Lathyrol inhibits the proliferation of renca cells by affecting the expression of TGF-β/smad pathway and then affecting the cell cycle | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Lathyrol inhibits the proliferation of renca cells by affecting the expression of TGF-β/smad pathway and then affecting the cell cycle Shengyou Song, Yalin Song This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6122802/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Renal cell carcinoma (RCC) is a prevalent malignant tumor with high morbidity and mortality. The TGF-β/smad signaling pathway plays a significant role in the development and progression of RCC. Methods This study explored the impact of lathyrol on the proliferation of mice RCC renca cells by inhibiting the TGF-β/smad signaling pathway and arresting the cell cycle. Bioinformatics analysis, cell culture experiments, and animal experiments were conducted to detect the effects of lathyrol on the activity, mRNA, and protein expressions of RCC cells and RCC xenograft tumors, as well as the expressions of cell cycle proteins and cell cycle regulatory proteins. Results Lathyrol treatment showed a positive correlation with the inhibitory effect on cell proliferation. The IC values of 786-O cells and renca cells were comparable. In vitro, lathyrol decreased the protein and mRNA expressions of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9, while increasing the mRNA expressions of smad2, smad3, and smad4. In vivo, lathyrol suppressed the mRNA and protein expressions of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9 in RCC xenografts, and decreased the protein expressions of cyclinD1, cyclinB1, cyclinA1, cyclinE1, CDK6, CDK4, and CDK1, while increasing the expressions of P16, P21, and P27. Conclusion Lathyrol can repress the expression of key proteins in the TGF-β/smad signaling pathway, impede the signal transduction, arrest the cell cycle progression of renca cells, and subsequently inhibit the proliferation of RCC cells. Future studies are needed to further explore the mechanism of lathyrol in RCC treatment. Lathyrol Renal Cell Cancer TGF-β/smad Signal Pathway Cell Cycle Proliferation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Renal cell carcinoma (RCC) constitutes roughly 2–3% of adult malignant neoplasms, with a global male-to-female ratio approximately at 1.5:1. It can emerge in all age brackets, with the highest incidence ranging between 60 and 70 years old, and a median age approximately at 64 years [ 1 ] . Currently, the incidence of RCC is escalating year on year, rendering it the second most prevalent urinary system neoplasm. Despite its lower incidence compared to prostate cancer (PCa), among patients with malignant tumors affecting the urinary system, the prognosis of RCC patients is poorer than that of other urinary system tumor patients [ 2 ] . The TGF-β/smad signaling pathway is a multifunctional cytokine that assumes a vital role in the genesis and development of neoplasms, and facilitates the advancement of neoplasm cells via diverse mechanisms. On one hand, the activation of the TGF-β/smad signaling pathway in cancerous disorders can stimulate the proliferation of carcinomas, boost the proliferation and dissemination of carcinoma cells, thereby expediting the progression of cancerous diseases [ 3 ] and leading to a decrease in the sensitivity of cancer cells to clinical drugs, thereby reducing the effectiveness of anti-cancer drugs [ 4 ] . It can also induce carcinoma cells to undergo epithelial-mesenchymal transition (EMT), etc. [ 5 ] , such that the originally closely-connected epithelial cells transform into cells with mesenchymal characteristics, thereby attaining stronger invasion and migration capabilities. This transformation enables neoplasm cells to more readily detach from the primary tumor. It also allows them to enter the bloodstream and ultimately form metastases, significantly augmenting the risk of prognosis deterioration in cancer patients [ 6 ] . On the other hand, the TGF-β/smad signaling pathway is closely associated with the cell cycle. By regulating the expression and signal transduction of the TGF-β/smad signaling pathway, it can thereby influence the normal operation of the cell cycle of cancer cells, thereby affecting the proliferation, apoptosis and other phenotypes of carcinoma cells, and influencing the malignant behavior of neoplasm cells [ 7 , 8 ] . Consequently, the TGF-β/smad signaling pathway plays a crucial role in the proliferation of carcinoma cells, the regulation of cell cycle operation, and EMT, as well as other biological behaviors, and has emerged as an important therapeutic target in neoplasms treatment research. By modulating this signaling pathway, it is anticipated to offer novel strategies for enhancing the prognosis of cancer patients. Lathyrol (chemical formula: C20H30O4) is one of the active ingredients of the traditional Chinese medicine Semen Euphorbiae Lathyridis, which has the functions of eliminating water, resolving blood stasis, and dissipating masses [ 9 ] . It is mainly used in the clinical treatment of constipation, edema, phlegm retention, abdominal distension, blood stasis and amenorrhea, and can be applied externally to treat stubborn tinea and warts [ 10 ] . We found that lathyrol monomer can exhibit anti-tumor effects in vivo and in vitro, and can quench the malignant behavior of tumors through literature research and experimental studies. [ 11 , 12 ] . Although lathyrol shows significant anti- neoplasms effects, its mechanism is not fully explored, especially the mechanism of its restrain effect on cancer cell proliferation still needs further in-depth study. Meanwhile, the pathogenesis of RCC also requires further exploration. Based on this, we present a hypothesis that lathyrol may suppress the proliferation of RCC cells by inhibiting the expression of TGF-β/smad signaling pathway in RCC, affecting the operation of RCC cell cycle, and thus exerting its anti-tumor effect. In order to verify this hypothesis, we further investigated whether lathyrol is able to restrain the progression of RCC cell cycle by suppressing the conduction of TGF-β/smad signaling pathway, thereby quenching the proliferation of RCC cells by culturing RCC cells and constructing RCC mice model. 2. Main materials and methods 2.1 Main material The following reagents and materials were used in this study: 786-O human RCC cell line (Procell Life Science & Technology Co., CL-0010) and Renca mice RCC cell line (Shanghai Zhong Qiao Xin Zhou Biotechnology Co., Ltd., ZQ0996) authenticated by RTS (Short Tandem Repeat) authentication and mycoplasma tests; lathyrol (Weikeqi-Biotech, Sichuan, China, Wakq-00424); carboplatin (Qilu Pharmaceutical Co., LTD. H10920028); BALB/c male SPF mice (SPF (Beijing) Biotechnology Co., Ltd., license: SCXK (Beijing) 2019–0010), 1.5-2-months-old and weighing 20 ± 2 g, were reared in the Laboratory Animal Centre at 25℃ in individually ventilated cages (IVCs) with food and water ad libitum; 1640 medium(Procell Biotechnology Co., Ltd.); fetal bovine serum (FBS, Shanghai Univ bio-Co., Ltd.); CCK-8 kit, phosphate-buffered saline (PBS) buffer (Biosharp Co.); trypsin-ethylenediaminetetraacetic acid (EDTA) (0.25%) digestion solution, enhanced chemiluminescence (ECL) developer, cell culture grade dimethyl sulfoxide (DMSO), tissue and cell radioimmunoprecipitation assay (RIPA) lysis buffer, phenyl methyl sulfonyl fluoride (PMSF), goat blocking serum, hydrogen peroxide (H 2 O 2 ), Mayer’s hematoxylin staining solution and neutral gum for immunohistochemistry (IHC) (Solarbio Co., Ltd.); bicinchoninic acid (BCA) protein quantification kit, horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody (Beyotime Biotechnology Company); real-time polymerase chain reaction(RT-PCR) kit, bovine serum albumin (BSA), prestained protein marker (10-180KD), cell membrane breaking solution, IHC staining reagent (Servicebio Co., Ltd.); Antibody in vivo: TGF-β1、TGF-βR1、smad2 + 3、smad6、smad9 antibody (Servicebio Co., Ltd.); smad4、CDK1、PCNA、Ki67 (Wuhan Proteintech Co.); CDK2、CDK4、CDK6、P16、P21、P27、cyclinD1、cyclinA1、cyclinB1、cyclinE1 (Shenzhen Youpin biotech-Co.). Antibody in vitro: TGF-β1、TGF-βR1、PCNA、Ki67、smad6、smad9、CDK6、cyclinA1、cyclinB1、cyclinD1、P16 (Servicebio Co., Ltd.); smad2、smad3、smad4 (Wuhan Proteintech Co.). 2.2 Methods 2.2.1 General bioinformatics analysis Through bioinformatics analysis, the differential expression and clinical prognosis of the proteins TGF-β1, TGF-βR1, Smad1, Smad2, Smad3, Smad4, Smad6, and Smad9 of the TGF-β/smad signaling pathway in RCC cases were analyzed. The patient case information was downloaded from the TCGA database ( https://portal.gdc.cancer.gov ), and the RNAseq data of the TCGA-KIRC (renal clear cell carcinoma) project STAR process were sorted out, and the TPM format data and clinical data were extracted. The data filtering strategy: remove normal + remove no clinical information. Data processing method: log2(value + 1). The expression differences were selected according to the data distribution as follows: T test (satisfying normal + variance homogeneity) | Welch t' test (satisfying normal + not satisfying variance homogeneity) | Wilcoxon rank sum test (not satisfying normal, non-parametric test), and the Cox regression analysis was used for the clinical prognosis statistical method. Subsequently, the data was imported into the Xiantao Academic Tool ( https://www.xiantao.love ) for visualization processing. 2.2.2 Cell culture 786-O and renca RCC cells were regularly grown at constant-temperature cell incubator (with 37°C, 5% CO2 and 95% humidity) in cell culture medium (contained RPMI 1640 medium, 10% FBS and 1% penicillin and streptomycin (PS)). When the cells reached about 85% confluence on the culture flask surface, the cells in the logarithmic phase of growth were digested and utilized in the subsequent experiments. 2.2.3 Establish a cell viability-drug concentration curve Use CCK-8 to detect the cell viability of 786-O and renca RCC cells treated with different concentrations of lathyrol solution for 24 hours, establish the RCC cell viability -drug concentration and regression curve formula, use the formula to calculate the drug concentrations of special values IC10, IC25, IC50, IC75, and IC90, and compare the differences in the effects of the drug on the two RCC cells. 2.2.4 Cell grouping Based on the results of preliminary experiments, the cells were divided into a DMSO control group (A group), an experimental group (B group) and a negative control group (C group), and the IC 50 value was selected as the intervention concentration of B group and C group for 24h. Cells in the DMSO control group were grown in DMSO working medium (contained RPMI 1640 medium and 1% DMSO), the negative control group cells were cultured in paraplatin working medium (contained DMSO working medium and corresponding carboplatin drug concentrations), while those in the experimental group were cultured in lathyrol working medium (contained DMSO working medium and corresponding lathyrol drug concentrations). 2.2.5 Construction of the RCC mice model Upon centrifugation for cell collection, the initial cell suspension was formulated in complete RPMI-1640 medium supplemented with 10% FBS, and adjusted to a concentration of 1.5 × 107 cells/ml. Depilatory cream was employed to eliminate hair and expose the skin of the axilla (right forelimb). Subsequently, Renca cell suspension (0.10 mL) was injected into the subcutaneous tissue of each mouse in the axilla (right forelimb), and the mice were housed in SPF-grade IVCs. The mice were permitted to consume food and water normally. The entire animal husbandry process and all experimental procedures in this study adhered to relevant experimental management requirements and ethical standards for experimental animal welfare. All experimental protocols regarding this study were approved by the Ethics Committee of the Zaozhuang Municipal Hospital (approval number: zzslyykyⅡ20241101003). The Ethics committee allows a tumor burden of 3 cm or approximately 15% of the body weight in mice. The maximum tumor burden recorded in the current study did not surpass 20% of the body weight. 2.2.6 Grouping and treatment Employing the SPSS random number generator, the mice were randomly assigned to a normal group (Group A), an experimental group (Group B), and a negative control group (Group C), with 5 mice per group after excluding mice that succumbed to tumor ulceration, infection, and fighting. Post-establishment of the RCC mice models, the growth of xenografts was closely monitored. It took approximately 15 days for xenografts to reach a size of 5–6 mm3. The model group was administered normal saline via gavage, the lathyrol experimental group was gavaged with 25 mg/kg lathyrol solution once daily, and the negative control group was intraperitoneally injected with 2 mg/kg paraplatin on days 0, 3, 7, 10, and 14, twice per week. After 14 days of treatment, the mice were anesthetized, blood was collected from the eyeball, and the xenografted tumor mass was isolated, with impurities and contaminated blood being washed away using PBS. 2.2.7 HE staining to observe the morphology of RCC xenograft tumors The xenograft samples were fixed with 4% paraformaldehyde tissue fixative, dehydrated after 72 hours of fixation, embedded in paraffin, sectioned, and stained according to the steps of the HE staining kit, and then the pathological changes of RCC renca xenograft tumor tissues at high and low magnification were observed under an optical microscope. 2.2.8 Rt-PCR to detect gene expression The samples were washed with PBS and added with Trizol, centrifuged and stratified after adding chloroform and shaking, the water phase was added with isopropanol to obtain RNA precipitation, washed with ethanol and centrifuged to remove the supernatant, the RNA was dried and dissolved in DEPC water, and the concentration and purity were measured and stored. When reverse transcription, thaw the reagent and mix and centrifuge, prepare the RNA-Primer Mix, denature at 65°C and place on ice, prepare the reverse transcription reaction solution, incubate at 37°C for 1 hour, inactivate at 85°C and store. Prepare the PCR Reaction Mix, design NTC quality control contamination, set the reaction program for PCR amplification, and perform melting curve analysis. Quantitative PCR data analysis uses the ΔΔCt data analysis method to analyze the amplification curve and melting curve. The target genes and primers can be seen in Table 1 . Table 1 Primer sequence table Gene Primer Sequence (5'-3') PCR Products Mus GAPDH Forward ATGGCCTTCCGTGTTCCTAC 167bp Reverse AAGTCGCAGGAGACAACCTG Mus TGF-β1 Forward TGACGTCACTGGAGTTGTACGG 170bp Reverse GGTTCATGTCATGGATGGTGC Mus TGF-βR1 Forward TTGCAGACTTGGGACTTGCT 211bp Reverse CCACCAATAGAACAGCGTCG Mus Smad2 Forward CTACACCCACTCCATTCC 231bp Reverse GCAGGTTCCGAGTAAGTAA Mus Smad3 Forward GGAACTTACAAGGCGACAC 107bp Reverse TGGGAGACTGGACGAAA Mus Smad4 Forward AGGCAGAGCATCAAGGAA 116bp Reverse CAGTCTAAAGGCTGTGGGT Mus SMAD6 Forward CAGCAAGATCGGTTTTGGCAT 293bp Reverse AGGAGGTGATGAACTGTCGC Mus Smad9 Forward CCATACCATTACCGCAGAGTG 155bp Reverse TCAGGGTAGGTGGCGTTGT 2.2.9 Western blot (WB) to detect protein expression in RCC renca cells and tumor xenograft tissues Take a sufficient amount of recna cell samples and clean rice-sized mice renca xenograft samples, add the prepared PIPA lysis buffer, and lyse the cells on ice to extract proteins. Determine the protein content by BCA method, configure SDS-PAGE gel electrophoresis, transfer to polyvinylidene fluoride membrane (PVDF membrane), soak the PVDF membrane in TBST (containing 5% skimmed milk powder), and incubate overnight on a 4°C shaker. The antibody dilution concentrations in vivo and in vitro experiments are shown in Tables 2 and 3 . The HRP-labeled secondary antibody was incubated on a 37°C room temperature shaker for 2.5 hours, and the ECL immunoblotting was developed. Scan the belts and quantitatively analyze the gray value of the belts. Table 2 Dilution of WB primary antibody (in vitro) Primary antibody Dilution rate TGFβ1 1:1000 TGFβR1 1:1000 Smad2 1:5000 Smad3 1:6000 Smad4 1:1000 CyclinE1 1:5000 CDK1 1:1000 GAPDH 1:1000 Table 3 Dilution of WB primary antibody (in vivo) Primary antibody Dilution rate Smad4 1:1000 Ki-67 1:1000 PCNA 1:3000 GAPDH 1:1000 2.2.10 Immunohistochemistry to detect protein expression in cells and RCC xenograft The fixation, dehydration, and embedding procedures of RCC xenograft tissues are the same as those in the HE staining steps. According to the requirements of the IHC kit manual, add 0.01M citrate buffer for antigen repair, block endogenous peroxidase with 3% H2O2, add primary antibody and incubate overnight at 4°C. The dilution ratio of the primary antibody can be seen in Tables 4 and 5 . On the second day, add HRP-labeled secondary antibody, DAB color development, Mayer hematoxylin counterstaining, conventional dehydration and transparency, and neutral gum sealing. For immunocytochemistry (ICC) and IHC, take random screenshots of 2 fields of view for each section, and quantitatively analyze the average optical density (AOD) value using ImageJ software. Table 4 Dilution of IHC primary antibody (in vitro) Primary antibody Dilution rate Smad6 1:500 Smad9 1:500 CyclinD1 1:500 CyclinA1 1:500 CyclinB1 1:300 CDK2 1:200 CDK4 1:400 CDK6 1:200 P16 1:500 P21 1:100 P27 1:200 Ki67 1:500 PCNA 1:500 Table 5 Dilution of IHC primary antibody (in vivo) Primary antibody Dilution rate TGFβ1 1:500 TGFβR1 1:500 Smad2 + 3 1:500 Smad6 1:500 Smad9 1:500 CyclinD1 1:500 CyclinA1 1:500 CyclinB1 1:300 CyclinE1 1:500 CDK1 1:500 CDK2 1:200 CDK4 1:400 CDK6 1:200 P16 1:400 P21 1:100 P27 1:200 2.3 Statistical analysis The data were analyzed via IBM SPSS 26.0, and the data visualization was generated with GraphPad Prism 9.0. All cell experiments were carried out with triplicated independent biological replicates. A difference was deemed statistically significant if P < 0.05, *P < 0.05, **P < 0.01, or ***P 0.05. 3. Results 3.1 The TGF-β/smad signaling pathway is highly expressed in RCC and has an impact on clinical prognosis. In the RCC sample to investigate the relative expression level of the target gene, it includes 72 normal group samples and 532 cancer group samples. Through integrating and analyzing relevant data, the results demonstrate that the expression of TGF-β1, smad1, smad2, smad3, smad4, and smad9 in malignant tissues is higher than that of the normal group, while the expression of smad6 in the normal group is significantly higher than that of the tumor group. There is no statistical difference in the expression of TGF-βR1 between the normal and tumor groups. The clinical prognosis analysis of the target gene expression (Fig. 1 C) comprises 270 samples in the low-expression group, with a total of 99 events and 171 censored cases; 271 samples in the high-expression group, with a total of 76 events and 195 censored cases. The clinical prognosis analysis reveals that patients with high expression of smad1, smad2, smad3, smad4, smad9, smad6, and TGF-βR1 in RCC patients have a better prognosis than those with low expression, while patients with low expression of TGF-β1 in RCC patients have a better prognosis than those with high expression, and the difference is statistically significant. 3.2 Lathyrol limits the proliferation of 786-O cells and renca cells, and the two are comparable. After 24 hours of treatment, we evaluated the cell viability by applying the CCK-8 assay. The results indicated that lathyrol could effectively inhibit the proliferation of human RCC 786-O cells (Fig. 2 A) and mouse RCC renca cells (Fig. 2 B) in vitro, and the inhibitory effect was positively correlated with the drug concentration. Subsequently, we analyzed the average cell viability under different drug concentrations and plotted the regression curve of drug concentration and cell viability (Fig. 2 C&D). As depicted in Fig. 2 E, there was no statistically significant difference between the IC value sequences of human RCC cancer 786-O cells and mouse RCC cancer renca cells ( t =-1.447, P = 0.186), suggesting that the therapeutic effect of lathyrol on these two cells was comparable (Fig. 2 F). To more precisely simulate the tumor microenvironment, we selected mouse RCC renca cells to construct xenograft animal models for subsequent in vitro and in vivo related experiments. 3.3 Lathyrol represses the protein and gene expression of the TGF-β/smad signaling pathway in RCC renca cells in vitro. Lathyrol possesses the capacity to reduce the protein and gene expression of the TGF-β/smad signaling pathway in RCC renca cells in vitro (Fig. 3 ). After 24 hours of treatment, the gene expression tendencies of TGF-β1, TGF-βR1, smad2, smad3, smad4, smad6, and smad9 in renca cells were partially distinct from the protein expression tendencies. The protein expression of TGF-β1 and TGF-βR1 in group B and group C was higher than that in group A (Fig. 3 A), while the mRNA expression of TGF-β1 and TGF-βR1 in group B and group C was higher than that in group A (Fig. 3 Ea&b), and the mRNA and protein expression trends of these two proteins were consistent with each other. The expression trends of the smad series proteins were dissimilar to the trends of their mRNA expression. After treatment, lathyrol (group B) and paraplatin (group C) could promote the mRNA expression of smad2, smad3, and smad4 in renca cells (Fig. 3 Ec-d), but could diminish the expression of smad2, smad3, and smad4 proteins (Fig. 3 B); while for smad9 protein, lathyrol could decrease the expression of smad9 mRNA, and paraplatin had minimal effect on it (Fig. 3 Eg), but both the two drugs could restrain the expression of smad9 protein (Fig. 3 D); for smad6 protein, lathyrol and paraplatin had no impact on its mRNA expression (Fig. 3 Ef), but both could enhance the expression of smad6 protein (Fig. 3 C). This finding implies that lathyrol and paraplatin may exert their anti-RCC cell effects by influencing the synthesis and expression of the TGF-β/smad signaling pathway proteins in RCC cells, rather than affecting the transcription of the genes of the TGF-β/smad pathway proteins. 3.4 Lathyrol straitens the expression of cyclin proteins in renca cells in vitro and block the cell cycle progression. The results (Fig. 4 ) demonstrated that both lathyrol and paraplatin efficaciously suppressed the expression of cyclin proteins in RCC cells in vitro. Among the Cyclin series proteins, lathyrol could curb the expression of cyclinD1, cyclinB1, cyclinA1, and cyclinE1 proteins in renca cells. In contrast, paraplatin hindered the expression of cyclinD1, cyclinA1, and cyclinE1 proteins in renca cells. Among the CDK proteins, lathyrol could impede the expression of CDK6, CDK4, and CDK1 proteins in renca cells, while paraplatin reduced the expression of CDK6 and CDK1 proteins in renca cells. Among the cyclin-dependent kinase inhibitor (CKI) proteins, the expression levels of P16, P21, and P27, the three cell cycle inhibitory proteins, in group B and group C cells were significantly higher than those in group A cells. Lathyrol did not impact CDK2 expression, and paraplatin had no influence on cyclinB1, CDK4, and CDK2 protein expression. This finding suggests that lathyrol and paraplatin may exert anti-RCC cell effects by influencing the expression of cell cycle proteins. 3.5 Lathyrol reduces the proliferation of RCC xenograft carcinomas. After 14 days of treatment, the xenograft volume-growth curve of mice (Fig. 5 D) showed the diminution effects of lathyrol and paraplatin on the proliferation of RCC xenograft tumors in mice. Specifically, the xenografts volume growth trend of mice in group A was lower than that in groups B and C, and this difference was statistically significant. It was further observed that the body weight of mice in group B decreased. The difference was also statistically significant compared with group A, suggesting that lathyrol may have a side-effect of reducing body weight in mice (Fig. 5 E). Through HE pathological section analysis (Fig. 5 C), the RCC xenografts in Group A, B, and C all exhibited high differentiation characteristics. The tumor cells were closely arranged, with large nuclei and deep staining. The terminal branches of blood vessels were abundant. The nuclei were deeply stained and appeared bluish-black, while the cytoplasm showed varying degrees of pink. Under low-power microscopy, rich neovascularization was observed in the xenograft tissues of each group, and the neoplasm was well-encapsulated, divided the cells into nest-like structures. Under high-power microscopy, significant atypia of tumor cells was visible, and the nuclei presented pathological nuclear division figures. It is noteworthy that in Group B and C, some xenograft tissues exhibited phenomena such as necrosis, limited proliferation, nuclear fragmentation, and pyknosis. 3.6 Lathyrol dwindle the expression of TGF-β/smad signaling pathway proteins and genes in RCC xenografts. After 14 days of drug administration, the mRNA expression level of smad6 in the RCC xenografts of mice in group A was lower than that in groups B and C; concurrently, the mRNA expression levels of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9 in the RCC xenografts of mice in groups B and C were also lower than that in group A (Fig. 6 ). Through WB and ICC detection, we observed that the expression levels of TGF-β1, TGF-βR1, and smad6 proteins in the RCC xenografts of mice in group A were also lower than those in groups B and C, while the expression levels of smad2, smad3, smad4, and smad9 proteins in the RCC xenografts of mice in groups B and C were also lower than those in group A. Compared with the results under in vitro experimental conditions (Fig. 3 ), under in vivo experimental conditions, the mRNA expression levels of these proteins in treated renca cells were in accordance with the protein presentation trend. These findings imply that lathyrol and paraplatin may exert a role in attenuating the TGF-β/smad signaling pathway by influencing the expression of TGF-β/smad signaling pathway proteins and inhibiting the mRNA transcription of these genes in the in vivo environment. 3.7 Lathyrol curtails the expression of cyclin in RCC xenografts and blocks the cell cycle. After treatment with lathyrol and paraplatin, the expression of cyclinD1, cyclinB1, cyclinE1, CDK4, CDK6, CDK2, and CDK1 in group A RCC xenografts was higher than that in groups B and C; while the expression of P16, P21, and P27 in groups B and C was higher than that in group A. However, lathyrol and paraplatin had little effects on the expression of cyclinA1 protein in renca cells in vivo, and the cell cycle might be blocked in the G1 phase. This finding suggests that lathyrol and paraplatin may have raw effects on the S phase of the cell cycle (Fig. 7 L), but they can still exert their anti-RCC cell affects by affecting the expression of cyclin. 3.8 Lathyrol abridged the expression of PCNA and ki67 protein in RCC cells PCNA protein is predominantly expressed in the cytoplasm, while ki67 protein is manifested in both the cytoplasm and the nucleus. Subsequent to in vivo and in vitro experimental manipulations with the two drugs, lathyrol and paraplatin, it was discerned that the expression of PCNA and ki67 proteins in RCC cells within groups B and C was repressed. This discovery intimates that lathyrol can efficaciously abbreviate the expression of PCNA and ki67 proteins in RCC cells in vivo and in vitro, thereby impeding the proliferation of RCC cells and xenografts. 4. Discussion In current medical practice, the treatment of RCC mainly relies on surgical resection. After surgery, doctors will decide whether to use tyrosine kinase inhibitors (TKIs) such as sunitinib and imatinib for adjuvant therapy based on the results of pathological examination [ 13 ] . These first-line clinical anti-cancer drugs and targeted drugs can efficaciously obstruct the growth and spread of neoplasm cells, thereby improving the therapeutic role. For those patients who cannot tolerate surgical treatment, that is, those who have developed to advanced stages and have metastasis, making radical surgical resection impossible in the advanced stage of the tumor, they provide additional alternative treatment methods [ 13 , 14 ] . Although there are relatively complete regimens for targeted therapy, immunotherapy, and combined target-immune therapy in RCC patients [ 15 , 16 ] , in actual clinical work, the side effects of their treatment often make patients intolerable, and they have to stop treatment [ 17 , 18 ] . Drug-related damage during treatment sometimes endangers the stability of vital signs, while traditional Chinese medicine has stable efficacy and better safety in this regard [ 19 – 21 ] . However, with the widespread application of anti-cancer drugs, some neoplasm cells may develop resistance to certain drugs, resulting in decreased drug sensitivity [ 22 ] . The emergence of this resistance will significantly reduce the anti-tumor efficacy of patients, bringing new challenges to the treatment of RCC patients [ 23 ] . Therefore, the medical community needs to continuously research and develop new drugs and treatment methods to address the problem of neoplasia resistance and improve the survival rate and quality of life of patients. In this experiment, our objective was to validate the anti-cancer activity of lathyrol, with paraplatin chosen as the control drug. Paraplatin, a second-generation platinum-based anti-cancer medication widely employed in clinical settings, is typically utilized in combination with other drugs to constitute a combined chemotherapy regimen for the management of related cancer disorders [ 24 , 25 ] . Its anti-cancer mechanism primarily entails the interaction with DNA. Upon entering the cell, paraplatin can establish cross-links with DNA molecules, particularly interstrand cross-links, thereby interfering with the normal replication and transcription processes of DNA [ 26 ] . Its anti-cancer mechanism primarily entails the interaction with DNA. Upon entering the cell, paraplatin can establish cross-links with DNA molecules, particularly interstrand cross-links, thereby interfering with the normal replication and transcription processes of DNA [ 27 , 28 ] . Additionally, the DNA damage caused by paraplatin will also activate the intracellular DNA damage response mechanism, encompassing the activation of the p53 protein [ 28 ] , which, in turn, triggers the apoptotic program and inhibits the proliferation of cancer cells, leading to the demise of cancer cells [ 27 , 29 ] . These mechanisms of paraplatin render it one of the efficacious drugs for the treatment of diverse cancers [ 30 , 31 ] . Hence, to compare the anti-cancer effect and mechanism of lathyrol, we employed paraplatin as the control group to verify the treatment outcomes of lathyrol against RCC. Through the preliminary investigation, we discovered that lathyrol possesses the capability of impeding the activity of RCC cells in both in vitro and in vivo settings, and established the regression equation between cell activity and drug concentration via the results of the CCK-8 experiment. Concurrently, we compared the statistical disparities in the specific IC values of human RCC 786-O cells and mouse RCC renca cells, and the findings indicated that there was no significant statistical difference between the two, suggesting that the therapeutic effects of lathyrol in 786-O cells and renca cells are comparable to a certain extent. Therefore, to more realistically simulate the in vivo environment, renca cells and partially immunosuppressed BALB/c mice were ultimately selected to construct an RCC xenograft animal model, and subsequent experiments were conducted to more clearly detect the phenotypic attenuation of lathyrol in the corresponding species in the in vivo environment for the treatment of RCC xenografts. In the TGF-β/smad signaling pathway transduction system, TGF-β1 and TGF-βR1, serving as the initiating elements of this pathway, exert a crucial role in the activation and operation of the entire route [ 6 , 32 ] , Meanwhile, smad2, smad3, and smad4 are significant cascade effector factors of this pathway, connecting the precedent and the subsequent, and the smad2/3/4 complex is also an essential protein that enters the nucleus and exerts the regulatory transcriptional function of this pathway [ 33 , 34 ] . Smad6 and smad7 possess similar functions, primarily playing a role in negative feedback regulation and reducing the signal transduction of the pathway [ 35 , 36 ] . The mechanism through which smad9 promotes tumorigenesis and development remains unclear, yet the expression of smad9 in tumor diseases is directly proportional to its malignancy and inversely proportional to the prognosis of patients [ 37 – 39 ] . Under in vitro experimental circumstances, we assessed the expression of certain proteins in the TGF-β/smad signaling pathway of RCC cells and RCC xenograft tumors. The outcomes demonstrated that following treatment with lathyrol and paraplatin, the expression of essential proteins in the TGF-β/smad signaling pathway of renca cells, encompassing smad2, smad3, smad4, and smad9, was inhibited. In contrast, the expression of TGF-β1, TGF-βR1, and smad6 proteins exhibited an upward trend. Nevertheless, at the gene expression level, the expression pattern of mRNA is distinct from the Western blot detection results at the protein level. After treatment with lathyrol and paraplatin, the mRNA expression of smad6 and smad9 in renca cells decreased, while the mRNA expression of TGF-β1, TGF-βR1, smad2, smad3, and smad4 increased. In in vivo experiments, the expression trends of marker proteins and mRNA in the TGF-β/smad signaling pathway of mice RCC xenograft cancer were consistent, indicating that the mRNA and protein expression of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9 decreased, while the expression of smad6 protein increased, although its mRNA expression decreased. Interestingly, lathyrol attenuates the expression of certain proteins in the TGF-β/smad signaling pathway and promotes the expression of inhibitory smad (I-smad) proteins in both in vivo and in vitro environments, thereby inhibiting the signal transmission and regulatory function of the TGF-β/smad pathway in RCC cells and exerting the corresponding anti-cancer effects [ 40 , 41 ] . However, in the in vitro environment, lathyrol primarily blocks the function of the TGF-β/smad pathway by reducing the translation and synthesis of proteins in the pathway; while in the in vivo environment, it further retards protein synthesis by inhibiting the mRNA transcription function of genes encoding proteins in the TGF-β/smad pathway to exert its role. In the life activities of cells, ensuring the normal operation of the cell cycle is of vital importance for cell proliferation and functional performance [ 42 ] . Similarly, in the treatment of malignant diseases, by interfering with the cell cycle process of malignant cells, the proliferation of cancer cells can be effectively reduced, apoptosis can be induced, and malignant behaviors such as the infiltration of cancer cells can be suppressed [ 43 , 44 ] . The TGF-β/smad pathway has a significant impact on the normal operation of the cell cycle [ 45 , 46 ] , and by influencing the signal transduction of the TGF-β/smad pathway, the cell cycle of tumor cells can be disrupted, thereby suppressing the malignant behavior of carcinoma cells [ 47 , 48 ] , which is also an essential point we plan to explore. The cell cycle comprises four main stages: the G1 phase before DNA synthesis, the S phase of DNA synthesis, the G2 phase after DNA synthesis, and the M phase of mitosis [ 49 ] . Throughout the cell cycle, the regulatory molecules include cyclin, cyclin-dependent kinase (CDK), and cyclin-dependent kinase inhibitor (CKI) [ 50 ] , which together constitute the cyclin-CDK-CKI regulatory network [ 51 – 53 ] . The cyclin protein binds to the corresponding CDK, forming a necessary checkpoint in the cell cycle [ 54 ] , and we discovered that both lathyrol and paraplatin can affect the expression of cyclin proteins, which play a blocking role in the cell cycle, and also impact the expression of cell cycle regulatory proteins CDK and CKI, indirectly influencing the normal operation of the RCC cell cycle through WB (Western Blot) and IHC/ICC (immunohistochemistry/immunocytochemistry) analysis. More specifically, after treatment with lathyrol and paraplatin, the expression levels of cyclinD1, cyclinE1, and cyclinA1 proteins in renca cells and mice xenograft tumors decreased, while the expression of CDK4, CDK6, CDK2, and CDK1 proteins also decreased. In contrast, the expression levels of CKI proteins P16, P27, and P21 increased. Additionally, the effect of lathyrol and paraplatin on the expression of cyclinB1 protein is relatively minor, indicating that these two compounds mainly exert a role in blocking the cell cycle of renal cell carcinoma (RCC) cells before the M phase of the cell cycle. It is worth noting that in vitro experiments, the restrictive significance of lathyrol on the expression of cyclinD1, cyclinE1, and cyclinA1 proteins is not as prominent as that of paraplatin. However, in vivo experiments, the inhibitory effect of lathyrol on the expression of cyclinD1 protein is slightly stronger than that of paraplatin, while the decreasing effect on the expression of cyclinA1 protein is weaker than that of paraplatin. For cyclinE1 protein, there is no significant difference in the repressing effect of the two on expression. Based on these findings, we hypothesize that paraplatin, as a widely utilized anticancer drug, may possess a more significant therapeutic function than lathyrol. Notwithstanding, via the cell cycle schematic diagram (Fig. 7 N), we contemplated that both medications can directly hinder RCC cells from entering the G1/S phase, impede DNA synthesis (S phase), and obstruct the G2/M checkpoint of cells in vitro, thereby influencing the advancement of the cell cycle. In the in vivo milieu, paraplatin can also inhibit the expression of cyclinD1 protein in renca cells, but its inhibitory effects on cyclinE1 and cyclinA1 proteins are more efficacious than that of lathyrol. This discovery implies that lathyrol might primarily exert a fundamental role in blocking the G1 phase of the cell cycle in the in vivo setting, while paraplatin might mainly play a blocking role in the S and G2 phases of RCC cells. These outcomes also suggest that lathyrol has comparable anti-cancer effects and mechanisms to clinical anti-cancer drugs in both in vivo and in vitro circumstances. Additionally, considering that lathyrol is capable of promoting the expression of P16, P21, and P27 in renca cells in both in vivo and in vitro environments, we surmise that this compound drug can enhance the aging process of cancer cells by exerting its inherent tumor suppressor significance, and it may also impact the senescence-associated secretory phenotype (SASP) in the in vivo environment, thereby influencing the immune function of the body, that is, regulating the immune aging and carcinoma immune function of the body [ 55 ] . Ultimately, we undertook an exhaustive examination of the effects of lathyrol and paraplatin on the proliferation phenotype of renal cancer renca cells. The experimental outcomes demonstrated that both compounds could appreciably impede the proliferation of renca cells and mice RCC xenografts. To further validate this discovery, we gauged the expression levels of PCNA and ki67. As crucial markers of cell proliferation function, the reduction in their expression further affirmed the anti-cancer effects of lathyrol and paraplatin on cell proliferation. Additionally, by observing mouse RCC xenografts via HE staining, we discerned that following treatment with lathyrol and paraplatin, partial tissue necrosis and cell lysis transpired in the RCC xenografts. The proliferation and apoptosis of cancer cells exert a crucial role in tumorigenesis, development, and treatment. In the realm of oncology research, Ki67, as a nuclear protein closely affiliated with the cell cycle, holds significant significance in its function and mechanism in oncology. As an important indicator to define cell apoptosis and proliferation, in addition to being capable of sensitively reflecting the cells in the proliferative stage in tumor tissues, it can also disclose the growth rate and potential invasive capacity of cells. Elevated Ki67 expression is typically associated with high proliferative activity of carcinoma cells and unfavorable prognosis, and the higher the positive rate of Ki67, the greater the proportion of tumor cells in the growth cycle, and the higher the malignancy of the carcinoma. Hence, in clinical practice, the expression level of Ki67 has emerged as one of the significant biomarkers for evaluating the malignancy of neoplasms and forecasting the prognosis of cancer patients [ 56 , 57 ] . Its expression level can be modulated by diverse intracellular and extracellular factors, such as growth factors, hormones, and cyclins, and may also be influenced by various factors such as tumor type, pathological grade, patient age, and gender, resulting in varying degrees of expression outcomes [ 58 , 59 ] . PCNA (proliferating cell nuclear antigen) is a protein that assumes a pivotal role in the cell cycle, particularly in DNA replication and cell proliferation [ 60 ] . As a marker of cell proliferation, the expression level of PCNA is generally correlated with the proliferative activity and prognosis of cancers. PCNA participates in the regulation of DNA replication and the process of DNA damage repair by interacting with various proteins. In neoplastic cells, due to certain genetic or epigenetic alterations, the expression level of PCNA may be upregulated, leading to accelerated DNA replication, uncontrolled cell proliferation, and ultimately facilitating tumor growth [ 61 ] . Furthermore, the expression level of PCNA is stringently regulated by the cell cycle, commencing to ascend at the G1/S transition and reaching a peak in the S phase [ 62 ] . Moreover, as one of the markers for assessing the proliferative status of cells, PCNA is closely associated with the proliferative activity and DNA damage repair capacity of cancer cells, and its expression level is frequently utilized as an indicator for tumor prognosis evaluation. Similar to ki67, high expression of PCNA typically implies a higher neoplasm recurrence rate and unfavorable prognosis [ 63 , 64 ] . The results demonstrated that in vitro experiments, the expression of ki67 decreased following the intervention of renca cells by lathyrol and cisplatin. In vivo experiments, after in vivo intervention in mice with RCC xenografts, the expression of PCNA protein and ki67 protein decreased. Combined with the cck-8 results, it can be deduced that lathyrol can impede the proliferative ability of RCC renca cells xenograft neoplasms, and exert an anti-cancer effect similar to that of clinical drugs. Its mechanism might be related to lathyrol influencing the TGF-β/smad signaling pathway of renca cells, thereby suppressing the expression of crucial regulatory proteins in the cell cycle. In conclusion, we initially discovered that lathyrol could impede the signal transduction of the TGF-β/smad signaling pathway by influencing the expression of elemental proteins within the pathway, arresting the cell cycle progression of renca cells, and thereby affecting the proliferation of renca cells. Generally, lathyrol and paraplatin have demonstrated significant effects in hindering the proliferation of renal cancer renca cells and mouse RCC xenografts, offering a new research direction and potential treatment alternatives for renal cancer therapy. Nevertheless, with regard to the application of lathyrol in the treatment of RCC patients, further exploration is still necessary. On the one hand, solely targeting the TGF-β/smad signaling pathway for medical intervention may not be the most favorable option. Bioinformatics data indicate that in RCC patients, low expression of TGF-β/smad signaling pathway-related marker target genes may also have a detrimental effect on the prognosis of patients and reduce survival rates. Additionally, in terms of gene expression differences, the expression of TGF-β/smad signaling pathway target genes in normal tissues is sometimes even higher than that in tumor tissues, suggesting that the occurrence of RCC is not always attributed to abnormal activation of the TGF-β/smad signaling pathway. Hence, we still need to further investigate the mechanism of occurrence and development of RCC. On the other hand, our research also has limitations. From the results, lathyrol, as a potential multi-target anti-cancer drug, may affect the cell cycle progression of RCC cells by influencing the signal transduction of the TGF-β/smad pathway, or by directly influencing the expression of cyclin proteins and cell cycle regulatory proteins CDK and CKI in the cell cycle. Furthermore, although we have detected the protein and mRNA expression levels of the marker targets of the TGF-β/smad signaling pathway, for other targets of lathyrol and paraplatin, as well as the mRNA and protein expression of cell cycle and proliferation phenotype markers, further exploration is still required. As medical technology progresses continuously, the analysis of the active ingredients of traditional Chinese medicine and its therapeutic mechanism has gradually become clearer and more transparent [ 65 ] . Through the continuous exploration and application of modern medical technology, the potential of traditional Chinese medicine in the treatment field has been further explored and utilized, and we can also have a deeper understanding of the composition and mechanism of action of traditional Chinese medicine, thereby providing a new treatment idea and method for tumor patients [ 66 ] . Currently, some scholars and researchers have explored and found that traditional Chinese medicine can not only directly suppress and kill neoplastic cells through its own active ingredients, but also have an indirect killing effect on cancer cells by improving the overall physical condition of patients and enhancing the immunity of the body [ 67 ] . This indirect effect is mainly achieved by improving the immune function of the body, enabling the body's own immune system to more effectively identify and attack cancer cells, thereby achieving the purpose of inhibiting cancer proliferation and invasion [ 68 , 69 ] . Several clinical workers have also found that by combining first-line anti-cancer drugs and traditional Chinese medicine, the efficacy of cancer patients can be improved and the prognosis of patients can be improved [ 70 , 71 ] . Therefore, using traditional Chinese medicine to prevent the proliferation and invasion ability of tumors and improve the survival prognosis of patients has become an effective alternative treatment method [ 72 ] . This method will not only provide new hope for those patients who are not sensitive or intolerant to traditional Western medicine treatment methods, but also provide an adjuvant treatment method for patients who have already received Western medicine treatment, helping them recover better and improve their quality of life. 5. Conclusion Based on the above analysis, lathyrol exhibited significant anti-cancer activity in vitro and in vivo experiments. Its mechanism of action may involve the modulation of the expression of marker proteins in the TGF-β/smad signaling pathway. We infer that lathyrol inhibits the signal transduction of this pathway, thereby blocking the cell cycle progression of renca cells, and thereby preventing the proliferation of RCC cells. Declarations Data availability The authors assert that the data underpinning the findings of this study are accessible within the paper and its Supplementary Information files. In the event that any raw data files are required in an alternative format, they can be obtained from the corresponding author upon a reasonable request. AI statement In the course of the preparation of this work, the authors utilized Newidea academic tools (https://ai.helixlife.cn/) to verify and rectify grammar. Subsequent to using this tool, the authors examined and edited the content as necessary and assume full accountability for the content of the published article. Acknowledgments I would like to express my sincere gratitude to my tutor, Professor Junfeng Zhao, for his invaluable guidance and encouragement throughout my research journey. I am also deeply appreciative of Professor Lu Wang for her substantial support and motivation in my academic endeavors. Their mentorship has been instrumental in the completion of this work. COI statement All authors declare that there are no competing interests. Funding information No funding organizations, all research funding was provided by corresponding authors. CRediT author statement Shengyou Song : Conceptualization, Methodology, Validation, Formal analysis, Investigation, Resources, Data Curation, Writing - Original Draft, Visualization, Project administration. Yalin Song# : Conceptualization, Project administration. Writing- Reviewing and Editing, Supervision, Funding acquisition References [Chinese expert consensus on the systemic treatment of advanced clear cell renal cell carcinoma (2024 edition)][J]. Zhonghua Zhong Liu Za Zhi, 2024, 46(9): 844-854. Gontero P, Birtle A, Capoun O, et al. European Association of Urology Guidelines on Non-muscle-invasive Bladder Cancer (TaT1 and Carcinoma In Situ)-A Summary of the 2024 Guidelines Update[J]. Eur Urol, 2024. Zhao S, Song C, Chen F, et al. LncRNA XIST/miR-455-3p/HOXC4 axis promotes breast cancer development by activating TGF-β/SMAD signaling pathway[J]. Funct Integr Genomics, 2024, 24(5): 159. Lu J, Li Z, Liu X, et al. Tiaogan Bushen Xiaoji Formula Enhances the Sensitivity of Estrogen Receptor- Positive Breast Cancer to Tamoxifen by Inhibiting the TGF-β/SMAD Pathway[J]. Cancer Manag Res, 2024, 16: 1189-1204. Qi C, Lyu M, Yao Z, et al. SVIL promotes ovarian cancer progression and epithelial-mesenchymal transition under hypoxic conditions through the TGF-β/Smad pathway[J]. Gynecol Oncol, 2024, 190: 167-178. Xin X, Cheng X, Zeng F, et al. The Role of TGF-β/SMAD Signaling in Hepatocellular Carcinoma: from Mechanism to Therapy and Prognosis[J]. Int J Biol Sci, 2024, 20(4): 1436-1451. Li J, Gao L, Wang A, et al. Forkhead box L2 is a target of miR-133b and plays an important role in the pathogenesis of non-small cell lung cancer[J]. Cancer Med, 2023, 12(8): 9826-9842. Cheng Y, Heng X, Feng F. G-protein Coupled Receptor 34 Promotes Gliomagenesis by Inducing Proliferation and Malignant Phenotype via TGF-Beta/Smad Signaling Pathway[J]. Technol Cancer Res Treat, 2022, 21: 15330338221105733. Yang T, Wang S, Li H, et al. Lathyrane diterpenes from Euphorbia lathyris and the potential mechanism to reverse the multi-drug resistance in HepG2/ADR cells[J]. Biomed Pharmacother, 2020, 121: 109663. Commission C P. chinese pharmacopoeia[M]. Beijing:: China Medical Science and Technology Press, 2020. Yan Y, Zhou W, Guo Q, et al. Effect of lathyrol derivatives on non-small cell lung cancer and the possible mechanism[J]. Zhong Nan Da Xue Xue Bao Yi Xue Ban, 2022, 47(2): 143-152. Song S, Tai L, Xu Y, et al. Lathyrol reduces the RCC invasion and incidence of EMT via affecting the expression of AR and SPHK2 in RCC mice[J]. Discov Oncol, 2024, 15(1): 264. Osorio L, Grazioso T P, De Velasco G, et al. Retrospective study assessing the role of the androgen receptor in clear cell renal cell cancer patients treated with VEGFR inhibitors in monotherapy[J]. Clin Transl Oncol, 2024. Angulo J C, Larrinaga G, Lecumberri D, et al. Predicting Survival of Metastatic Clear Cell Renal Cell Cancer Treated with VEGFR-TKI-Based Sequential Therapy[J]. Cancers (Basel), 2024, 16(16). Tsuboi I, Araki M, Yokoyama S, et al. Sequential therapy for hereditary leiomyomatosis and renal cell cancer-associated renal cell carcinoma: a case report and report of a new family pedigree[J]. Oxf Med Case Reports, 2024, 2024(8): omae060. Cano Garcia C, Hoeh B, Mandal S, et al. First-Line Immune Combination Therapies for Nonclear Cell Versus Clear Cell Metastatic Renal Cell Carcinoma: Real-World Multicenter Data From Germany[J]. Clin Genitourin Cancer, 2024, 22(4): 102112. Dri A, Garattini S K, Cinausero M, et al. Rare and Insidious Toxicities from New Combination Therapies in Metastatic Renal Cell Cancer: Lessons Learned from Real-Practice[J]. Curr Oncol, 2022, 29(10): 6776-6786. Albarakat M M, Ahmed Y B, Alshwayyat S, et al. The efficacy and safety of cabozantinib in patients with metastatic or advanced renal cell carcinoma: a systematic review and meta-analysis[J]. Proc (Bayl Univ Med Cent), 2024, 37(5): 822-830. Bao Z, Wu G, Du J, et al. The comparative efficacy and safety of 9 traditional Chinese medicines combined with standard quadruple therapy for Helicobacter pylori-associated gastritis: a systematic review and network meta-analysis[J]. Ann Transl Med, 2022, 10(24): 1349. Chen L, Zhang Y, Li J, et al. Efficacy and safety of traditional Chinese medicine in managing bone loss post-endocrine therapy in hormone receptor-positive breast cancer patients[J]. Medicine (Baltimore), 2024, 103(41): e39961. Niu X, Gu H, Li J, et al. Efficacy and safety of Atractylodes macrocephala-containing traditional Chinese medicine combined with neoadjuvant chemotherapy in the treatment of advanced gastric cancer: a systematic evaluation and meta-analysis[J]. Front Oncol, 2024, 14: 1431381. Aweys H, Lewis D, Sheriff M, et al. Renal Cell Cancer - Insights in Drug Resistance Mechanisms[J]. Anticancer Res, 2023, 43(11): 4781-4792. Li L, Zhao S, Liu Z, et al. Sunitinib treatment promotes metastasis of drug-resistant renal cell carcinoma via TFE3 signaling pathway[J]. Cell Death Dis, 2021, 12(2): 220. Ye H, Xue K, Zhang P, et al. Three vs 6 Cycles of Chemotherapy for High-Risk Retinoblastoma: A Randomized Clinical Trial[J]. Jama, 2024. Santoro A, Pilar G, Tan D S W, et al. Spartalizumab in combination with platinum-doublet chemotherapy with or without canakinumab in patients with PD-L1-unselected, metastatic NSCLC[J]. BMC Cancer, 2024, 24(1): 1307. Platinum Coordination Complexes, LiverTox: Clinical and Research Information on Drug-Induced Liver Injury, Bethesda (MD): National Institute of Diabetes and Digestive and Kidney Diseases, 2012. Fahmy S A, Sedky N K, Hassan H, et al. Synergistic Enhancement of Carboplatin Efficacy through pH-Sensitive Nanoparticles Formulated Using Naturally Derived Boswellia Extract for Colorectal Cancer Therapy[J]. Pharmaceutics, 2024, 16(10). Fathy M, El-Hallouty S M, Mansour A S, et al. The Anti-proliferative Effect, Apoptotic Induction, and Cell Cycle Arrest of Tetra Halo Ruthenate Nanocomposites in Different Human Cancer Cell Lines[J]. Cell Biochem Biophys, 2024. Nafees M, Hanif M, Muhammad Asif Khan R, et al. A Dual Action Platinum(IV) Complex with Self-assembly Property Inhibits Prostate Cancer through Mitochondrial Stress Pathway[J]. ChemMedChem, 2024: e202400289. Bestvina C M, Hara J H L, Karrison T, et al. DARES: A Phase II Trial of Durvalumab and Ablative Radiation in Extensive-Stage Small Cell Lung Cancer[J]. Clin Lung Cancer, 2024. Yin L, Jiang W, Liu S, et al. Efficacy and safety of nanoparticle albumin-bound paclitaxel plus carboplatin as neoadjuvant chemotherapy for stages III-IV, unresectable ovarian cancer: a single-arm, open-label, phase Ib/II study[J]. BMC Med, 2024, 22(1): 496. Liu H, Sun M, Wu N, et al. TGF-β/Smads signaling pathway, Hippo-YAP/TAZ signaling pathway, and VEGF: Their mechanisms and roles in vascular remodeling related diseases[J]. Immun Inflamm Dis, 2023, 11(11): e1060. Peng B, Cheng S, Wang H, et al. N(6)-methyladenosine enhances the expression of TGF-β-SMAD signaling family to inhibit cell growth and promote cell metastasis[J]. Cancer Lett, 2024, 603: 217195. Tirpude N V, Sharma A, Joshi R, et al. Vitex negundo Linn. extract alleviates inflammatory aggravation and lung injury by modulating AMPK/PI3K/Akt/p38-NF-κB and TGF-β/Smad/Bcl2/caspase/LC3 cascade and macrophages activation in murine model of OVA-LPS induced allergic asthma[J]. J Ethnopharmacol, 2021, 271: 113894. Zhang X, Hu Z, Wang X, et al. ANXA10 promotes melanoma metastasis by suppressing E3 ligase TRIM41-directed PKD1 degradation[J]. Cancer Lett, 2021, 519: 237-249. Voytyuk O, Ohata Y, Moustakas A, et al. Smad7 palmitoylation by the S-acyltransferase zDHHC17 enhances its inhibitory effect on TGF-β/Smad signaling[J]. J Biol Chem, 2024, 300(7): 107462. Zhao J, Tang X, Zhu H. Chondroitin polymerizing factor (CHPF) promotes the progression of colorectal cancer through ASB2-mediated ubiquitylation of SMAD9[J]. Histol Histopathol, 2024, 39(11): 1493-1503. Tan K, Mo J, Li M, et al. SMAD9-MYCN positive feedback loop represents a unique dependency for MYCN-amplified neuroblastoma[J]. J Exp Clin Cancer Res, 2022, 41(1): 352. Chen Y, Li E, Chang Z, et al. Identifying potential therapeutic targets in lung adenocarcinoma: a multi-omics approach integrating bulk and single-cell RNA sequencing with Mendelian randomization[J]. Front Pharmacol, 2024, 15: 1433147. Wang S, Li Y, Jin K, et al. PSME3 promotes lung adenocarcinoma development by regulating the TGF-β/SMAD signaling pathway[J]. Transl Lung Cancer Res, 2024, 13(6): 1331-1345. Cao J P, Yan Y, Li X S, et al. Oroxylin A suppressed colorectal cancer metastasis by inhibiting the activation of the TGF-β/SMAD signal pathway[J]. Sci Rep, 2024, 14(1): 24091. Li J, Huang X, Luo L, et al. The role of p53 in male infertility[J]. Front Endocrinol (Lausanne), 2024, 15: 1457985. Song G, Liu J, Tang X, et al. Cell cycle checkpoint revolution: targeted therapies in the fight against malignant tumors[J]. Front Pharmacol, 2024, 15: 1459057. Selvaraj C. Therapeutic targets in cancer treatment: Cell cycle proteins[J]. Adv Protein Chem Struct Biol, 2023, 135: 313-342. Chen C, Chen J, Wang Y, et al. Ganoderma lucidum polysaccharide inhibits HSC activation and liver fibrosis via targeting inflammation, apoptosis, cell cycle, and ECM-receptor interaction mediated by TGF-β/Smad signaling[J]. Phytomedicine, 2023, 110: 154626. Xie L, Huang L, Zhang G, et al. Inhibition of keloid by (32)P isotope radiotherapy through suppressing TGF-β/Smad signaling pathway[J]. Aging (Albany NY), 2023, 15(21): 11985-11993. Chen L, Fang W, Chen W, et al. Deciphering the molecular mechanism of the THBS1 gene in the TNF signaling axis in glioma stem cells[J]. Cell Signal, 2023, 106: 110656. Du T, Zhang K, Zhang Z, et al. ITGBL1 transcriptionally inhibited by JDP2 promotes the development of pancreatic cancer through the TGF-beta/Smad pathway[J]. Braz J Med Biol Res, 2022, 55: e11989. Wang C, Xu J, Liu M, et al. [Relationship between GTSE1 and Cell Cycle and Potential Regulatory Mechanisms in Lung Cancer Cells][J]. Zhongguo Fei Ai Za Zhi, 2024, 27(6): 451-458. Manousakis E, Miralles C M, Esquerda M G, et al. CDKN1A/p21 in Breast Cancer: Part of the Problem, or Part of the Solution?[J]. Int J Mol Sci, 2023, 24(24). Shaikh M a J, Babu M A, Ghaboura N, et al. Non-coding RNAs: Key regulators of CDK and Wnt/β-catenin signaling in cancer[J]. Pathol Res Pract, 2024, 263: 155659. Yang L, Liu Y, Guo R, et al. CDK4 gene copy number increase and concurrent genetic changes in acral melanoma of a Chinese cohort[J]. Pathology, 2024. Burns M C, Borgal L. Asp/ASPM phospho-regulation throughout the cell cycle[J]. Genome, 2024. Pathania A S, Chava H, Balusu R, et al. The crosstalk between non-coding RNAs and cell-cycle events: A new frontier in cancer therapy[J]. Mol Ther Oncol, 2024, 32(2): 200785. Devulder J V. Unveiling mechanisms of lung aging in COPD: A promising target for therapeutics development[J]. Chin Med J Pulm Crit Care Med, 2024, 2(3): 133-141. Menon S S, Guruvayoorappan C, Sakthivel K M, et al. Ki-67 protein as a tumour proliferation marker[J]. Clin Chim Acta, 2019, 491: 39-45. Yerushalmi R, Woods R, Ravdin P M, et al. Ki67 in breast cancer: prognostic and predictive potential[J]. Lancet Oncol, 2010, 11(2): 174-83. Probert J, Dodwell D, Broggio J, et al. Ki67 and breast cancer mortality in women with invasive breast cancer[J]. JNCI Cancer Spectr, 2023, 7(5). Zhang A, Wang X, Fan C, et al. The Role of Ki67 in Evaluating Neoadjuvant Endocrine Therapy of Hormone Receptor-Positive Breast Cancer[J]. Front Endocrinol (Lausanne), 2021, 12: 687244. Zhu X, Wu J, Chen X, et al. DNA ligase III mediates deoxynivalenol exposure-induced DNA damage in intestinal epithelial cells by regulating oxidative stress and interaction with PCNA[J]. Int J Biol Macromol, 2024: 137137. Wang Y, Fernandez A, Pei X, et al. EGFR-mediated HSP70 phosphorylation facilitates PCNA association with chromatin and DNA replication[J]. Nucleic Acids Res, 2024. Porras-Gómez T J, Moreno-Mendoza N. Identification of the proliferative activity of germline progenitor cells in the adult ovary of the bat Artibeus jamaicensis[J]. Zygote, 2024: 1-10. Gu L, Li M, Li C M, et al. Small molecule targeting of transcription-replication conflict for selective chemotherapy[J]. Cell Chem Biol, 2023, 30(10): 1235-1247.e6. Simoneau A, Engel J L, Belti M, et al. Ubiquitinated PCNA Drives USP1 Synthetic Lethality in Cancer[J]. Mol Cancer Ther, 2023, 22(2): 215-226. Wang Y N, Zhai X Y, Wang Z, et al. Jianpi-Huatan-Huoxue-Anshen formula ameliorates gastrointestinal inflammation and microecological imbalance in chemotherapy-treated mice transplanted with H22 hepatocellular carcinoma[J]. World J Gastrointest Oncol, 2024, 16(10): 4209-4231. Zhang H, Tang J, Cao H, et al. Effect and mechanism of Magnolia officinalis in colorectal cancer: multi-component-multi-target approach[J]. J Ethnopharmacol, 2024: 119007. Pan B, Zhu H, Yang J, et al. From complexity to clarity: development of CHM-FIEFP for predicting effective components in Chinese herbal formulas by using big data[J]. Cancer Biol Med, 2024. Hu W W, Chen Y, Cai C K, et al. A case report of effective treatment of intracranial atherosclerotic stenosis treated with the integration of traditional Chinese medicine and Western medicine[J]. Medicine (Baltimore), 2024, 103(41): e40055. Cai W J, Chen R R, Liu Z B, et al. Prognostic Prediction and Immune Microenvironment Characterization in Uveal Melanoma: A Novel Mitochondrial Metabolism-Related Gene Signature[J]. ACS Omega, 2024, 9(42): 43034-43045. Jiang Y, Liu F F, Cai Y Q, et al. Oral Decoctions Based on Qi-Yin Syndrome Differentiation After Adjuvant Chemotherapy in Resected Stage ΙΙΙA Non-Small Cell Lung Cancer: A Randomized Controlled Trial[J]. Integr Cancer Ther, 2024, 23: 15347354241268271. Tang Z, Zhou P, Sun H. Clinical Efficacy of Yiqi Yangyin Decoction Combined with Adjuvant Chemotherapy on the Postoperative Life Quality of Breast Cancer[J]. Nutr Cancer, 2024, 76(9): 824-830. Sun J R, Lou Y N, Huang R, et al. Predictive value of TCM tongue characteristics for chemotherapy-induced myelosuppression in patients with lung cancer[J]. Medicine (Baltimore), 2024, 103(15): e37636. Additional Declarations No competing interests reported. Supplementary Files Highlight.docx WBrawbelt1.pdf checklist.docx StatementofNonduplication.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6122802","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":422210576,"identity":"f7c37a8c-4068-461a-a793-094e012505c7","order_by":0,"name":"Shengyou Song","email":"","orcid":"","institution":"Shandong provincial hospital","correspondingAuthor":false,"prefix":"","firstName":"Shengyou","middleName":"","lastName":"Song","suffix":""},{"id":422210577,"identity":"2482ca2f-8052-4f07-b43f-b8b30e67b72f","order_by":1,"name":"Yalin Song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIie3RuwrCMBgF4JRAXH51jTf6CoFAVRR9lYrg1M1JFByEuqizi6+RXQq6BOeCi5dRBzsouoipOKeOgjnTGc4HfwhCJia/mwogjJc71SDzJaGAUn6bxYR8S9RWOjSuicQeT4MTDGixTF2nd/UaRYLw/hBqCJObTg1WFKpzt7MtibY6jHDu6Qj1HA6EAgvd1TYnsCJACjpiz2PyjEnL7+bEMJmg0OPHtK+IDIgViSCZMCkdazFTZO3jgiXWQHDCW+zxhF/Ot3qTBdkoeoh+M5sa7Y/aw9RH5OHT8Ltg/fw9ie6fZt21QxMTE5N/zQsPVEIGRfHmAQAAAABJRU5ErkJggg==","orcid":"","institution":"Zaozhuang Municipal Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yalin","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2025-02-27 16:38:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6122802/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6122802/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":77577258,"identity":"73bc798a-b340-4797-8689-31ddf78eedd8","added_by":"auto","created_at":"2025-03-03 09:20:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":320329,"visible":true,"origin":"","legend":"\u003cp\u003eBioinformatics gene expression and clinical prognosis analysis of the main target proteins of the TGF-β/smad signaling pathway. Part A presents the bioinformatics gene expression results of TGF-β1, TGF-βR1, smad1, smad2, smad3, smad4, smad6, and smad9 proteins, a for TGF-β1, b for TGF-βR1, c for smad1, d for smad2, e for smad3, f for smad4, g for smad6, h for smad9. Part B shows the simple heatmap integration of the gene expression results. Part C shows the clinical prognosis analysis of the gene expression of TGF-β1, TGF-βR1, smad1, smad2, smad3, smad4, smad6, and smad9, a for TGF-β1, b for TGF-βR1, c for smad1, d for smad2, e for smad3, f for smad4, g for smad6, h for smad9.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/95e46ad9cb473aa728d87bf9.png"},{"id":77577251,"identity":"15ad9c80-a961-4f75-87f2-739bd268761c","added_by":"auto","created_at":"2025-03-03 09:20:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":24286337,"visible":true,"origin":"","legend":"\u003cp\u003eAfter 24 hours of lathyrol treatment, the experimental results of 786-O cells and renca cells showed that the compound had an inhibitory effect on the activity of these two cells. Due to the poor solubility of lathyrol in water, an appropriate amount of DMSO was used as a cosolvent. In order to evaluate the effect of DMSO on cell viability, we compared the viability of RCC cells cultured in a medium containing 1% DMSO with that of RCC cells cultured in a normal medium. The results showed that there was no significant difference in cell viability between the two groups, so in subsequent experiments, different concentrations of the drug were added to the medium containing 1% DMSO. Parts C and D show the regression curve equations between the activity of 786-O cells and renca cells and the drug concentration based on the results of the CCK-8 assay. Part E then calculates the drug concentration required to reach a specific inhibitory concentration (IC value) based on these equations. Finally, part F performs statistical analysis on the drug concentration data of the two cells in part E.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/25b60b4d1da04b0cfb92e9a6.png"},{"id":77577255,"identity":"d8461763-8c81-4d30-80ac-993e691f0ffe","added_by":"auto","created_at":"2025-03-03 09:20:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":282412,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental analysis of the impact of lathyrol on the expression of TGF-β/smad pathway proteins and mRNA in renca cells. Part A presents the detection outcome of TGF-β1 and TGF-βR1 protein expression, which was determined through the WB experiment. a represents the WB band, while b and c constitute the statistical analysis. Part B displays the detection result of smad2, smad3, and smad4 protein expression, with the experimental approach being identical to A. a indicates the WB band, and b, c, and d represent the statistical analysis. Part C showcases the detection result of smad6 protein expression, where the experimental method is ICC. a is the result of low magnification, b is the outcome of high magnification, and c and d respectively denote the statistical analysis results of the AOD value. Part D presents the detection result of smad9 protein expression, with the experimental method and parts a, b, c, and d being the same as C. Part E is the mRNA expression result of TGF-β1, TGF-βR1, smad2, smad3, smad4, smad6, and smad9 proteins in renca cells, with a for TGF-β1, b for TGF-βR1, c for smad2, d for smad3, e for smad4, f for smad6, and g for smad9.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/b6ae7324a2173f69c90f49b8.png"},{"id":77577249,"identity":"c21d7d3e-240a-49b8-8b2c-b92154543878","added_by":"auto","created_at":"2025-03-03 09:20:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":368228,"visible":true,"origin":"","legend":"\u003cp\u003eICC and WB experiments were conducted to examine the effect of lathyrol on the expression of cell cycle regulatory proteins. Components A-I display the outcomes of the ICC experiment. The a depicts the observation findings under a low-power microscope, while figure b showcases the observation results under a high-power microscope; figures c and d respectively represent the statistical analysis results of the AOD value. Part J presents the results of the WB experiment. The a reveals the WB bands, and figures b and c illustrate the corresponding statistical analysis results. A for cyclinD1, B for cyclinA1, C for cyclinB1, D for CDK6, E for CDK4, F for CDK2, G for P16, H for P21, and I for P27. J for cyclinE1 \u0026amp; CDK1.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/67f0ac08a8c788942307af19.png"},{"id":77578652,"identity":"9c083c3c-26ac-4d14-aec4-d7d31f62ec16","added_by":"auto","created_at":"2025-03-03 09:28:43","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":398596,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction and therapeutic results evaluation of mice RCC model. Part A describes the construction process of the mice RCC model. Firstly, the cells were treated with trypsin digestion, and an appropriate amount of mice RCC renca cells was collected, and then these cells were injected subcutaneously into the axilla of mice. After more than one week, the formation of xenografts could be observed in the axilla of mice. When the RCC xenograft volumes of mice in each experimental group were similar, treatment began. Part B shows the RCC xenograft samples isolated from mice in each group after 14 days of treatment. Among them, ① represents the RCC xenograft samples of mice in group A, ② is group B, and ③ is group C. Part C involves the slice analysis of HE (hematoxylin-eosin) pathological staining of RCC xenograft tumors in each group of mice. Part D presents the growth curves of RCC xenografts in each group of mice to evaluate the growth dynamics of the cancers. Part E records the weight changes of mice in each group during the experiment.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/075b3610156811c549c0b62c.png"},{"id":77577275,"identity":"b415ddb3-eddc-411f-a977-dc12998f0832","added_by":"auto","created_at":"2025-03-03 09:20:43","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":552271,"visible":true,"origin":"","legend":"\u003cp\u003ePart A shows the detection result of TGF-β1 protein expression using IHC. a represents the result of low magnification, b represents the result of high magnification, and c and d represent the statistical analysis results of AOD values respectively. Part B shows the detection result of TGF-βR1 protein expression, with the same experimental method and a, b, c, d parts as A. Part C shows the detection result of smad2+3 protein expression, with the same experimental method and a, b, c, d parts as A. Part D shows the detection result of smad6 protein expression, with the same experimental method and a, b, c, d parts as A. Part E shows the detection result of E protein expression, with the same experimental method and a, b, c, d parts as A. Part F shows the WB experimental result, in which a shows the WB band, and b and c show the corresponding statistical analysis results. Part G shows the mRNA expression result of TGF-β1, TGF-βR1, smad2, smad3, smad4, smad6, and smad9 proteins in renca cells, with a for TGF-β1, b for TGF-βR1, c for smad2, d for smad3, e for smad4, f for smad6, and g for smad9.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/33f3f6b9718bc8a3316abcfa.png"},{"id":77577313,"identity":"6a91e4c9-5c9a-4934-b240-530055f4a462","added_by":"auto","created_at":"2025-03-03 09:20:44","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":232155504,"visible":true,"origin":"","legend":"\u003cp\u003eParts A-M present the results of the IHC experiment. Part a displays the observation results under a low-power microscope, and figure b shows the observation results under a high-power microscope; figures c and d respectively represent the statistical analysis results of the AOD value. A for cyclinD1, B for CDK4, C for CDK6, D for cyclinE1, E for CDK2, F for CDK2, G for CDK1, H for cyclinB1, I for P16. J for P21 and K for P27. Part L is a schematic diagram of the cell cycle.\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/ffac2689bf68f52c712e3ed4.png"},{"id":77577277,"identity":"aefeb1f6-12f7-44cd-bbaf-db41acc38ca1","added_by":"auto","created_at":"2025-03-03 09:20:43","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":47839778,"visible":true,"origin":"","legend":"\u003cp\u003eComponents A-B present the outcomes of the ICC experiment, wherein figure a depicts the results under a low-power microscope, and figure b showcases the results under a high-power microscope; figures c and d respectively represent the statistical analysis findings of the AOD value. Components C-D exhibit the results of the WB experiment, where figure a is the WB result band, and figures b and c are the statistical analysis outcomes of the expression of ki67 and PCNA proteins. A designates ki67, B indicates PCNA, and C represents ki67 \u0026amp; PCNA in vivo.\u003c/p\u003e","description":"","filename":"figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/c6ff22c20f2c93205ed3fcd1.png"},{"id":77577250,"identity":"600cc86b-e693-4bf6-9eb1-429eaa0d113f","added_by":"auto","created_at":"2025-03-03 09:20:41","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":11795,"visible":true,"origin":"","legend":"","description":"","filename":"Highlight.docx","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/91a67c2e7e1b3d898ec8a4b9.docx"},{"id":77577268,"identity":"9a26b2a4-900c-447e-9a4d-79f87ea1b3c7","added_by":"auto","created_at":"2025-03-03 09:20:42","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":5609731,"visible":true,"origin":"","legend":"","description":"","filename":"WBrawbelt1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/aedef4872ce33bac3dcf5732.pdf"},{"id":77577257,"identity":"22a9e5a3-1f95-499a-b0fa-00e4523ed294","added_by":"auto","created_at":"2025-03-03 09:20:42","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":11326,"visible":true,"origin":"","legend":"","description":"","filename":"checklist.docx","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/e698e121121b555b650e498b.docx"},{"id":77577253,"identity":"1c50d950-d508-4355-bf1b-195b890ad163","added_by":"auto","created_at":"2025-03-03 09:20:42","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":10785,"visible":true,"origin":"","legend":"","description":"","filename":"StatementofNonduplication.docx","url":"https://assets-eu.researchsquare.com/files/rs-6122802/v1/b126735e1fde7d7fcd58db1a.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Lathyrol inhibits the proliferation of renca cells by affecting the expression of TGF-β/smad pathway and then affecting the cell cycle","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRenal cell carcinoma (RCC) constitutes roughly 2\u0026ndash;3% of adult malignant neoplasms, with a global male-to-female ratio approximately at 1.5:1. It can emerge in all age brackets, with the highest incidence ranging between 60 and 70 years old, and a median age approximately at 64 years\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. Currently, the incidence of RCC is escalating year on year, rendering it the second most prevalent urinary system neoplasm. Despite its lower incidence compared to prostate cancer (PCa), among patients with malignant tumors affecting the urinary system, the prognosis of RCC patients is poorer than that of other urinary system tumor patients\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe TGF-β/smad signaling pathway is a multifunctional cytokine that assumes a vital role in the genesis and development of neoplasms, and facilitates the advancement of neoplasm cells via diverse mechanisms. On one hand, the activation of the TGF-β/smad signaling pathway in cancerous disorders can stimulate the proliferation of carcinomas, boost the proliferation and dissemination of carcinoma cells, thereby expediting the progression of cancerous diseases\u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e and leading to a decrease in the sensitivity of cancer cells to clinical drugs, thereby reducing the effectiveness of anti-cancer drugs\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. It can also induce carcinoma cells to undergo epithelial-mesenchymal transition (EMT), etc.\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e, such that the originally closely-connected epithelial cells transform into cells with mesenchymal characteristics, thereby attaining stronger invasion and migration capabilities. This transformation enables neoplasm cells to more readily detach from the primary tumor. It also allows them to enter the bloodstream and ultimately form metastases, significantly augmenting the risk of prognosis deterioration in cancer patients\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. On the other hand, the TGF-β/smad signaling pathway is closely associated with the cell cycle. By regulating the expression and signal transduction of the TGF-β/smad signaling pathway, it can thereby influence the normal operation of the cell cycle of cancer cells, thereby affecting the proliferation, apoptosis and other phenotypes of carcinoma cells, and influencing the malignant behavior of neoplasm cells\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Consequently, the TGF-β/smad signaling pathway plays a crucial role in the proliferation of carcinoma cells, the regulation of cell cycle operation, and EMT, as well as other biological behaviors, and has emerged as an important therapeutic target in neoplasms treatment research. By modulating this signaling pathway, it is anticipated to offer novel strategies for enhancing the prognosis of cancer patients.\u003c/p\u003e \u003cp\u003eLathyrol (chemical formula: C20H30O4) is one of the active ingredients of the traditional Chinese medicine Semen Euphorbiae Lathyridis, which has the functions of eliminating water, resolving blood stasis, and dissipating masses\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]\u003c/sup\u003e. It is mainly used in the clinical treatment of constipation, edema, phlegm retention, abdominal distension, blood stasis and amenorrhea, and can be applied externally to treat stubborn tinea and warts\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. We found that lathyrol monomer can exhibit anti-tumor effects in vivo and in vitro, and can quench the malignant behavior of tumors through literature research and experimental studies.\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. Although lathyrol shows significant anti- neoplasms effects, its mechanism is not fully explored, especially the mechanism of its restrain effect on cancer cell proliferation still needs further in-depth study. Meanwhile, the pathogenesis of RCC also requires further exploration. Based on this, we present a hypothesis that lathyrol may suppress the proliferation of RCC cells by inhibiting the expression of TGF-β/smad signaling pathway in RCC, affecting the operation of RCC cell cycle, and thus exerting its anti-tumor effect. In order to verify this hypothesis, we further investigated whether lathyrol is able to restrain the progression of RCC cell cycle by suppressing the conduction of TGF-β/smad signaling pathway, thereby quenching the proliferation of RCC cells by culturing RCC cells and constructing RCC mice model.\u003c/p\u003e"},{"header":"2. Main materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Main material\u003c/h2\u003e \u003cp\u003eThe following reagents and materials were used in this study: 786-O human RCC cell line (Procell Life Science \u0026amp; Technology Co., CL-0010) and Renca mice RCC cell line (Shanghai Zhong Qiao Xin Zhou Biotechnology Co., Ltd., ZQ0996) authenticated by RTS (Short Tandem Repeat) authentication and mycoplasma tests; lathyrol (Weikeqi-Biotech, Sichuan, China, Wakq-00424); carboplatin (Qilu Pharmaceutical Co., LTD. H10920028); BALB/c male SPF mice (SPF (Beijing) Biotechnology Co., Ltd., license: SCXK (Beijing) 2019\u0026ndash;0010), 1.5-2-months-old and weighing 20\u0026thinsp;\u0026plusmn;\u0026thinsp;2 g, were reared in the Laboratory Animal Centre at 25℃ in individually ventilated cages (IVCs) with food and water ad libitum; 1640 medium(Procell Biotechnology Co., Ltd.); fetal bovine serum (FBS, Shanghai Univ bio-Co., Ltd.); CCK-8 kit, phosphate-buffered saline (PBS) buffer (Biosharp Co.); trypsin-ethylenediaminetetraacetic acid (EDTA) (0.25%) digestion solution, enhanced chemiluminescence (ECL) developer, cell culture grade dimethyl sulfoxide (DMSO), tissue and cell radioimmunoprecipitation assay (RIPA) lysis buffer, phenyl methyl sulfonyl fluoride (PMSF), goat blocking serum, hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e), Mayer\u0026rsquo;s hematoxylin staining solution and neutral gum for immunohistochemistry (IHC) (Solarbio Co., Ltd.); bicinchoninic acid (BCA) protein quantification kit, horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody (Beyotime Biotechnology Company); real-time polymerase chain reaction(RT-PCR) kit, bovine serum albumin (BSA), prestained protein marker (10-180KD), cell membrane breaking solution, IHC staining reagent (Servicebio Co., Ltd.); Antibody in vivo: TGF-β1、TGF-βR1、smad2\u0026thinsp;+\u0026thinsp;3、smad6、smad9 antibody (Servicebio Co., Ltd.); smad4、CDK1、PCNA、Ki67 (Wuhan Proteintech Co.); CDK2、CDK4、CDK6、P16、P21、P27、cyclinD1、cyclinA1、cyclinB1、cyclinE1 (Shenzhen Youpin biotech-Co.). Antibody in vitro: TGF-β1、TGF-βR1、PCNA、Ki67、smad6、smad9、CDK6、cyclinA1、cyclinB1、cyclinD1、P16 (Servicebio Co., Ltd.); smad2、smad3、smad4 (Wuhan Proteintech Co.).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Methods\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 General bioinformatics analysis\u003c/h2\u003e \u003cp\u003eThrough bioinformatics analysis, the differential expression and clinical prognosis of the proteins TGF-β1, TGF-βR1, Smad1, Smad2, Smad3, Smad4, Smad6, and Smad9 of the TGF-β/smad signaling pathway in RCC cases were analyzed. The patient case information was downloaded from the TCGA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://portal.gdc.cancer.gov\u003c/span\u003e\u003cspan address=\"https://portal.gdc.cancer.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the RNAseq data of the TCGA-KIRC (renal clear cell carcinoma) project STAR process were sorted out, and the TPM format data and clinical data were extracted. The data filtering strategy: remove normal\u0026thinsp;+\u0026thinsp;remove no clinical information. Data processing method: log2(value\u0026thinsp;+\u0026thinsp;1). The expression differences were selected according to the data distribution as follows: T test (satisfying normal\u0026thinsp;+\u0026thinsp;variance homogeneity) | Welch t' test (satisfying normal\u0026thinsp;+\u0026thinsp;not satisfying variance homogeneity) | Wilcoxon rank sum test (not satisfying normal, non-parametric test), and the Cox regression analysis was used for the clinical prognosis statistical method. Subsequently, the data was imported into the Xiantao Academic Tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.xiantao.love\u003c/span\u003e\u003cspan address=\"https://www.xiantao.love\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for visualization processing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 Cell culture\u003c/h2\u003e \u003cp\u003e786-O and renca RCC cells were regularly grown at constant-temperature cell incubator (with 37\u0026deg;C, 5% CO2 and 95% humidity) in cell culture medium (contained RPMI 1640 medium, 10% FBS and 1% penicillin and streptomycin (PS)). When the cells reached about 85% confluence on the culture flask surface, the cells in the logarithmic phase of growth were digested and utilized in the subsequent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.2.3 Establish a cell viability-drug concentration curve\u003c/h2\u003e \u003cp\u003eUse CCK-8 to detect the cell viability of 786-O and renca RCC cells treated with different concentrations of lathyrol solution for 24 hours, establish the RCC cell viability -drug concentration and regression curve formula, use the formula to calculate the drug concentrations of special values IC10, IC25, IC50, IC75, and IC90, and compare the differences in the effects of the drug on the two RCC cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.2.4 Cell grouping\u003c/h2\u003e \u003cp\u003eBased on the results of preliminary experiments, the cells were divided into a DMSO control group (A group), an experimental group (B group) and a negative control group (C group), and the IC\u003csub\u003e50\u003c/sub\u003e value was selected as the intervention concentration of B group and C group for 24h. Cells in the DMSO control group were grown in DMSO working medium (contained RPMI 1640 medium and 1% DMSO), the negative control group cells were cultured in paraplatin working medium (contained DMSO working medium and corresponding carboplatin drug concentrations), while those in the experimental group were cultured in lathyrol working medium (contained DMSO working medium and corresponding lathyrol drug concentrations).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.2.5 Construction of the RCC mice model\u003c/h2\u003e \u003cp\u003eUpon centrifugation for cell collection, the initial cell suspension was formulated in complete RPMI-1640 medium supplemented with 10% FBS, and adjusted to a concentration of 1.5 \u0026times; 107 cells/ml. Depilatory cream was employed to eliminate hair and expose the skin of the axilla (right forelimb). Subsequently, Renca cell suspension (0.10 mL) was injected into the subcutaneous tissue of each mouse in the axilla (right forelimb), and the mice were housed in SPF-grade IVCs. The mice were permitted to consume food and water normally. The entire animal husbandry process and all experimental procedures in this study adhered to relevant experimental management requirements and ethical standards for experimental animal welfare. All experimental protocols regarding this study were approved by the Ethics Committee of the Zaozhuang Municipal Hospital (approval number: zzslyykyⅡ20241101003). The Ethics committee allows a tumor burden of 3 cm or approximately 15% of the body weight in mice. The maximum tumor burden recorded in the current study did not surpass 20% of the body weight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.2.6 Grouping and treatment\u003c/h2\u003e \u003cp\u003eEmploying the SPSS random number generator, the mice were randomly assigned to a normal group (Group A), an experimental group (Group B), and a negative control group (Group C), with 5 mice per group after excluding mice that succumbed to tumor ulceration, infection, and fighting. Post-establishment of the RCC mice models, the growth of xenografts was closely monitored. It took approximately 15 days for xenografts to reach a size of 5\u0026ndash;6 mm3. The model group was administered normal saline via gavage, the lathyrol experimental group was gavaged with 25 mg/kg lathyrol solution once daily, and the negative control group was intraperitoneally injected with 2 mg/kg paraplatin on days 0, 3, 7, 10, and 14, twice per week. After 14 days of treatment, the mice were anesthetized, blood was collected from the eyeball, and the xenografted tumor mass was isolated, with impurities and contaminated blood being washed away using PBS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.2.7 HE staining to observe the morphology of RCC xenograft tumors\u003c/h2\u003e \u003cp\u003eThe xenograft samples were fixed with 4% paraformaldehyde tissue fixative, dehydrated after 72 hours of fixation, embedded in paraffin, sectioned, and stained according to the steps of the HE staining kit, and then the pathological changes of RCC renca xenograft tumor tissues at high and low magnification were observed under an optical microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.2.8 Rt-PCR to detect gene expression\u003c/h2\u003e \u003cp\u003eThe samples were washed with PBS and added with Trizol, centrifuged and stratified after adding chloroform and shaking, the water phase was added with isopropanol to obtain RNA precipitation, washed with ethanol and centrifuged to remove the supernatant, the RNA was dried and dissolved in DEPC water, and the concentration and purity were measured and stored. When reverse transcription, thaw the reagent and mix and centrifuge, prepare the RNA-Primer Mix, denature at 65\u0026deg;C and place on ice, prepare the reverse transcription reaction solution, incubate at 37\u0026deg;C for 1 hour, inactivate at 85\u0026deg;C and store. Prepare the PCR Reaction Mix, design NTC quality control contamination, set the reaction program for PCR amplification, and perform melting curve analysis. Quantitative PCR data analysis uses the ΔΔCt data analysis method to analyze the amplification curve and melting curve. The target genes and primers can be seen in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequence table\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePCR Products\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGCCTTCCGTGTTCCTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e167bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGTCGCAGGAGACAACCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus TGF-β1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGACGTCACTGGAGTTGTACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e170bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTTCATGTCATGGATGGTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus TGF-βR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGCAGACTTGGGACTTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e211bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACCAATAGAACAGCGTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus Smad2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTACACCCACTCCATTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e231bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGTTCCGAGTAAGTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus Smad3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAACTTACAAGGCGACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e107bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGGAGACTGGACGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus Smad4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGCAGAGCATCAAGGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e116bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGTCTAAAGGCTGTGGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus SMAD6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCAAGATCGGTTTTGGCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e293bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGAGGTGATGAACTGTCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus Smad9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATACCATTACCGCAGAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e155bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGGGTAGGTGGCGTTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.2.9 Western blot (WB) to detect protein expression in RCC renca cells and tumor xenograft tissues\u003c/h2\u003e \u003cp\u003eTake a sufficient amount of recna cell samples and clean rice-sized mice renca xenograft samples, add the prepared PIPA lysis buffer, and lyse the cells on ice to extract proteins. Determine the protein content by BCA method, configure SDS-PAGE gel electrophoresis, transfer to polyvinylidene fluoride membrane (PVDF membrane), soak the PVDF membrane in TBST (containing 5% skimmed milk powder), and incubate overnight on a 4\u0026deg;C shaker. The antibody dilution concentrations in vivo and in vitro experiments are shown in Tables\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The HRP-labeled secondary antibody was incubated on a 37\u0026deg;C room temperature shaker for 2.5 hours, and the ECL immunoblotting was developed. Scan the belts and quantitatively analyze the gray value of the belts.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDilution of WB primary antibody (in vitro)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimary antibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGFβ1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGFβR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:6000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:5000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDilution of WB primary antibody (in vivo)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimary antibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKi-67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:3000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.2.10 Immunohistochemistry to detect protein expression in cells and RCC xenograft\u003c/h2\u003e \u003cp\u003eThe fixation, dehydration, and embedding procedures of RCC xenograft tissues are the same as those in the HE staining steps. According to the requirements of the IHC kit manual, add 0.01M citrate buffer for antigen repair, block endogenous peroxidase with 3% H2O2, add primary antibody and incubate overnight at 4\u0026deg;C. The dilution ratio of the primary antibody can be seen in Tables\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. On the second day, add HRP-labeled secondary antibody, DAB color development, Mayer hematoxylin counterstaining, conventional dehydration and transparency, and neutral gum sealing. For immunocytochemistry (ICC) and IHC, take random screenshots of 2 fields of view for each section, and quantitatively analyze the average optical density (AOD) value using ImageJ software.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDilution of IHC primary antibody (in vitro)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimary antibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:300\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKi67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDilution of IHC primary antibody (in vivo)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimary antibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDilution rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGFβ1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGFβR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad2\u0026thinsp;+\u0026thinsp;3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSmad9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:300\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclinE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDK6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:400\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe data were analyzed via IBM SPSS 26.0, and the data visualization was generated with GraphPad Prism 9.0. All cell experiments were carried out with triplicated independent biological replicates. A difference was deemed statistically significant if P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, or ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001; otherwise, a difference was considered not significant (ns) if P\u0026thinsp;\u0026gt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e3.1 The TGF-β/smad signaling pathway is highly expressed in RCC and has an impact on clinical prognosis.\u003c/p\u003e \u003cp\u003eIn the RCC sample to investigate the relative expression level of the target gene, it includes 72 normal group samples and 532 cancer group samples. Through integrating and analyzing relevant data, the results demonstrate that the expression of TGF-β1, smad1, smad2, smad3, smad4, and smad9 in malignant tissues is higher than that of the normal group, while the expression of smad6 in the normal group is significantly higher than that of the tumor group. There is no statistical difference in the expression of TGF-βR1 between the normal and tumor groups. The clinical prognosis analysis of the target gene expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) comprises 270 samples in the low-expression group, with a total of 99 events and 171 censored cases; 271 samples in the high-expression group, with a total of 76 events and 195 censored cases. The clinical prognosis analysis reveals that patients with high expression of smad1, smad2, smad3, smad4, smad9, smad6, and TGF-βR1 in RCC patients have a better prognosis than those with low expression, while patients with low expression of TGF-β1 in RCC patients have a better prognosis than those with high expression, and the difference is statistically significant.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Lathyrol limits the proliferation of 786-O cells and renca cells, and the two are comparable.\u003c/h2\u003e \u003cp\u003eAfter 24 hours of treatment, we evaluated the cell viability by applying the CCK-8 assay. The results indicated that lathyrol could effectively inhibit the proliferation of human RCC 786-O cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) and mouse RCC renca cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) in vitro, and the inhibitory effect was positively correlated with the drug concentration. Subsequently, we analyzed the average cell viability under different drug concentrations and plotted the regression curve of drug concentration and cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u0026amp;D). As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, there was no statistically significant difference between the IC value sequences of human RCC cancer 786-O cells and mouse RCC cancer renca cells (\u003cem\u003et\u003c/em\u003e=-1.447, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.186), suggesting that the therapeutic effect of lathyrol on these two cells was comparable (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). To more precisely simulate the tumor microenvironment, we selected mouse RCC renca cells to construct xenograft animal models for subsequent in vitro and in vivo related experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.3 Lathyrol represses the protein and gene expression of the TGF-β/smad signaling pathway in RCC renca cells in vitro.\u003c/p\u003e \u003cp\u003eLathyrol possesses the capacity to reduce the protein and gene expression of the TGF-β/smad signaling pathway in RCC renca cells in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). After 24 hours of treatment, the gene expression tendencies of TGF-β1, TGF-βR1, smad2, smad3, smad4, smad6, and smad9 in renca cells were partially distinct from the protein expression tendencies. The protein expression of TGF-β1 and TGF-βR1 in group B and group C was higher than that in group A (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), while the mRNA expression of TGF-β1 and TGF-βR1 in group B and group C was higher than that in group A (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eEa\u0026amp;b), and the mRNA and protein expression trends of these two proteins were consistent with each other. The expression trends of the smad series proteins were dissimilar to the trends of their mRNA expression. After treatment, lathyrol (group B) and paraplatin (group C) could promote the mRNA expression of smad2, smad3, and smad4 in renca cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eEc-d), but could diminish the expression of smad2, smad3, and smad4 proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB); while for smad9 protein, lathyrol could decrease the expression of smad9 mRNA, and paraplatin had minimal effect on it (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eEg), but both the two drugs could restrain the expression of smad9 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD); for smad6 protein, lathyrol and paraplatin had no impact on its mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eEf), but both could enhance the expression of smad6 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). This finding implies that lathyrol and paraplatin may exert their anti-RCC cell effects by influencing the synthesis and expression of the TGF-β/smad signaling pathway proteins in RCC cells, rather than affecting the transcription of the genes of the TGF-β/smad pathway proteins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3.4 Lathyrol straitens the expression of cyclin proteins in renca cells in vitro and block the cell cycle progression.\u003c/p\u003e \u003cp\u003eThe results (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) demonstrated that both lathyrol and paraplatin efficaciously suppressed the expression of cyclin proteins in RCC cells in vitro. Among the Cyclin series proteins, lathyrol could curb the expression of cyclinD1, cyclinB1, cyclinA1, and cyclinE1 proteins in renca cells. In contrast, paraplatin hindered the expression of cyclinD1, cyclinA1, and cyclinE1 proteins in renca cells. Among the CDK proteins, lathyrol could impede the expression of CDK6, CDK4, and CDK1 proteins in renca cells, while paraplatin reduced the expression of CDK6 and CDK1 proteins in renca cells. Among the cyclin-dependent kinase inhibitor (CKI) proteins, the expression levels of P16, P21, and P27, the three cell cycle inhibitory proteins, in group B and group C cells were significantly higher than those in group A cells. Lathyrol did not impact CDK2 expression, and paraplatin had no influence on cyclinB1, CDK4, and CDK2 protein expression. This finding suggests that lathyrol and paraplatin may exert anti-RCC cell effects by influencing the expression of cell cycle proteins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Lathyrol reduces the proliferation of RCC xenograft carcinomas.\u003c/h2\u003e \u003cp\u003eAfter 14 days of treatment, the xenograft volume-growth curve of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) showed the diminution effects of lathyrol and paraplatin on the proliferation of RCC xenograft tumors in mice. Specifically, the xenografts volume growth trend of mice in group A was lower than that in groups B and C, and this difference was statistically significant. It was further observed that the body weight of mice in group B decreased. The difference was also statistically significant compared with group A, suggesting that lathyrol may have a side-effect of reducing body weight in mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Through HE pathological section analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), the RCC xenografts in Group A, B, and C all exhibited high differentiation characteristics. The tumor cells were closely arranged, with large nuclei and deep staining. The terminal branches of blood vessels were abundant. The nuclei were deeply stained and appeared bluish-black, while the cytoplasm showed varying degrees of pink. Under low-power microscopy, rich neovascularization was observed in the xenograft tissues of each group, and the neoplasm was well-encapsulated, divided the cells into nest-like structures. Under high-power microscopy, significant atypia of tumor cells was visible, and the nuclei presented pathological nuclear division figures. It is noteworthy that in Group B and C, some xenograft tissues exhibited phenomena such as necrosis, limited proliferation, nuclear fragmentation, and pyknosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Lathyrol dwindle the expression of TGF-β/smad signaling pathway proteins and genes in RCC xenografts.\u003c/h2\u003e \u003cp\u003eAfter 14 days of drug administration, the mRNA expression level of smad6 in the RCC xenografts of mice in group A was lower than that in groups B and C; concurrently, the mRNA expression levels of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9 in the RCC xenografts of mice in groups B and C were also lower than that in group A (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Through WB and ICC detection, we observed that the expression levels of TGF-β1, TGF-βR1, and smad6 proteins in the RCC xenografts of mice in group A were also lower than those in groups B and C, while the expression levels of smad2, smad3, smad4, and smad9 proteins in the RCC xenografts of mice in groups B and C were also lower than those in group A. Compared with the results under in vitro experimental conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), under in vivo experimental conditions, the mRNA expression levels of these proteins in treated renca cells were in accordance with the protein presentation trend. These findings imply that lathyrol and paraplatin may exert a role in attenuating the TGF-β/smad signaling pathway by influencing the expression of TGF-β/smad signaling pathway proteins and inhibiting the mRNA transcription of these genes in the in vivo environment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Lathyrol curtails the expression of cyclin in RCC xenografts and blocks the cell cycle.\u003c/h2\u003e \u003cp\u003eAfter treatment with lathyrol and paraplatin, the expression of cyclinD1, cyclinB1, cyclinE1, CDK4, CDK6, CDK2, and CDK1 in group A RCC xenografts was higher than that in groups B and C; while the expression of P16, P21, and P27 in groups B and C was higher than that in group A. However, lathyrol and paraplatin had little effects on the expression of cyclinA1 protein in renca cells in vivo, and the cell cycle might be blocked in the G1 phase. This finding suggests that lathyrol and paraplatin may have raw effects on the S phase of the cell cycle (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eL), but they can still exert their anti-RCC cell affects by affecting the expression of cyclin.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.8 Lathyrol abridged the expression of PCNA and ki67 protein in RCC cells\u003c/h2\u003e \u003cp\u003ePCNA protein is predominantly expressed in the cytoplasm, while ki67 protein is manifested in both the cytoplasm and the nucleus. Subsequent to in vivo and in vitro experimental manipulations with the two drugs, lathyrol and paraplatin, it was discerned that the expression of PCNA and ki67 proteins in RCC cells within groups B and C was repressed. This discovery intimates that lathyrol can efficaciously abbreviate the expression of PCNA and ki67 proteins in RCC cells in vivo and in vitro, thereby impeding the proliferation of RCC cells and xenografts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn current medical practice, the treatment of RCC mainly relies on surgical resection. After surgery, doctors will decide whether to use tyrosine kinase inhibitors (TKIs) such as sunitinib and imatinib for adjuvant therapy based on the results of pathological examination\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. These first-line clinical anti-cancer drugs and targeted drugs can efficaciously obstruct the growth and spread of neoplasm cells, thereby improving the therapeutic role. For those patients who cannot tolerate surgical treatment, that is, those who have developed to advanced stages and have metastasis, making radical surgical resection impossible in the advanced stage of the tumor, they provide additional alternative treatment methods\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Although there are relatively complete regimens for targeted therapy, immunotherapy, and combined target-immune therapy in RCC patients\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e, in actual clinical work, the side effects of their treatment often make patients intolerable, and they have to stop treatment\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Drug-related damage during treatment sometimes endangers the stability of vital signs, while traditional Chinese medicine has stable efficacy and better safety in this regard\u003csup\u003e[\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. However, with the widespread application of anti-cancer drugs, some neoplasm cells may develop resistance to certain drugs, resulting in decreased drug sensitivity\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. The emergence of this resistance will significantly reduce the anti-tumor efficacy of patients, bringing new challenges to the treatment of RCC patients\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Therefore, the medical community needs to continuously research and develop new drugs and treatment methods to address the problem of neoplasia resistance and improve the survival rate and quality of life of patients.\u003c/p\u003e \u003cp\u003eIn this experiment, our objective was to validate the anti-cancer activity of lathyrol, with paraplatin chosen as the control drug. Paraplatin, a second-generation platinum-based anti-cancer medication widely employed in clinical settings, is typically utilized in combination with other drugs to constitute a combined chemotherapy regimen for the management of related cancer disorders\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Its anti-cancer mechanism primarily entails the interaction with DNA. Upon entering the cell, paraplatin can establish cross-links with DNA molecules, particularly interstrand cross-links, thereby interfering with the normal replication and transcription processes of DNA\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Its anti-cancer mechanism primarily entails the interaction with DNA. Upon entering the cell, paraplatin can establish cross-links with DNA molecules, particularly interstrand cross-links, thereby interfering with the normal replication and transcription processes of DNA\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Additionally, the DNA damage caused by paraplatin will also activate the intracellular DNA damage response mechanism, encompassing the activation of the p53 protein\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e, which, in turn, triggers the apoptotic program and inhibits the proliferation of cancer cells, leading to the demise of cancer cells\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. These mechanisms of paraplatin render it one of the efficacious drugs for the treatment of diverse cancers\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e. Hence, to compare the anti-cancer effect and mechanism of lathyrol, we employed paraplatin as the control group to verify the treatment outcomes of lathyrol against RCC. Through the preliminary investigation, we discovered that lathyrol possesses the capability of impeding the activity of RCC cells in both in vitro and in vivo settings, and established the regression equation between cell activity and drug concentration via the results of the CCK-8 experiment. Concurrently, we compared the statistical disparities in the specific IC values of human RCC 786-O cells and mouse RCC renca cells, and the findings indicated that there was no significant statistical difference between the two, suggesting that the therapeutic effects of lathyrol in 786-O cells and renca cells are comparable to a certain extent. Therefore, to more realistically simulate the in vivo environment, renca cells and partially immunosuppressed BALB/c mice were ultimately selected to construct an RCC xenograft animal model, and subsequent experiments were conducted to more clearly detect the phenotypic attenuation of lathyrol in the corresponding species in the in vivo environment for the treatment of RCC xenografts.\u003c/p\u003e \u003cp\u003eIn the TGF-β/smad signaling pathway transduction system, TGF-β1 and TGF-βR1, serving as the initiating elements of this pathway, exert a crucial role in the activation and operation of the entire route\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e, Meanwhile, smad2, smad3, and smad4 are significant cascade effector factors of this pathway, connecting the precedent and the subsequent, and the smad2/3/4 complex is also an essential protein that enters the nucleus and exerts the regulatory transcriptional function of this pathway\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Smad6 and smad7 possess similar functions, primarily playing a role in negative feedback regulation and reducing the signal transduction of the pathway\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. The mechanism through which smad9 promotes tumorigenesis and development remains unclear, yet the expression of smad9 in tumor diseases is directly proportional to its malignancy and inversely proportional to the prognosis of patients\u003csup\u003e[\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. Under in vitro experimental circumstances, we assessed the expression of certain proteins in the TGF-β/smad signaling pathway of RCC cells and RCC xenograft tumors. The outcomes demonstrated that following treatment with lathyrol and paraplatin, the expression of essential proteins in the TGF-β/smad signaling pathway of renca cells, encompassing smad2, smad3, smad4, and smad9, was inhibited. In contrast, the expression of TGF-β1, TGF-βR1, and smad6 proteins exhibited an upward trend. Nevertheless, at the gene expression level, the expression pattern of mRNA is distinct from the Western blot detection results at the protein level. After treatment with lathyrol and paraplatin, the mRNA expression of smad6 and smad9 in renca cells decreased, while the mRNA expression of TGF-β1, TGF-βR1, smad2, smad3, and smad4 increased. In in vivo experiments, the expression trends of marker proteins and mRNA in the TGF-β/smad signaling pathway of mice RCC xenograft cancer were consistent, indicating that the mRNA and protein expression of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9 decreased, while the expression of smad6 protein increased, although its mRNA expression decreased. Interestingly, lathyrol attenuates the expression of certain proteins in the TGF-β/smad signaling pathway and promotes the expression of inhibitory smad (I-smad) proteins in both in vivo and in vitro environments, thereby inhibiting the signal transmission and regulatory function of the TGF-β/smad pathway in RCC cells and exerting the corresponding anti-cancer effects\u003csup\u003e[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]\u003c/sup\u003e. However, in the in vitro environment, lathyrol primarily blocks the function of the TGF-β/smad pathway by reducing the translation and synthesis of proteins in the pathway; while in the in vivo environment, it further retards protein synthesis by inhibiting the mRNA transcription function of genes encoding proteins in the TGF-β/smad pathway to exert its role.\u003c/p\u003e \u003cp\u003eIn the life activities of cells, ensuring the normal operation of the cell cycle is of vital importance for cell proliferation and functional performance\u003csup\u003e[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. Similarly, in the treatment of malignant diseases, by interfering with the cell cycle process of malignant cells, the proliferation of cancer cells can be effectively reduced, apoptosis can be induced, and malignant behaviors such as the infiltration of cancer cells can be suppressed\u003csup\u003e[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/sup\u003e. The TGF-β/smad pathway has a significant impact on the normal operation of the cell cycle\u003csup\u003e[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/sup\u003e, and by influencing the signal transduction of the TGF-β/smad pathway, the cell cycle of tumor cells can be disrupted, thereby suppressing the malignant behavior of carcinoma cells\u003csup\u003e[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/sup\u003e, which is also an essential point we plan to explore. The cell cycle comprises four main stages: the G1 phase before DNA synthesis, the S phase of DNA synthesis, the G2 phase after DNA synthesis, and the M phase of mitosis\u003csup\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/sup\u003e. Throughout the cell cycle, the regulatory molecules include cyclin, cyclin-dependent kinase (CDK), and cyclin-dependent kinase inhibitor (CKI)\u003csup\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/sup\u003e, which together constitute the cyclin-CDK-CKI regulatory network\u003csup\u003e[\u003cspan additionalcitationids=\"CR52\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/sup\u003e. The cyclin protein binds to the corresponding CDK, forming a necessary checkpoint in the cell cycle\u003csup\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/sup\u003e, and we discovered that both lathyrol and paraplatin can affect the expression of cyclin proteins, which play a blocking role in the cell cycle, and also impact the expression of cell cycle regulatory proteins CDK and CKI, indirectly influencing the normal operation of the RCC cell cycle through WB (Western Blot) and IHC/ICC (immunohistochemistry/immunocytochemistry) analysis. More specifically, after treatment with lathyrol and paraplatin, the expression levels of cyclinD1, cyclinE1, and cyclinA1 proteins in renca cells and mice xenograft tumors decreased, while the expression of CDK4, CDK6, CDK2, and CDK1 proteins also decreased. In contrast, the expression levels of CKI proteins P16, P27, and P21 increased. Additionally, the effect of lathyrol and paraplatin on the expression of cyclinB1 protein is relatively minor, indicating that these two compounds mainly exert a role in blocking the cell cycle of renal cell carcinoma (RCC) cells before the M phase of the cell cycle. It is worth noting that in vitro experiments, the restrictive significance of lathyrol on the expression of cyclinD1, cyclinE1, and cyclinA1 proteins is not as prominent as that of paraplatin. However, in vivo experiments, the inhibitory effect of lathyrol on the expression of cyclinD1 protein is slightly stronger than that of paraplatin, while the decreasing effect on the expression of cyclinA1 protein is weaker than that of paraplatin. For cyclinE1 protein, there is no significant difference in the repressing effect of the two on expression. Based on these findings, we hypothesize that paraplatin, as a widely utilized anticancer drug, may possess a more significant therapeutic function than lathyrol. Notwithstanding, via the cell cycle schematic diagram (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eN), we contemplated that both medications can directly hinder RCC cells from entering the G1/S phase, impede DNA synthesis (S phase), and obstruct the G2/M checkpoint of cells in vitro, thereby influencing the advancement of the cell cycle. In the in vivo milieu, paraplatin can also inhibit the expression of cyclinD1 protein in renca cells, but its inhibitory effects on cyclinE1 and cyclinA1 proteins are more efficacious than that of lathyrol. This discovery implies that lathyrol might primarily exert a fundamental role in blocking the G1 phase of the cell cycle in the in vivo setting, while paraplatin might mainly play a blocking role in the S and G2 phases of RCC cells. These outcomes also suggest that lathyrol has comparable anti-cancer effects and mechanisms to clinical anti-cancer drugs in both in vivo and in vitro circumstances. Additionally, considering that lathyrol is capable of promoting the expression of P16, P21, and P27 in renca cells in both in vivo and in vitro environments, we surmise that this compound drug can enhance the aging process of cancer cells by exerting its inherent tumor suppressor significance, and it may also impact the senescence-associated secretory phenotype (SASP) in the in vivo environment, thereby influencing the immune function of the body, that is, regulating the immune aging and carcinoma immune function of the body\u003csup\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eUltimately, we undertook an exhaustive examination of the effects of lathyrol and paraplatin on the proliferation phenotype of renal cancer renca cells. The experimental outcomes demonstrated that both compounds could appreciably impede the proliferation of renca cells and mice RCC xenografts. To further validate this discovery, we gauged the expression levels of PCNA and ki67. As crucial markers of cell proliferation function, the reduction in their expression further affirmed the anti-cancer effects of lathyrol and paraplatin on cell proliferation. Additionally, by observing mouse RCC xenografts via HE staining, we discerned that following treatment with lathyrol and paraplatin, partial tissue necrosis and cell lysis transpired in the RCC xenografts. The proliferation and apoptosis of cancer cells exert a crucial role in tumorigenesis, development, and treatment. In the realm of oncology research, Ki67, as a nuclear protein closely affiliated with the cell cycle, holds significant significance in its function and mechanism in oncology. As an important indicator to define cell apoptosis and proliferation, in addition to being capable of sensitively reflecting the cells in the proliferative stage in tumor tissues, it can also disclose the growth rate and potential invasive capacity of cells. Elevated Ki67 expression is typically associated with high proliferative activity of carcinoma cells and unfavorable prognosis, and the higher the positive rate of Ki67, the greater the proportion of tumor cells in the growth cycle, and the higher the malignancy of the carcinoma. Hence, in clinical practice, the expression level of Ki67 has emerged as one of the significant biomarkers for evaluating the malignancy of neoplasms and forecasting the prognosis of cancer patients\u003csup\u003e[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]\u003c/sup\u003e. Its expression level can be modulated by diverse intracellular and extracellular factors, such as growth factors, hormones, and cyclins, and may also be influenced by various factors such as tumor type, pathological grade, patient age, and gender, resulting in varying degrees of expression outcomes\u003csup\u003e[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]\u003c/sup\u003e. PCNA (proliferating cell nuclear antigen) is a protein that assumes a pivotal role in the cell cycle, particularly in DNA replication and cell proliferation\u003csup\u003e[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]\u003c/sup\u003e. As a marker of cell proliferation, the expression level of PCNA is generally correlated with the proliferative activity and prognosis of cancers. PCNA participates in the regulation of DNA replication and the process of DNA damage repair by interacting with various proteins. In neoplastic cells, due to certain genetic or epigenetic alterations, the expression level of PCNA may be upregulated, leading to accelerated DNA replication, uncontrolled cell proliferation, and ultimately facilitating tumor growth\u003csup\u003e[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]\u003c/sup\u003e. Furthermore, the expression level of PCNA is stringently regulated by the cell cycle, commencing to ascend at the G1/S transition and reaching a peak in the S phase\u003csup\u003e[\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]\u003c/sup\u003e. Moreover, as one of the markers for assessing the proliferative status of cells, PCNA is closely associated with the proliferative activity and DNA damage repair capacity of cancer cells, and its expression level is frequently utilized as an indicator for tumor prognosis evaluation. Similar to ki67, high expression of PCNA typically implies a higher neoplasm recurrence rate and unfavorable prognosis\u003csup\u003e[\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]\u003c/sup\u003e. The results demonstrated that in vitro experiments, the expression of ki67 decreased following the intervention of renca cells by lathyrol and cisplatin. In vivo experiments, after in vivo intervention in mice with RCC xenografts, the expression of PCNA protein and ki67 protein decreased. Combined with the cck-8 results, it can be deduced that lathyrol can impede the proliferative ability of RCC renca cells xenograft neoplasms, and exert an anti-cancer effect similar to that of clinical drugs. Its mechanism might be related to lathyrol influencing the TGF-β/smad signaling pathway of renca cells, thereby suppressing the expression of crucial regulatory proteins in the cell cycle.\u003c/p\u003e \u003cp\u003eIn conclusion, we initially discovered that lathyrol could impede the signal transduction of the TGF-β/smad signaling pathway by influencing the expression of elemental proteins within the pathway, arresting the cell cycle progression of renca cells, and thereby affecting the proliferation of renca cells. Generally, lathyrol and paraplatin have demonstrated significant effects in hindering the proliferation of renal cancer renca cells and mouse RCC xenografts, offering a new research direction and potential treatment alternatives for renal cancer therapy. Nevertheless, with regard to the application of lathyrol in the treatment of RCC patients, further exploration is still necessary. On the one hand, solely targeting the TGF-β/smad signaling pathway for medical intervention may not be the most favorable option. Bioinformatics data indicate that in RCC patients, low expression of TGF-β/smad signaling pathway-related marker target genes may also have a detrimental effect on the prognosis of patients and reduce survival rates. Additionally, in terms of gene expression differences, the expression of TGF-β/smad signaling pathway target genes in normal tissues is sometimes even higher than that in tumor tissues, suggesting that the occurrence of RCC is not always attributed to abnormal activation of the TGF-β/smad signaling pathway. Hence, we still need to further investigate the mechanism of occurrence and development of RCC. On the other hand, our research also has limitations. From the results, lathyrol, as a potential multi-target anti-cancer drug, may affect the cell cycle progression of RCC cells by influencing the signal transduction of the TGF-β/smad pathway, or by directly influencing the expression of cyclin proteins and cell cycle regulatory proteins CDK and CKI in the cell cycle. Furthermore, although we have detected the protein and mRNA expression levels of the marker targets of the TGF-β/smad signaling pathway, for other targets of lathyrol and paraplatin, as well as the mRNA and protein expression of cell cycle and proliferation phenotype markers, further exploration is still required.\u003c/p\u003e \u003cp\u003eAs medical technology progresses continuously, the analysis of the active ingredients of traditional Chinese medicine and its therapeutic mechanism has gradually become clearer and more transparent\u003csup\u003e[\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]\u003c/sup\u003e. Through the continuous exploration and application of modern medical technology, the potential of traditional Chinese medicine in the treatment field has been further explored and utilized, and we can also have a deeper understanding of the composition and mechanism of action of traditional Chinese medicine, thereby providing a new treatment idea and method for tumor patients\u003csup\u003e[\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]\u003c/sup\u003e. Currently, some scholars and researchers have explored and found that traditional Chinese medicine can not only directly suppress and kill neoplastic cells through its own active ingredients, but also have an indirect killing effect on cancer cells by improving the overall physical condition of patients and enhancing the immunity of the body\u003csup\u003e[\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]\u003c/sup\u003e. This indirect effect is mainly achieved by improving the immune function of the body, enabling the body's own immune system to more effectively identify and attack cancer cells, thereby achieving the purpose of inhibiting cancer proliferation and invasion\u003csup\u003e[\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]\u003c/sup\u003e. Several clinical workers have also found that by combining first-line anti-cancer drugs and traditional Chinese medicine, the efficacy of cancer patients can be improved and the prognosis of patients can be improved\u003csup\u003e[\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e, \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]\u003c/sup\u003e. Therefore, using traditional Chinese medicine to prevent the proliferation and invasion ability of tumors and improve the survival prognosis of patients has become an effective alternative treatment method\u003csup\u003e[\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]\u003c/sup\u003e. This method will not only provide new hope for those patients who are not sensitive or intolerant to traditional Western medicine treatment methods, but also provide an adjuvant treatment method for patients who have already received Western medicine treatment, helping them recover better and improve their quality of life.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eBased on the above analysis, lathyrol exhibited significant anti-cancer activity in vitro and in vivo experiments. Its mechanism of action may involve the modulation of the expression of marker proteins in the TGF-β/smad signaling pathway. We infer that lathyrol inhibits the signal transduction of this pathway, thereby blocking the cell cycle progression of renca cells, and thereby preventing the proliferation of RCC cells.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eThe authors assert that the data underpinning the findings of this study are accessible within the paper and its Supplementary Information files. In the event that any raw data files are required in an alternative format, they can be obtained from the corresponding author upon a reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAI statement\u003c/p\u003e\n\u003cp\u003eIn the course of the preparation of this work, the authors utilized Newidea academic tools (https://ai.helixlife.cn/) to verify and rectify grammar. Subsequent to using this tool, the authors examined and edited the content as necessary and assume full accountability for the content of the published article.\u003c/p\u003e\n\u003cp\u003eAcknowledgments\u003c/p\u003e\n\u003cp\u003eI would like to express my sincere gratitude to my tutor, Professor Junfeng Zhao, for his invaluable guidance and encouragement throughout my research journey. I am also deeply appreciative of Professor Lu Wang for her substantial support and motivation in my academic endeavors. Their mentorship has been instrumental in the completion of this work.\u003c/p\u003e\n\u003cp\u003eCOI statement\u003c/p\u003e\n\u003cp\u003eAll authors declare that there are no competing interests.\u003c/p\u003e\n\u003cp\u003eFunding information\u003c/p\u003e\n\u003cp\u003eNo funding organizations, all research funding was provided by corresponding authors.\u003c/p\u003e\n\u003cp\u003eCRediT author statement\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eShengyou Song\u003c/strong\u003e: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Resources, Data Curation, Writing - Original Draft, Visualization, Project administration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYalin Song#\u003c/strong\u003e: Conceptualization, Project administration. Writing- Reviewing and Editing, Supervision, Funding acquisition\u003c/p\u003e\n"},{"header":"References ","content":"\u003col\u003e\n\u003cli\u003e[Chinese expert consensus on the systemic treatment of advanced clear cell renal cell carcinoma (2024 edition)][J]. Zhonghua Zhong Liu Za Zhi, 2024, 46(9): 844-854.\u003c/li\u003e\n\u003cli\u003eGontero P, Birtle A, Capoun O, et al. European Association of Urology Guidelines on Non-muscle-invasive Bladder Cancer (TaT1 and Carcinoma In Situ)-A Summary of the 2024 Guidelines Update[J]. Eur Urol, 2024.\u003c/li\u003e\n\u003cli\u003eZhao S, Song C, Chen F, et al. LncRNA XIST/miR-455-3p/HOXC4 axis promotes breast cancer development by activating TGF-\u0026beta;/SMAD signaling pathway[J]. Funct Integr Genomics, 2024, 24(5): 159.\u003c/li\u003e\n\u003cli\u003eLu J, Li Z, Liu X, et al. Tiaogan Bushen Xiaoji Formula Enhances the Sensitivity of Estrogen Receptor- Positive Breast Cancer to Tamoxifen by Inhibiting the TGF-\u0026beta;/SMAD Pathway[J]. Cancer Manag Res, 2024, 16: 1189-1204.\u003c/li\u003e\n\u003cli\u003eQi C, Lyu M, Yao Z, et al. SVIL promotes ovarian cancer progression and epithelial-mesenchymal transition under hypoxic conditions through the TGF-\u0026beta;/Smad pathway[J]. Gynecol Oncol, 2024, 190: 167-178.\u003c/li\u003e\n\u003cli\u003eXin X, Cheng X, Zeng F, et al. The Role of TGF-\u0026beta;/SMAD Signaling in Hepatocellular Carcinoma: from Mechanism to Therapy and Prognosis[J]. Int J Biol Sci, 2024, 20(4): 1436-1451.\u003c/li\u003e\n\u003cli\u003eLi J, Gao L, Wang A, et al. Forkhead box L2 is a target of miR-133b and plays an important role in the pathogenesis of non-small cell lung cancer[J]. Cancer Med, 2023, 12(8): 9826-9842.\u003c/li\u003e\n\u003cli\u003eCheng Y, Heng X, Feng F. G-protein Coupled Receptor 34 Promotes Gliomagenesis by Inducing Proliferation and Malignant Phenotype via TGF-Beta/Smad Signaling Pathway[J]. Technol Cancer Res Treat, 2022, 21: 15330338221105733.\u003c/li\u003e\n\u003cli\u003eYang T, Wang S, Li H, et al. Lathyrane diterpenes from Euphorbia lathyris and the potential mechanism to reverse the multi-drug resistance in HepG2/ADR cells[J]. Biomed Pharmacother, 2020, 121: 109663.\u003c/li\u003e\n\u003cli\u003eCommission C P. chinese pharmacopoeia[M]. Beijing:: China Medical Science and Technology Press, 2020.\u003c/li\u003e\n\u003cli\u003eYan Y, Zhou W, Guo Q, et al. Effect of lathyrol derivatives on non-small cell lung cancer and the possible mechanism[J]. Zhong Nan Da Xue Xue Bao Yi Xue Ban, 2022, 47(2): 143-152.\u003c/li\u003e\n\u003cli\u003eSong S, Tai L, Xu Y, et al. Lathyrol reduces the RCC invasion and incidence of EMT via affecting the expression of AR and SPHK2 in RCC mice[J]. Discov Oncol, 2024, 15(1): 264.\u003c/li\u003e\n\u003cli\u003eOsorio L, Grazioso T P, De Velasco G, et al. Retrospective study assessing the role of the androgen receptor in clear cell renal cell cancer patients treated with VEGFR inhibitors in monotherapy[J]. Clin Transl Oncol, 2024.\u003c/li\u003e\n\u003cli\u003eAngulo J C, Larrinaga G, Lecumberri D, et al. Predicting Survival of Metastatic Clear Cell Renal Cell Cancer Treated with VEGFR-TKI-Based Sequential Therapy[J]. Cancers (Basel), 2024, 16(16).\u003c/li\u003e\n\u003cli\u003eTsuboi I, Araki M, Yokoyama S, et al. Sequential therapy for hereditary leiomyomatosis and renal cell cancer-associated renal cell carcinoma: a case report and report of a new family pedigree[J]. Oxf Med Case Reports, 2024, 2024(8): omae060.\u003c/li\u003e\n\u003cli\u003eCano Garcia C, Hoeh B, Mandal S, et al. First-Line Immune Combination Therapies for Nonclear Cell Versus Clear Cell Metastatic Renal Cell Carcinoma: Real-World Multicenter Data From Germany[J]. Clin Genitourin Cancer, 2024, 22(4): 102112.\u003c/li\u003e\n\u003cli\u003eDri A, Garattini S K, Cinausero M, et al. Rare and Insidious Toxicities from New Combination Therapies in Metastatic Renal Cell Cancer: Lessons Learned from Real-Practice[J]. Curr Oncol, 2022, 29(10): 6776-6786.\u003c/li\u003e\n\u003cli\u003eAlbarakat M M, Ahmed Y B, Alshwayyat S, et al. The efficacy and safety of cabozantinib in patients with metastatic or advanced renal cell carcinoma: a systematic review and meta-analysis[J]. Proc (Bayl Univ Med Cent), 2024, 37(5): 822-830.\u003c/li\u003e\n\u003cli\u003eBao Z, Wu G, Du J, et al. The comparative efficacy and safety of 9 traditional Chinese medicines combined with standard quadruple therapy for Helicobacter pylori-associated gastritis: a systematic review and network meta-analysis[J]. Ann Transl Med, 2022, 10(24): 1349.\u003c/li\u003e\n\u003cli\u003eChen L, Zhang Y, Li J, et al. Efficacy and safety of traditional Chinese medicine in managing bone loss post-endocrine therapy in hormone receptor-positive breast cancer patients[J]. Medicine (Baltimore), 2024, 103(41): e39961.\u003c/li\u003e\n\u003cli\u003eNiu X, Gu H, Li J, et al. Efficacy and safety of Atractylodes macrocephala-containing traditional Chinese medicine combined with neoadjuvant chemotherapy in the treatment of advanced gastric cancer: a systematic evaluation and meta-analysis[J]. Front Oncol, 2024, 14: 1431381.\u003c/li\u003e\n\u003cli\u003eAweys H, Lewis D, Sheriff M, et al. Renal Cell Cancer - Insights in Drug Resistance Mechanisms[J]. Anticancer Res, 2023, 43(11): 4781-4792.\u003c/li\u003e\n\u003cli\u003eLi L, Zhao S, Liu Z, et al. Sunitinib treatment promotes metastasis of drug-resistant renal cell carcinoma via TFE3 signaling pathway[J]. Cell Death Dis, 2021, 12(2): 220.\u003c/li\u003e\n\u003cli\u003eYe H, Xue K, Zhang P, et al. Three vs 6 Cycles of Chemotherapy for High-Risk Retinoblastoma: A Randomized Clinical Trial[J]. Jama, 2024.\u003c/li\u003e\n\u003cli\u003eSantoro A, Pilar G, Tan D S W, et al. Spartalizumab in combination with platinum-doublet chemotherapy with or without canakinumab in patients with PD-L1-unselected, metastatic NSCLC[J]. BMC Cancer, 2024, 24(1): 1307.\u003c/li\u003e\n\u003cli\u003ePlatinum Coordination Complexes, LiverTox: Clinical and Research Information on Drug-Induced Liver Injury, Bethesda (MD): National Institute of Diabetes and Digestive and Kidney Diseases, 2012.\u003c/li\u003e\n\u003cli\u003eFahmy S A, Sedky N K, Hassan H, et al. Synergistic Enhancement of Carboplatin Efficacy through pH-Sensitive Nanoparticles Formulated Using Naturally Derived Boswellia Extract for Colorectal Cancer Therapy[J]. Pharmaceutics, 2024, 16(10).\u003c/li\u003e\n\u003cli\u003eFathy M, El-Hallouty S M, Mansour A S, et al. The Anti-proliferative Effect, Apoptotic Induction, and Cell Cycle Arrest of Tetra Halo Ruthenate Nanocomposites in Different Human Cancer Cell Lines[J]. Cell Biochem Biophys, 2024.\u003c/li\u003e\n\u003cli\u003eNafees M, Hanif M, Muhammad Asif Khan R, et al. A Dual Action Platinum(IV) Complex with Self-assembly Property Inhibits Prostate Cancer through Mitochondrial Stress Pathway[J]. ChemMedChem, 2024: e202400289.\u003c/li\u003e\n\u003cli\u003eBestvina C M, Hara J H L, Karrison T, et al. DARES: A Phase II Trial of Durvalumab and Ablative Radiation in Extensive-Stage Small Cell Lung Cancer[J]. Clin Lung Cancer, 2024.\u003c/li\u003e\n\u003cli\u003eYin L, Jiang W, Liu S, et al. Efficacy and safety of nanoparticle albumin-bound paclitaxel plus carboplatin as neoadjuvant chemotherapy for stages III-IV, unresectable ovarian cancer: a single-arm, open-label, phase Ib/II study[J]. BMC Med, 2024, 22(1): 496.\u003c/li\u003e\n\u003cli\u003eLiu H, Sun M, Wu N, et al. TGF-\u0026beta;/Smads signaling pathway, Hippo-YAP/TAZ signaling pathway, and VEGF: Their mechanisms and roles in vascular remodeling related diseases[J]. Immun Inflamm Dis, 2023, 11(11): e1060.\u003c/li\u003e\n\u003cli\u003ePeng B, Cheng S, Wang H, et al. N(6)-methyladenosine enhances the expression of TGF-\u0026beta;-SMAD signaling family to inhibit cell growth and promote cell metastasis[J]. Cancer Lett, 2024, 603: 217195.\u003c/li\u003e\n\u003cli\u003eTirpude N V, Sharma A, Joshi R, et al. Vitex negundo Linn. extract alleviates inflammatory aggravation and lung injury by modulating AMPK/PI3K/Akt/p38-NF-\u0026kappa;B and TGF-\u0026beta;/Smad/Bcl2/caspase/LC3 cascade and macrophages activation in murine model of OVA-LPS induced allergic asthma[J]. J Ethnopharmacol, 2021, 271: 113894.\u003c/li\u003e\n\u003cli\u003eZhang X, Hu Z, Wang X, et al. ANXA10 promotes melanoma metastasis by suppressing E3 ligase TRIM41-directed PKD1 degradation[J]. Cancer Lett, 2021, 519: 237-249.\u003c/li\u003e\n\u003cli\u003eVoytyuk O, Ohata Y, Moustakas A, et al. Smad7 palmitoylation by the S-acyltransferase zDHHC17 enhances its inhibitory effect on TGF-\u0026beta;/Smad signaling[J]. J Biol Chem, 2024, 300(7): 107462.\u003c/li\u003e\n\u003cli\u003eZhao J, Tang X, Zhu H. Chondroitin polymerizing factor (CHPF) promotes the progression of colorectal cancer through ASB2-mediated ubiquitylation of SMAD9[J]. Histol Histopathol, 2024, 39(11): 1493-1503.\u003c/li\u003e\n\u003cli\u003eTan K, Mo J, Li M, et al. SMAD9-MYCN positive feedback loop represents a unique dependency for MYCN-amplified neuroblastoma[J]. J Exp Clin Cancer Res, 2022, 41(1): 352.\u003c/li\u003e\n\u003cli\u003eChen Y, Li E, Chang Z, et al. Identifying potential therapeutic targets in lung adenocarcinoma: a multi-omics approach integrating bulk and single-cell RNA sequencing with Mendelian randomization[J]. Front Pharmacol, 2024, 15: 1433147.\u003c/li\u003e\n\u003cli\u003eWang S, Li Y, Jin K, et al. PSME3 promotes lung adenocarcinoma development by regulating the TGF-\u0026beta;/SMAD signaling pathway[J]. Transl Lung Cancer Res, 2024, 13(6): 1331-1345.\u003c/li\u003e\n\u003cli\u003eCao J P, Yan Y, Li X S, et al. Oroxylin A suppressed colorectal cancer metastasis by inhibiting the activation of the TGF-\u0026beta;/SMAD signal pathway[J]. Sci Rep, 2024, 14(1): 24091.\u003c/li\u003e\n\u003cli\u003eLi J, Huang X, Luo L, et al. The role of p53 in male infertility[J]. Front Endocrinol (Lausanne), 2024, 15: 1457985.\u003c/li\u003e\n\u003cli\u003eSong G, Liu J, Tang X, et al. Cell cycle checkpoint revolution: targeted therapies in the fight against malignant tumors[J]. Front Pharmacol, 2024, 15: 1459057.\u003c/li\u003e\n\u003cli\u003eSelvaraj C. Therapeutic targets in cancer treatment: Cell cycle proteins[J]. Adv Protein Chem Struct Biol, 2023, 135: 313-342.\u003c/li\u003e\n\u003cli\u003eChen C, Chen J, Wang Y, et al. Ganoderma lucidum polysaccharide inhibits HSC activation and liver fibrosis via targeting inflammation, apoptosis, cell cycle, and ECM-receptor interaction mediated by TGF-\u0026beta;/Smad signaling[J]. Phytomedicine, 2023, 110: 154626.\u003c/li\u003e\n\u003cli\u003eXie L, Huang L, Zhang G, et al. Inhibition of keloid by (32)P isotope radiotherapy through suppressing TGF-\u0026beta;/Smad signaling pathway[J]. Aging (Albany NY), 2023, 15(21): 11985-11993.\u003c/li\u003e\n\u003cli\u003eChen L, Fang W, Chen W, et al. Deciphering the molecular mechanism of the THBS1 gene in the TNF signaling axis in glioma stem cells[J]. Cell Signal, 2023, 106: 110656.\u003c/li\u003e\n\u003cli\u003eDu T, Zhang K, Zhang Z, et al. ITGBL1 transcriptionally inhibited by JDP2 promotes the development of pancreatic cancer through the TGF-beta/Smad pathway[J]. Braz J Med Biol Res, 2022, 55: e11989.\u003c/li\u003e\n\u003cli\u003eWang C, Xu J, Liu M, et al. [Relationship between GTSE1 and Cell Cycle and Potential Regulatory Mechanisms \u2029in Lung Cancer Cells][J]. Zhongguo Fei Ai Za Zhi, 2024, 27(6): 451-458.\u003c/li\u003e\n\u003cli\u003eManousakis E, Miralles C M, Esquerda M G, et al. CDKN1A/p21 in Breast Cancer: Part of the Problem, or Part of the Solution?[J]. Int J Mol Sci, 2023, 24(24).\u003c/li\u003e\n\u003cli\u003eShaikh M a J, Babu M A, Ghaboura N, et al. Non-coding RNAs: Key regulators of CDK and Wnt/\u0026beta;-catenin signaling in cancer[J]. Pathol Res Pract, 2024, 263: 155659.\u003c/li\u003e\n\u003cli\u003eYang L, Liu Y, Guo R, et al. CDK4 gene copy number increase and concurrent genetic changes in acral melanoma of a Chinese cohort[J]. Pathology, 2024.\u003c/li\u003e\n\u003cli\u003eBurns M C, Borgal L. Asp/ASPM phospho-regulation throughout the cell cycle[J]. Genome, 2024.\u003c/li\u003e\n\u003cli\u003ePathania A S, Chava H, Balusu R, et al. The crosstalk between non-coding RNAs and cell-cycle events: A new frontier in cancer therapy[J]. Mol Ther Oncol, 2024, 32(2): 200785.\u003c/li\u003e\n\u003cli\u003eDevulder J V. Unveiling mechanisms of lung aging in COPD: A promising target for therapeutics development[J]. Chin Med J Pulm Crit Care Med, 2024, 2(3): 133-141.\u003c/li\u003e\n\u003cli\u003eMenon S S, Guruvayoorappan C, Sakthivel K M, et al. Ki-67 protein as a tumour proliferation marker[J]. Clin Chim Acta, 2019, 491: 39-45.\u003c/li\u003e\n\u003cli\u003eYerushalmi R, Woods R, Ravdin P M, et al. Ki67 in breast cancer: prognostic and predictive potential[J]. Lancet Oncol, 2010, 11(2): 174-83.\u003c/li\u003e\n\u003cli\u003eProbert J, Dodwell D, Broggio J, et al. Ki67 and breast cancer mortality in women with invasive breast cancer[J]. JNCI Cancer Spectr, 2023, 7(5).\u003c/li\u003e\n\u003cli\u003eZhang A, Wang X, Fan C, et al. The Role of Ki67 in Evaluating Neoadjuvant Endocrine Therapy of Hormone Receptor-Positive Breast Cancer[J]. Front Endocrinol (Lausanne), 2021, 12: 687244.\u003c/li\u003e\n\u003cli\u003eZhu X, Wu J, Chen X, et al. DNA ligase III mediates deoxynivalenol exposure-induced DNA damage in intestinal epithelial cells by regulating oxidative stress and interaction with PCNA[J]. Int J Biol Macromol, 2024: 137137.\u003c/li\u003e\n\u003cli\u003eWang Y, Fernandez A, Pei X, et al. EGFR-mediated HSP70 phosphorylation facilitates PCNA association with chromatin and DNA replication[J]. Nucleic Acids Res, 2024.\u003c/li\u003e\n\u003cli\u003ePorras-G\u0026oacute;mez T J, Moreno-Mendoza N. Identification of the proliferative activity of germline progenitor cells in the adult ovary of the bat Artibeus jamaicensis[J]. Zygote, 2024: 1-10.\u003c/li\u003e\n\u003cli\u003eGu L, Li M, Li C M, et al. Small molecule targeting of transcription-replication conflict for selective chemotherapy[J]. Cell Chem Biol, 2023, 30(10): 1235-1247.e6.\u003c/li\u003e\n\u003cli\u003eSimoneau A, Engel J L, Belti M, et al. Ubiquitinated PCNA Drives USP1 Synthetic Lethality in Cancer[J]. Mol Cancer Ther, 2023, 22(2): 215-226.\u003c/li\u003e\n\u003cli\u003eWang Y N, Zhai X Y, Wang Z, et al. Jianpi-Huatan-Huoxue-Anshen formula ameliorates gastrointestinal inflammation and microecological imbalance in chemotherapy-treated mice transplanted with H22 hepatocellular carcinoma[J]. World J Gastrointest Oncol, 2024, 16(10): 4209-4231.\u003c/li\u003e\n\u003cli\u003eZhang H, Tang J, Cao H, et al. Effect and mechanism of Magnolia officinalis in colorectal cancer: multi-component-multi-target approach[J]. J Ethnopharmacol, 2024: 119007.\u003c/li\u003e\n\u003cli\u003ePan B, Zhu H, Yang J, et al. From complexity to clarity: development of CHM-FIEFP for predicting effective components in Chinese herbal formulas by using big data[J]. Cancer Biol Med, 2024.\u003c/li\u003e\n\u003cli\u003eHu W W, Chen Y, Cai C K, et al. A case report of effective treatment of intracranial atherosclerotic stenosis treated with the integration of traditional Chinese medicine and Western medicine[J]. Medicine (Baltimore), 2024, 103(41): e40055.\u003c/li\u003e\n\u003cli\u003eCai W J, Chen R R, Liu Z B, et al. Prognostic Prediction and Immune Microenvironment Characterization in Uveal Melanoma: A Novel Mitochondrial Metabolism-Related Gene Signature[J]. ACS Omega, 2024, 9(42): 43034-43045.\u003c/li\u003e\n\u003cli\u003eJiang Y, Liu F F, Cai Y Q, et al. Oral Decoctions Based on Qi-Yin Syndrome Differentiation After Adjuvant Chemotherapy in Resected Stage \u0026Iota;\u0026Iota;\u0026Iota;A Non-Small Cell Lung Cancer: A Randomized Controlled Trial[J]. Integr Cancer Ther, 2024, 23: 15347354241268271.\u003c/li\u003e\n\u003cli\u003eTang Z, Zhou P, Sun H. Clinical Efficacy of Yiqi Yangyin Decoction Combined with Adjuvant Chemotherapy on the Postoperative Life Quality of Breast Cancer[J]. Nutr Cancer, 2024, 76(9): 824-830.\u003c/li\u003e\n\u003cli\u003eSun J R, Lou Y N, Huang R, et al. Predictive value of TCM tongue characteristics for chemotherapy-induced myelosuppression in patients with lung cancer[J]. Medicine (Baltimore), 2024, 103(15): e37636.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Lathyrol, Renal Cell Cancer, TGF-β/smad Signal Pathway, Cell Cycle, Proliferation","lastPublishedDoi":"10.21203/rs.3.rs-6122802/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6122802/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eRenal cell carcinoma (RCC) is a prevalent malignant tumor with high morbidity and mortality. The TGF-β/smad signaling pathway plays a significant role in the development and progression of RCC.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eThis study explored the impact of lathyrol on the proliferation of mice RCC renca cells by inhibiting the TGF-β/smad signaling pathway and arresting the cell cycle. Bioinformatics analysis, cell culture experiments, and animal experiments were conducted to detect the effects of lathyrol on the activity, mRNA, and protein expressions of RCC cells and RCC xenograft tumors, as well as the expressions of cell cycle proteins and cell cycle regulatory proteins.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eLathyrol treatment showed a positive correlation with the inhibitory effect on cell proliferation. The IC values of 786-O cells and renca cells were comparable. In vitro, lathyrol decreased the protein and mRNA expressions of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9, while increasing the mRNA expressions of smad2, smad3, and smad4. In vivo, lathyrol suppressed the mRNA and protein expressions of TGF-β1, TGF-βR1, smad2, smad3, smad4, and smad9 in RCC xenografts, and decreased the protein expressions of cyclinD1, cyclinB1, cyclinA1, cyclinE1, CDK6, CDK4, and CDK1, while increasing the expressions of P16, P21, and P27.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eLathyrol can repress the expression of key proteins in the TGF-β/smad signaling pathway, impede the signal transduction, arrest the cell cycle progression of renca cells, and subsequently inhibit the proliferation of RCC cells. Future studies are needed to further explore the mechanism of lathyrol in RCC treatment.\u003c/p\u003e","manuscriptTitle":"Lathyrol inhibits the proliferation of renca cells by affecting the expression of TGF-β/smad pathway and then affecting the cell cycle","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-03 09:20:36","doi":"10.21203/rs.3.rs-6122802/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"68e58c83-e6be-496b-9829-84961109b366","owner":[],"postedDate":"March 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-02T08:02:53+00:00","versionOfRecord":[],"versionCreatedAt":"2025-03-03 09:20:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6122802","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6122802","identity":"rs-6122802","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.