitro model, HT22 cells were treated with different concentrations of CORT for 24 hours in subsequent experiments. LDH leakage rate and cell morphology changes were comprehensively evaluated. Compared with the 0 \u0026micro;M CORT group, the leakage rate of LDH in HT22 cells at 100 \u0026micro;M CORT began to increase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Under an optical microscope, it was observed that the number of HT22 cells was decreased, the cells changed from plump to wrinkled, the synaptic shape shortened and became thinner, and no tight network structure was formed at 100 \u0026micro;M CORT intervention for 24 hours.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn order to further observe the effect of CORT exposure on apoptosis of hippocampal neurons HT22 cells, q-PCR and Western Blotting were used to detect the changes of apoptosis related genes and proteins in HT22 cells. At the genetic level, we found that the expression of apoptosis related genes Caspase3 and Bax significantly increased after CORT intervention (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG), while the expression levels of Bcl-2 and Bcl-2/Bax decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). At the protein level, the expression levels of Bcl-2 and Bcl-2/Bax were consistent with the gene level changes (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The above results suggest that CORT exposure can increase apoptosis of hippocampal neurons. We also investigated the effect of CORT on the proliferation ability of HT22 cells, and flow cytometry was used to detect changes in cell cycle. It was found that compared with the Control group, the percentage of HT22 cells in the CORT group increased in the G1 phase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eI), while the percentage decreased in the S phase (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The above results indicate that CORT exposure causes cell arrest in G1 phase and decrease in S phase during the proliferation of HT22 cells, ultimately leading to cell damage.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe Notch signaling pathway promotes CORT induced synaptic plasticity damage in HT22 neuronal cells in vitro\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn vivo studies, we have found that maternal chronic stress during pregnancy can activate the Notch signaling pathway. To explore the molecular mechanisms of the Notch signaling pathway in CORT induced proliferation, differentiation, and synaptic formation of HT22 cells, this study mainly examined the changes in key components of the Notch signaling pathway (Hes1, Notch1, Notch2, and NICD) at the gene and protein levels. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA and C, CORT significantly activated the Notch signaling pathway, which found that the expression of Hes1, Notch1, Notch2, and NICD mRNA were increased in CORT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The protein expression trend was consistent with the mRNA expression trend. Meanwhile, the expression levels of BDNF and PSD95 mRNA decreased compared to the Control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but only the expression of the PSD95 protein decreased in the CORT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In order to further explore the role of the Notch signaling pathway in neuronal damage caused by CORT exposure, we selected the Notch signaling pathway inhibitor 10 \u0026micro;M DAPT to inhibite the Notch signaling pathway in vitro model to observed the synaptic plasticity changes of HT22 neuronal cells. As expected, it was found that DAPT intervention significantly inhibited the expression of the Notch signaling pathway key genes Hes1, Notch1, Notch2, and NICD mRNA and proteins levels (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Furthermore, DAPT markedly reversed the changes in synaptic related genes and proteins in CORT group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). To sum up, our results indicate that maternal chronic unpredictable mild stress exposure cause affective behaviors disorder in offspring rats via persistent activation of Notch signaling pathway in the hippocampus\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the real environment, women are inevitably exposed to multiple environmental risk factors during pregnancy, such as natural disasters, negative life events, or psychological stress. Many population studies and animal experiments had shown that maternal stressors can increase the risk of mental illness in generation\u003csup\u003e[\u003cspan additionalcitationids=\"CR34\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Increasing evidence suggested that maternal chronic stress exposure impaired the neurobehavioral development of offspring\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. However, the effect of maternal chronic stress on offspring affective function and its underlying mechanism remain largely unknown, warranting further studies. In the present study, we chose the CUMS model originally created by Paul Willner and colleagues\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e, which has been widely used to establish chronic stress models in rodents. In order to verify the scientific and rational establishment of CUMS model, we comprehensively evaluated the plasma corticosterone levels, weight changes, OFT and SPT behavioral performance of female SD rats on the first day before stress (baseline) and on the 1st, 7th, 14th and 21st day during stress. In the present study, our results indicated that the PS group showed an increase in plasma corticosterone content, slow weight gain, decreased scores in both horizontal and vertical movements in OFT, and a decrease in the 1% sugar water preference percentage in SPT. Thus, the data suggested that the CUMS pregnant rat model was successfully established, allowing for further research on the offspring.\u003c/p\u003e \u003cp\u003eTo clarify the impact of chronic stress during pregnancy on the emotional behavior of offspring at different stages, the results OFT and SPT showed that the exploration ability of offspring decreased and anxiety like behavior increased during childhood and adolescence. There is a consensus that the hippocampus is essential in the stress response and in the pathophysiology of mood-related disorders\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. A previous animal experiment indicated that prenatal stress caused various degrees of damage to neurons cell, mitochondria and synaptic structure in the hippocampus\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]\u003c/sup\u003e. In the current study, the H\u0026amp;E staining results showed that maternal stress exposure could significantly increase the damage to neuronal cells in various regions of the hippocampus of offspring rats, and this damage will worsen with age in the CA1 region. In addition to the hippocampal neuron structure, the results of electron microscope showed that the number of synapses in different hippocampal subregions decreased, synaptic gaps widened, and postsynaptic dense matter thickened of OPS group at different ages, even the adverse effects can be sustained until adolescence. These findings are consistent with previous findings on synaptic structure and function abnormalities in offspring caused by exposure to adverse environments during pregnancy\u003csup\u003e[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eStress exposure induced maternal release of excessive cortisol (corticosterone in rodents) has been regarded as an important mediator of prenatal stress\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. Moreover, epidemiological investigations have also found that excessive cortisol in the fetus from placental barrier can reprogram the HPA axis, and dysfunction of the HPA axis has adverse effects on the morphology structure, physiological function, and behavioral performance of the brain\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/sup\u003e. Corticosterone, as the final product secreted after abnormal activation of the HPA axis by prenatal stress, may have an impact on the proliferation and differentiation of offspring hippocampal neurons\u003csup\u003e[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e. Consistent with the study, we found that maternal exposure to chronic stress during pregnancy can cause an increase in plasma levels of CRH and ACTH in offspring at PND28 and PND42, ultimately leading to an increase in GC levels. CORT, as the most potent glucocorticoid in the body, also increases in content. As mentioned above, chronic stress during pregnancy can cause abnormal activation of the HPA axis in childhood and adolescence offspring.\u003c/p\u003e \u003cp\u003eThere was a rich literature available suggesting that the synaptic-related proteins, such as PSD95 and BDNF, promoted synaptic plasticity and were the biomolecular basis of emotional function\u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e. It has been reported that BDNF is a member of the neurotrophin family, involved in structural regulation of synaptic generation, maintenance, expansion, and modification, as well as functional regulation of neural conduction and receptor activity, and promoting dendritic and axonal growth\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. Postsynaptic dense-95 (PSD95) is mainly expressed on the cell bodies and dendrites of pyramidal neurons and granulosa cells\u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e. Rodent studies have found that reduced expression levels of PSD-95 and BDNF can cause loss of hippocampal synapses and dendritic spines, ultimately leading to significant changes in the morphology of neurons and their synapses\u003csup\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/sup\u003e. The present results revealed that the gene and protein levels of BDNF and PSD95 in the hippocampus of OPS group decreased at PND28 and PND42. Thus, chronic stress during pregnancy can cause synaptic related proteins abnormal expression in offspring of hippocampus and might further impair offspring emotional ability.\u003c/p\u003e \u003cp\u003eOverwhelming evidence substantiated that during the development of the hippocampus, external environmental stress can cause morphological changes in hippocampal neurons, increased neuronal apoptosis, decreased synaptic plasticity, thereby impairing offspring neurodevelopment\u003csup\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/sup\u003e. Neuron apoptosis is considered the most typical pathological feature in immature brain injury. In order to further investigate the effect of chronic stress during pregnancy on neuronal apoptosis in the hippocampus of offspring at different developmental stages, this study also conducted molecular level related experiments. The results of q-PCR and Western Blotting detection showed that the expression levels of Bcl-2/Bax gene and protein in the hippocampus of OPS group decreased at PND28 and PND42, while the expression levels of Caspase-3 gene increased. Several studies indicated that as the damage worsen during hippocampal development, Caspase3 and Bax were overexpressed, while Bcl-2 expression was inhibited, ultimately leading to an imbalance in the proportion of Bcl-2/Bax and an increase in neuronal apoptosis\u003csup\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e. In summary, maternal CUMS exposure can cause increased apoptosis of hippocampal neurons in offspring at different stages, ultimately leading to neurobehavioral developmental damage in offspring.\u003c/p\u003e \u003cp\u003eA more important class of molecules in the development of the hippocampus from fetus to adult is the Notch signaling pathway and its key factors\u003csup\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/sup\u003e. Research has found that Notch receptors and their ligands are expressed at all stages of hippocampal development\u003csup\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]\u003c/sup\u003e. Notch signaling regulates the dendritic morphology of newly formed neurons, and it is necessary for hippocampal synaptic plasticity and emotional behavior\u003csup\u003e[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]\u003c/sup\u003e. This study focused on the role of Notch signaling pathway in the neurobehavioral development damage of offspring caused by chronic stress during pregnancy. The results showed that chronic stress during pregnancy can cause an increase in the expression of Hes1, Notch1 and NICD genes and proteins in the hippocampus of offspring at PND28, and an increase in the expression levels of Notch1, NICD and Notch2 genes and proteins at PND42. Therefore, we speculate that the emotional damage of offspring at different ages caused by chronic stress during pregnancy may be related to abnormal activation of the Notch signaling pathway.\u003c/p\u003e \u003cp\u003eIn addition to Notch signaling pathway regulates the dendritic morphology of newly formed neurons and synaptic plasticity, it is also involved in regulation of neural stem cell proliferation and differentiation during embryonic and adult development\u003csup\u003e[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/sup\u003e. It had been established that Notch pathway is a highly conserved mediator of cell fate determination\u003csup\u003e[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]\u003c/sup\u003e. The Notch pathway in the neuronal lineage is involved in regulating processes such as cell proliferation, differentiation, and apoptosis\u003csup\u003e[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]\u003c/sup\u003e. Neural stem cells in the brain mainly differentiate into NeuN and GFAP\u003csup\u003e[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]\u003c/sup\u003e, among which NeuN is a protein specifically expressed in neurons and is considered a specific marker of mature neurons\u003csup\u003e[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]\u003c/sup\u003e. NeuN has two subtypes: 46 kD and 48 kD, expressed in the nucleus and cytoplasm, respectively. When brain tissue is exposed to adverse factors such as ischemia and hypoxia, the expression of NeuN will decrease, ultimately inducing an increase in neuronal apoptosis\u003csup\u003e[\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]\u003c/sup\u003e. GFAP is a skeletal protein synthesized by astrocytes, commonly used to label astrocytes, and is also a marker of astrocyte activation\u003csup\u003e[\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]\u003c/sup\u003e. Under physiological conditions, the number of astrocytes in the hippocampus is relatively small, but a large number of reactive proliferative astrocytes will appear after being subjected to adverse environment. In addition to causing morphological changes such as swelling and increased protrusions in the cell body, excessive proliferation of astrocytes may also secrete a large amount of toxic cytokines, promote the formation of glial scars, and ultimately affect neuronal axon regeneration, exacerbating neuronal damage\u003csup\u003e[\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]\u003c/sup\u003e. The present results revealed that the expression of NeuN protein decreased in the hippocampus of OPS group at PND28 and PND42, while the expression of GFAP protein increased during PND28. In the current study, chronic stress exposure during pregnancy leads to abnormal neuronal differentiation in the hippocampus of offspring, which may lead to axonal regeneration, exacerbate neuronal apoptosis, and ultimately cause changes in hippocampal synaptic plasticity. This series of damages may be related to abnormal activation of the Notch signaling pathway.\u003c/p\u003e \u003cp\u003eIt is worth noting that corticosterone (CORT) has important roles in normal maturation of the developing brain, such as maturation of nerve terminal, remodeling axons and dendrites, and the cell survival\u003csup\u003e[\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]\u003c/sup\u003e. CORT is a steroid hormone secreted and synthesized by the adrenal cortex after stress stimulation in the body. Elevated plasma cortisol levels can cause damage to the morphology or function of the hippocampus\u003csup\u003e[\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]\u003c/sup\u003e. In order to simulate the dysfunction of neuronal plasticity caused by elevated glucocorticoids when the body is subjected to external stress, CORT was pretreated in HT22 cells. Observation of HT22 cell damage through morphological and apoptosis related detection, detection of Notch signaling pathway. We found that compared with the control group, the protein levels of CyclinD1 and Bcl-2 were markedly reduced in HT22 cells treated with CORT. The levels of Caspase3 and Bax proteins significantly increased, which is consistent with the results of the animal in vivo model in this study. Previous studies have also found that corticosterone exposure can reduce the survival rate of neuronal cells and significantly reduce the expression of PSD95 protein\u003csup\u003e[\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]\u003c/sup\u003e. Furthermore, DAPT also obviously decreased the expression of apoptotic proteins Bax and Caspase3, and downregulate the expression of Notch related proteins in damaged HT22 cells. Further research showed that inhibiting Notch signaling pathway significantly alleviated maternal stress exposure-caused hippocampal neuronal demage and emotion deficits in offspring. As mentioned above, maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOverall, our work provides strong in vitro and in vivo evidence supporting the important role of the Notch signaling pathway in the regulation of maternal chronic unpredictable stress on the occurrence and development of emotional behavior in offspring rats. Our data uncovered novel molecular mechanisms regulating the development of offspring neurobehavioral damage provided effective intervention strategies for early life and proposed a new insight into preventing and controlling for maternal originated diseases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (No: 82260647, 81960591), Key R\u0026amp;D projects in Ningxia (No:2023BEG02005), Key Project of Ningxia Natural Science Foundation (No:2022AAC02030), Chinese Academy of Sciences \"Light of the West\" talent training program. Ningxia Medical University scientific research project\u0026nbsp;（XZ2023001）.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYoujuan Fu and Ting Liu conceived and designed the study. Youjuan Fu,\u0026nbsp;Can Liu, Ye Li\u0026nbsp;performed the experiments and acquired the data.\u0026nbsp;Rui Wang and Jiashu Zhu\u0026nbsp;interpreted the data. Suzhen Guan and Zhihong Liu drafted the paper and revised it. All authors reviewed and approved the final version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study will be available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNath A, Murthy G, Babu G R, et al. Effect of prenatal exposure to maternal cortisol and psychological distress on infant development in Bengaluru, southern India: a prospective cohort study[J]. BMC Psychiatry,2017,17(1):255.\u003c/li\u003e\n\u003cli\u003eLondono T A, Diaz S A, Ross D A, et al. Effects of Maternal Prenatal Stress: Mechanisms, Implications, and Novel Therapeutic Interventions[J]. Biol Psychiatry,2016,80(11):e85-e87.\u003c/li\u003e\n\u003cli\u003eBarker D J. The developmental origins of chronic adult disease[J]. Acta Paediatr Suppl,2004,93(446):26-33.\u003c/li\u003e\n\u003cli\u003eVan den Bergh B, van den Heuvel M I, Lahti M, et al. Prenatal developmental origins of behavior and mental health: The influence of maternal stress in pregnancy[J]. Neurosci Biobehav Rev,2020,117:26-64.\u003c/li\u003e\n\u003cli\u003eVelazquez M A, Fleming T P, Watkins A J. Periconceptional environment and the developmental origins of disease[J]. J Endocrinol,2019,242(1):T33-T49.\u003c/li\u003e\n\u003cli\u003eBethlehem R, Seidlitz J, White S R, et al. Brain charts for the human lifespan[J]. Nature,2022,604(7906):525-533.\u003c/li\u003e\n\u003cli\u003eKim D R, Bale T L, Epperson C N. Prenatal programming of mental illness: current understanding of relationship and mechanisms[J]. Curr Psychiatry Rep,2015,17(2):5.\u003c/li\u003e\n\u003cli\u003eBurgess D J, Moritz K M. Prenatal alcohol exposure and developmental programming of mental illness[J]. J Dev Orig Health Dis,2020,11(3):211-221.\u003c/li\u003e\n\u003cli\u003eMonk C, Lugo-Candelas C, Trumpff C. Prenatal Developmental Origins of Future Psychopathology: Mechanisms and Pathways[J]. Annu Rev Clin Psychol,2019,15:317-344.\u003c/li\u003e\n\u003cli\u003eAris I M, Fleisch A F, Oken E. Developmental Origins of Disease: Emerging Prenatal Risk Factors and Future Disease Risk[J]. Curr Epidemiol Rep,2018,5(3):293-302.\u003c/li\u003e\n\u003cli\u003eSenn V, Bassler D, Choudhury R, et al. Microbial Colonization From the Fetus to Early Childhood-A Comprehensive Review[J]. Front Cell Infect Microbiol,2020,10:573735.\u003c/li\u003e\n\u003cli\u003eFeyaerts D, Urbschat C, Gaudilliere B, et al. Establishment of tissue-resident immune populations in the fetus[J]. Semin Immunopathol,2022,44(6):747-766.\u003c/li\u003e\n\u003cli\u003eKinney D K, Munir K M, Crowley D J, et al. Prenatal stress and risk for autism[J]. Neurosci Biobehav Rev,2008,32(8):1519-1532.\u003c/li\u003e\n\u003cli\u003eMbiydzenyuy N E, Hemmings S, Qulu L. Prenatal maternal stress and offspring aggressive behavior: Intergenerational and transgenerational inheritance[J]. Front Behav Neurosci,2022,16:977416.\u003c/li\u003e\n\u003cli\u003eCardenas A, Faleschini S, Cortes H A, et al. Prenatal maternal antidepressants, anxiety, and depression and offspring DNA methylation: epigenome-wide associations at birth and persistence into early childhood[J]. Clin Epigenetics,2019,11(1):56.\u003c/li\u003e\n\u003cli\u003ePlant D T, Pawlby S, Sharp D, et al. Prenatal maternal depression is associated with offspring inflammation at 25 years: a prospective longitudinal cohort study[J]. Transl Psychiatry,2016,6(11):e936.\u003c/li\u003e\n\u003cli\u003eKrontira A C, Cruceanu C, Binder E B. Glucocorticoids as Mediators of Adverse Outcomes of Prenatal Stress[J]. Trends Neurosci,2020,43(6):394-405.\u003c/li\u003e\n\u003cli\u003eGuan S Z, Fu Y J, Zhao F, et al. The mechanism of enriched environment repairing the learning and memory impairment in offspring of prenatal stress by regulating the expression of activity-regulated cytoskeletal-associated and insulin-like growth factor-2 in hippocampus[J]. Environ Health Prev Med,2021,26(1):8.\u003c/li\u003e\n\u003cli\u003eWei S, Li Z, Ren M, et al. Social defeat stress before pregnancy induces depressive-like behaviours and cognitive deficits in adult male offspring: correlation with neurobiological changes[J]. BMC Neurosci,2018,19(1):61.\u003c/li\u003e\n\u003cli\u003eDiz-Chaves Y, Baquedano E, Frago L M, et al. Maternal stress alters the developmental program of embryonic hippocampal neurons growing in vitro[J]. Psychoneuroendocrinology,2013,38(3):455-459.\u003c/li\u003e\n\u003cli\u003eBasak O, Taylor V. Identification of self-replicating multipotent progenitors in the embryonic nervous system by high Notch activity and Hes5 expression[J]. Eur J Neurosci,2007,25(4):1006-1022.\u003c/li\u003e\n\u003cli\u003eZhang R, Engler A, Taylor V. Notch: an interactive player in neurogenesis and disease[J]. Cell Tissue Res,2018,371(1):73-89.\u003c/li\u003e\n\u003cli\u003eEngler A, Zhang R, Taylor V. Notch and Neurogenesis[J]. Adv Exp Med Biol,2018,1066:223-234.\u003c/li\u003e\n\u003cli\u003eGiachino C, Barz M, Tchorz J S, et al. GABA suppresses neurogenesis in the adult hippocampus through GABAB receptors[J]. Development,2014,141(1):83-90.\u003c/li\u003e\n\u003cli\u003eGuo Y J, Zhang Z J, Wang S H, et al. Notch1 signaling, hippocampal neurogenesis and behavioral responses to chronic unpredicted mild stress in adult ischemic rats[J]. Prog Neuropsychopharmacol Biol Psychiatry,2009,33(4):688-694.\u003c/li\u003e\n\u003cli\u003eShang X, Shang Y, Fu J, et al. Nicotine Significantly Improves Chronic Stress-Induced Impairments of Cognition and Synaptic Plasticity in Mice[J]. Mol Neurobiol,2017,54(6):4644-4658.\u003c/li\u003e\n\u003cli\u003eShen J, Lin L, Liao L, et al. The involvement of Notch1 signaling pathway in mid-aged female rats under chronic restraint stress[J]. Neurosci Lett,2020,738:135313.\u003c/li\u003e\n\u003cli\u003eFu Y, Liu H, He L, et al. Prenatal chronic stress impairs the learning and memory ability via inhibition of the NO/cGMP/PKG pathway in the Hippocampus of offspring[J]. Behav Brain Res,2022,433:114009.\u003c/li\u003e\n\u003cli\u003eWillner P. The chronic mild stress (CMS) model of depression: History, evaluation and usage[J]. Neurobiol Stress,2017,6:78-93.\u003c/li\u003e\n\u003cli\u003eLiu X H, Qian L J, Gong J B, et al. Proteomic analysis of mitochondrial proteins in cardiomyocytes from chronic stressed rat[J]. Proteomics,2004,4(10):3167-3176.\u003c/li\u003e\n\u003cli\u003eGuan L, Jia N, Zhao X, et al. The involvement of ERK/CREB/Bcl-2 in depression-like behavior in prenatally stressed offspring rats[J]. Brain Res Bull,2013,99:1-8.\u003c/li\u003e\n\u003cli\u003eBatool S, Raza H, Zaidi J, et al. Synapse formation: from cellular and molecular mechanisms to neurodevelopmental and neurodegenerative disorders[J]. J Neurophysiol,2019,121(4):1381-1397.\u003c/li\u003e\n\u003cli\u003eWeinstock M. Prenatal stressors in rodents: Effects on behavior[J]. Neurobiol Stress,2017,6:3-13.\u003c/li\u003e\n\u003cli\u003eAlves R L, Portugal C C, Lopes I M, et al. Maternal stress and vulnerability to depression: coping and maternal care strategies and its consequences on adolescent offspring[J]. Transl Psychiatry,2022,12(1):463.\u003c/li\u003e\n\u003cli\u003evan Rooij S, Powers A. Maternal Stress and Vulnerability in Offspring: Hippocampal Mechanisms of Resilience[J]. Biol Psychiatry,2024,95(1):3-5.\u003c/li\u003e\n\u003cli\u003eSivasangari K, Sivamaruthi B S, Chaiyasut C, et al. Maternal stress-induced changes in adolescent and adult offspring: Neurobehavioural improvement and telomere maintenance[J]. Heliyon,2023,9(10):e20385.\u003c/li\u003e\n\u003cli\u003eLisman J, Buzsaki G, Eichenbaum H, et al. Viewpoints: how the hippocampus contributes to memory, navigation and cognition[J]. Nat Neurosci,2017,20(11):1434-1447.\u003c/li\u003e\n\u003cli\u003eJeffery K J. The Hippocampus: From Memory, to Map, to Memory Map[J]. Trends Neurosci,2018,41(2):64-66.\u003c/li\u003e\n\u003cli\u003eLi Y J, Yang L P, Hou J L, et al. Prenatal Stress Impairs Postnatal Learning and Memory Development via Disturbance of the cGMP-PKG Pathway and Oxidative Phosphorylation in the Hippocampus of Rats[J]. Front Mol Neurosci,2020,13:158.\u003c/li\u003e\n\u003cli\u003eZhang H, Shang Y, Xiao X, et al. Prenatal stress-induced impairments of cognitive flexibility and bidirectional synaptic plasticity are possibly associated with autophagy in adolescent male-offspring[J]. Exp Neurol,2017,298(Pt A):68-78.\u003c/li\u003e\n\u003cli\u003eHao Y, Guo X, Wang X, et al. Maternal exposure to triclosan during lactation alters social behaviors and the hippocampal ultrastructure in adult mouse offspring[J]. Toxicol Appl Pharmacol,2022,449:116131.\u003c/li\u003e\n\u003cli\u003ePopova E N. Maternal alcohol consumption before pregnancy and ultrastructure of neurons and interneuronal connections in rat offspring[J]. Int J Neurosci,1993,73(1-2):37-45.\u003c/li\u003e\n\u003cli\u003eCapron L E, Glover V, Pearson R M, et al. Associations of maternal and paternal antenatal mood with offspring anxiety disorder at age 18 years[J]. J Affect Disord,2015,187:20-26.\u003c/li\u003e\n\u003cli\u003eBraeken M A, Jones A, Otte R A, et al. Potential benefits of mindfulness during pregnancy on maternal autonomic nervous system function and infant development[J]. Psychophysiology,2017,54(2):279-288.\u003c/li\u003e\n\u003cli\u003eHarris A, Seckl J. Glucocorticoids, prenatal stress and the programming of disease[J]. Horm Behav,2011,59(3):279-289.\u003c/li\u003e\n\u003cli\u003eVan den Hove D L, Steinbusch H W, Scheepens A, et al. Prenatal stress and neonatal rat brain development[J]. Neuroscience,2006,137(1):145-155.\u003c/li\u003e\n\u003cli\u003eFarajdokht F, Vatandoust S M, Hosseini L, et al. Sericin protects against acute sleep deprivation-induced memory impairment via enhancement of hippocampal synaptic protein levels and inhibition of oxidative stress and neuroinflammation in mice[J]. Brain Res Bull,2021,174:203-211.\u003c/li\u003e\n\u003cli\u003eLu B, Nagappan G, Lu Y. BDNF and synaptic plasticity, cognitive function, and dysfunction[J]. Handb Exp Pharmacol,2014,220:223-250.\u003c/li\u003e\n\u003cli\u003eEdlow A G. Maternal obesity and neurodevelopmental and psychiatric disorders in offspring[J]. Prenat Diagn,2017,37(1):95-110.\u003c/li\u003e\n\u003cli\u003eLi K, Shen S, Ji Y T, et al. Melatonin Augments the Effects of Fluoxetine on Depression-Like Behavior and Hippocampal BDNF-TrkB Signaling[J]. Neurosci Bull,2018,34(2):303-311.\u003c/li\u003e\n\u003cli\u003eJakaria M, Park S Y, Haque M E, et al. Neurotoxic Agent-Induced Injury in Neurodegenerative Disease Model: Focus on Involvement of Glutamate Receptors[J]. Front Mol Neurosci,2018,11:307.\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Connor D B, Thayer J F, Vedhara K. Stress and Health: A Review of Psychobiological Processes[J]. Annu Rev Psychol,2021,72:663-688.\u003c/li\u003e\n\u003cli\u003eMohammad A E, Mahdavi M, Jenani F F, et al. Metformin protects PC12 cells against oxygen-glucose deprivation/reperfusion injury[J]. Toxicol Mech Methods,2018,28(8):622-629.\u003c/li\u003e\n\u003cli\u003eGomez-Pinedo U, Galan L, Matias-Guiu J A, et al. Notch Signalling in the Hippocampus of Patients With Motor Neuron Disease[J]. Front Neurosci,2019,13:302.\u003c/li\u003e\n\u003cli\u003ePleasure S J, Collins A E, Lowenstein D H. Unique expression patterns of cell fate molecules delineate sequential stages of dentate gyrus development[J]. J Neurosci,2000,20(16):6095-6105.\u003c/li\u003e\n\u003cli\u003eDing X F, Gao X, Ding X C, et al. Postnatal dysregulation of Notch signal disrupts dendrite development of adult-born neurons in the hippocampus and contributes to memory impairment[J]. Sci Rep,2016,6:25780.\u003c/li\u003e\n\u003cli\u003eBreunig J J, Silbereis J, Vaccarino F M, et al. Notch regulates cell fate and dendrite morphology of newborn neurons in the postnatal dentate gyrus[J]. Proc Natl Acad Sci U S A,2007,104(51):20558-20563.\u003c/li\u003e\n\u003cli\u003eHitoshi S, Alexson T, Tropepe V, et al. Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells[J]. Genes Dev,2002,16(7):846-858.\u003c/li\u003e\n\u003cli\u003eSood C, Justis V T, Doyle S E, et al. Notch signaling regulates neural stem cell quiescence entry and exit in Drosophila[J]. Development,2022,149(4).\u003c/li\u003e\n\u003cli\u003eSprinzak D, Blacklow S C. Biophysics of Notch Signaling[J]. Annu Rev Biophys,2021,50:157-189.\u003c/li\u003e\n\u003cli\u003eTanveer R, Gowran A, Noonan J, et al. The endocannabinoid, anandamide, augments Notch-1 signaling in cultured cortical neurons exposed to amyloid-beta and in the cortex of aged rats[J]. J Biol Chem,2012,287(41):34709-34721.\u003c/li\u003e\n\u003cli\u003eWang J, Ye Z, Zheng S, et al. Lingo-1 shRNA and Notch signaling inhibitor DAPT promote differentiation of neural stem/progenitor cells into neurons[J]. Brain Res,2016,1634:34-44.\u003c/li\u003e\n\u003cli\u003eDuan W, Zhang Y P, Hou Z, et al. Novel Insights into NeuN: from Neuronal Marker to Splicing Regulator[J]. Mol Neurobiol,2016,53(3):1637-1647.\u003c/li\u003e\n\u003cli\u003eXiong L L, Tan Y X, Du RL, et al. Effect of Sutellarin on Neurogenesis in Neonatal Hypoxia-Ischemia Rat Model: Potential Mechanisms of Action[J]. Am J Chin Med,2021,49(3):677-703.\u003c/li\u003e\n\u003cli\u003eHossain M M, Belkadi A, Al-Haddad S, et al. Deltamethrin Exposure Inhibits Adult Hippocampal Neurogenesis and Causes Deficits in Learning and Memory in Mice[J]. Toxicol Sci,2020,178(2):347-357.\u003c/li\u003e\n\u003cli\u003eDe Luca C, Virtuoso A, Korai S A, et al. Altered Spinal Homeostasis and Maladaptive Plasticity in GFAP Null Mice Following Peripheral Nerve Injury[J]. Cells,2022,11(7).\u003c/li\u003e\n\u003cli\u003eJutapakdeegul N, Afadlal S, Polaboon N, et al. Repeated restraint stress and corticosterone injections during late pregnancy alter GAP-43 expression in the hippocampus and prefrontal cortex of rat pups[J]. Int J Dev Neurosci,2010,28(1):83-90.\u003c/li\u003e\n\u003cli\u003eKorte S M. Corticosteroids in relation to fear, anxiety and psychopathology[J]. Neurosci Biobehav Rev,2001,25(2):117-142.\u003c/li\u003e\n\u003cli\u003eKott J M, Mooney-Leber S M, Shoubah F A, et al. Effectiveness of different corticosterone administration methods to elevate corticosterone serum levels, induce depressive-like behavior, and affect neurogenesis levels in female rats[J]. Neuroscience,2016,312:201-214.\u003c/li\u003e\n\u003cli\u003eLiu Y, Zou G J, Tu B X, et al. Corticosterone Induced the Increase of proBDNF in Primary Hippocampal Neurons Via Endoplasmic Reticulum Stress[J]. Neurotox Res,2020,38(2):370-384.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"chronic unpredictable mild stress, affective behaviors; Notch signaling pathway, offspring","lastPublishedDoi":"10.21203/rs.3.rs-3828353/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3828353/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMaternal chronic unpredictable mild stress (CUMS) is associated with neuropsychiatric disorders in offspring, including anxiety, depression, and autism spectrum disorders. There is mounting evidence that these behavioral phenotypes have origins in utero, which provided that corticosterone, as a stress hormone, penetrates the placental barrier and enters the fetal body and reprograms the early neural development. Notch signaling pathway is involved in the entire life cycle from embryonic development to birth to death, and mainly regulates neural stem cell proliferation and differentiation, synaptic plasticity and neuronal damage repair, and it has been intensively involved in emotional functioning. However, the role of Notch signaling pathway in affective behaviors of offspring has not been determined. In the present study, the function of Notch signaling pathway in affective behaviors was investigated in open field test (OFT) and sucrose preference test (SPT) in offspring. The results showed that maternal chronic unpredictable mild stress alters affective behaviors in offspring. We examined HPA axis related hormones, hippocampal neuronal cell apoptosis and Notch signaling pathway in offspring. Maternal CUMS damage hippocampal pathology structure and synaptic plasticity in childhood and adolescence offspring, suggesting Notch signaling pathway in the hippocampus was activated. Furthermore, we explored the role and mechanism of Notch signaling pathway in HT22 cell damage after high corticosterone exposure in vitro. Taken together, these results indicate that maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus.\u003c/p\u003e","manuscriptTitle":"Maternal chronic unpredictable mild stress alters affective behaviors in offspring rats through persistent activation of Notch signaling pathway in the hippocampus","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-19 06:40:09","doi":"10.21203/rs.3.rs-3828353/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"51eb6c14-422b-4b30-8bbf-f48d25ff2b5f","owner":[],"postedDate":"January 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":28206719,"name":"Biological sciences/Neuroscience/Learning and memory/Hippocampus"},{"id":28206720,"name":"Biological sciences/Neuroscience/Molecular neuroscience"}],"tags":[],"updatedAt":"2024-11-13T11:47:24+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-19 06:40:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3828353","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3828353","identity":"rs-3828353","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}