Lethal Endotoxin (ccdB) Based Counterselection Improved the Efficiency of Sequential Gene Editing in Escherichia coli | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Lethal Endotoxin (ccdB) Based Counterselection Improved the Efficiency of Sequential Gene Editing in Escherichia coli Shiyao Zou, Weiqi Chen, Ying Cao, Xiaolan Liu, Jinhua Wang, yongze wang, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6455048/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Sep, 2025 Read the published version in Biotechnology Letters → Version 1 posted 5 You are reading this latest preprint version Abstract The CRISPR/Cas9 based technology has been used for sequential gene editing in E. coli . The plasmids carrying the sgRNA and/or Cas9 genes need to be cured after each round of editing. Curing of these plasmids, particularly the sgRNA plasmid, limits the efficiency of sequential gene editing. In this study, a lethal endotoxin ( ccd B) based counter-selection was established for improving the overall efficiency of sequential gene editing in E. coli . This approach was validated for sequential editing (deletion) of cst A and pps A genes. The experimental results showed that the transformation efficiency sgRNA plasmid (pTargetF- tcr -P L - ccd B-N20) reached to 10 8 -10 9 cfu / µg -DNA , resulting in a 90% of recombination rate for the target gene ( cst A and pps A). Upon completion of cst A gene editing, the sgRNA plasmid (pTargetF- tcr -P L - ccd B-N20( cst A)) were effectively cured through ccd B based counterselection at 42°C, with a 43.75% efficiency. At the end of sequential editing of pps A gene, both Cas9 (25A) and sgRNA (pTargetF- tcr -P L - ccd B-N20( pps A)) plasmids were cured simultaneously through the sac B and ccd B based counterselections by incubating the cells on LB-sucrose (5%) plate at 42°C, achieving a curing rate of 100% for Cas9 plasmid (25A), and 37.5% for sgRNA plasmid (pTargetF- tcr -P L - ccd B-N20( pps A)). These results demonstrated that the endotoxin ( ccd B) based counterselection improved the transformation efficiency of sgRNA plasmid, the recombination rate of the editing target gene, the curing rate of sgRNA plasmid, and the overall efficiency of sequential gene editing. E. coli sequential gene editing CRISPR/Cas9 ccdB counter-selection Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The CRISPR/Cas9 based technology has been widely used in prokaryotes and eukaryotes for sequential gene editing, due to its efficiency, easy operation, and short editing cycle(Lan et al., 2021 ; Li et al., 2016 ). The CRISPR/Cas9 based genes are typically cloned into a single(Zhao et al., 2016 ) or a dual plasmid(Li et al., 2015 ; Ye et al., 2022 ) for gene editing in E. coli . The limitations of a single plasmid approach include complicated cloning, reduced transformation/electroporation efficiency, and unable to modulate expression of sgRNA and Cas9 gene through plasmid copy number(Wang et al., 2021 ). The dual plasmid approach can overcome these limitations with an enhanced efficiency (Wang et al., 2021 ). However, curing off these tool plasmids such as sgRNA expression plasmid limits the efficiency of sequential gene editing(Zhao et al., 2016 ). Recently, a targeted curing of the tool plasmid was developed to improve the efficiency of CRISPR/Cas9 gene editing technology (Jiang et al., 2015 ). This methodology primarily utilizes the temperature sensitivity of plasmids and/or the strategic placement of restriction enzyme cleavage sites on Cas9 plasmid to facilitate the removal of the dual tool plasmids. Yang et al.(Jiang et al., 2015 ) utilized the pCas and pTargetF plasmids within a cooperative framework to achieve successive gene editing. The pCas plasmid is characterized as a temperature-sensitive plasmid that concurrently expresses a single guide RNA (sgRNA) under a lactose operon, which enables the anchoring of the pTargetF plasmid replicon through IPTG-induced expression. Although the pTargetF plasmid can be cleaved via IPTG-induced expression of the cleavage enzyme, significant leaking expression of the lactose operon was observed, resulting in a substantial decreased transformation (electroporation) efficiency (10 6 cfu / µg- DNA ) of the pTargetF plasmid(Jiang et al., 2015 ). Substituting the lactose operon with a more stringent rhamnose operon, the transformation efficiency was improved to 10 7 cfu / µg- DNA (Li et al., 2021 ), which was lower than the 10 8 cfu / µg- DNA achieved by the plasmid without a cleavage site(Pyne et al., 2015 ). For the CRISPR/Cas9 based gene editing, the pCas plasmid is normally first transformed into the host organism. This initial step often results in a significant accumulation of leaky expression of sgRNA, which subsequently increases the likelihood of cleavage during the subsequent electroporation of the incoming pTargetF plasmid. To address this issue, Zhang et al.(Shao et al., 2020 ) developed an improved donor plasmid, designated pV4, which is based on the pTargetF plasmid backbone and incorporates a self-cleavage function. Additionally, they integrated a lactose operon into the pV4 plasmid to regulate plasmid elimination. This modification serves to mitigate the impact of unintended expression of the cleavage enzyme to improve the efficiency of electroporation of the sgRNA plasmid. Regardless of whether the operon responsible for plasmid elimination is cloned into the pCas plasmid or the pTargetF plasmid, the challenge of optimizing transformation (electroporation) efficiency remains due to the unintended expression of sgRNA. A proposed "rock-paper-scissors" strategy presents a novel approach(Wang et al., 2021 ), which uses a third plasmid such as pTargetF plasmid. It utilizes the incoming pTargetF plasmid encoded restriction enzyme to cleave the one from the previous round. However, the implementation of this strategy necessitates the construction of three different plasmids, which increases operational complexity. The leakage expression of restriction enzyme cloned on Cas9 plasmid significantly affects transformation efficiency of the incoming sgRNA plasmid, which subsequently influences the overall editing efficiency. To address this challenge, we are investigating the non-cleavage counterselection approach to facilitate the removal of the dual plasmids. Our strategy will use the sac B based counterselection for curing of Cas9 gene expression plasmid by incubating cells on LB-sucrose plate (Li et al., 2021 ), and construct a lethal endotoxin ( ccd B) based counterselection for curing of the sgRNA expression plasmid(Wang et al., 2014 ). To facilitate the ccd B based counterselection, we cloned a stringent thermal active P L promoter to regulate the ccd B expression. Therefore, the sgRNA plasmid can be cured by incubating the cells under the induction temperature (42°C) after each round of gene editing. At the end of sequential editing, both Cas9 and sgRNA plasmid can be cured simultaneously by incubating cells on LB-sucrose plate at 42°C. Materials and Methods Bacterial strains, plasmids, primers, and growth conditions The bacterial strains, plasmids, and primers used in this study are listed in Table 1 . Bacterial cultures were grown 37°C unless specified otherwise in Luria-Bertani (LB) broth (g L − 1 : tryptone 10, yeast extract 5, and NaCl 5) or LB-sucrose broth (sucrose 50 g), on LB plates (agar 18 g) or LB-sucrose plate (sucrose 50 g). For preparation of cells for electroporation, bacterial cultures were grown in SOB broth (g L − 1 : peptone 20, yeast extract 5, NaCl 0.6, KCl 0.186, MgCl 2 0.95), or SOC broth (SOB supplemented with 3.5 g glucose). During plasmid/strain construction, kanamycin, ampicillin, chlortetracycline, or spectinomycin, were added to the media (50 µg mL − 1 ) accordingly. Table 1 Strains, plasmids and primers used in the Study E. coli Strain Relevant characteristics Source DH5α end A1 rec A1 φ80 dlac Z∆M15 ∆( lac ZYA- arg F) U169, hsd R17 Invitrogen HBUT-P2 E. coli W, ∆ frd ABCD, ∆ adh E, ∆ pta , ∆ pfl B, ∆ ald A, ∆ csc R, ∆ ldh A, ∆ pox B Wang lab HBUT-P2 (25A) Plasmid 25A was transformed into HBUT-P2 strain This study HBUT-P2 (25A, pTargetF- tcr -P L - ccd B) Plasmid 25A and pTargetF- tcr -P L - ccd B were transformed into HBUT-P2 strain This study HBUT-P2 (25A, pTargetF- tcr -P L - ccd B-N20( cst A)) Plasmid 25A and pTargetF- tcr -P L - ccd B-N20( cst A) were transformed into HBUT-P2 strain This study HBUT-P23 (25A) Plasmid 25A was transformed into HBUT-P23 This study HBUT-P23 (25A, pTargetF- tcr -P L - ccd B-N20( pps A)) Plasmid 25A and pTargetF- tcr -P L - ccd B-N20( pps A) were transformed into HBUT-P23 strain This study HBUT-P2-∆ cst A cst A gene was deleted from HBUT-P2 This study HBUT-P2-∆ cst A-∆ pps A pps A gene was deleted from HBUT-∆ cst A This study Plasmids Relevant characteristics Source pSim6 Ampicillin resistance, contains the thermal active promoter (P L ) (Datta et al., 2006 ) pTargetF sgRNA plasmid with chloramphenicol resistance (Li et al., 2021 ) pBR322 Chlortetracycline resistance Wang lab 25A Cas9 plasmid with kanamycin resistance (Huang et al., 2020 ) pEcgRNA The pEcgRNA plasmid containing the ccd B gene. HEDGEHOGBIO pSim6-P L - ccd B The P L - ccd B fragment was inserted into pSim6 This study pTargetF- tcr sgRNA plasmid with chlortetracycline resistance. This study pTargetF- tcr -P L - ccd B sgRNA plasmid with P L - ccd B fragment inserted This study pTargetF- tcr -P L - ccd B-N20 ( cst A) The engineered single guide RNA (sgRNA) fragment targeting cst A gene was inserted into the plasmid pTargetF- tcr -P L - ccd B. This study pTargetF- tcr -P L - ccd B-N20 ( pps A) The specifically designed single guide RNA (sgRNA) fragment targeting pps A gene was inserted into the plasmid pTargetF- tcr -P L - ccd B. This study Primers Sequence Source pSim6-F aacgaatgagtactgcactcgcaacg This study pSim6-R ggtggtcagtgcgtcctgct This study ccd B-F agcaggacgcactgaccaccatgcagtttaaggtttacacctata This study ccd B-R gagtgcagtactcattcgttttatattccccagaacatcaggtta This study pSim6- ccd B-yz-F gttatctacacgacggggag This study pSim6- ccd B-yz-R gctgagatcagccacttctt This study P L - ccd B-F aagaaatagcgctttcagcc This study P L - ccd B-R ttatattccccagaacatcaggtta This study pTargetF- tcr -F tgatgttctggggaatataacgaacgcgtaaaggatctag This study pTargetF- tcr -R ggctgaaagcgctatttcttcggaacttcggaataggaac This study pTargetF- tcr -P L - ccd B-yz-F tccaggcaggtagatgacga This study pTargetF- tcr -P L - ccd B-yz-R gctgagatcagccacttctt This study N20- cst A-F aatcagggaaatacctcgtcgttttagagctagaaatagc This study N20- cst A-R gacgaggtatttccctgattactagtattatacctaggac This study N20- cst A-yz-F aatcagggaaatacctcgtc This study N20- cst A-yz-R cctgtcctacgagttgcatg This study cst A-F gagatgatgtgctggaagcc This study cst A-R gtgattgcccacaccttgcg This study cst A-yz-F cggttaacggagtgatcgag This study cst A-yz-R acatcttggcctccgctaac This study N20- pps A-F cgtccataaaccgacactgggttttagagctagaaatagcaagtt This study N20- pps A-R ccagtgtcggtttatggacgactagtattatacctaggactgagc This study N20- pps A-yz-F cgtccataaaccgacactgg This study N20- pps A-yz-F cctgtcctacgagttgcatg This study pps A-F atgaacctgaattaaccgcc This study pps A-R aatctgatccttcactgccc This study pps A-yz-F atcctttgtcgcgctttatg This study pps A-yz-R cgatggagtagaagaccagc This study Chemicals and Enzymes The chemicals used in this study are analytical grade. The IPTG inducer and L- (+) arabinose were obtained from Macklin. The restriction enzymes, T5 exonuclease (1000 U), PrimeSTAR Max DNA Polymerase, 2×Taq polymerase were provided by Takara. The primers were synthesized by Wuhan Tsingke Biotech Co., Ltd. Genetic methods Standard methods were used for plasmid construction(Yu et al., 2023 ), transformation(Chang et al., 2017 ), and electroporation(Dower et al., 1988 ). Plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer’s instructions. DNA was purified by ethanol precipitation or by using a Wizard Plus Minipreps DNA Purification Systems Kit (Promega). PCR reactions were performed in 50 µl volumes containing 50 ng of template DNA, 300 pmol of each oligonucleotide primer, 25 µl of PrimeSTAR Max DNA Polymerase, 2×Taq polymerase. DNA sequencing was conducted by Wuhan Tsingke Biotech Co., Ltd. or DynaScience. Plasmid construction Construction of pTargetF- tcr -P L - ccd B plasmid The promoter-less ccd B gene was amplified via PCR with the primers ccd B-F/R and pEcgRNA as the template. A thermal (42°C) active P L promoter was amplified from pSim6 and placed into the upstream of the ccd B gene, resulting in a P L - ccd B DNA fragment. The pSim6 plasmid was linearized through PCR using the primers pSim6-F/R. The linearized pSim6 plasmid and P L - ccd B DNA fragment were then digested with T5 exonuclease (Yu et al., 2023 ). The resulting reaction mixture was transformed into E. coli DH5α, spread onto LB-ampicillin plate and incubated overnight (Chang et al., 2017 ). The resulting colonies were screened through colony PCR with the primer pairs pSim6- ccd B-yz-F/R. The colony PCR verified plasmids were then isolated and sequenced (Wuhan Tsingke Biotech Co., Ltd.). The resulting plasmid with right sequence was designated as pSim6-P L - ccd B. The spectinomycin resistance gene in the pTargetF was replaced by the chlortetracycline resistance gene ( tcr ) cloned from pBR322, resulting in pTargetF- tcr plasmid which was then linearized by PCR with the primers pTargetF- tcr -F/R. The P L - ccd B DNA fragment was then amplified from pSim6-P L - ccd B with the primers P L - ccd B-F/R. Both linearized pTargetF- tcr and P L - ccd B fragments were digested with T5 exonuclease (Yu et al., 2023 ). The digested reaction mixture was transformed into E. coli DH5α, spread onto LB-chlortetracycline plates (Chang et al., 2017 ). After overnight incubation, the resulting colonies were screened through colony PCR using the primers pTargetF- tcr -P L - ccd B-yz-F/R, and then sequenced (DynaScience). The plasmid with the expected sequence was designated as pTargetF- tcr -P L - ccd B. 2) Construction of sgRNA expression plasmids The pTargetF- tcr -P L - ccd B was linearized through PCR employing the primer pairs N20( cst A)-F/R, and N20( pps A)-F/R, respectively, followed by T5 exonuclease digestion (Yu et al., 2023 ). The digestion mixture was subsequently transformed into E. coli DH5α, respectively (Chang et al., 2017 ). After overnight incubation on LB-chlortetracycline plates, the resulting colonies were verified via colony PCR using the primers N20( cst A)-yz-F/R, and N20( pps A)-yz-F/R, respectively. Upon successful colony PCR verification, plasmids were isolated and sequenced (Wuhan Tsingke Biotech Co., Ltd.). The plasmid with right sequence was designated as pTargetF- tcr -P L - ccd B-N20( cst A), and pTargetF- tcr -P L - ccd B-N20( pps A), respectively. Thermal induction of ccd B gene expression The pTargetF- tcr -P L - ccd B-N20( cst A) plasmid was transformed into the HBUT-P2 cells. Both HBUT-P2 and HBUT-P2 (pTargetF- tcr -P L - ccd B-N20( cst A)) strains were spread onto LB plates and incubated at 30°C, 37°C and 42°C to evaluate their growth on the agar medium. In addition, the HBUT-P2 (pTargetF- tcr -P L - ccd B-N20( cst A)) were grown in LB broth to an OD 600 of 0.4, diluted 10 4 -fold, spread onto LB-chlortetracycline plates, and incubated overnight at 30°C and 42°C, respectively. The effectiveness of thermal induction was assessed by the number of colonies obtained at 30°C (uninduced) and 42°C (induced). Evaluation of the transformation efficiency of sgRNA expression plasmid The plasmid pTargetF- tcr -P L - ccd B-N20( cst A) was transformed into the HBUT-P2 via electroporation(Huang et al., 2020 ). After a three-hour recovery incubation at 30°C in SOC broth, the transformed cells were spread onto on LB-chlortetracycline plates and incubated overnight at 30°C. The electroporation efficiency was calculated based on the number of colonies (cfu) obtained on the plates and the amount of plasmid DNA (µg) used for electroporation. Sequential gene editing with sgRNA plasmids containing counterselection gene (ccd B) 1) Deletion of A gene from HBUT-P2 The plasmid 25A (containing Cas9 gene) was transformed into the HBUT-P2 strain (Dower et al., 1988 ). The transformed HBUT-P2 (25A) cells was incubated in SOB broth (50 ml) to an OD 600 of 0.1–0.2 (37°C, 200 rpm shaking). The isopropyl β-D-1-thiogalactopyranoside (IPTG) inducer was added to the culture (0.5 mmol/L), which was further incubated for one hour. Five mL of 16% arabinose solution was added to the culture. After reaching to an OD 600 of 0.4–0.6, the culture was transferred to a pre-cooled 50 mL centrifuge tube (on ice) for 30 minutes, and centrifuged (4°C, 6000 rpm) for 5 minutes. The resulting pellet was washed three times with pre-cooled ultrapure water. The final pellet was resuspended with the residual ultrapure water in the centrifuge tube and aliquoted into pre-cooled 1.5 mL centrifuge tubes. These cells were ready for electroporation. The ∆ cst A donor DNA was amplified using the HBUT-P23 (∆ cst A) as template and the cst A-F/R primer pairs and purified through ethanol precipitation. This donor DNA (2,000 ng) were mixed with the sgRNA plasmid DNA (pTargetF- tcr -P L - ccd B-N20 ( cst A), 500 ng) and resuspended to a final volume of 10 µL with ultrapure water in a PCR tube. This DNA mixture was electroporated into HBUT-P2 (25A) cells prepared above. After electroporation, 5 mL SOC broth was promptly added to the cultures and incubated for three hours. This culture was then centrifuged (4°C, 6,000 rpm) for 1 minute. After removing 4 mL of the supernatants, the pellets were resuspended and diluted 100 folds with SOC broth. 100 µL of the diluted cells was spread onto LB-(kanamycin + chlortetracycline) plates and incubated overnight at 30°C. The colonies obtained were verified through colony PCR with the cst A-YZ-F/R primers and DNA were sequenced (Wuhan Tsingke Biotech Co., Ltd). The strain with the expected cst A deletion was designated as HBUT-P2-∆ cst A. Sequential deletion of pps A gene from HBUT-P2-∆ cst A After successful curing of pTargetF- tcr -P L - ccd B-N20 ( cst A), the strain HBUT-P2-∆ cst A (25A) was transformed (electroporated) with a mixture of plasmid pTargetF- tcr -P L - ccd B-N20 ( pps A) and the PCR amplified donor DNA (made from a previous constructed pps A deletion strain). Following the similar procedure for cst A deletion described above, the pps A gene was successfully deleted from the HBUT-P2-∆ cst A, resulting in a new strain designated as HBUT-P2-∆ cst A-∆ pps A. Plasmid curing Curing of sgRNA plasmid with ccd B based counterselection The HBUT-P2-∆ cst A (25A, pTargetF- tcr -P L - ccd B-N20 ( cst A)) cells were grown in a shaking flask containing LB-(kanamycin + chlortetracycline) broth (37°C, 200 rpm) to an OD 600 of 0.4–0.6, and then diluted 10 4 -fold. The diluted cell broth (100 µL) was spread onto LB-kanamycin plates. The plates were then incubated overnight at 42°C. Individual colonies were picked from the overnight growing plates and tested for their growth (37°C) on replicate plates: LB-kanamycin, and LB-chlortetracycline plates, respectively. If growth was observed on the LB-kanamycin plate while no growth on the LB-chlortetracycline plates for the same colony, it suggested that the pTargetF- tcr -P L - ccd B-N20 ( cst A) plasmid had been successfully cured from the strain. Simultaneously curing of both sgRNA and Cas9 plasmid The HBUT-P2-∆ cst A-∆ pps A (25A, pTargetF- tcr -P L - ccd B-N20 ( pps A)) cells were grown 37°C in LB-(kanamycin + chlortetracycline) broth to an OD 600 of 0.4–0.6, then diluted 10 4 -fold. The diluted cells (100 µL) were spread onto a LB-sucrose plate and incubated overnight at 42°C. Individual colonies from LB-sucrose plate were streaked for triplicate plate testing: LB plate, LB-kanamycin plate, and LB-chlortetracycline plate, respectively. If colony growth was observed on the LB plate, but neither on the LB-kanamycin plate nor on the LB-chlortetracycline plate, it suggested that both 25A and pTargetF- tcr -P L - ccd B-N20 ( pps A) plasmids had been simultaneously cured effectively. Results Construction of a sgRNA plasmid with a lethal endotoxin gene The CRISPR/Cas9 technology has been used for sequential gene editing in E. coli . To this end, a dual modulate expression plasmids (high copy for sgRNA expression and low copy for Cas9 gene expression) are often used as a tool to enhance the efficiency of gene editing and simplify the plasmid construction process(Wang et al., 2021 ). After each round of gene editing, however, curing of the tool plasmid, particularly the high copy sgRNA expression plasmid, remains a challenge that affect the overall efficiency of sequential editing process. To address this issue, we constructed a new plasmid (pTargetF- tcr -P L - ccd B-N20) with a lethal endotoxin gene ( ccd B) for sgRNA plasmid curing through counterselection. As shown in Fig. 1 , the ccd B endotoxin gene was placed under the control of a heat-inducible promoter (P L ). Upon induction of the ccd B gene expression at 42°C, the CcdB endotoxin would kill the host cell and leave the one with sgRNA plasmid cured successfully. It is expected that this approach will facilitate sgRNA plasmid curing at the end of each round of gene editing, and the overall efficiency for sequential editing of multiple genes. Thermal induction of the ccdB endotoxin gene To evaluate the thermal induction of the ccd B endotoxin gene expression and its lethal impact on the host, the sgRNA plasmid, pTargetF- tcr -P L - ccd B-N20( cst A), was transformed into HBUT-P2 cells. The cell growth of these transformed cells containing the endotoxin gene were then compared with the parent cell without endotoxin gene (HBUT-P2 cells) under the induction temperature (42°C) and non-induction temperature (30°C and 37°C). As shown in Fig. 2 , the control HBUT-P2 cells grew well (cell lawn) under three test temperature, the transformed cells containing P L - ccd B endotoxin gene grew well (cell lawn) under non-induction temperature (30°C and 37°C). However, obviously less cell growth was observed (isolated colonies without cell lawn) under the 42°C induction temperature (Fig. 2 C). This result suggested that the ccd B gene was induced at 42°C and the CcdB endotoxin killed most host cells, resulting in fewer cell growth. To quantitatively assess the lethal effect of ccd B gene expression, the overnight cultures of E. coli HBUT-P2 (pTargetF- tcr -P L - ccd B-N20( cst A)) were diluted 10 4 -fold. 100 µl of diluted cells were spread onto LB-chlortetracycline plates and grown overnight under 30°C and 42°C, respectively (Fig. 3 ). The results showed that a total of 2,213 and 66 colonies were obtained from 30°C and 42°C plates, respectively. The grown colonies on the chlortetracycline selective plate indicated that the sgRNA expression plasmid (pTargetF- tcr -P L - ccd B-N20( cst A)) remains in host cells. Therefore, fewer colonies at 42°C suggested the ccd B gene was effectively induced through the thermal active P L -promoter. The expressed CcdB endotoxin killed host cells, leading to fewer colonies. Based on the number of colonies obtained at 30°C (2,213 colonies) and 42°C (66 colonies), an estimated lethal rate of 97% was achieved under the thermal induction. Transformation efficiency of the sgRNA plasmid containing P L -ccdB gene For Cas9 based sequential gene editing, the sgRNA expression plasmid for prior gene needs to be cured off and a new one for next target gene needs to be transformed into the host cell at each round of gene editing. Therefore, the plasmid curing efficiency of prior gene as well as transformation efficiency of next one has great impact on the overall efficiency of sequential gene editing. To evaluate whether the P L - ccd B endotoxin gene affect the transformation efficiency of sgRNA expression plasmid, the pTargetF- tcr -P L - ccd B-N20( cst A) was transformed (electroporated) into the host containing Cas9 plasmid, HBUT-P2 (25A). After electroporation recovery incubation, the cell broth was diluted 10 6 -fold. A 100 µL of the diluted cells were spread onto the LB-(kanamycin + chlortetracycline) selective plates and incubated overnight at 37°C. As shown in Fig. 4 , a total of 84 transformed colonies were obtained on the selective plates. Based on the number of colonies obtained and the amount of plasmid DNA used for electroporation, an estimated transformation efficiency of 8.4×10⁸ colony-forming units per microgram of DNA (cfu/µg- DNA ) was achieved, which is at least one-magnitude higher than the results reported in the literature (10 6 − 10 7 cfu / µg -DNA )(Jiang et al., 2015 ; Li et al., 2021 ). Sequential deletion of cstA and ppsA gene using sgRNA plasmids containing P L -ccd B endotoxin gene The primary goal of cloning the ccd B endotoxin gene into the sgRNA plasmid is to improve the efficiency of plasmid curing through counter selection during sequential gene editing. This approach, of course, should has no negative impact on the functionality of Cas9 based gene editing. To this end, two sgRNA plasmids, pTargetF- tcr -P L - ccd B-N20( cst A) and pTargetF- tcr -P L - ccd B-N20( pps A), were constructed for sequential deletion of the cst A and pps A from E. coli chromosome. As described in the method, these plasmids, along with the corresponding donor DNA, were co-electroporated into host cells containing Cas9 plasmid (25A), respectively. After post-electroporation recovery, the electroporation solution was diluted 100-fold and 100 µL of cells were spread onto LB plates supplemented with both kanamycin and chlortetracycline. After overnight incubation, a total of 6,000 and 4,200 recombinants were obtained on the plates for sequential deletions of cst A and pps A, respectively. For each target gene, 16 colonies from the plates were chosen for verification by colony PCR (Fig. 5 ). The results showed that all 16 colonies had the cst A gene successfully deleted, resulting in a recombination rate of 100%. 15 of the 16 tested colonies were successfully knocked out for pps A gene, corresponding to a recombination rate of 93.75%. These results suggested that cloning of ccd B endotoxin gene into the sgRNA plasmid had no negative impact on the function of Cas9 based gene editing. Curing of sgRNA plasmids through P L -ccdB based counterselection In the sequential gene editing workflows, efficient curing of the sgRNA-expressing plasmid after each round of gene editing is crucial to prevent cross-round interference and improve the overall efficiency of editing multiple genes. Our hypothesis is that the efficiency of curing sgRNA plasmid can be achieved through ccd B endotoxin based counterselection. To test this hypothesis, the E. coli cells harboring the dual tool plasmids (25A, pTargetF- tcr -P L - ccd B-N20( cst A)) were incubated overnight at 42°C on LB-kanamycin plate for curing of the sgRNA plasmid. 16 of the isolated colonies were picked for replicate-plate testing: LB-kanamycin plate and LB-chlortetracycline plate (Fig. 6 ). It was expected that the thermal treatment (42°C) induced the expression of ccd B endotoxin gene. The resulting CcdB endotoxin would then kill the host cell, resulting in no growth on LB-chlortetracycline plates (the tcr containing sgRNA plasmid was successfully cured). The replicate-plate testing results showed that all 16 colonies grew well on the kanamycin plate ( kan containing 25A plasmid retained) and 7 colonies did not grow on the chlortetracycline plate ( tcr containing sgRNA plasmid was cured). These results suggested that an estimated 43.75% of efficiency (7 out of 16 colonies) was achieved for sgRNA plasmid curing through the ccd B endotoxin based counterselection. In addition, upon completion of all gene-editing operations, it is ideally to cure the dual tool plasmids simultaneously. To test the feasibility of curing both Cas9 and sgRNA plasmids in one step, E. coli cells containing the dual plasmids (25A, pTargetF- tcr -P L - ccd B-N20 ( pps A)) were incubated overnight on LB-sucrose plate at 42°C. The sucrose was used for curing of 25A plasmid through sac B based counterselection(Li et al., 2021 ). Again, 16 of the isolated colonies were selected for triplicate-plate testing: LB plate, LB-kanamycin plate, and LB-chlortetracycline plate. As illustrated in Fig. 7 . All colonies grew well on the non-selective LB plate. None of the colonies exhibited growth on the LB-kanamycin plate, indicating the kan containing 25A plasmid was cured. In contrast, 6 of the 16 colonies showed no growth on the LB-chlortetracycline plate, suggesting the tcr -containing sgRNA plasmid (pTargetF- tcr -P L - ccd B-N20( pps A)) were cured from them. Quantitative analysis of these growth patterns revealed a 100% curing rate for the Cas9 tool plasmid (25A), and a 37.5% curing rate for sgRNA plasmid (pTargetF- tcr -P L - ccd B-N20( pps A)) were achieved in one step curing process, highlighting the efficiency of the dual plasmid-curing strategy through the ccd B endotoxin and sac B based counterselections. Discussion The curing of the CRISPR-Cas9 tool plasmids, especially the one for sgRNA expression, is a bottleneck impeding the efficiency of sequential gene-editing(Wang et al., 2021 ). To address this issue, multiple strategies were developed for plasmid curing within the framework of CRISPR/Cas9 gene-editing technology. These include temperature-sensitive plasmids with the repA101(Ts) replicon(Huang et al., 2020 ; Jiang et al., 2015 ; Reisch and Prather, 2015 ; Srinivas et al., 2019 ; Zerbini et al., 2017 ), the sac B counterselection (Huang et al., 2020 ; Li et al., 2021 ; Wang et al., 2021 ; Zerbini et al., 2017 ), and Cas9-guided plasmid cleavage curing strategies(Jiang et al., 2015 ; Li et al., 2021 ; Reisch and Prather, 2015 ; Wang et al., 2021 ). However, certain limitations with these approaches remains. For instance, the temperature-sensitive plasmid featuring the repA101(Ts) replicon is prone to intermittently lose its effectiveness. Moreover, the temperature-sensitive plasmids have a low copy number, which limits the expression level of the Cas9 protein and/or the quantity of sgRNA(Wang et al., 2021 ). In the Cas9-guided plasmid cleavage curing strategies, a leaky gene expression of the restriction enzyme may result in the cleavage of the sgRNA plasmid. This unintended cleavage decreases the available host cells containing both Cas9 and sgRNA tool plasmids, resulting in a decreased efficiency of gene editing. Attempts to address this issue by introducing a third-party plasmid(Reisch and Prather, 2015 ; Wang et al., 2021 ), resulted in procedural complexity. In this study, we attempted to address the challenge of sgRNA plasmid curing by cloning a lethal endotoxin gene ( ccd B) for counterselection. The lethality of the P L - ccd B used in our sgRNA plasmid showed a 97% efficiency to kill the host cells upon induction of ccd B gene at 42°C. This result is in line with those reported (86–91%) in the RED gene editing using ccd B based counterselection (Zhang et al., 2023 ). Latifi et al.(Menestreau et al., 2022 ) used Para- ccd B to remove background plasmids, achieving a lethality of 98%. Overall, the ccd B gene can be used for plasmid curing through counterselection for gene editing in E. coli . The sgRNA plasmid containing a P L - ccd B counterselection gene also demonstrated an improved transformation efficiency in our study. This efficiency is directly associated with the number of recombinants generated after gene editing(Reisch and Prather, 2015 ). Normally, the plasmid transformation efficiency can reach to 10⁹ cfu/µg- DNA (Pyne et al., 2015 ). However, empirical data suggest that the CRISPR/Cas9 gene-edited tool plasmids consistently fail to reach this expected transformation efficiency. Yang et al. reported that the transformation efficiency of a CRISPR/Cas9 tool plasmid was approximately 10 6 cfu/µg- DNA (Jiang et al., 2015 ). They speculated that this inefficiency might derive from the leaky expression of restriction enzyme cloned for plasmid curing, which leads to the unintended cleavage of the pTargetF plasmid after its transformation into the host cells. To address this issue, a more stringent rhamnose-inducible operon was employed, which subsequently increased the transformation efficiency to 10 7 cfu/µg- DNA (Li et al., 2021 ). Despite this improvement, some degree of leaky expression remains. In our study, the transformation efficiency of the sgRNA plasmid containing P L - ccd B lethal gene reached to 8.4 × 10 8 cfu/µg- DNA , which is at least one-magnitude improvement compared to the reported results (10 6 − 10 7 cfu / µg -DNA )(Jiang et al., 2015 ; Li et al., 2021 ). Along with 25A (carrying Cas9 gene), the sgRNA plasmid containing P L - ccd B lethal gene was tested for sequential editing of cst A and pps A genes. As a result, a total of 10⁶-10⁷ recombinants were obtained, with a 90% recombination rate for both genes. This outcome is better than our expectations. Previous reports have demonstrated that CRISPR/Cas9-mediated genome editing achieved up to 95% of recombination efficiencies when employing 600-bp homology arms, a critical length for optimal homology-directed repair (HDR) (Bassalo et al., 2016 ). Our high recombination rate is attributed to the high transformation efficiency of sgRNA plasmid. When transformation efficiency is as high as 8.4 × 10 8 cfu/µg- DNA , a large number of recombinants can be generated with the efficient Cas9 enzyme. We further demonstrated the effectiveness of curing the sgRNA plasmid following each round of gene editing. The curing efficiency of the sgRNA plasmid (pTargetF- tcr -P L - ccd B-N20( cst A)) was approximately 43.75% in one step curing process, which is an easier approach compared to other reported methods (Zhang et al., 2023 ). Upon completion of sequential gene-editing task, both Cas9 (25A) and sgRNA (pTargetF- tcr -P L - ccd B-N20( pps A)) tool plasmids were effectively cured simultaneously through sac B and ccd B based counterselections in one step, achieving a curing rate of 100% and 37.5% for Cas9 and sgRNA plasmids, respectively. Undoubtedly, this one step curing process offers convenience and improves overall efficiency compared to the sequential removal of the two tool plasmids(Jiang et al., 2015 ; Li et al., 2021 ). The P L - ccd B endotoxin and sac B based dual counterselection enables independent and interference-free curing of the tool plasmids, thus shortening the overall time needed for sequential gene-editing process. Declarations Funding This work was supported by Science and Technology Major Project of Guangxi (Guike AA24206048, AA24206050),Hubei University of Technology High-Level Talent Research Startup Fund Program (4301/00960). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions Yongze Wang contributed to the study conception and design. Shiyao Zou, Weiqi Chen, and Ying Cao performed material preparation, data collection, and analysis. The first draft of the manuscript was written by Jinhua Wang and Shengde Zhou; Xiaolan Liu revised and polished the manuscript for intellectual content and language clarity. All authors commented on previous versions of the manuscript, and all authors read and approved the final manuscript. Data Availability The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Ethics approval This is an observational study, and no ethical approval is required. References Bassalo MC, Garst AD, Halweg-Edwards AL, Grau WC, Domaille DW, Mutalik VK, Arkin AP, Gill RT (2016) Rapid and efficient one-step metabolic pathway integration in E. coli . ACS synthetic biology, 5(7), 561–568. https://doi.org/10.1021/acssynbio.5b00187 Chang AY, Chau V, Landas JA, Pang Y (2017) Preparation of calcium competent Escherichia coli and heat-shock transformation. JEMI methods 1:22–25. https://doi.org/10.1101/pdb.prot3932 Datta S, Costantino N, Court DL (2006) A set of recombineering plasmids for gram-negative bacteria. Gene 379:109–115. https://doi.org/10.1016/j.gene.2006.04.018 Dower WJ, Miller JF, Ragsdale CW (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res 16(13):6127–6145. https://doi.org/10.1093/nar/16.13.6127 Huang C, Guo L, Wang J, Wang N, Huo Y-X (2020) Efficient long fragment editing technique enables large-scale and scarless bacterial genome engineering. Appl Microbiol Biotechnol 104(18):7943–7956. https://doi.org/10.1007/s00253-020-10819-1 Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81(7):2506–2514. https://doi.org/10.1128/AEM.04023-14 Lan Y-J, Tan S-I, Cheng S-Y, Ting W-W, Xue C, Lin T-H, Cai M-Z, Chen P-T, Ng I-S (2021) Development of Escherichia coli Nissle 1917 derivative by CRISPR/Cas9 and application for gamma-aminobutyric acid (GABA) production in antibiotic-free system. Biochem Eng J 168107952. .https://doi.org/10.1016/j.bej.2021.107952 Li M, Li X, Zhou Z, Wu P, Fang M, Pan X, Lin Q, Luo W, Wu G, Li H (2016) Reassessment of the four yield-related genes Gn1a, DEP1, GS3, and IPA1 in rice using a CRISPR/Cas9 system. 7. Frontiers in plant science 377.https://doi.org/10.3389/fpls.2016.00377 Li Q, Sun B, Chen J, Zhang Y, Jiang Y, Yang S (2021) A modified pCas/pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim Biophys Sin (Shanghai) 53(5):620–627. https://doi.org/10.1093/abbs/gmab036 Li Y, Lin Z, Huang C, Zhang Y, Wang Z, Tang Y-j, Chen T, Zhao X (2015) Metabolic engineering of Escherichia coli using CRISPR/Cas9 meditated genome editing. Metab Eng 31:13–21. https://doi.org/10.1016/j.ymben.2015.06.006 Menestreau M, Rachedi R, Risoul V, Foglino M, Latifi A (2022) The CcdB toxin is an efficient selective marker for CRISPR-plasmids developed for genome editing in cyanobacteria. microPublication Biology. https://doi.org/10.17912/micropub.biology.000512 Pyne ME, Moo-Young M, Chung DA, Chou CP (2015) Coupling the CRISPR/Cas9 system with lambda red recombineering enables simplified chromosomal gene replacement in Escherichia coli . Appl Environ Microbiol 81(15):5103–5114. https://doi.org/10.1128/AEM.01248-15 Reisch CR, Prather KL (2015) The no-SCAR (S carless C as9 A ssisted R ecombineering) system for genome editing in Escherichia coli . Sci Rep 5(1):15096. https://doi.org/10.1038/srep15096 Shao M, Lu F, Zhu X, Zhang X (2020) Optimization of Escherichia coli CRISPR/Cas9 gene editing system and its application. J Biol 37(04):106–110. https://doi.org/10.3969/j.issn.2095-1736.2020.04.106 Srinivas S, Hu Z, Cronan JE (2019) Escherichia coli vectors having stringently repressible replication origins allow a streamlining of Crispr/Cas9 gene editing. Plasmid 103:53–62. https://doi.org/10.1016/j.plasmid.2019.04.004 Wang H, Bian X, Xia L, Ding X, Müller R, Zhang Y, Fu J, Stewart AF (2014) Improved seamless mutagenesis by recombineering using ccdB for counterselection. Nucleic Acids Res 42(5):e37. .https://doi.org/10.1093/nar/gkt1339 Wang J, Sui X, Ding Y, Fu Y, Feng X, Liu M, Zhang Y, Xian M, Zhao G (2021) A fast and robust iterative genome-editing method based on a Rock-Paper-Scissors strategy. Nucleic Acids Res 49(2):e12. .https://doi.org/10.1093/nar/gkaa1141 Wang K, Wang X, Su X, Zhang J (2021) Optimization and Application of Double-plasmid CRISPR-Cas9 System in Escherichia coli . Biotechnol Bull 37(12):252–264. https://doi.org/10.13560/j.cnki.biotech.bull.1985.2021-0618 Ye C, Yang Y, Chen X, Yang L, Hua X, Yang M, Zeng X, Qiao S (2022) Metabolic engineering of Escherichia coli BW25113 for the production of 5-Aminolevulinic Acid based on CRISPR/Cas9 mediated gene knockout and metabolic pathway modification. J Biol Eng 16(1):26. https://doi.org/10.1186/s13036-022-00307-7 Yu F, Li X, Wang F, Liu Y, Zhai C, Li W, Ma L, Chen W (2023) TLTC, a T5 exonuclease–mediated low-temperature DNA cloning method. Front Bioeng Biotechnol 11:1167534. https://doi.org/10.3389/fbioe.2023.1167534 Zerbini F, Zanella I, Fraccascia D, König E, Irene C, Frattini LF, Tomasi M, Fantappiè L, Ganfini L, Caproni E, Parri M, Grandi A, Grandi G (2017) Large scale validation of an efficient CRISPR/Cas-based multi gene editing protocol in Escherichia coli . Microb Cell Fact 16:1–18. https://doi.org/10.1186/s12934-017-0681-1 Zhang G, Zhang Q, Wang J, Zhang J, Shang G (2023) Characterization of a novel Escherichia coli recombineering selection/counterselection cassette. Biotechnol Lett 45(2):191–197. https://doi.org/10.1007/s10529-022-03333-z Zhao D, Yuan S, Xiong B, Sun H, Ye L, Li J, Zhang X, Bi C (2016) Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9. Microb Cell Fact 15(1). 205.https://doi.org/10.1186/s12934-016-0605-5 Cite Share Download PDF Status: Published Journal Publication published 29 Sep, 2025 Read the published version in Biotechnology Letters → Version 1 posted Reviewers agreed at journal 24 May, 2025 Reviewers invited by journal 08 May, 2025 Editor assigned by journal 07 May, 2025 First submitted to journal 06 May, 2025 Editorial decision: Major revisions 22 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6455048","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":453965086,"identity":"f492c834-56ff-4a4b-9930-1a056def95ce","order_by":0,"name":"Shiyao Zou","email":"","orcid":"","institution":"Hubei University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Shiyao","middleName":"","lastName":"Zou","suffix":""},{"id":453965087,"identity":"cd896ea2-0103-4a61-8a34-b7344ab95b4c","order_by":1,"name":"Weiqi Chen","email":"","orcid":"","institution":"Hubei University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Weiqi","middleName":"","lastName":"Chen","suffix":""},{"id":453965088,"identity":"750057dc-d5e2-491f-bed1-21b65a135fbd","order_by":2,"name":"Ying Cao","email":"","orcid":"","institution":"Hubei University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Cao","suffix":""},{"id":453965089,"identity":"671eca60-75c8-480a-92c7-fad82dc6f0a0","order_by":3,"name":"Xiaolan Liu","email":"","orcid":"","institution":"Hubei University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Xiaolan","middleName":"","lastName":"Liu","suffix":""},{"id":453965090,"identity":"ea33c2e2-22e8-453e-9a13-5d2faef8fcac","order_by":4,"name":"Jinhua Wang","email":"","orcid":"","institution":"Hubei University of Technology","correspondingAuthor":false,"prefix":"","firstName":"Jinhua","middleName":"","lastName":"Wang","suffix":""},{"id":453965091,"identity":"357853ab-f36e-4ec8-b31a-edd8692c59e5","order_by":5,"name":"yongze wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGklEQVRIiWNgGAWjYHAD5gMMDAYWDAYSEB4xWtgSGEDqgYixgUgtPAZAgggtBsfPHn7NU3HHbn57z9cNPwokGMyle8wfMFRYJzawnz2AVcuZvDRrnjPPkht7zm672QO0wnLOGcMGhjPpiQ08eQnYtJgdyDEz5m07nMwskbvtBg/ILzdyDBsY2w4nNkiAnYqp5fwbiBY2+TfPbv6Ba/mHR8uNHOPHQC12PBI8bLcRtjTg1mJ/440Z45wzhxMkeNLMbssYAJXdOVY4I+FYunEbTw5WLZL9OcYf3lQctpdvP/zs5ps/NnIGt5s3fPhQYy3bz34GqxYgYJPiYWBIbIDyeMAkKKjYcKgHAuaPP4AOxC0/CkbBKBgFIx4AAPbhY4h1CB1/AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0009-0003-8264-6146","institution":"Hubei University of Technology","correspondingAuthor":true,"prefix":"","firstName":"yongze","middleName":"","lastName":"wang","suffix":""},{"id":453965092,"identity":"bde08897-4c36-4789-8887-0630000b0aa7","order_by":6,"name":"Shengde Zhou","email":"","orcid":"","institution":"Northern Illinois University","correspondingAuthor":false,"prefix":"","firstName":"Shengde","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2025-04-15 12:57:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6455048/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6455048/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10529-025-03642-z","type":"published","date":"2025-09-29T15:57:54+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82650127,"identity":"8c89fac0-3573-4c67-a90b-95fdccfdab9d","added_by":"auto","created_at":"2025-05-13 17:02:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":181637,"visible":true,"origin":"","legend":"\u003cp\u003eCloning of P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB endotoxin gene into the sgRNA plasmid.\u003c/p\u003e\n\u003cp\u003eThe P\u003csub\u003eL\u003c/sub\u003e thermal active promoter was cloned from pSim6; The \u003cem\u003eccd\u003c/em\u003eB endotoxin gene was cloned from pEcgRNA plasmid; the \u003cem\u003etcr\u003c/em\u003e gene of pBR322 was cloned and used to replace the spectinomycin gene in pTargetF, resulting in pTargetF-\u003cem\u003etcr\u003c/em\u003e; the P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB fragment was cloned and inserted into pTargetF-\u003cem\u003etcr\u003c/em\u003e, resulting in the pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20.\u0026nbsp;\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/13d9f61af3cfb030299090da.png"},{"id":82648945,"identity":"c40cfe04-8a7d-4494-bb94-8d6e81aae3c7","added_by":"auto","created_at":"2025-05-13 16:46:22","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":391340,"visible":true,"origin":"","legend":"\u003cp\u003eThermal induction of P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB endotoxin gene.\u003c/p\u003e\n\u003cp\u003eBoth HBUT-P2 and HBUT-P2 (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) cells were streaked on LB plates and tested for induction of \u003cem\u003eccd\u003c/em\u003eB expression at three different temperatures: (A) 30°C; (B) 37°C; (C) 42°C.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/bc8f698d35a63f31c732bc2d.jpeg"},{"id":82648949,"identity":"0ea54f18-ca86-43be-8e7e-dfe6a9bb0fb4","added_by":"auto","created_at":"2025-05-13 16:46:22","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":228867,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of the lethality of the induced CcdB endotoxin on cell growth.\u003c/p\u003e\n\u003cp\u003eOvernight cultures of HBUT-P2 (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) were diluted 10\u003csup\u003e4\u003c/sup\u003e-fold, 100 µl of diluted cells were spread on LB-chlortetracycline plates and incubated at (A) 30°C (control temperature) and (B) 42°C (induction temperature).\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/a9bbbcfb974558c081e4bc1e.jpeg"},{"id":82649846,"identity":"b5de8fb0-8461-407c-b316-9e33765ae074","added_by":"auto","created_at":"2025-05-13 16:54:22","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":130166,"visible":true,"origin":"","legend":"\u003cp\u003eEvaluation of the transformation efficiency of the sgRNA plasmid containing \u003cem\u003eccd\u003c/em\u003eB endotoxin gene.\u003c/p\u003e\n\u003cp\u003e0.5 µg of the pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA) plasmid were transformed into HBUT-P2 (25A) cells through electroporation. After recovery incubation, the cells were diluted 10\u003csup\u003e6\u003c/sup\u003e-fold, and spread (100 µl) onto LB-(kanamycin + chlortetracycline) plates for overnight incubation.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/24b54d5c303d057700bdb03a.jpeg"},{"id":82649850,"identity":"3efe9e41-354b-4cbc-b8f2-b720f93ef480","added_by":"auto","created_at":"2025-05-13 16:54:22","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":404076,"visible":true,"origin":"","legend":"\u003cp\u003ePCR verification of \u003cem\u003ecst\u003c/em\u003eA and \u003cem\u003epps\u003c/em\u003eA sequential deletions using sgRNA plasmids containing P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB endotoxin gene.\u003c/p\u003e\n\u003cp\u003e(A) Recombinant for deletion of the \u003cem\u003ecst\u003c/em\u003eA gene; (B) Recombinant for deletion of \u003cem\u003epps\u003c/em\u003eA gene; (C) PCR verification of \u003cem\u003ecst\u003c/em\u003eA deletion for the recombinant colonies in panel (A), M denotes the marker bands, lane 1 represents \u003cem\u003ecst\u003c/em\u003eA gene fragment from the control strain HBUT-P2, lanes 2 to 17 represent the DNA fragment with \u003cem\u003ecst\u003c/em\u003eA gene deletion from the recombinant colonies; (D) PCR verification of \u003cem\u003epps\u003c/em\u003eA deletion from the recombinant colonies in panel (B), M denotes the marker bands, lane 1 represents the \u003cem\u003epps\u003c/em\u003eA gene fragment from the control strain HBUT-P2, lanes 2 to 17 represent the DNA fragment with \u003cem\u003epps\u003c/em\u003eA gene deletion from the recombinant colonies.\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/7fcf88d3b808b27c7b0c76c1.jpeg"},{"id":82649855,"identity":"17a2eeb3-1991-4e0d-8532-6c4b37d00efa","added_by":"auto","created_at":"2025-05-13 16:54:23","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":280254,"visible":true,"origin":"","legend":"\u003cp\u003eCuring of the sgRNA plasmid through \u003cem\u003eccd\u003c/em\u003eB endotoxin based counterselection.\u003c/p\u003e\n\u003cp\u003eThe HBUT-P2-\u003cem\u003e∆cstA\u003c/em\u003e (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) cells were streaked onto LB plates and incubated at 42°C overnight. The isolated colonies obtained were tested for growth on replicate plates: (A) LB-kanamycin plates; (B) LB-chlortetracycline plates.\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/748769992acbfe1a4a7f20fe.jpeg"},{"id":82649852,"identity":"e0f19b8b-41b0-4bb5-bd19-6e87512284d3","added_by":"auto","created_at":"2025-05-13 16:54:22","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":400125,"visible":true,"origin":"","legend":"\u003cp\u003eOne step simultaneous curing of both Cas9 and sgRNA tool plasmids.\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003eHBUT-P2-∆cstA-∆ppsA\u003c/em\u003e (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA)) cells were streaked onto LB-sucrose plates and incubated at 42°C overnight. The isolated colonies were tested for their growth on triplicate plates: (A) LB plate; (B) LB-kanamycin plate; (C) LB-chlortetracycline plate.\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage12.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/b7d75bc5766fac111da02fe9.jpeg"},{"id":92884002,"identity":"7c5c7d06-7de5-4cd0-a4ed-2784e9676473","added_by":"auto","created_at":"2025-10-06 16:11:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3155735,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6455048/v1/a28cf7ea-1d66-4c29-b033-9ab7f7377772.pdf"}],"financialInterests":"","formattedTitle":"Lethal Endotoxin (ccdB) Based Counterselection Improved the Efficiency of Sequential Gene Editing in Escherichia coli","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe CRISPR/Cas9 based technology has been widely used in prokaryotes and eukaryotes for sequential gene editing, due to its efficiency, easy operation, and short editing cycle(Lan et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The CRISPR/Cas9 based genes are typically cloned into a single(Zhao et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) or a dual plasmid(Li et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Ye et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) for gene editing in \u003cem\u003eE. coli\u003c/em\u003e. The limitations of a single plasmid approach include complicated cloning, reduced transformation/electroporation efficiency, and unable to modulate expression of sgRNA and Cas9 gene through plasmid copy number(Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The dual plasmid approach can overcome these limitations with an enhanced efficiency (Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, curing off these tool plasmids such as sgRNA expression plasmid limits the efficiency of sequential gene editing(Zhao et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecently, a targeted curing of the tool plasmid was developed to improve the efficiency of CRISPR/Cas9 gene editing technology (Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This methodology primarily utilizes the temperature sensitivity of plasmids and/or the strategic placement of restriction enzyme cleavage sites on Cas9 plasmid to facilitate the removal of the dual tool plasmids. Yang et al.(Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) utilized the pCas and pTargetF plasmids within a cooperative framework to achieve successive gene editing. The pCas plasmid is characterized as a temperature-sensitive plasmid that concurrently expresses a single guide RNA (sgRNA) under a lactose operon, which enables the anchoring of the pTargetF plasmid replicon through IPTG-induced expression. Although the pTargetF plasmid can be cleaved via IPTG-induced expression of the cleavage enzyme, significant leaking expression of the lactose operon was observed, resulting in a substantial decreased transformation (electroporation) efficiency (10\u003csup\u003e6\u003c/sup\u003e cfu / \u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e) of the pTargetF plasmid(Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Substituting the lactose operon with a more stringent rhamnose operon, the transformation efficiency was improved to 10\u003csup\u003e7\u003c/sup\u003e cfu / \u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e (Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), which was lower than the 10\u003csup\u003e8\u003c/sup\u003e cfu / \u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e achieved by the plasmid without a cleavage site(Pyne et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFor the CRISPR/Cas9 based gene editing, the pCas plasmid is normally first transformed into the host organism. This initial step often results in a significant accumulation of leaky expression of sgRNA, which subsequently increases the likelihood of cleavage during the subsequent electroporation of the incoming pTargetF plasmid. To address this issue, Zhang et al.(Shao et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) developed an improved donor plasmid, designated pV4, which is based on the pTargetF plasmid backbone and incorporates a self-cleavage function. Additionally, they integrated a lactose operon into the pV4 plasmid to regulate plasmid elimination. This modification serves to mitigate the impact of unintended expression of the cleavage enzyme to improve the efficiency of electroporation of the sgRNA plasmid.\u003c/p\u003e \u003cp\u003eRegardless of whether the operon responsible for plasmid elimination is cloned into the pCas plasmid or the pTargetF plasmid, the challenge of optimizing transformation (electroporation) efficiency remains due to the unintended expression of sgRNA. A proposed \"rock-paper-scissors\" strategy presents a novel approach(Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), which uses a third plasmid such as pTargetF plasmid. It utilizes the incoming pTargetF plasmid encoded restriction enzyme to cleave the one from the previous round. However, the implementation of this strategy necessitates the construction of three different plasmids, which increases operational complexity.\u003c/p\u003e \u003cp\u003eThe leakage expression of restriction enzyme cloned on Cas9 plasmid significantly affects transformation efficiency of the incoming sgRNA plasmid, which subsequently influences the overall editing efficiency. To address this challenge, we are investigating the non-cleavage counterselection approach to facilitate the removal of the dual plasmids. Our strategy will use the \u003cem\u003esac\u003c/em\u003eB based counterselection for curing of Cas9 gene expression plasmid by incubating cells on LB-sucrose plate (Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and construct a lethal endotoxin (\u003cem\u003eccd\u003c/em\u003eB) based counterselection for curing of the sgRNA expression plasmid(Wang et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). To facilitate the \u003cem\u003eccd\u003c/em\u003eB based counterselection, we cloned a stringent thermal active P\u003csub\u003eL\u003c/sub\u003e promoter to regulate the \u003cem\u003eccd\u003c/em\u003eB expression. Therefore, the sgRNA plasmid can be cured by incubating the cells under the induction temperature (42\u0026deg;C) after each round of gene editing. At the end of sequential editing, both Cas9 and sgRNA plasmid can be cured simultaneously by incubating cells on LB-sucrose plate at 42\u0026deg;C.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eBacterial strains, plasmids, primers, and growth conditions\u003c/h2\u003e \u003cp\u003eThe bacterial strains, plasmids, and primers used in this study are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Bacterial cultures were grown 37\u0026deg;C unless specified otherwise in Luria-Bertani (LB) broth (g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e: tryptone 10, yeast extract 5, and NaCl 5) or LB-sucrose broth (sucrose 50 g), on LB plates (agar 18 g) or LB-sucrose plate (sucrose 50 g). For preparation of cells for electroporation, bacterial cultures were grown in SOB broth (g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e: peptone 20, yeast extract 5, NaCl 0.6, KCl 0.186, MgCl\u003csub\u003e2\u003c/sub\u003e 0.95), or SOC broth (SOB supplemented with 3.5 g glucose). During plasmid/strain construction, kanamycin, ampicillin, chlortetracycline, or spectinomycin, were added to the media (50 \u0026micro;g mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) accordingly.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStrains, plasmids and primers used in the Study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e Strain\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eRelevant characteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDH5α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eend\u003c/em\u003eA1 \u003cem\u003erec\u003c/em\u003eA1 φ80\u003cem\u003edlac\u003c/em\u003eZ∆M15 ∆(\u003cem\u003elac\u003c/em\u003eZYA-\u003cem\u003earg\u003c/em\u003eF) U169, \u003cem\u003ehsd\u003c/em\u003eR17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eInvitrogen\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e W, ∆\u003cem\u003efrd\u003c/em\u003eABCD, ∆\u003cem\u003eadh\u003c/em\u003eE, ∆\u003cem\u003epta\u003c/em\u003e, ∆\u003cem\u003epfl\u003c/em\u003eB, ∆\u003cem\u003eald\u003c/em\u003eA, ∆\u003cem\u003ecsc\u003c/em\u003eR, ∆\u003cem\u003eldh\u003c/em\u003eA, ∆\u003cem\u003epox\u003c/em\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eWang lab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P2 (25A)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlasmid 25A was transformed into HBUT-P2 strain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P2 (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlasmid 25A and pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB were transformed into HBUT-P2 strain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P2 (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA))\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlasmid 25A and pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA) were transformed into HBUT-P2 strain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P23 (25A)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlasmid 25A was transformed into HBUT-P23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P23 (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA))\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003ePlasmid 25A and pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA) were transformed into HBUT-P23 strain\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003ecst\u003c/em\u003eA gene was deleted from HBUT-P2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA-∆\u003cem\u003epps\u003c/em\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003epps\u003c/em\u003eA gene was deleted from HBUT-∆\u003cem\u003ecst\u003c/em\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlasmids\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eRelevant characteristics\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epSim6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eAmpicillin resistance, contains the thermal active promoter (P\u003csub\u003eL\u003c/sub\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e(Datta et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2006\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTargetF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003esgRNA plasmid with chloramphenicol resistance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e(Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epBR322\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eChlortetracycline resistance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eWang lab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e25A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eCas9 plasmid with kanamycin resistance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003e(Huang et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epEcgRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eThe pEcgRNA plasmid containing the \u003cem\u003eccd\u003c/em\u003eB gene.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eHEDGEHOGBIO\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epSim6-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eThe P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB fragment was inserted into pSim6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003esgRNA plasmid with chlortetracycline resistance.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003esgRNA plasmid with P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB fragment inserted\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003ecst\u003c/em\u003eA)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eThe engineered single guide RNA (sgRNA) fragment targeting \u003cem\u003ecst\u003c/em\u003eA gene was inserted into the plasmid pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003epps\u003c/em\u003eA)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e \u003cp\u003eThe specifically designed single guide RNA (sgRNA) fragment targeting \u003cem\u003epps\u003c/em\u003eA gene was inserted into the plasmid pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eSource\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epSim6-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eaacgaatgagtactgcactcgcaacg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epSim6-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eggtggtcagtgcgtcctgct\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eccd\u003c/em\u003eB-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eagcaggacgcactgaccaccatgcagtttaaggtttacacctata\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003eccd\u003c/em\u003eB-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egagtgcagtactcattcgttttatattccccagaacatcaggtta\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epSim6-\u003cem\u003eccd\u003c/em\u003eB-yz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egttatctacacgacggggag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epSim6-\u003cem\u003eccd\u003c/em\u003eB-yz-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egctgagatcagccacttctt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eP\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eaagaaatagcgctttcagcc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eP\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ettatattccccagaacatcaggtta\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etgatgttctggggaatataacgaacgcgtaaaggatctag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eggctgaaagcgctatttcttcggaacttcggaataggaac\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-yz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003etccaggcaggtagatgacga\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003epTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-yz-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egctgagatcagccacttctt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003ecst\u003c/em\u003eA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eaatcagggaaatacctcgtcgttttagagctagaaatagc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003ecst\u003c/em\u003eA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egacgaggtatttccctgattactagtattatacctaggac\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003ecst\u003c/em\u003eA-yz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eaatcagggaaatacctcgtc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003ecst\u003c/em\u003eA-yz-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecctgtcctacgagttgcatg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecst\u003c/em\u003eA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egagatgatgtgctggaagcc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecst\u003c/em\u003eA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003egtgattgcccacaccttgcg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecst\u003c/em\u003eA-yz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecggttaacggagtgatcgag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecst\u003c/em\u003eA-yz-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eacatcttggcctccgctaac\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003epps\u003c/em\u003eA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecgtccataaaccgacactgggttttagagctagaaatagcaagtt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003epps\u003c/em\u003eA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eccagtgtcggtttatggacgactagtattatacctaggactgagc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003epps\u003c/em\u003eA-yz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecgtccataaaccgacactgg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eN20-\u003cem\u003epps\u003c/em\u003eA-yz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecctgtcctacgagttgcatg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003epps\u003c/em\u003eA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eatgaacctgaattaaccgcc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003epps\u003c/em\u003eA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eaatctgatccttcactgccc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003epps\u003c/em\u003eA-yz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eatcctttgtcgcgctttatg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u003cem\u003epps\u003c/em\u003eA-yz-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ecgatggagtagaagaccagc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c6\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eChemicals and Enzymes\u003c/h3\u003e\n\u003cp\u003eThe chemicals used in this study are analytical grade. The IPTG inducer and L- (+) arabinose were obtained from Macklin. The restriction enzymes, T5 exonuclease (1000 U), PrimeSTAR Max DNA Polymerase, 2\u0026times;Taq polymerase were provided by Takara. The primers were synthesized by Wuhan Tsingke Biotech Co., Ltd.\u003c/p\u003e\n\u003ch3\u003eGenetic methods\u003c/h3\u003e\n\u003cp\u003eStandard methods were used for plasmid construction(Yu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), transformation(Chang et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and electroporation(Dower et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1988\u003c/span\u003e). Plasmid DNA was isolated using a QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer\u0026rsquo;s instructions. DNA was purified by ethanol precipitation or by using a Wizard Plus Minipreps DNA Purification Systems Kit (Promega). PCR reactions were performed in 50 \u0026micro;l volumes containing 50 ng of template DNA, 300 pmol of each oligonucleotide primer, 25 \u0026micro;l of PrimeSTAR Max DNA Polymerase, 2\u0026times;Taq polymerase. DNA sequencing was conducted by Wuhan Tsingke Biotech Co., Ltd. or DynaScience.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePlasmid construction\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eConstruction of pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB plasmid\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe promoter-less \u003cem\u003eccd\u003c/em\u003eB gene was amplified via PCR with the primers \u003cem\u003eccd\u003c/em\u003eB-F/R and pEcgRNA as the template. A thermal (42\u0026deg;C) active P\u003csub\u003eL\u003c/sub\u003e promoter was amplified from pSim6 and placed into the upstream of the \u003cem\u003eccd\u003c/em\u003eB gene, resulting in a P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB DNA fragment. The pSim6 plasmid was linearized through PCR using the primers pSim6-F/R. The linearized pSim6 plasmid and P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB DNA fragment were then digested with T5 exonuclease (Yu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The resulting reaction mixture was transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α, spread onto LB-ampicillin plate and incubated overnight (Chang et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The resulting colonies were screened through colony PCR with the primer pairs pSim6-\u003cem\u003eccd\u003c/em\u003eB-yz-F/R. The colony PCR verified plasmids were then isolated and sequenced (Wuhan Tsingke Biotech Co., Ltd.). The resulting plasmid with right sequence was designated as pSim6-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB.\u003c/p\u003e \u003cp\u003eThe spectinomycin resistance gene in the pTargetF was replaced by the chlortetracycline resistance gene (\u003cem\u003etcr\u003c/em\u003e) cloned from pBR322, resulting in pTargetF-\u003cem\u003etcr\u003c/em\u003e plasmid which was then linearized by PCR with the primers pTargetF-\u003cem\u003etcr\u003c/em\u003e-F/R. The P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB DNA fragment was then amplified from pSim6-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB with the primers P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-F/R. Both linearized pTargetF-\u003cem\u003etcr\u003c/em\u003e and P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB fragments were digested with T5 exonuclease (Yu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The digested reaction mixture was transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α, spread onto LB-chlortetracycline plates (Chang et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). After overnight incubation, the resulting colonies were screened through colony PCR using the primers pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-yz-F/R, and then sequenced (DynaScience). The plasmid with the expected sequence was designated as pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB.\u003c/p\u003e\n\u003ch3\u003e2) Construction of sgRNA expression plasmids\u003c/h3\u003e\n\u003cp\u003eThe pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB was linearized through PCR employing the primer pairs N20(\u003cem\u003ecst\u003c/em\u003eA)-F/R, and N20(\u003cem\u003epps\u003c/em\u003eA)-F/R, respectively, followed by T5 exonuclease digestion (Yu et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The digestion mixture was subsequently transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α, respectively (Chang et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). After overnight incubation on LB-chlortetracycline plates, the resulting colonies were verified via colony PCR using the primers N20(\u003cem\u003ecst\u003c/em\u003eA)-yz-F/R, and N20(\u003cem\u003epps\u003c/em\u003eA)-yz-F/R, respectively. Upon successful colony PCR verification, plasmids were isolated and sequenced (Wuhan Tsingke Biotech Co., Ltd.). The plasmid with right sequence was designated as pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA), and pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA), respectively.\u003c/p\u003e\n\u003cdiv class=\"Heading\"\u003e\u003cem\u003eThermal induction of ccd\u003c/em\u003eB \u003cem\u003egene expression\u003c/em\u003e\u003c/div\u003e \u003cp\u003eThe pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA) plasmid was transformed into the HBUT-P2 cells. Both HBUT-P2 and HBUT-P2 (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) strains were spread onto LB plates and incubated at 30\u0026deg;C, 37\u0026deg;C and 42\u0026deg;C to evaluate their growth on the agar medium. In addition, the HBUT-P2 (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) were grown in LB broth to an OD\u003csub\u003e600\u003c/sub\u003e of 0.4, diluted 10\u003csup\u003e4\u003c/sup\u003e-fold, spread onto LB-chlortetracycline plates, and incubated overnight at 30\u0026deg;C and 42\u0026deg;C, respectively. The effectiveness of thermal induction was assessed by the number of colonies obtained at 30\u0026deg;C (uninduced) and 42\u0026deg;C (induced).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of the transformation efficiency of sgRNA expression plasmid\u003c/h2\u003e \u003cp\u003eThe plasmid pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA) was transformed into the HBUT-P2 via electroporation(Huang et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). After a three-hour recovery incubation at 30\u0026deg;C in SOC broth, the transformed cells were spread onto on LB-chlortetracycline plates and incubated overnight at 30\u0026deg;C. The electroporation efficiency was calculated based on the number of colonies (cfu) obtained on the plates and the amount of plasmid DNA (\u0026micro;g) used for electroporation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSequential gene editing with sgRNA plasmids containing counterselection gene (ccd\u003c/b\u003e \u003cb\u003eB)\u003c/b\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e1) Deletion of A gene from HBUT-P2\u003c/h3\u003e\n\u003cp\u003eThe plasmid 25A (containing Cas9 gene) was transformed into the HBUT-P2 strain (Dower et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1988\u003c/span\u003e). The transformed HBUT-P2 (25A) cells was incubated in SOB broth (50 ml) to an OD\u003csub\u003e600\u003c/sub\u003e of 0.1\u0026ndash;0.2 (37\u0026deg;C, 200 rpm shaking). The isopropyl β-D-1-thiogalactopyranoside (IPTG) inducer was added to the culture (0.5 mmol/L), which was further incubated for one hour. Five mL of 16% arabinose solution was added to the culture. After reaching to an OD\u003csub\u003e600\u003c/sub\u003e of 0.4\u0026ndash;0.6, the culture was transferred to a pre-cooled 50 mL centrifuge tube (on ice) for 30 minutes, and centrifuged (4\u0026deg;C, 6000 rpm) for 5 minutes. The resulting pellet was washed three times with pre-cooled ultrapure water. The final pellet was resuspended with the residual ultrapure water in the centrifuge tube and aliquoted into pre-cooled 1.5 mL centrifuge tubes. These cells were ready for electroporation.\u003c/p\u003e \u003cp\u003eThe ∆\u003cem\u003ecst\u003c/em\u003eA donor DNA was amplified using the HBUT-P23 (∆\u003cem\u003ecst\u003c/em\u003eA) as template and the \u003cem\u003ecst\u003c/em\u003eA-F/R primer pairs and purified through ethanol precipitation. This donor DNA (2,000 ng) were mixed with the sgRNA plasmid DNA (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003ecst\u003c/em\u003eA), 500 ng) and resuspended to a final volume of 10 \u0026micro;L with ultrapure water in a PCR tube. This DNA mixture was electroporated into HBUT-P2 (25A) cells prepared above. After electroporation, 5 mL SOC broth was promptly added to the cultures and incubated for three hours. This culture was then centrifuged (4\u0026deg;C, 6,000 rpm) for 1 minute. After removing 4 mL of the supernatants, the pellets were resuspended and diluted 100 folds with SOC broth. 100 \u0026micro;L of the diluted cells was spread onto LB-(kanamycin\u0026thinsp;+\u0026thinsp;chlortetracycline) plates and incubated overnight at 30\u0026deg;C. The colonies obtained were verified through colony PCR with the \u003cem\u003ecst\u003c/em\u003eA-YZ-F/R primers and DNA were sequenced (Wuhan Tsingke Biotech Co., Ltd). The strain with the expected \u003cem\u003ecst\u003c/em\u003eA deletion was designated as HBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA.\u003c/p\u003e \u003cp\u003e \u003col start=2\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eSequential deletion of \u003cem\u003epps\u003c/em\u003eA gene from HBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eAfter successful curing of pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003ecst\u003c/em\u003eA), the strain HBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA (25A) was transformed (electroporated) with a mixture of plasmid pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003epps\u003c/em\u003eA) and the PCR amplified donor DNA (made from a previous constructed \u003cem\u003epps\u003c/em\u003eA deletion strain). Following the similar procedure for \u003cem\u003ecst\u003c/em\u003eA deletion described above, the \u003cem\u003epps\u003c/em\u003eA gene was successfully deleted from the HBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA, resulting in a new strain designated as HBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA-∆\u003cem\u003epps\u003c/em\u003eA.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePlasmid curing\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eCuring of sgRNA plasmid with \u003cem\u003eccd\u003c/em\u003eB based counterselection\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe HBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003ecst\u003c/em\u003eA)) cells were grown in a shaking flask containing LB-(kanamycin\u0026thinsp;+\u0026thinsp;chlortetracycline) broth (37\u0026deg;C, 200 rpm) to an OD\u003csub\u003e600\u003c/sub\u003e of 0.4\u0026ndash;0.6, and then diluted 10\u003csup\u003e4\u003c/sup\u003e-fold. The diluted cell broth (100 \u0026micro;L) was spread onto LB-kanamycin plates. The plates were then incubated overnight at 42\u0026deg;C. Individual colonies were picked from the overnight growing plates and tested for their growth (37\u0026deg;C) on replicate plates: LB-kanamycin, and LB-chlortetracycline plates, respectively. If growth was observed on the LB-kanamycin plate while no growth on the LB-chlortetracycline plates for the same colony, it suggested that the pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003ecst\u003c/em\u003eA) plasmid had been successfully cured from the strain.\u003c/p\u003e \u003cp\u003e \u003col start=2\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003eSimultaneously curing of both sgRNA and Cas9 plasmid\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003eThe HBUT-P2-∆\u003cem\u003ecst\u003c/em\u003eA-∆\u003cem\u003epps\u003c/em\u003eA (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003epps\u003c/em\u003eA)) cells were grown 37\u0026deg;C in LB-(kanamycin\u0026thinsp;+\u0026thinsp;chlortetracycline) broth to an OD\u003csub\u003e600\u003c/sub\u003e of 0.4\u0026ndash;0.6, then diluted 10\u003csup\u003e4\u003c/sup\u003e-fold. The diluted cells (100 \u0026micro;L) were spread onto a LB-sucrose plate and incubated overnight at 42\u0026deg;C. Individual colonies from LB-sucrose plate were streaked for triplicate plate testing: LB plate, LB-kanamycin plate, and LB-chlortetracycline plate, respectively. If colony growth was observed on the LB plate, but neither on the LB-kanamycin plate nor on the LB-chlortetracycline plate, it suggested that both 25A and pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003epps\u003c/em\u003eA) plasmids had been simultaneously cured effectively.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of a sgRNA plasmid with a lethal endotoxin gene\u003c/h2\u003e \u003cp\u003eThe CRISPR/Cas9 technology has been used for sequential gene editing in \u003cem\u003eE. coli\u003c/em\u003e. To this end, a dual modulate expression plasmids (high copy for sgRNA expression and low copy for Cas9 gene expression) are often used as a tool to enhance the efficiency of gene editing and simplify the plasmid construction process(Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). After each round of gene editing, however, curing of the tool plasmid, particularly the high copy sgRNA expression plasmid, remains a challenge that affect the overall efficiency of sequential editing process. To address this issue, we constructed a new plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20) with a lethal endotoxin gene (\u003cem\u003eccd\u003c/em\u003eB) for sgRNA plasmid curing through counterselection. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the \u003cem\u003eccd\u003c/em\u003eB endotoxin gene was placed under the control of a heat-inducible promoter (P\u003csub\u003eL\u003c/sub\u003e). Upon induction of the \u003cem\u003eccd\u003c/em\u003eB gene expression at 42\u0026deg;C, the CcdB endotoxin would kill the host cell and leave the one with sgRNA plasmid cured successfully. It is expected that this approach will facilitate sgRNA plasmid curing at the end of each round of gene editing, and the overall efficiency for sequential editing of multiple genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eThermal induction of the ccdB endotoxin gene\u003c/h2\u003e \u003cp\u003eTo evaluate the thermal induction of the \u003cem\u003eccd\u003c/em\u003eB endotoxin gene expression and its lethal impact on the host, the sgRNA plasmid, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA), was transformed into HBUT-P2 cells. The cell growth of these transformed cells containing the endotoxin gene were then compared with the parent cell without endotoxin gene (HBUT-P2 cells) under the induction temperature (42\u0026deg;C) and non-induction temperature (30\u0026deg;C and 37\u0026deg;C). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, the control HBUT-P2 cells grew well (cell lawn) under three test temperature, the transformed cells containing P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB endotoxin gene grew well (cell lawn) under non-induction temperature (30\u0026deg;C and 37\u0026deg;C). However, obviously less cell growth was observed (isolated colonies without cell lawn) under the 42\u0026deg;C induction temperature (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). This result suggested that the \u003cem\u003eccd\u003c/em\u003eB gene was induced at 42\u0026deg;C and the CcdB endotoxin killed most host cells, resulting in fewer cell growth.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo quantitatively assess the lethal effect of \u003cem\u003eccd\u003c/em\u003eB gene expression, the overnight cultures of \u003cem\u003eE. coli\u003c/em\u003e HBUT-P2 (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) were diluted 10\u003csup\u003e4\u003c/sup\u003e-fold. 100 \u0026micro;l of diluted cells were spread onto LB-chlortetracycline plates and grown overnight under 30\u0026deg;C and 42\u0026deg;C, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The results showed that a total of 2,213 and 66 colonies were obtained from 30\u0026deg;C and 42\u0026deg;C plates, respectively. The grown colonies on the chlortetracycline selective plate indicated that the sgRNA expression plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) remains in host cells. Therefore, fewer colonies at 42\u0026deg;C suggested the \u003cem\u003eccd\u003c/em\u003eB gene was effectively induced through the thermal active P\u003csub\u003eL\u003c/sub\u003e-promoter. The expressed CcdB endotoxin killed host cells, leading to fewer colonies. Based on the number of colonies obtained at 30\u0026deg;C (2,213 colonies) and 42\u0026deg;C (66 colonies), an estimated lethal rate of 97% was achieved under the thermal induction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eTransformation efficiency of the sgRNA plasmid containing P\u003csub\u003eL\u003c/sub\u003e-ccdB gene\u003c/h2\u003e \u003cp\u003eFor Cas9 based sequential gene editing, the sgRNA expression plasmid for prior gene needs to be cured off and a new one for next target gene needs to be transformed into the host cell at each round of gene editing. Therefore, the plasmid curing efficiency of prior gene as well as transformation efficiency of next one has great impact on the overall efficiency of sequential gene editing. To evaluate whether the P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB endotoxin gene affect the transformation efficiency of sgRNA expression plasmid, the pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA) was transformed (electroporated) into the host containing Cas9 plasmid, HBUT-P2 (25A). After electroporation recovery incubation, the cell broth was diluted 10\u003csup\u003e6\u003c/sup\u003e-fold. A 100 \u0026micro;L of the diluted cells were spread onto the LB-(kanamycin\u0026thinsp;+\u0026thinsp;chlortetracycline) selective plates and incubated overnight at 37\u0026deg;C. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, a total of 84 transformed colonies were obtained on the selective plates. Based on the number of colonies obtained and the amount of plasmid DNA used for electroporation, an estimated transformation efficiency of 8.4\u0026times;10⁸ colony-forming units per microgram of DNA (cfu/\u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e) was achieved, which is at least one-magnitude higher than the results reported in the literature (10\u003csup\u003e6\u003c/sup\u003e \u0026minus;\u0026thinsp;10\u003csup\u003e7\u003c/sup\u003e cfu / \u0026micro;g\u003csub\u003e-DNA\u003c/sub\u003e)(Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSequential deletion of cstA and ppsA gene using sgRNA plasmids containing P\u003c/b\u003e \u003csub\u003e \u003cb\u003eL\u003c/b\u003e \u003c/sub\u003e \u003cb\u003e-ccd\u003c/b\u003e \u003cb\u003eB\u003c/b\u003e \u003cb\u003eendotoxin gene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe primary goal of cloning the \u003cem\u003eccd\u003c/em\u003eB endotoxin gene into the sgRNA plasmid is to improve the efficiency of plasmid curing through counter selection during sequential gene editing. This approach, of course, should has no negative impact on the functionality of Cas9 based gene editing. To this end, two sgRNA plasmids, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA) and pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA), were constructed for sequential deletion of the \u003cem\u003ecst\u003c/em\u003eA and \u003cem\u003epps\u003c/em\u003eA from \u003cem\u003eE. coli\u003c/em\u003e chromosome. As described in the method, these plasmids, along with the corresponding donor DNA, were co-electroporated into host cells containing Cas9 plasmid (25A), respectively. After post-electroporation recovery, the electroporation solution was diluted 100-fold and 100 \u0026micro;L of cells were spread onto LB plates supplemented with both kanamycin and chlortetracycline. After overnight incubation, a total of 6,000 and 4,200 recombinants were obtained on the plates for sequential deletions of \u003cem\u003ecst\u003c/em\u003eA and \u003cem\u003epps\u003c/em\u003eA, respectively. For each target gene, 16 colonies from the plates were chosen for verification by colony PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The results showed that all 16 colonies had the \u003cem\u003ecst\u003c/em\u003eA gene successfully deleted, resulting in a recombination rate of 100%. 15 of the 16 tested colonies were successfully knocked out for \u003cem\u003epps\u003c/em\u003eA gene, corresponding to a recombination rate of 93.75%. These results suggested that cloning of \u003cem\u003eccd\u003c/em\u003eB endotoxin gene into the sgRNA plasmid had no negative impact on the function of Cas9 based gene editing.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCuring of sgRNA plasmids through P\u003csub\u003eL\u003c/sub\u003e-ccdB based counterselection\u003c/h2\u003e \u003cp\u003eIn the sequential gene editing workflows, efficient curing of the sgRNA-expressing plasmid after each round of gene editing is crucial to prevent cross-round interference and improve the overall efficiency of editing multiple genes. Our hypothesis is that the efficiency of curing sgRNA plasmid can be achieved through \u003cem\u003eccd\u003c/em\u003eB endotoxin based counterselection. To test this hypothesis, the \u003cem\u003eE. coli\u003c/em\u003e cells harboring the dual tool plasmids (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) were incubated overnight at 42\u0026deg;C on LB-kanamycin plate for curing of the sgRNA plasmid. 16 of the isolated colonies were picked for replicate-plate testing: LB-kanamycin plate and LB-chlortetracycline plate (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). It was expected that the thermal treatment (42\u0026deg;C) induced the expression of \u003cem\u003eccd\u003c/em\u003eB endotoxin gene. The resulting CcdB endotoxin would then kill the host cell, resulting in no growth on LB-chlortetracycline plates (the \u003cem\u003etcr\u003c/em\u003e containing sgRNA plasmid was successfully cured). The replicate-plate testing results showed that all 16 colonies grew well on the kanamycin plate (\u003cem\u003ekan\u003c/em\u003e containing 25A plasmid retained) and 7 colonies did not grow on the chlortetracycline plate (\u003cem\u003etcr\u003c/em\u003e containing sgRNA plasmid was cured). These results suggested that an estimated 43.75% of efficiency (7 out of 16 colonies) was achieved for sgRNA plasmid curing through the \u003cem\u003eccd\u003c/em\u003eB endotoxin based counterselection.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition, upon completion of all gene-editing operations, it is ideally to cure the dual tool plasmids simultaneously. To test the feasibility of curing both Cas9 and sgRNA plasmids in one step, \u003cem\u003eE. coli\u003c/em\u003e cells containing the dual plasmids (25A, pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20 (\u003cem\u003epps\u003c/em\u003eA)) were incubated overnight on LB-sucrose plate at 42\u0026deg;C. The sucrose was used for curing of 25A plasmid through \u003cem\u003esac\u003c/em\u003eB based counterselection(Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Again, 16 of the isolated colonies were selected for triplicate-plate testing: LB plate, LB-kanamycin plate, and LB-chlortetracycline plate. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e. All colonies grew well on the non-selective LB plate. None of the colonies exhibited growth on the LB-kanamycin plate, indicating the \u003cem\u003ekan\u003c/em\u003e containing 25A plasmid was cured. In contrast, 6 of the 16 colonies showed no growth on the LB-chlortetracycline plate, suggesting the \u003cem\u003etcr\u003c/em\u003e-containing sgRNA plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA)) were cured from them. Quantitative analysis of these growth patterns revealed a 100% curing rate for the Cas9 tool plasmid (25A), and a 37.5% curing rate for sgRNA plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA)) were achieved in one step curing process, highlighting the efficiency of the dual plasmid-curing strategy through the \u003cem\u003eccd\u003c/em\u003eB endotoxin and \u003cem\u003esac\u003c/em\u003eB based counterselections.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe curing of the CRISPR-Cas9 tool plasmids, especially the one for sgRNA expression, is a bottleneck impeding the efficiency of sequential gene-editing(Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). To address this issue, multiple strategies were developed for plasmid curing within the framework of CRISPR/Cas9 gene-editing technology. These include temperature-sensitive plasmids with the repA101(Ts) replicon(Huang et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Reisch and Prather, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Srinivas et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zerbini et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), the \u003cem\u003esac\u003c/em\u003eB counterselection (Huang et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zerbini et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and Cas9-guided plasmid cleavage curing strategies(Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Reisch and Prather, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, certain limitations with these approaches remains. For instance, the temperature-sensitive plasmid featuring the repA101(Ts) replicon is prone to intermittently lose its effectiveness. Moreover, the temperature-sensitive plasmids have a low copy number, which limits the expression level of the Cas9 protein and/or the quantity of sgRNA(Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In the Cas9-guided plasmid cleavage curing strategies, a leaky gene expression of the restriction enzyme may result in the cleavage of the sgRNA plasmid. This unintended cleavage decreases the available host cells containing both Cas9 and sgRNA tool plasmids, resulting in a decreased efficiency of gene editing. Attempts to address this issue by introducing a third-party plasmid(Reisch and Prather, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), resulted in procedural complexity. In this study, we attempted to address the challenge of sgRNA plasmid curing by cloning a lethal endotoxin gene (\u003cem\u003eccd\u003c/em\u003eB) for counterselection.\u003c/p\u003e \u003cp\u003eThe lethality of the P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB used in our sgRNA plasmid showed a 97% efficiency to kill the host cells upon induction of \u003cem\u003eccd\u003c/em\u003eB gene at 42\u0026deg;C. This result is in line with those reported (86\u0026ndash;91%) in the RED gene editing using \u003cem\u003eccd\u003c/em\u003eB based counterselection (Zhang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Latifi et al.(Menestreau et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) used Para-\u003cem\u003eccd\u003c/em\u003eB to remove background plasmids, achieving a lethality of 98%. Overall, the \u003cem\u003eccd\u003c/em\u003eB gene can be used for plasmid curing through counterselection for gene editing in \u003cem\u003eE. coli\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThe sgRNA plasmid containing a P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB counterselection gene also demonstrated an improved transformation efficiency in our study. This efficiency is directly associated with the number of recombinants generated after gene editing(Reisch and Prather, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Normally, the plasmid transformation efficiency can reach to 10⁹ cfu/\u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e(Pyne et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, empirical data suggest that the CRISPR/Cas9 gene-edited tool plasmids consistently fail to reach this expected transformation efficiency. Yang et al. reported that the transformation efficiency of a CRISPR/Cas9 tool plasmid was approximately 10\u003csup\u003e6\u003c/sup\u003e cfu/\u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e(Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). They speculated that this inefficiency might derive from the leaky expression of restriction enzyme cloned for plasmid curing, which leads to the unintended cleavage of the pTargetF plasmid after its transformation into the host cells. To address this issue, a more stringent rhamnose-inducible operon was employed, which subsequently increased the transformation efficiency to 10\u003csup\u003e7\u003c/sup\u003e cfu/\u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e(Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Despite this improvement, some degree of leaky expression remains. In our study, the transformation efficiency of the sgRNA plasmid containing P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB lethal gene reached to 8.4 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e cfu/\u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e, which is at least one-magnitude improvement compared to the reported results (10\u003csup\u003e6\u003c/sup\u003e \u0026minus;\u0026thinsp;10\u003csup\u003e7\u003c/sup\u003e cfu / \u0026micro;g\u003csub\u003e-DNA\u003c/sub\u003e)(Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAlong with 25A (carrying Cas9 gene), the sgRNA plasmid containing P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB lethal gene was tested for sequential editing of \u003cem\u003ecst\u003c/em\u003eA and \u003cem\u003epps\u003c/em\u003eA genes. As a result, a total of 10⁶-10⁷ recombinants were obtained, with a 90% recombination rate for both genes. This outcome is better than our expectations. Previous reports have demonstrated that CRISPR/Cas9-mediated genome editing achieved up to 95% of recombination efficiencies when employing 600-bp homology arms, a critical length for optimal homology-directed repair (HDR) (Bassalo et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Our high recombination rate is attributed to the high transformation efficiency of sgRNA plasmid. When transformation efficiency is as high as 8.4 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e cfu/\u0026micro;g-\u003csub\u003eDNA\u003c/sub\u003e, a large number of recombinants can be generated with the efficient Cas9 enzyme.\u003c/p\u003e \u003cp\u003eWe further demonstrated the effectiveness of curing the sgRNA plasmid following each round of gene editing. The curing efficiency of the sgRNA plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) was approximately 43.75% in one step curing process, which is an easier approach compared to other reported methods (Zhang et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eUpon completion of sequential gene-editing task, both Cas9 (25A) and sgRNA (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA)) tool plasmids were effectively cured simultaneously through \u003cem\u003esac\u003c/em\u003eB and \u003cem\u003eccd\u003c/em\u003eB based counterselections in one step, achieving a curing rate of 100% and 37.5% for Cas9 and sgRNA plasmids, respectively. Undoubtedly, this one step curing process offers convenience and improves overall efficiency compared to the sequential removal of the two tool plasmids(Jiang et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Li et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB endotoxin and \u003cem\u003esac\u003c/em\u003eB based dual counterselection enables independent and interference-free curing of the tool plasmids, thus shortening the overall time needed for sequential gene-editing process.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Science and Technology Major Project of Guangxi (Guike AA24206048, AA24206050),Hubei University of Technology High-Level Talent Research Startup Fund Program (4301/00960).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYongze Wang contributed to the study conception and design. Shiyao Zou, Weiqi Chen, and Ying Cao performed material preparation, data collection, and analysis. The first draft of the manuscript was written by Jinhua Wang and Shengde Zhou; Xiaolan Liu revised and polished the manuscript for intellectual content and language clarity. All authors commented on previous versions of the manuscript, and all authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis is an observational study, and no ethical approval is required.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBassalo MC, Garst AD, Halweg-Edwards AL, Grau WC, Domaille DW, Mutalik VK, Arkin AP, Gill RT (2016) Rapid and efficient one-step metabolic pathway integration in \u003cem\u003eE. coli\u003c/em\u003e. ACS synthetic biology, 5(7), 561\u0026ndash;568.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acssynbio.5b00187\u003c/span\u003e\u003cspan address=\"10.1021/acssynbio.5b00187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang AY, Chau V, Landas JA, Pang Y (2017) Preparation of calcium competent \u003cem\u003eEscherichia coli\u003c/em\u003e and heat-shock transformation. JEMI methods 1:22\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/pdb.prot3932\u003c/span\u003e\u003cspan address=\"10.1101/pdb.prot3932\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDatta S, Costantino N, Court DL (2006) A set of recombineering plasmids for gram-negative bacteria. Gene 379:109\u0026ndash;115. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.gene.2006.04.018\u003c/span\u003e\u003cspan address=\"10.1016/j.gene.2006.04.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDower WJ, Miller JF, Ragsdale CW (1988) High efficiency transformation of \u003cem\u003eE. coli\u003c/em\u003e by high voltage electroporation. Nucleic Acids Res 16(13):6127\u0026ndash;6145. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/16.13.6127\u003c/span\u003e\u003cspan address=\"10.1093/nar/16.13.6127\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang C, Guo L, Wang J, Wang N, Huo Y-X (2020) Efficient long fragment editing technique enables large-scale and scarless bacterial genome engineering. Appl Microbiol Biotechnol 104(18):7943\u0026ndash;7956. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00253-020-10819-1\u003c/span\u003e\u003cspan address=\"10.1007/s00253-020-10819-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Y, Chen B, Duan C, Sun B, Yang J, Yang S (2015) Multigene editing in the \u003cem\u003eEscherichia coli\u003c/em\u003e genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81(7):2506\u0026ndash;2514. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.04023-14\u003c/span\u003e\u003cspan address=\"10.1128/AEM.04023-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLan Y-J, Tan S-I, Cheng S-Y, Ting W-W, Xue C, Lin T-H, Cai M-Z, Chen P-T, Ng I-S (2021) Development of \u003cem\u003eEscherichia coli\u003c/em\u003e Nissle 1917 derivative by CRISPR/Cas9 and application for gamma-aminobutyric acid (GABA) production in antibiotic-free system. Biochem Eng J 168107952. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1016/j.bej.2021.107952\u003c/span\u003e\u003cspan address=\".10.1016/j.bej.2021.107952\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M, Li X, Zhou Z, Wu P, Fang M, Pan X, Lin Q, Luo W, Wu G, Li H (2016) Reassessment of the four yield-related genes Gn1a, DEP1, GS3, and IPA1 in rice using a CRISPR/Cas9 system. 7. Frontiers in plant science\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e377.https://doi.org/10.3389/fpls.2016.00377\u003c/span\u003e\u003cspan address=\"377.10.3389/fpls.2016.00377\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Sun B, Chen J, Zhang Y, Jiang Y, Yang S (2021) A modified pCas/pTargetF system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochim Biophys Sin (Shanghai) 53(5):620\u0026ndash;627. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/abbs/gmab036\u003c/span\u003e\u003cspan address=\"10.1093/abbs/gmab036\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Lin Z, Huang C, Zhang Y, Wang Z, Tang Y-j, Chen T, Zhao X (2015) Metabolic engineering of \u003cem\u003eEscherichia coli\u003c/em\u003e using CRISPR/Cas9 meditated genome editing. Metab Eng 31:13\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ymben.2015.06.006\u003c/span\u003e\u003cspan address=\"10.1016/j.ymben.2015.06.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenestreau M, Rachedi R, Risoul V, Foglino M, Latifi A (2022) The CcdB toxin is an efficient selective marker for CRISPR-plasmids developed for genome editing in cyanobacteria. microPublication Biology. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.17912/micropub.biology.000512\u003c/span\u003e\u003cspan address=\"10.17912/micropub.biology.000512\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePyne ME, Moo-Young M, Chung DA, Chou CP (2015) Coupling the CRISPR/Cas9 system with lambda red recombineering enables simplified chromosomal gene replacement in \u003cem\u003eEscherichia coli\u003c/em\u003e. Appl Environ Microbiol 81(15):5103\u0026ndash;5114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.01248-15\u003c/span\u003e\u003cspan address=\"10.1128/AEM.01248-15\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReisch CR, Prather KL (2015) The no-SCAR (S carless C as9 A ssisted R ecombineering) system for genome editing in \u003cem\u003eEscherichia coli\u003c/em\u003e. Sci Rep 5(1):15096. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep15096\u003c/span\u003e\u003cspan address=\"10.1038/srep15096\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao M, Lu F, Zhu X, Zhang X (2020) Optimization of \u003cem\u003eEscherichia coli\u003c/em\u003e CRISPR/Cas9 gene editing system and its application. J Biol 37(04):106\u0026ndash;110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3969/j.issn.2095-1736.2020.04.106\u003c/span\u003e\u003cspan address=\"10.3969/j.issn.2095-1736.2020.04.106\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrinivas S, Hu Z, Cronan JE (2019) \u003cem\u003eEscherichia coli\u003c/em\u003e vectors having stringently repressible replication origins allow a streamlining of Crispr/Cas9 gene editing. Plasmid 103:53\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.plasmid.2019.04.004\u003c/span\u003e\u003cspan address=\"10.1016/j.plasmid.2019.04.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Bian X, Xia L, Ding X, M\u0026uuml;ller R, Zhang Y, Fu J, Stewart AF (2014) Improved seamless mutagenesis by recombineering using \u003cem\u003eccdB\u003c/em\u003e for counterselection. Nucleic Acids Res 42(5):e37. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1093/nar/gkt1339\u003c/span\u003e\u003cspan address=\".10.1093/nar/gkt1339\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Sui X, Ding Y, Fu Y, Feng X, Liu M, Zhang Y, Xian M, Zhao G (2021) A fast and robust iterative genome-editing method based on a Rock-Paper-Scissors strategy. Nucleic Acids Res 49(2):e12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1093/nar/gkaa1141\u003c/span\u003e\u003cspan address=\".10.1093/nar/gkaa1141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang K, Wang X, Su X, Zhang J (2021) Optimization and Application of Double-plasmid CRISPR-Cas9 System in \u003cem\u003eEscherichia coli\u003c/em\u003e. Biotechnol Bull 37(12):252\u0026ndash;264. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.13560/j.cnki.biotech.bull.1985.2021-0618\u003c/span\u003e\u003cspan address=\"10.13560/j.cnki.biotech.bull.1985.2021-0618\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYe C, Yang Y, Chen X, Yang L, Hua X, Yang M, Zeng X, Qiao S (2022) Metabolic engineering of \u003cem\u003eEscherichia coli\u003c/em\u003e BW25113 for the production of 5-Aminolevulinic Acid based on CRISPR/Cas9 mediated gene knockout and metabolic pathway modification. J Biol Eng 16(1):26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13036-022-00307-7\u003c/span\u003e\u003cspan address=\"10.1186/s13036-022-00307-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu F, Li X, Wang F, Liu Y, Zhai C, Li W, Ma L, Chen W (2023) TLTC, a T5 exonuclease\u0026ndash;mediated low-temperature DNA cloning method. Front Bioeng Biotechnol 11:1167534. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fbioe.2023.1167534\u003c/span\u003e\u003cspan address=\"10.3389/fbioe.2023.1167534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZerbini F, Zanella I, Fraccascia D, K\u0026ouml;nig E, Irene C, Frattini LF, Tomasi M, Fantappi\u0026egrave; L, Ganfini L, Caproni E, Parri M, Grandi A, Grandi G (2017) Large scale validation of an efficient CRISPR/Cas-based multi gene editing protocol in \u003cem\u003eEscherichia coli\u003c/em\u003e. Microb Cell Fact 16:1\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12934-017-0681-1\u003c/span\u003e\u003cspan address=\"10.1186/s12934-017-0681-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang G, Zhang Q, Wang J, Zhang J, Shang G (2023) Characterization of a novel \u003cem\u003eEscherichia coli\u003c/em\u003e recombineering selection/counterselection cassette. Biotechnol Lett 45(2):191\u0026ndash;197. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10529-022-03333-z\u003c/span\u003e\u003cspan address=\"10.1007/s10529-022-03333-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao D, Yuan S, Xiong B, Sun H, Ye L, Li J, Zhang X, Bi C (2016) Development of a fast and easy method for \u003cem\u003eEscherichia coli\u003c/em\u003e genome editing with CRISPR/Cas9. Microb Cell Fact 15(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e205.https://doi.org/10.1186/s12934-016-0605-5\u003c/span\u003e\u003cspan address=\"205.10.1186/s12934-016-0605-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"biotechnology-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bile","sideBox":"Learn more about [Biotechnology Letters](https://www.springer.com/journal/10529)","snPcode":"10529","submissionUrl":"https://submission.nature.com/new-submission/10529/3","title":"Biotechnology Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"E. coli, sequential gene editing, CRISPR/Cas9, ccdB, counter-selection","lastPublishedDoi":"10.21203/rs.3.rs-6455048/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6455048/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe CRISPR/Cas9 based technology has been used for sequential gene editing in \u003cem\u003eE. coli\u003c/em\u003e. The plasmids carrying the sgRNA and/or Cas9 genes need to be cured after each round of editing. Curing of these plasmids, particularly the sgRNA plasmid, limits the efficiency of sequential gene editing. In this study, a lethal endotoxin (\u003cem\u003eccd\u003c/em\u003eB) based counter-selection was established for improving the overall efficiency of sequential gene editing in \u003cem\u003eE. coli\u003c/em\u003e. This approach was validated for sequential editing (deletion) of \u003cem\u003ecst\u003c/em\u003eA and \u003cem\u003epps\u003c/em\u003eA genes. The experimental results showed that the transformation efficiency sgRNA plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20) reached to 10\u003csup\u003e8\u003c/sup\u003e-10\u003csup\u003e9\u003c/sup\u003e cfu / \u0026micro;g\u003csub\u003e-DNA\u003c/sub\u003e, resulting in a 90% of recombination rate for the target gene (\u003cem\u003ecst\u003c/em\u003eA and \u003cem\u003epps\u003c/em\u003eA). Upon completion of \u003cem\u003ecst\u003c/em\u003eA gene editing, the sgRNA plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003ecst\u003c/em\u003eA)) were effectively cured through \u003cem\u003eccd\u003c/em\u003eB based counterselection at 42\u0026deg;C, with a 43.75% efficiency. At the end of sequential editing of \u003cem\u003epps\u003c/em\u003eA gene, both Cas9 (25A) and sgRNA (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA)) plasmids were cured simultaneously through the \u003cem\u003esac\u003c/em\u003eB and \u003cem\u003eccd\u003c/em\u003eB based counterselections by incubating the cells on LB-sucrose (5%) plate at 42\u0026deg;C, achieving a curing rate of 100% for Cas9 plasmid (25A), and 37.5% for sgRNA plasmid (pTargetF-\u003cem\u003etcr\u003c/em\u003e-P\u003csub\u003eL\u003c/sub\u003e-\u003cem\u003eccd\u003c/em\u003eB-N20(\u003cem\u003epps\u003c/em\u003eA)). These results demonstrated that the endotoxin (\u003cem\u003eccd\u003c/em\u003eB) based counterselection improved the transformation efficiency of sgRNA plasmid, the recombination rate of the editing target gene, the curing rate of sgRNA plasmid, and the overall efficiency of sequential gene editing.\u003c/p\u003e","manuscriptTitle":"Lethal Endotoxin (ccdB) Based Counterselection Improved the Efficiency of Sequential Gene Editing in Escherichia coli","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-13 16:46:18","doi":"10.21203/rs.3.rs-6455048/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-05-24T05:21:03+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-08T19:52:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-07T15:04:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biotechnology Letters","date":"2025-05-06T05:57:32+00:00","index":"","fulltext":""},{"type":"decision","content":"Major revisions","date":"2025-04-22T13:28:31+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"biotechnology-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bile","sideBox":"Learn more about [Biotechnology Letters](https://www.springer.com/journal/10529)","snPcode":"10529","submissionUrl":"https://submission.nature.com/new-submission/10529/3","title":"Biotechnology Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d7f58d30-b785-4f43-92cd-c8d918670bc0","owner":[],"postedDate":"May 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-10-06T16:07:03+00:00","versionOfRecord":{"articleIdentity":"rs-6455048","link":"https://doi.org/10.1007/s10529-025-03642-z","journal":{"identity":"biotechnology-letters","isVorOnly":false,"title":"Biotechnology Letters"},"publishedOn":"2025-09-29 15:57:54","publishedOnDateReadable":"September 29th, 2025"},"versionCreatedAt":"2025-05-13 16:46:18","video":"","vorDoi":"10.1007/s10529-025-03642-z","vorDoiUrl":"https://doi.org/10.1007/s10529-025-03642-z","workflowStages":[]},"version":"v1","identity":"rs-6455048","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6455048","identity":"rs-6455048","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.