MiR-129-5p inhibits the proliferation, migration, and invasion of U87 glioblastoma cells by targeting CaMK IV via the MAPK signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article MiR-129-5p inhibits the proliferation, migration, and invasion of U87 glioblastoma cells by targeting CaMK IV via the MAPK signaling pathway Haidong Gong, Tao Yu, Lijiao Jin, Fakang Zheng, Weining Wang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3905658/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective The purpose was to investigate the expression of CaMK IV in glioblastoma (GBM) and its specific role in GBM cell proliferation, invasion, migration, and other malignant phenotypes. Furthermore, this study aimed to validate the functional relationship between miR-129-5p and CaMK IV, then explore the underlying molecular mechanisms involved. Results Bioinformatics analysis revealed that CaMK IV was expressed at higher levels in normal brain tissues than in GBM tissues. qRT-PCR demonstrated significantly lower expression of CaMK IV in GBM cell samples than in the control tissue. CCK-8 assays indicated that overexpression of CaMK IV significantly inhibited the activity and proliferation of U87 GBM cells, while knockdown of CaMK IV had the opposite effect. Similarly, the introduction of miR-129-5p mimics inhibited the activity and proliferation of U87 GBM cells, while the use of a miR-129-5p inhibitor yielded the opposite results. The scratch assay revealed that, compared with control treatment, CaMK IV overexpression led to larger scratch areas at 12 and 24 hours, indicating that CaMK IV has an inhibitory effect on the migration ability of the GBM cell line U87. Conversely, knockdown of CaMK IV had the opposite effect. Moreover, Transwell assays demonstrated that the overexpression of CaMK IV resulted in significantly fewer penetrating cells than was observed in the control group, suggesting that CaMK IV has an inhibitory effect on the invasion ability of U87 GBM cells. Again, knockdown of CaMK IV yielded the opposite results. Western blot analysis revealed that the overexpression of CaMK IV significantly suppressed the expression of proliferation-related proteins while promoting the activity of apoptosis-related proteins in the U87 GBM cell line. Moreover, overexpression of CaMK IV inhibited the phosphorylation of the MAPK pathway-related proteins JNK and P38, indicating CaMK IV has an inhibitory effect on GBM cells via the MAPK signaling pathway. Conclusion MiR-129-5p selectively inhibits the proliferation, migration, and invasion of U87 cells by targeting CaMK IV via the MAPK signaling pathway. MiR-129-5p and CaMK IV play an important inhibitory roles in GBM and may serve as potential therapeutic targets for GBM treatment. Glioblastoma U87 cells CaMK IV miR-129-5p Targeted therapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Glioblastoma (GBM) is the most malignant type of glioma in the central nervous system (CNS) and accounts for 45% of primary tumors in the CNS [1,2] . GBM patients have a poor prognosis, with a 5-year survival rate of less than 5% after diagnosis [3] . Despite the initial response to previous treatments, approximately 90% of patients experience disease recurrence within 2 years of treatment, with a median survival of less than 2 years [4] . Despite extensive research, there is a lack of models that can accurately replicate the genetic and phenotypic characteristics of GBM, which hinders the development of new therapies for this disease. Due to the significant side effects of chemical drugs, the development of targeted molecular therapies for GBM is urgently needed. MicroRNAs (miRNAs) are important biomarkers for detecting gliomas. They are short noncoding RNAs that act as posttranscriptional regulators of gene expression and are relatively evolutionarily conserved [5] . miRNAs target most mRNAs, allowing them to play significant roles in various physiological processes [6,7] . MiR-129 is a miRNA family that includes three members: miR-129-5p, miR-129-2-3p, and miR-129-3p [8] . However, the functional role of miR-129-5p in GBM is still unknown. Calcium/calmodulin-dependent kinase 4 (CaMK IV) is a member of the serine/threonine kinase family, and its gene is located at chromosomal region 5q21. CaMK IV is significantly upregulated in the brain, thymus, and chromatin [9,10] . Previous studies have shown that the CaMK IV gene has a significant effect on the cAMP pathway and can positively induce adenylate cyclase in the cAMP signaling pathway [11] . The cAMP/PKA signaling pathway regulates the FAK/Akt pathway, promoting GBM cell invasion and migration and contributing to the malignancy of GBM [12] . However, whether miR-129-5p can target CaMK IV through the MAPK signaling pathway in gliomas remained unknown. This study aimed to investigate the expression of CaMK IV in GBM, as well as its specific effects on malignant phenotypes such as proliferation, invasion, and migration in GBM cells. We also aimed to verify the interaction between miR-129-5p and CaMK IV and explore the molecular mechanisms underlying their effects. 2. Materials and methods 2.1 Bioinformatics analysis of GBM-related differentially expressed mRNAs The TCGA and GTEx databases were used to download GBM and normal brain tissue sample data, with logFC > 2.0 or logFC<-2.0 as the threshold for screening DEGs. Moreover, a cluster heatmap was generated to better distinguish these genes. The DEGs in normal brain tissue and GBM tissue were screened using edgeR kits and analyzed by a cluster Heatmap to better distinguish these genes. Then, GO and KEGG enrichment analyses were performed to determine the key action targets and signaling pathways of the genes. 2.2 Culture of cells The human GBM cell line U87 was purchased from Shanghai Enzyme Research Biotechnology Co., Ltd. The cells were subsequently cultured in DMEM (Beijing Solaibao Technology Co., Ltd, China) supplemented with 15% FBS (BI Biotechnology Co., Israel) and 1% penicillin-streptomycin solution (Shanghai Biyuntian Biotechnology Co., Ltd, China) in a 5% CO2 incubator (Sanyo Corporation of Japan) at 37°C. On the day before transfection, U87 GBM cells were digested with pancreatic enzymes (Shanghai Biyuntian Biotechnology Co., Ltd, China) and counted on cell counting plates. The cell suspension was 1×105 cells. The cells were inoculated in 6-well plates, cultured, and then incubated in serum-free medium 12 hours before transfection. 2.3 cell transfection First, dissolved 4 µg of the CaMK IV overexpression plasmi(Sangon Bioengineering (Shanghai) Co., Ltd, China) and LipoHigh transfection reaget ༈Sangon Bioengineering (Shanghai) Co., Ltd, China)were dissolved in 250µL of cell culture medium and left to stand for 20 minutes. The mixture was subsequently added dropwise to the seeded cells, which were later incubated in a CO2 incubator for 4–8 hours. The medium was replaced with fresh culture medium, and the cells were incubated for another 24 hours. Next, diluted CaMK IV siRNA (1–3)༈Sangon Bioengineering (Shanghai) Co., Ltd, China༉, miR-NC, miR-129-5p mimic༈Guangzhou RiboBiotechnology Co., Ltd, China༉, and inhibitor ༈Guangzhou RiboBiotechnology Co., Ltd, China༉with 30 µL of 1× riboFECTTM CP Buffer༈Guangzhou RiboBiotechnology Co., Ltd, China), mixed Seperately, and added riboFECTTM CP ReagentGuangzhou RiboBiotechnology Co., Ltd, China༉to the mixture. The mixture was stand for 10 minutes before it was added to the serum-free culture medium. Finally, the sells were transfered to a well plate and incubated for 24 hours. 2.4 RNA extraction from brain tissue samples and U87 cells After passing the ethical review of the Medical Ethics Committee of Hongqi Hospital Affiliated to Mudanjiang Medical University and providing informed consent, the primary GBM from the patients diagnosed by pathologists and the normal brain tissue specimens near the tumors were surgically removed, for a total of 4 patients each. The requirements for specimen collection were as follows: ① Patients who had not received preoperative chemoradiotherapy; ② Patients were histologically diagnosed independently by more than two pathologists; and all tissue samples were immediately frozen in liquid nitrogen and stored at − 80°C. RNA was extracted using an AXYgen RNA Extraction Kit (Axygen Biotechnology Co., Ltd, China), according to the manufacturer’s instructions. 2.5 Verification of the expression of CaMK IV and miR-129-5p in clinical tissues and U87 cells was via qRT-PCR. mRNA and miRNA qRT-PCR were completed by an Applied Biosystems 7500 quantitative PCR instrument (ABI Company in the United States) using a Xinbei 2xS6 Universal SYBR qPCR Mix Kit and a 2xS6 miRNA SYBR qPCR Mix Kit, respectively.U6 was used as an internal reference for miRNA, whereas GAPDH was used as a reference for mRNA. All primers used were obtained from Guangzhou RiboBiotechnology Co., Ltd (Guangzhou, China) and were listed in Table 1 . The formula 2 − ΔΔCT was used to determine the miR-129-5p and mRNA expression levels. All the reactions were repeated for three times. Table 1 The sequences of primers Primer name Sequence(5 ’-3 ’) miR- 129-5p-forword GCGGCTTTTTGCGGTCTGG miR- 129-5p-reverse GTGCAGGGTCCGAGGT U6-forward CTCGCTTCGGCAGCACA U6-reverse AACGCTTCACGAATTTGCGT CAMK IV-forward AATCATATGCTCAAAGTCACGGTGCCC CAMK IV-reverse TACATCTCGAGTTAGTACTCTGGCAGGATC GAPDH-forward AACGACCCCTTCATTGAC GAPDH-reverse TCCACGACATACTCAGCAC 2.6 Cell protein extraction and Western blot analysis The tissues and cells were lysed using the RIPA buffer (Beijing Solaibao Technology Co., Ltd, China), and the supernatant was collected and stored. The protein concentration was measured using a microplate spectrophotometer (Thermo Scientific Co., USA). Gel electrophoresis was performed using the a 10% SDS-PAGE Colored Gel Rapid Preparation Kit (Shanghai Yaenzyme Biomedical Technology Co., Ltd,China). Transblotting was carried out on PVDF membranes (Thermo Fisher Scientific Co., USA). The membranes were then blocked with 5% skim milk at room temperature for 2 hours. The following primary antibodies were used: BAX polyclonal antibody (Wuhan Sanying Biotechnology Co., Ltd, China); BCL2 polyclonal antibody (Wuhan Sanying Biotechnology Co., Ltd, China); Caspase 3 (Active) rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); Ki67 rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); phospho-JNK1/2 (Thr183/Tyr185) rabbit polyclonal antibody(Shanghai Biotech Biotechnology Co., Ltd, China); p38 MAPK rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); JNK1 + JNK2 + JNK3 rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); Phospho-p38 MAPK (Thr180/Tyr182) Rab-Biotechnology Co., Ltd, China); and mouse anti-β actin mAb (Zhongshan Golden Bridge Biotechnology Co., Ltd, China). The secondary antibodies used were Goat anti-rabbit IgG/horseradish peroxidase-labeled antibody and sheep anti-mouse IgG/horseradish peroxidase-labeled antibody, both of which were purchased from Shanghai Biotech Biotechnology Co., Ltd. The membranes were visualized using an enhanced chemiluminescence (ECL) system and scanned using a fully automated chemiluminescence imaging system. 2.7 CCK-8 detection Cell viability was assessed using a CCK-8 assay kit (White Shark Biological Technology Co., Ltd, China). Cells (3000 cells) were seeded into a 96-well plate and incubated with 10µL of CCK-8 solution for 0, 24, 48, or 72 hours. The optical density (OD) at 490 nm was measured using a microplate reader (Molecular Devices, USA). 2.8 Transwell experiments. After thawing, 60 µL of Matrigel matrix gel (Shanghai Bangjing Industrial Co., Ltd., China) was added to each well (24-well plate), followed by the addition of 3000 cells per well. The cells were cultured for 24 hours. Subsequently, the cells were fixed with 4% paraformaldehyde, permeabilized with methanol, and stained with crystal violet for fixation. Finally, an inverted microscope (Nikon Co., Japan)was used for observation, and the experiment was repeated three times. 2.9 Cell scratch experiment The cells were cultured in a six-well plate. After a 1cm scratch was created on the surface using a 10 µL pipette, the original culture medium was aspirated. The scratch was then observed at 0, 12, and 24 hours, after which images were taken. Finally, the scratch area was calculated using ImageJ to analyze the healing progress. Differences in the healed scratch area were observed to assess cell migration ability. 2.10 Statistical methods ImageJ was used for image processing, and the results were analyzed of the results was performed using SPSS 26.0. The experimental data are presented as the mean ± standard deviation. A t test was used for comparisons between two groups, while a repeated measures analysis of variance was used for comparisons between multiple groups. A significance level of P < 0.05 was used to indicate statistical significance. 3. Results 3.1 Analysis of public data indicated that the expression level of CaMK IV in GBM tissues was lower than that in normal tissues First, to determine the differences in mRNAexpression between GBM tissue and normal brain tissue, 168 GBM tissue samples and 1152 GBM tissue samples, as well as 5 normal tissue samples in the TCGA and related data, were downloaded from the TCGA and GTEx databases, respectively, to analyze the prognostic significance of the differentially expressed mRNAs in GBM. With logFC > 2.0 or logFC<-2.0 as the threshold, the edgeR package was used to screen the DEGs and CaMK IV was screened out; the genes were analyzed via a cluster Heatmap to better distinguish these genes(Fig. 1 A). Subsequently, KEGG analysis revealed CaMK IV was directly involved in the occurrence and development of GBM through the Ca2 + signaling pathway and MAPK signaling pathway(Fig. 1 B and C). GO enrichment analysis was conducted to explore the key action targets of CaMK IV(Fig. 1 D). CaMK IV was mainly enriched in the “signal transduction”, “gene expression”, “cell proliferation” and other functions, and was found to be related to GBM. In addition, survival analysis using a survival kit also revealed that the survival rate of the group with high CaMK IV expression was significantly greater than that of the group with low CaMK IV expression(Fig. 2 A). the relationship between CaMK IV expression and the clinical characteristics of GBM patients was validated via the GEPIA 2 and KM Plotter databases. In the GEPIA 2 database, high CaMK IV was associated with improved OS in GBM patients (Hazard Ritio (HR) = 1.5, log-rank test = 0.022)(Fig. 2 B). The KM Plotter database also showed that high CaMK IV expression was associated with improved OS [HR = 0.81(0.71 − 0.94), log-rankP = 0.0037) (Fig. 2 C). 3.2 Low expression of CaMK IV in GBM tissues was detected in clinical tissue samples GBM tissues were obtained from 4 postoperative patients at the Department of Neurosurgery, Hongqi Hospital Affiliated to Mudanjiang Medical University, as well as from 4 cases with normal brain tissue adjacent to the tumor. Total RNA was extracted, and CaMK IV expression was detected via qRT-PCR. The results showed that the expression level of CaMK IV in GBM patients was significantly lower than that in the control group (P < 0.05)(Fig. 3 A). 3.3 Transfection efficiency of U87 cells was measured by qRT-PCR To analyze the effect of CaMK IV on U87 cells, CaMK IV overexpression and siCaMK IV transient transfection cell lines were constructed, and named as the blank control group, NC group, CaMK IV overexpression group, and siCaMK IV (1–3) groups. qRT-PCR was performed to validate the knockdown efficiency of siCaMK IV in U87 cells, and it was found that all three different transient transfection regimens effectively reduced the expression of CaMK IV mRNA in U87 cell lines, with siCaMK IV 2 being the most effective(Fig. 3 B). To further validate the effect of miR-129-5p on U87 cells, miR-129-5p mimics and inhibitor cell lines were constructed, and named as the blank control group, miR-NC group, miR-129-5p mimics group, and miR-129-5p inhibitor group. qRT-PCR was performed to verify the transfection efficiency of miR-129-5p, and the results showed that the expression level of miR-129-5p in U87 cells in the miR-129-5p mimics group was significantly greater than that in the miR-NC group, while the opposite trends in the miR-129-5p inhibitor group(Fig. 3 C). 3.4 CaMK IV expression was detected in U87 cells after transfection Western blot analysis was performed to detect the expression levels of CaMK IV in each transfected group. The results showed that the level of CaMK IV in the CaMK IV overexpression group was significantly greater than that in the blank control group, while the opposite effect was observed in the siCaMK IV group(Fig. 3 D-E). In the miR-129-5p mimic group, the expression level of CaMK IV was significantly greater than that in the control group, whereas in the miR-129-5p inhibitor group, the expression level of CaMK IV was significantly lower than that in the control group(Fig. 3 F-G). 3.5 MiR-129-5p and CaMK IV inhibited proliferation in GBM cells To investigate the effects of miR-129-5p and CaMK IV on glioblastoma cell proliferation, CCK-8 assays were performed. The results revealed that the OD values of U87 cells in the blank control group and NC-transfected group were similar, indicating comparable growth states. However, the OD of the miR-129-5p mimic group and CaMK IV overexpression group were lower than those of the blank control group and NC group, suggesting that CaMK IV and miR-129-5p suppress the growth of U87 cells and significantly decrease cell viability(Fig. 4 A and B). 3.6 CaMK IV inhibited invasion and migration of U87 cells A cell scratch experiment was performed to investigate the effect of CaMK IV on the migration ability of the GBM cell. the scratch area in the CaMK IV overexpression group was larger than that in the control group, and the cell invasion rate was significantly lower, indicating that CaMK IV significantly inhibited the migration of U87 cells(Fig. 4 C and D-E). In addition, Transwell experiments were conducted to validate the effect of CaMK IV on the invasion of U87 cells. The results revealed no significant difference in cell number between the control group and the NC group, while the cell number in the CaMK IV overexpression group was significantly lower than that in the control group and the NC group, with the opposite result observed in the siCaMK IV group. CaMK IV overexpression significantly decreased the invasion ability of U87 GBM cells(Fig. 5 A-B). 3.7 CaMK IV inhibits proliferation and inhibits apoptosis-related proteins To analyze the antiproliferation and proapoptosis effects of CaMK IV, Western blotting was performed to detect the expression of proliferation-related proteins and apoptosis-related proteins. The results showed that in U87 cells, the overexpression of CaMK IV significantly decreased the expression of Ki-67 and Bcl-2 compared to that in the blank control group and the negative control group. Conversely, the expression of active caspase-3 and BAX was significantly greater in the treated group than in the blank control group and the negative control group. The opposite results were obtained in the siCaMK IV group(Fig. 6 A-B). 3.8 CaMK IV inhibits MAPK phosphorylation and exerts a cancer-inhibiting effect In addition, this study analyzed the mechanism by which CaMK IV exerts its anticancer effects on GBM and conducted Western blot experiments to detect the phosphorylation levels of MAPK signaling pathway proteins in cells. In U87 cells, the phosphorylation levels of p38 and JNK were significantly lower in the CaMK IV group than in the control group and the negative control group. The overexpression of CaMK IV inhibited the phosphorylation of proteins in the MAPK pathway(Fig. 6 C-D). This findings validated that the inhibitory effect of CaMK IV on GBM is achieved through the MAPK signaling pathway. 4. Discussion GBM represents the most prevalent histological subtype of glioma observed in adult patients, with a median survival time of 12 months [ 1 3] . Despite being relatively rare, GBM has high mortality and incidence rates. Genomic analysis of GBM has also produced new evidence regarding risk and prognosis [ 14 , 15 ] . Despite the continuous development of emerging medical technologies and the clinical application of chemotherapeutic drugs such as temozolomide for GBM, the prognosis for GBM patients remains poor due to the highly invasive and rapidly progressing nature of GBM. Therefore, targeted gene therapy has gradually become a new treatment modality for GBM at this stage [ 16 ] . Moreover, mRNAs can serve as a molecular biomarkers for the early diagnosis and treatment of tumors, as well as for predicting patient prognosis and providing potential therapeutic targets. Currently, the pathogenesis of GBM is not fully understood. Therefore, in this study,bioinformatics analysis of data extracted from the TCGA and GTEx databases found that CaMK IV was significantly downregulated in GBM. Enrichment analysis and survival analysis results indicated that CaMK IV and others are important tumor suppressor factors. After reviewing relevant literature in recent years, we ultimately selected CaMK IV. Additionally, CaMK IV is highly expressed in various normal tissues in the human body, especially in brain tissue. Therefore, it is inferred that the low expression of CaMK IV in GBM may be one of the reasons for malignant proliferation. In human cells, under the action of CaMK IV, Ser/Thr kinase residues of Ca2+ signaling-related proteins are phosphorylated and activated, where they exert their functions. In addition, this study predicted through bioinformatics analysis,we predicted that miR-129-5p expression is downregulated in GBM, and that its low expression significantly promotes tumor biological activity, facilitating tumor development. This effect may be achieved through targeting CaMK IV. Therefore, U87 cells were transfected with miR-129-5p mimics and inhibitors to verify the proliferative activity of the transfected U87 cells. CCK-8 assays showed that the overexpression of miR-129-5p significantly inhibited the proliferation ability of U87 cells, indicating that miR-129-5p has a significant tumor-suppressive effect. The tumor suppressive effect of miR-129-5p is consistent with the findings of previous studies. Feng et al [ 17 ] reported that miR-129-5p can inhibit the proliferation of gastric cancer cells by downregulating the expression of HMGB1. Similar experimental results were also observed in the study by Yan et al [ 18 ] , who demonstrated that miR-129-5p inhibits the activity, proliferation, mitosis, migration, and invasion of gastric cancer cells by specifically inhibiting the expression of SPOCK1. This study used bioinformatics analysis to predict a potential targeting relationship between miR-129-5p and CaMK IV in GBM, suggesting that they may work together to exert tumor-suppressive effects. Subsequently, U87 cells were transfected with miR-129-5p mimics and inhibitors, and Western Blotting was performed to detect the protein expression level of CaMK IV to validate the correlation between miR-129-5p and CaMK IV. The results showed that the expression of CaMK IV increased in U87 cells transfected with miR-129-5p mimics, indicating that the inhibitory effect of miR-129-5p on U87 cells may be achieved through targeting CaMK IV. Both miR-129-5p and CaMK IV act as tumor suppressor genes in GBM, consistent with previous bioinformatics predictions. Additionally, Li et al [1 9 ] validated the targeting relationship between miR-129-5p and CaMK IV in hepatocellular carcinoma. The team conducted dual luciferase reporter assays to analyze the interaction between miR-129-5p and CaMK IV, confirming the targeting relationship between them. The team also performed in vitro experiments to verify the tumor-suppressive roles of miR-129-5p and CaMK IV in hepatocellular carcinoma, which is consistent with the results of this study. In conclusion, miR-129-5p and CaMK IV have synergistic targeting effects on GBM, and both play a role in inhibiting the occurrence and development of GBM. Further exploration of the biological mechanisms underlying their synergistic relationship is warranted. To further explore the inhibitory effect of CaMK IV on GBM, GBM U87 cell lines with CaMK IV overexpression or knockdown were constructed for subsequent studies. After transfection, a CCK-8 assay was performed to validate the cell proliferation activity. The results showed that CaMK IV overexpression weakened the proliferation ability of U87 GBM cells, while CaMK IV knockdown enhanced cell proliferation. These findings indicate that CaMK IV has a significant inhibitory effect on GBM cells. Next, cell scratch and Transwell assays were performed to validate the impact of CaMK IV on GBM cell migration and invasion. The results showed that there was no significant difference in the scratch area between the CaMK IV overexpression group and the control group at 12 hours, but at 24 hours, the scratch area of the CaMK IV overexpression group was significantly larger than that of the control group. However, in the CaMK IV knockdown group, the scratch area was significantly smaller than that in the control group at both 12 and 24 hours, indicating that CaMK IV significantly inhibited the migration of GBM cell lines. According to the Transwell assay, the number of cells that passed through the chamber was lower in the CaMK IV overexpression group than in the control group, while the CaMK IV knockdown group had a significantly greater number of cells that passed through the chamber than did the control group. These findings also suggested that CaMK IV has a clear inhibitory effect on the invasive ability of the GBM cell line U87. Migration and invasion were important characteristics of tumor cells, and directly contributed to distant metastasis and peritumoral invasion. Next, Western blot analysis was performed to examine the effect of CaMK IV on the proliferation and apoptosis ability of GBM cell lines, and the expression levels of apoptosis-related proteins were detected. The results showed that the expression levels of the proapoptotic proteins caspase-3 and BAX were significantly greater in the CaMK IV overexpression group than in the control group, while the expression levels of the antiapoptotic protein Bcl-2 and the proliferation protein Ki67 were decreased in the CaMK IV overexpression group. Conversely, CaMK IV knockdown had the opposite effect. Ki67 is closely associated with cell mitosis, and higher levels of Ki67 contribute to more active cell proliferation and poorer tissue differentiation. Additionally, Bcl-2 and BAX are representative apoptosis-related proteins in this family, with Bcl-2 being an antiapoptotic protein and BAX being a proapoptotic protein. Some studies suggest that the ratio of Bcl-2 to BAX after apoptotic stimulation determines cell survival or death [ 20 , 21 ] . Caspases, including cysteine aspartate-specific proteinases (caspases), are key mediators of cellular apoptosis. Caspase-3 is an activated protease in the mitochondrial-dependent apoptotic pathway, and its activation is triggered by the release of cytochrome C after mitochondrial membrane permeabilization. Activated Caspase-3 catalyzes the specific cleavage of many key cellular proteins and acts as an executor of cell apoptosis [ 22 ] . These results suggest that CaMK IV can significantly promote apoptosis, inhibit cell proliferation, and suppress tumor occurrence and development in GBM cell lines. To further validate how CaMK IV exerts its inhibitory effect on GBM, Western blot experiments were conducted to detect the phosphorylation levels of MAPK signaling pathway proteins in cells. The overexpression and activation of MAPK pathway-related proteins are two of the main mechanisms by which tumor cells resist apoptosis. The MAPK signaling pathway is a cascade process involving three kinases, with the most upstream kinase (MAPKKK) responding to various extracellular and intracellular signals and activating intermediate kinases (MAPKKs) through direct phosphorylation [ 23 , 24 ] . MAPKKs specifically phosphorylate and activate MAPK, which usually has many substrates that execute specific cell fate decisions in response to input signals. There are three major families of MAPKs: extracellular signal-regulated kinases (EKs), c-Jun N-terminal kinases (JNKs), and stress-activated protein kinases (p38/SAPKs). JNK mainly responds to stress such as ionizing radiation and oxidative stress, and is involved in cell apoptosis, cytokine production, inflammation, and metabolism [ 25 , 26 ] . p38 MAPK is strongly activated by cytokines and cellular stress, and activation of the p38 MAPK pathway contributes to inflammation, cell apoptosis, cell differentiation, and cell cycle regulation [ 27 ] . Behzad et al. [ 28 ] reported that HMGA2 activates signaling through the MAPK pathway, affecting different DNA repair mechanisms and promoting epithelial-to-mesenchymal transition. In addition, HMGA2 supports cancer stem cell phenotypes and confers chemoresistance to cancer cells. Fan et al. [ 29 ] covered that cell apoptosis and autophagy mediated by bruceine D were significantly inhibited in cells pretreated with the intracellular reactive oxygen species scavenger N-acetylcysteine (NAC), and this change was accompanied by activation of the MAPK signaling pathway. Bruceine D inhibited cell proliferation in non-small cell lung cancer tissues, and NAC eliminated the upregulation of p-ERK and p-JNK. The results of this study indicate that miR-129-5p can inhibit the proliferation of GBM cells and promote cell apoptosis by directly targeting CaMK IV and inhibiting the activation of the MAPK pathway. These findings suggested that CaMK IV may be a better target for potential anti-GBM drugs. Research on CaMK IV has focused mainly on its role in maintaining neuronal integrity, while its function in tumors has been relatively understudied. A small amount of literature suggests that CaMK IV has tumor-suppressive effects and can inhibit cell proliferation while promoting apoptosis. CaMK IV can inhibit the proliferation of HepG2 and neuroblastoma cells (SH-SY5Y) by binding with coumarin to increase its activity [ 30 ] . Lin et al [ 31 ] suggested that CaMK IV is an important regulatory factor in liver cancer. In hepatocellular carcinoma, CaMKK2 is necessary for maintaining S6K/S6 phosphorylation and optimal protein translation, while the loss of CaMK IV has the most significant inhibitory effect on protein synthesis. Its downregulation significantly reduces the activity of S6K/S6. The CaMKK2 signaling pathway selectively controls protein translation in liver cancer cells through CaMK IV. However, some studies suggest that the knockdown of CaMK IV has a relatively insignificant promoting effect on hepatocellular carcinoma cell lines, which contradicts the results of Lin et al. This may be due to the relatively low expression of CaMK IV in normal liver tissue and even lower expression in liver cancer cells, and the artificial knockout of CaMK IV in transfection experiments may have led to relatively insignificant results. Summary,molecular targeted therapy for GBM aims to target tumor driver genes, precisely and specifically inhibiting or even killing tumor cells. This approach can provide significant therapeutic effects and fewer adverse reactions for molecular targeted therapy of tumors, with the hope of providing better treatment strategies and improving patient prognosis. This study has certain limitations. First, after in vitro experiments, further in vivo experiments are needed to validate the inhibitory effect of CaMK IV on GBM tumors. Second, cotransfection of miR-129-5p and CaMK IV should be conducted to verify the relationship between miR-129-5p and CaMK IV and their effects on GBM. This study verified the inhibitory effect of CaMK IV on GBM through bioinformatics analysis and subsequent CaMK IV knockout and overexpression, providing certain value for the molecular targeted therapy for GBM and "precision medicine". Declarations Author Contribution HG and DL designed the study. HG and TY wrote the manuscript. LJ analyzed the data. FZ, WW,QZ and BL prepared the images and tables. DL reviewed and revised the manuscript. All the authors approved the final manuscript. References Le Rhun E, Preusser M, Roth P, et al. Molecular targeted therapy of glioblastoma[J]. Cancer Treat Rev, 2019, 80-96. Ou A, Yung WKA, Majd N. Molecular Mechanisms of Treatment Resistance in Glioblastoma[J]. Int J Mol Sci, 2020, 22(1). Lah TT, Novak M, Breznik B. Brain malignancies: Glioblastoma and brain metastases[J]. Semin Cancer Biol, 2020,60,262-273. Gimple RC, Bhargava S, Dixit D, et al. Glioblastoma stem cells: lessons from the tumor hierarchy in a lethal cancer[J]. Genes Dev, 2019, 33(11-12): 591-609. Ali Syeda Z, Langden SSS, Munkhzul C, et al. Regulatory Mechanism of MicroRNA Expression in Cancer[J]. Int J Mol Sci, 2020, 21(5). Çakmak HA, Demir M. MicroRNA and Cardiovascular Diseases[J]. Balkan Med J, 2020, 37(2): 60-71. Abo-Al-Ela HG, Faggio C. MicroRNA-mediated stress response in bivalve species[J]. Ecotoxicol Environ Saf, 2021, 208-222. Deng B, Tang X, Wang Y. Role of microRNA-129 in cancer and noncancerous diseases (Review)[J]. Exp Ther Med, 2021, 22(3): 918. Naz H, Islam A, Ahmad F, et al. Calcium/calmodulin-dependent protein kinase IV: A multifunctional enzyme and potential therapeutic target[J]. Prog Biophys Mol Biol, 2016, 121(1): 54-65. Fujisawa H. Regulation of the activities of multifunctional Ca2+/calmodulin-dependent protein kinases[J]. J Biochem, 2001, 129(2): 193-199. Persaud SJ, Liu B, Sampaio HB, et al. Calcium/calmodulin-dependent kinase IV controls glucose-induced Irs2 expression in mouse beta cells via activation of cAMP response element-binding protein[J]. Diabetologia, 2011, 54(5): 1109-1120. Jiang K, Yao G, Hu L, et al. MOB2 suppresses GBM cell migration and invasion via regulation of FAK/Akt and cAMP/PKA signaling[J]. Cell Death Dis, 2020, 11(4): 230. Witthayanuwat S, Pesee M, Supaadirek C, et al. Survival Analysis of Glioblastoma Multiforme[J]. Asian Pac J Cancer Prev. 2018 Sep 26;19(9):2613-2617. Tom MC, Cahill DP, Buckner JC, et al. Management for Different Glioma Subtypes: Are All Low-Grade Gliomas Created Equal?[J]. Am Soc Clin Oncol Educ Book, 2019, 39,133-145. Tsitlakidis A, Aifantis EC, Kritis A, et al. Mechanical properties of human glioma[J]. Neurol Res, 2020, 42(12): 1018-1026. Wang TJC, Mehta MP. Low-Grade Glioma Radiotherapy Treatment and Trials[J]. Neurosurg Clin N Am, 2019, 30(1): 111-118. Feng J, Guo J, Wang JP, et al. MiR-129-5p inhibits proliferation of gastric cancer cells through targeted inhibition on HMGB1 expression[J]. Eur Rev Med Pharmacol Sci. 2020 Apr;24(7):3665-3673. Yan L, Sun K, Liu Y, et al. MiR-129-5p influences the progression of gastric cancer cells through interacting with SPOCK1[J]. Tumor Biol. 2017 Jun;39(6):1010428317706916. Li Z, Lu J, Zeng G, et al. MiR-129-5p inhibits liver cancer growth by targeting calcium calmodulin-dependent protein kinase IV (CAMK4)[J]. Cell Death Dis, 2019, 10(11): 789. Spitz AZ, Gavathiotis E. Physiological and pharmacological modulation of BAX[J]. Trends Pharmacol Sci. 2022 Mar;43(3):206-220. Sun X, Kaufman PD. Ki-67: more than a proliferation marker[J]. Chromosoma. 2018 Jun;127(2):175-186. Jiang M, Qi L, Li L, Li Y. The caspase-3/GSDME signal pathway as a switch between apoptosis and pyroptosis in cancer[J]. Cell Death Discov. 2020 Oct 28;6:112. Yong HY, Koh MS, Moon A. The p38 MAPK inhibitors for the treatment of inflammatory diseases and cancer[J]. Expert Opin Investig Drugs, 2009, 18(12): 1893-1905. Zhang W, Liu HT. MAPK signal pathways in the regulation of cell proliferation in mammalian cells[J]. Cell Res, 2002, 12(1): 9-18. Hammouda MB, Ford AE, Liu Y, et al. The JNK Signaling Pathway in Inflammatory Skin Disorders and Cancer[J]. Cells, 2020, 9(4). Li G, Qi W, Li X, et al. Recent Advances in c-Jun N-Terminal Kinase (JNK) Inhibitors[J]. Curr Med Chem, 2021, 28(3): 607-627. Cuadrado A, Nebreda AR. Mechanisms and functions of p38 MAPK signalling[J]. Biochem J, 2010, 429(3): 403-417. Mansoori B, Mohammadi A, Ditzel HJ, et al. HMGA2 as a Critical Regulator in Cancer Development[J]. Genes (Basel), 2021, 12(2). Fan J, Ren D, Wang J, et al. Bruceine D induces lung cancer cell apoptosis and autophagy via the ROS/MAPK signaling pathway in vitro and in vivo[J]. Cell Death Dis, 2020, 11(2): 126. Rakoczy K, Szlasa W, Saczko J, Kulbacka J. Therapeutic role of vanillin receptors in cancer[J]. Adv Clin Exp Med. 2021 Dec;30(12):1293-1301. Lin F, Marcelo KL, Rajapakshe K, et al. The camKK2/camKIV relay is an essential regulator of hepatic cancer[J]. Hepatology. 2015 Aug;62(2):505-20. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3905658","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":271423254,"identity":"bb8aa1e7-9142-4202-bd87-6593fc4cc3ba","order_by":0,"name":"Haidong Gong","email":"","orcid":"","institution":"First Affiliated Hospital of Harbin Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Haidong","middleName":"","lastName":"Gong","suffix":""},{"id":271423255,"identity":"22bf8c3a-85c1-40e0-8fbd-1fa6cb098aea","order_by":1,"name":"Tao Yu","email":"","orcid":"","institution":"Hongqi Hospital affiliated to Mudanjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tao","middleName":"","lastName":"Yu","suffix":""},{"id":271423256,"identity":"d436832c-70bb-4228-a02d-2e00445df2e7","order_by":2,"name":"Lijiao Jin","email":"","orcid":"","institution":"Mudanjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lijiao","middleName":"","lastName":"Jin","suffix":""},{"id":271423257,"identity":"3469486a-9ee8-4e21-8151-f9ab9dfa9216","order_by":3,"name":"Fakang Zheng","email":"","orcid":"","institution":"Hongqi Hospital affiliated to Mudanjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fakang","middleName":"","lastName":"Zheng","suffix":""},{"id":271423258,"identity":"723e77e4-dabf-4a4b-b7f6-9bd96afab95e","order_by":4,"name":"Weining Wang","email":"","orcid":"","institution":"Hongqi Hospital affiliated to Mudanjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Weining","middleName":"","lastName":"Wang","suffix":""},{"id":271423259,"identity":"fc6b0692-75c4-4bb6-a2be-f44e6478744f","order_by":5,"name":"Bo Lv","email":"","orcid":"","institution":"Hongqi Hospital affiliated to Mudanjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bo","middleName":"","lastName":"Lv","suffix":""},{"id":271423260,"identity":"6385cbbb-8b6a-42d2-9979-5506e0b0b83e","order_by":6,"name":"Qiwen Zhao","email":"","orcid":"","institution":"Hongqi Hospital affiliated to Mudanjiang Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiwen","middleName":"","lastName":"Zhao","suffix":""},{"id":271423261,"identity":"b940d58c-bdff-422a-b462-c90a4671fe3e","order_by":7,"name":"Danian Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYDCCA2BkwcPAzHzwwYcKCTl5IrVI8DCwsyUbzjhjYWzYQIQWIJBgYODnMZPmbatIhIrgBnzHzx488HOHhIzBYR5jA955EgmMDcwPH93Ao0XyTF7Cwd4zEjwGh9kKH0huk8hjZ2AzNs7Bo8XgQI7BAd42kBbmzQaG2ySKGRt42KTxajn/xuDgX7AWBjOJxDkSiQ0HCGm5kWNwGGILi5nEwQYitEjeeGNwWBaoRfIwMJAbjkkYGzYT8Avf+Rzjj2/bbOz5zh8++PhPTZ2cPHvzw8f4tGABzKQpHwWjYBSMglGABQAAShZNo81SlbAAAAAASUVORK5CYII=","orcid":"","institution":"Hongqi Hospital affiliated to Mudanjiang Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Danian","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-01-28 11:59:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3905658/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3905658/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50785254,"identity":"0c1ed5e5-c3c6-4cdc-908e-cce41f2d8197","added_by":"auto","created_at":"2024-02-07 09:19:52","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":396407,"visible":true,"origin":"","legend":"\u003cp\u003eBioinformatics analysis and Kaplan-Meier survival analysis curve compared the effect of high and low CaMK IV expression on patient prognosis in GBM. \u003cstrong\u003eA \u003c/strong\u003eBioinformatics analysis cluster analysis heat map. The horizontal representative sample, the vertical representative gene, red represents the high expression of the gene, and the green represents the low expression of the gene, which is used to find and analyze the differentially expressed genes in GBM. \u003cstrong\u003eB-C \u003c/strong\u003eKEGG enrichmentanalysis showed CaMK IV gene-related signaling pathway. \u003cstrong\u003eD \u003c/strong\u003eGO enrichment analysis to explore CaMK IV as a key target for GBM modulators.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3905658/v1/3cb35432ef06afc6c1dc1f97.png"},{"id":50785253,"identity":"f144da25-f429-42f9-aef7-3f00d5275ce5","added_by":"auto","created_at":"2024-02-07 09:19:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":82344,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eThe OS survival curveobtained by the survival package of the TCGA and GTEx databases(Logrank p=0.042). \u003cstrong\u003eB \u003c/strong\u003ethe OS survival curve of GBM in the GEPIA2 database. \u003cstrong\u003eC \u003c/strong\u003eGBM OS survival curve in KM Plotter database, high expression of CaMK IV and better OS.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3905658/v1/ae94890fb03624fbdc6823d6.png"},{"id":50785257,"identity":"41c06594-1b73-44c7-9cb0-d8b0fa5e419e","added_by":"auto","created_at":"2024-02-07 09:19:52","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":172911,"visible":true,"origin":"","legend":"\u003cp\u003eA Expression of CaMK IV in GBM tissues and adjacent normal brain tissues detected by qrt-PCR. B qRT-PCR to verify CaMK IV expression after transfection with three different siCaMK IV. C Expression level of miR-129-5p mimics and inhibitor after transfection. D-E Representative western and quantification of CaMK IV mRNA in the CaMK IV transfection group. F-G epresentative western and quantification of CaMK IV mRNA in miR-129-5p transfection group.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3905658/v1/edf8005c17666321b0dc9be2.png"},{"id":50785255,"identity":"86856bef-9d73-4c5e-ad72-3452d9e32b80","added_by":"auto","created_at":"2024-02-07 09:19:52","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":534849,"visible":true,"origin":"","legend":"\u003cp\u003eA CCK-8 verified the effect of miR-129-5p mimics and inhibitor on the proliferation of U87 cells. B Effects of CaMK IV overexpression and knockdown on the proliferation of U87 cells. C Decreased migration of 0-, 12-, and 24-hour CaMK IV overexpressing cell lines. The siCaMK IV has improved migration capabilities. represent migration inhibition rates at 12 and 24 hours, respectively.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3905658/v1/ea3eb0b08cdfe275d894782d.png"},{"id":50785879,"identity":"9aced338-3f26-4a58-af85-d2fe2a7ce3f9","added_by":"auto","created_at":"2024-02-07 09:27:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":90606,"visible":true,"origin":"","legend":"\u003cp\u003eA-B Transwell experimental results of Control group, NC group, siCaMK IV group, and CaMK IV group.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3905658/v1/b626200d04590de7a44d5461.png"},{"id":50785880,"identity":"01d1566c-288d-4e44-a74e-ebe6388def3f","added_by":"auto","created_at":"2024-02-07 09:27:52","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":246584,"visible":true,"origin":"","legend":"\u003cp\u003eA-B Western blot results of CaMK IV on the levels of proliferation and apoptosis-related proteins. C-D Phosphorylation levels of MAPK signaling pathway related proteins were detected by Western Blot.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-3905658/v1/a6d4a829d815f17ea012be1d.png"},{"id":52221304,"identity":"08eabfe7-12a5-4004-bc1c-4e1a0a7ccb43","added_by":"auto","created_at":"2024-03-08 04:07:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1696343,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3905658/v1/7f8546f1-e8fa-47b3-bec7-424f3b02bc76.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"MiR-129-5p inhibits the proliferation, migration, and invasion of U87 glioblastoma cells by targeting CaMK IV via the MAPK signaling pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eGlioblastoma (GBM) is the most malignant type of glioma in the central nervous system (CNS) and accounts for 45% of primary tumors in the CNS \u003csup\u003e[1,2]\u003c/sup\u003e. GBM patients have a poor prognosis, with a 5-year survival rate of less than 5% after diagnosis \u003csup\u003e[3]\u003c/sup\u003e. Despite the initial response to previous treatments, approximately 90% of patients experience disease recurrence within 2 years of treatment, with a median survival of less than 2 years \u003csup\u003e[4]\u003c/sup\u003e. Despite extensive research, there is a lack of models that can accurately replicate the genetic and phenotypic characteristics of GBM, which hinders the development of new therapies for this disease. Due to the significant side effects of chemical drugs, the development of targeted molecular therapies for GBM is urgently needed.\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are important biomarkers for detecting gliomas. They are short noncoding RNAs that act as posttranscriptional regulators of gene expression and are relatively evolutionarily conserved \u003csup\u003e[5]\u003c/sup\u003e. miRNAs target most mRNAs, allowing them to play significant roles in various physiological processes \u003csup\u003e[6,7]\u003c/sup\u003e. MiR-129 is a miRNA family that includes three members: miR-129-5p, miR-129-2-3p, and miR-129-3p \u003csup\u003e[8]\u003c/sup\u003e. However, the functional role of miR-129-5p in GBM is still unknown.\u003c/p\u003e \u003cp\u003eCalcium/calmodulin-dependent kinase 4 (CaMK IV) is a member of the serine/threonine kinase family, and its gene is located at chromosomal region 5q21. CaMK IV is significantly upregulated in the brain, thymus, and chromatin \u003csup\u003e[9,10]\u003c/sup\u003e. Previous studies have shown that the CaMK IV gene has a significant effect on the cAMP pathway and can positively induce adenylate cyclase in the cAMP signaling pathway \u003csup\u003e[11]\u003c/sup\u003e. The cAMP/PKA signaling pathway regulates the FAK/Akt pathway, promoting GBM cell invasion and migration and contributing to the malignancy of GBM \u003csup\u003e[12]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eHowever, whether miR-129-5p can target CaMK IV through the MAPK signaling pathway in gliomas remained unknown. This study aimed to investigate the expression of CaMK IV in GBM, as well as its specific effects on malignant phenotypes such as proliferation, invasion, and migration in GBM cells. We also aimed to verify the interaction between miR-129-5p and CaMK IV and explore the molecular mechanisms underlying their effects.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Bioinformatics analysis of GBM-related differentially expressed mRNAs\u003c/h2\u003e \u003cp\u003eThe TCGA and GTEx databases were used to download GBM and normal brain tissue sample data, with logFC\u0026thinsp;\u0026gt;\u0026thinsp;2.0 or logFC\u0026lt;-2.0 as the threshold for screening DEGs. Moreover, a cluster heatmap was generated to better distinguish these genes. The DEGs in normal brain tissue and GBM tissue were screened using edgeR kits and analyzed by a cluster Heatmap to better distinguish these genes. Then, GO and KEGG enrichment analyses were performed to determine the key action targets and signaling pathways of the genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Culture of cells\u003c/h2\u003e \u003cp\u003eThe human GBM cell line U87 was purchased from Shanghai Enzyme Research Biotechnology Co., Ltd. The cells were subsequently cultured in DMEM (Beijing Solaibao Technology Co., Ltd, China) supplemented with 15% FBS (BI Biotechnology Co., Israel) and 1% penicillin-streptomycin solution (Shanghai Biyuntian Biotechnology Co., Ltd, China) in a 5% CO2 incubator (Sanyo Corporation of Japan) at 37\u0026deg;C. On the day before transfection, U87 GBM cells were digested with pancreatic enzymes (Shanghai Biyuntian Biotechnology Co., Ltd, China) and counted on cell counting plates. The cell suspension was 1\u0026times;105 cells. The cells were inoculated in 6-well plates, cultured, and then incubated in serum-free medium 12 hours before transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.3 cell transfection\u003c/h2\u003e \u003cp\u003eFirst, dissolved 4 \u0026micro;g of the CaMK IV overexpression plasmi(Sangon Bioengineering (Shanghai) Co., Ltd, China) and LipoHigh transfection reaget ༈Sangon Bioengineering (Shanghai) Co., Ltd, China)were dissolved in 250\u0026micro;L of cell culture medium and left to stand for 20 minutes. The mixture was subsequently added dropwise to the seeded cells, which were later incubated in a CO2 incubator for 4\u0026ndash;8 hours. The medium was replaced with fresh culture medium, and the cells were incubated for another 24 hours. Next, diluted CaMK IV siRNA (1\u0026ndash;3)༈Sangon Bioengineering (Shanghai) Co., Ltd, China༉, miR-NC, miR-129-5p mimic༈Guangzhou RiboBiotechnology Co., Ltd, China༉, and inhibitor ༈Guangzhou RiboBiotechnology Co., Ltd, China༉with 30 \u0026micro;L of 1\u0026times; riboFECTTM CP Buffer༈Guangzhou RiboBiotechnology Co., Ltd, China), mixed Seperately, and added riboFECTTM CP ReagentGuangzhou RiboBiotechnology Co., Ltd, China༉to the mixture. The mixture was stand for 10 minutes before it was added to the serum-free culture medium. Finally, the sells were transfered to a well plate and incubated for 24 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.4 RNA extraction from brain tissue samples and U87 cells\u003c/h2\u003e \u003cp\u003eAfter passing the ethical review of the Medical Ethics Committee of Hongqi Hospital Affiliated to Mudanjiang Medical University and providing informed consent, the primary GBM from the patients diagnosed by pathologists and the normal brain tissue specimens near the tumors were surgically removed, for a total of 4 patients each. The requirements for specimen collection were as follows: ① Patients who had not received preoperative chemoradiotherapy; ② Patients were histologically diagnosed independently by more than two pathologists; and all tissue samples were immediately frozen in liquid nitrogen and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. RNA was extracted using an AXYgen RNA Extraction Kit (Axygen Biotechnology Co., Ltd, China), according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.5 Verification of the expression of CaMK IV and miR-129-5p in clinical tissues and U87 cells was via qRT-PCR.\u003c/b\u003e \u003c/p\u003e \u003cp\u003emRNA and miRNA qRT-PCR were completed by an Applied Biosystems 7500 quantitative PCR instrument (ABI Company in the United States) using a Xinbei 2xS6 Universal SYBR qPCR Mix Kit and a 2xS6 miRNA SYBR qPCR Mix Kit, respectively.U6 was used as an internal reference for miRNA, whereas GAPDH was used as a reference for mRNA. All primers used were obtained from Guangzhou RiboBiotechnology Co., Ltd (Guangzhou, China) and were listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The formula 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCT was used to determine the miR-129-5p and mRNA expression levels. All the reactions were repeated for three times.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequences of primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence(5 \u0026rsquo;-3 \u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR- 129-5p-forword\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGGCTTTTTGCGGTCTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR- 129-5p-reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGCAGGGTCCGAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6-forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCGCTTCGGCAGCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eU6-reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACGCTTCACGAATTTGCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCAMK IV-forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATCATATGCTCAAAGTCACGGTGCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCAMK IV-reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACATCTCGAGTTAGTACTCTGGCAGGATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACGACCCCTTCATTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCACGACATACTCAGCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Cell protein extraction and Western blot analysis\u003c/h2\u003e \u003cp\u003eThe tissues and cells were lysed using the RIPA buffer (Beijing Solaibao Technology Co., Ltd, China), and the supernatant was collected and stored. The protein concentration was measured using a microplate spectrophotometer (Thermo Scientific Co., USA). Gel electrophoresis was performed using the a 10% SDS-PAGE Colored Gel Rapid Preparation Kit (Shanghai Yaenzyme Biomedical Technology Co., Ltd,China). Transblotting was carried out on PVDF membranes (Thermo Fisher Scientific Co., USA). The membranes were then blocked with 5% skim milk at room temperature for 2 hours. The following primary antibodies were used: BAX polyclonal antibody (Wuhan Sanying Biotechnology Co., Ltd, China); BCL2 polyclonal antibody (Wuhan Sanying Biotechnology Co., Ltd, China); Caspase 3 (Active) rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); Ki67 rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); phospho-JNK1/2 (Thr183/Tyr185) rabbit polyclonal antibody(Shanghai Biotech Biotechnology Co., Ltd, China); p38 MAPK rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); JNK1\u0026thinsp;+\u0026thinsp;JNK2\u0026thinsp;+\u0026thinsp;JNK3 rabbit monoclonal antibody (Shanghai Biotech Biotechnology Co., Ltd, China); Phospho-p38 MAPK (Thr180/Tyr182) Rab-Biotechnology Co., Ltd, China); and mouse anti-β actin mAb (Zhongshan Golden Bridge Biotechnology Co., Ltd, China). The secondary antibodies used were Goat anti-rabbit IgG/horseradish peroxidase-labeled antibody and sheep anti-mouse IgG/horseradish peroxidase-labeled antibody, both of which were purchased from Shanghai Biotech Biotechnology Co., Ltd. The membranes were visualized using an enhanced chemiluminescence (ECL) system and scanned using a fully automated chemiluminescence imaging system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 CCK-8 detection\u003c/h2\u003e \u003cp\u003eCell viability was assessed using a CCK-8 assay kit (White Shark Biological Technology Co., Ltd, China). Cells (3000 cells) were seeded into a 96-well plate and incubated with 10\u0026micro;L of CCK-8 solution for 0, 24, 48, or 72 hours. The optical density (OD) at 490 nm was measured using a microplate reader (Molecular Devices, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Transwell experiments.\u003c/h2\u003e \u003cp\u003eAfter thawing, 60 \u0026micro;L of Matrigel matrix gel (Shanghai Bangjing Industrial Co., Ltd., China) was added to each well (24-well plate), followed by the addition of 3000 cells per well. The cells were cultured for 24 hours. Subsequently, the cells were fixed with 4% paraformaldehyde, permeabilized with methanol, and stained with crystal violet for fixation. Finally, an inverted microscope (Nikon Co., Japan)was used for observation, and the experiment was repeated three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Cell scratch experiment\u003c/h2\u003e \u003cp\u003eThe cells were cultured in a six-well plate. After a 1cm scratch was created on the surface using a 10 \u0026micro;L pipette, the original culture medium was aspirated. The scratch was then observed at 0, 12, and 24 hours, after which images were taken. Finally, the scratch area was calculated using ImageJ to analyze the healing progress. Differences in the healed scratch area were observed to assess cell migration ability.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Statistical methods\u003c/h2\u003e \u003cp\u003eImageJ was used for image processing, and the results were analyzed of the results was performed using SPSS 26.0. The experimental data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. A t test was used for comparisons between two groups, while a repeated measures analysis of variance was used for comparisons between multiple groups. A significance level of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was used to indicate statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1 Analysis of public data indicated that the expression level of CaMK IV in GBM tissues was lower than that in normal tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst, to determine the differences in mRNAexpression between GBM tissue and normal brain tissue, 168 GBM tissue samples and 1152 GBM tissue samples, as well as 5 normal tissue samples in the TCGA and related data, were downloaded from the TCGA and GTEx databases, respectively, to analyze the prognostic significance of the differentially expressed mRNAs in GBM. With logFC\u0026thinsp;\u0026gt;\u0026thinsp;2.0 or logFC\u0026lt;-2.0 as the threshold, the edgeR package was used to screen the DEGs and CaMK IV was screened out; the genes were analyzed via a cluster Heatmap to better distinguish these genes(Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). Subsequently, KEGG analysis revealed CaMK IV was directly involved in the occurrence and development of GBM through the Ca2\u0026thinsp;+\u0026thinsp;signaling pathway and MAPK signaling pathway(Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB and C). GO enrichment analysis was conducted to explore the key action targets of CaMK IV(Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD). CaMK IV was mainly enriched in the \u0026ldquo;signal transduction\u0026rdquo;, \u0026ldquo;gene expression\u0026rdquo;, \u0026ldquo;cell proliferation\u0026rdquo; and other functions, and was found to be related to GBM. In addition, survival analysis using a survival kit also revealed that the survival rate of the group with high CaMK IV expression was significantly greater than that of the group with low CaMK IV expression(Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). the relationship between CaMK IV expression and the clinical characteristics of GBM patients was validated via the GEPIA 2 and KM Plotter databases. In the GEPIA 2 database, high CaMK IV was associated with improved OS in GBM patients (Hazard Ritio (HR)\u0026thinsp;=\u0026thinsp;1.5, log-rank test\u0026thinsp;=\u0026thinsp;0.022)(Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). The KM Plotter database also showed that high CaMK IV expression was associated with improved OS [HR\u0026thinsp;=\u0026thinsp;0.81(0.71\u0026thinsp;\u0026minus;\u0026thinsp;0.94), log-rankP\u0026thinsp;=\u0026thinsp;0.0037) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003cp\u003e3.2 Low expression of CaMK IV in GBM tissues was detected in clinical tissue samples\u003c/p\u003e\n \u003cp\u003eGBM tissues were obtained from 4 postoperative patients at the Department of Neurosurgery, Hongqi Hospital Affiliated to Mudanjiang Medical University, as well as from 4 cases with normal brain tissue adjacent to the tumor. Total RNA was extracted, and CaMK IV expression was detected via qRT-PCR. The results showed that the expression level of CaMK IV in GBM patients was significantly lower than that in the control group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)(Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003cp\u003e3.3 Transfection efficiency of U87 cells was measured by qRT-PCR\u003c/p\u003e\n \u003cp\u003eTo analyze the effect of CaMK IV on U87 cells, CaMK IV overexpression and siCaMK IV transient transfection cell lines were constructed, and named as the blank control group, NC group, CaMK IV overexpression group, and siCaMK IV (1\u0026ndash;3) groups. qRT-PCR was performed to validate the knockdown efficiency of siCaMK IV in U87 cells, and it was found that all three different transient transfection regimens effectively reduced the expression of CaMK IV mRNA in U87 cell lines, with siCaMK IV 2 being the most effective(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e\n \u003cp\u003eTo further validate the effect of miR-129-5p on U87 cells, miR-129-5p mimics and inhibitor cell lines were constructed, and named as the blank control group, miR-NC group, miR-129-5p mimics group, and miR-129-5p inhibitor group. qRT-PCR was performed to verify the transfection efficiency of miR-129-5p, and the results showed that the expression level of miR-129-5p in U87 cells in the miR-129-5p mimics group was significantly greater than that in the miR-NC group, while the opposite trends in the miR-129-5p inhibitor group(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003cp\u003e3.4 CaMK IV expression was detected in U87 cells after transfection\u003c/p\u003e\n \u003cp\u003eWestern blot analysis was performed to detect the expression levels of CaMK IV in each transfected group. The results showed that the level of CaMK IV in the CaMK IV overexpression group was significantly greater than that in the blank control group, while the opposite effect was observed in the siCaMK IV group(Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eD-E). In the miR-129-5p mimic group, the expression level of CaMK IV was significantly greater than that in the control group, whereas in the miR-129-5p inhibitor group, the expression level of CaMK IV was significantly lower than that in the control group(Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eF-G).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003cp\u003e3.5 MiR-129-5p and CaMK IV inhibited proliferation in GBM cells\u003c/p\u003e\n \u003cp\u003eTo investigate the effects of miR-129-5p and CaMK IV on glioblastoma cell proliferation, CCK-8 assays were performed. The results revealed that the OD values of U87 cells in the blank control group and NC-transfected group were similar, indicating comparable growth states. However, the OD of the miR-129-5p mimic group and CaMK IV overexpression group were lower than those of the blank control group and NC group, suggesting that CaMK IV and miR-129-5p suppress the growth of U87 cells and significantly decrease cell viability(Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA and B).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003cp\u003e3.6 CaMK IV inhibited invasion and migration of U87 cells\u003c/p\u003e\n \u003cp\u003eA cell scratch experiment was performed to investigate the effect of CaMK IV on the migration ability of the GBM cell. the scratch area in the CaMK IV overexpression group was larger than that in the control group, and the cell invasion rate was significantly lower, indicating that CaMK IV significantly inhibited the migration of U87 cells(Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC and D-E). In addition, Transwell experiments were conducted to validate the effect of CaMK IV on the invasion of U87 cells. The results revealed no significant difference in cell number between the control group and the NC group, while the cell number in the CaMK IV overexpression group was significantly lower than that in the control group and the NC group, with the opposite result observed in the siCaMK IV group. CaMK IV overexpression significantly decreased the invasion ability of U87 GBM cells(Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA-B).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003cp\u003e3.7 CaMK IV inhibits proliferation and inhibits apoptosis-related proteins\u003c/p\u003e\n \u003cp\u003eTo analyze the antiproliferation and proapoptosis effects of CaMK IV, Western blotting was performed to detect the expression of proliferation-related proteins and apoptosis-related proteins. The results showed that in U87 cells, the overexpression of CaMK IV significantly decreased the expression of Ki-67 and Bcl-2 compared to that in the blank control group and the negative control group. Conversely, the expression of active caspase-3 and BAX was significantly greater in the treated group than in the blank control group and the negative control group. The opposite results were obtained in the siCaMK IV group(Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA-B).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003cp\u003e3.8 CaMK IV inhibits MAPK phosphorylation and exerts a cancer-inhibiting effect\u003c/p\u003e\n \u003cp\u003eIn addition, this study analyzed the mechanism by which CaMK IV exerts its anticancer effects on GBM and conducted Western blot experiments to detect the phosphorylation levels of MAPK signaling pathway proteins in cells. In U87 cells, the phosphorylation levels of p38 and JNK were significantly lower in the CaMK IV group than in the control group and the negative control group. The overexpression of CaMK IV inhibited the phosphorylation of proteins in the MAPK pathway(Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC-D). This findings validated that the inhibitory effect of CaMK IV on GBM is achieved through the MAPK signaling pathway.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eGBM represents the most prevalent histological subtype of glioma observed in adult patients, with a median survival time of 12 months\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e3]\u003c/sup\u003e. Despite being relatively rare, GBM has high mortality and incidence rates. Genomic analysis of GBM has also produced new evidence regarding risk and prognosis \u003csup\u003e[\u003c/sup\u003e\u003csup\u003e14\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e15\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Despite the continuous development of emerging medical technologies and the clinical application of chemotherapeutic\u0026nbsp;drugs such as temozolomide for GBM, the prognosis for GBM patients remains poor due to\u0026nbsp;the\u0026nbsp;highly invasive and rapidly progressing nature\u0026nbsp;of GBM. Therefore, targeted gene therapy has gradually become a new treatment modality for GBM at this stage \u003csup\u003e[\u003c/sup\u003e\u003csup\u003e16\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eMoreover,\u0026nbsp;mRNAs\u0026nbsp;can serve as a molecular biomarkers\u0026nbsp;for\u0026nbsp;the\u0026nbsp;early diagnosis and treatment of tumors, as well as\u0026nbsp;for\u0026nbsp;predicting patient prognosis and providing potential therapeutic targets. Currently, the pathogenesis of GBM is not fully understood. Therefore,\u0026nbsp;in\u0026nbsp;this study,bioinformatics analysis\u0026nbsp;of data extracted\u0026nbsp;from the TCGA and GTEx databases found that CaMK IV was significantly downregulated in GBM. Enrichment analysis and survival analysis results\u0026nbsp;indicated\u0026nbsp;that CaMK IV and others are important tumor suppressor factors. After reviewing relevant literature in recent years,\u0026nbsp;we\u0026nbsp;ultimately selected\u0026nbsp;CaMK IV. Additionally, CaMK IV is highly expressed in various normal tissues in the human body, especially in brain tissue. Therefore, it is inferred that the low expression of CaMK IV in GBM may be one of the reasons for malignant proliferation. In human cells, under the action of CaMK IV, Ser/Thr kinase residues of Ca2+ signaling-related proteins are phosphorylated and activated,\u0026nbsp;where they\u0026nbsp;exert\u0026nbsp;their functions. In addition, this study predicted through bioinformatics analysis,we predicted that\u0026nbsp;miR-129-5p\u0026nbsp;expression\u0026nbsp;is downregulated in GBM, and\u0026nbsp;that\u0026nbsp;its low expression significantly promotes tumor biological activity, facilitating tumor development. This effect may be achieved through targeting CaMK IV. Therefore, U87 cells were transfected with miR-129-5p mimics and inhibitors to verify the proliferative activity of\u0026nbsp;the\u0026nbsp;transfected U87 cells. CCK-8\u0026nbsp;assays\u0026nbsp;showed that the overexpression of miR-129-5p significantly inhibited the proliferation ability of U87 cells, indicating that miR-129-5p has\u0026nbsp;a\u0026nbsp;significant tumor-suppressive\u0026nbsp;effect. The tumor\u0026nbsp;suppressive effect of miR-129-5p is consistent with\u0026nbsp;the findings of\u0026nbsp;previous\u0026nbsp;studies. Feng et al \u003csup\u003e[\u003c/sup\u003e\u003csup\u003e17\u003c/sup\u003e\u003csup\u003e]\u0026nbsp;\u003c/sup\u003ereported\u0026nbsp;that miR-129-5p can inhibit the proliferation of gastric cancer cells by downregulating the expression of HMGB1. Similar experimental results were also observed in the study by Yan et al\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e18\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e,\u0026nbsp;who\u0026nbsp;demonstrated\u0026nbsp;that miR-129-5p inhibits the activity, proliferation, mitosis, migration, and invasion of gastric cancer cells by specifically inhibiting the expression of SPOCK1.\u003c/p\u003e\n\u003cp\u003eThis study used bioinformatics analysis to predict a potential targeting relationship between miR-129-5p and CaMK IV in GBM, suggesting that\u0026nbsp;they\u0026nbsp;may work together to exert tumor-suppressive effects. Subsequently, U87 cells were transfected with miR-129-5p mimics and inhibitors, and Western Blotting\u0026nbsp;was performed to detect the protein expression level of CaMK IV to validate the correlation between miR-129-5p and CaMK IV. The results showed that the expression of CaMK IV increased in U87 cells transfected with miR-129-5p mimics, indicating that the inhibitory effect of miR-129-5p\u0026nbsp;on\u0026nbsp;U87 cells may be achieved through targeting CaMK IV. Both miR-129-5p and CaMK IV act as tumor suppressor genes in GBM, consistent with previous bioinformatics predictions. Additionally, Li et al \u003csup\u003e[1\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e validated the targeting relationship between miR-129-5p and CaMK IV in hepatocellular carcinoma. The team conducted dual luciferase reporter assays to analyze the interaction between miR-129-5p and CaMK IV, confirming the targeting relationship between them. The team also performed in vitro experiments to verify the tumor-suppressive roles of miR-129-5p and CaMK IV in hepatocellular carcinoma, which is consistent with the results of this study. In conclusion, miR-129-5p and CaMK IV have synergistic targeting\u0026nbsp;effects on\u0026nbsp;GBM,\u0026nbsp;and\u0026nbsp;both play a role in inhibiting the occurrence and development of GBM. Further exploration of the biological mechanisms underlying their synergistic relationship is warranted.\u003c/p\u003e\n\u003cp\u003eTo further explore the inhibitory effect of CaMK IV on GBM, GBM U87 cell lines with CaMK IV overexpression\u0026nbsp;or\u0026nbsp;knockdown were constructed for subsequent studies. After transfection,\u0026nbsp;a\u0026nbsp;CCK-8 assay was performed to validate\u0026nbsp;the\u0026nbsp;cell proliferation activity. The results showed that CaMK IV overexpression weakened the proliferation ability of U87 GBM cells, while CaMK IV knockdown enhanced cell proliferation. These findings\u0026nbsp;indicate that CaMK IV has a significant inhibitory effect on GBM cells.\u003c/p\u003e\n\u003cp\u003eNext, cell scratch and Transwell assays\u0026nbsp;were performed to validate the impact of CaMK IV on\u0026nbsp;GBM\u0026nbsp;cell migration and invasion.\u0026nbsp;The results showed that there was no significant difference in the scratch area between the CaMK IV overexpression group and the control group at 12 hours, but at 24 hours, the scratch area of the CaMK IV overexpression group was significantly larger than that of the control group.\u0026nbsp;However, in the CaMK IV knockdown group, the scratch area was significantly smaller than that\u0026nbsp;in\u0026nbsp;the control group at both 12 and 24 hours, indicating that CaMK IV significantly\u0026nbsp;inhibited\u0026nbsp;the migration of GBM cell lines.\u003c/p\u003e\n\u003cp\u003eAccording to\u0026nbsp;the Transwell assay, the number of cells\u0026nbsp;that\u0026nbsp;passed\u0026nbsp;through the chamber was lower in the CaMK IV overexpression group\u0026nbsp;than in\u0026nbsp;the control group, while the CaMK IV knockdown group had a significantly\u0026nbsp;greater\u0026nbsp;number of cells\u0026nbsp;that passed\u0026nbsp;through the chamber than\u0026nbsp;did\u0026nbsp;the control group.\u0026nbsp;These findings\u0026nbsp;also suggested\u0026nbsp;that CaMK IV has a clear inhibitory effect on the invasive ability of\u0026nbsp;the\u0026nbsp;GBM cell line U87.\u0026nbsp;Migration and invasion\u0026nbsp;were\u0026nbsp;important characteristics of tumor cells,\u0026nbsp;and\u0026nbsp;directly contributed\u0026nbsp;to distant metastasis and peritumoral invasion.\u003c/p\u003e\n\u003cp\u003eNext, Western blot analysis was performed to examine the effect of CaMK IV on the proliferation and apoptosis ability of GBM cell lines, and the expression levels of apoptosis-related proteins were detected. The results showed that the expression levels of\u0026nbsp;the\u0026nbsp;proapoptotic proteins caspase-3 and BAX were significantly\u0026nbsp;greater\u0026nbsp;in the CaMK IV overexpression group\u0026nbsp;than in\u0026nbsp;the control group, while the expression levels of\u0026nbsp;the\u0026nbsp;antiapoptotic protein Bcl-2 and\u0026nbsp;the\u0026nbsp;proliferation protein Ki67 were decreased in the CaMK IV overexpression group. Conversely, CaMK IV\u0026nbsp;knockdown\u0026nbsp;had the\u0026nbsp;opposite\u0026nbsp;effect. Ki67 is closely associated with cell mitosis, and higher levels of Ki67 contribute to more active cell proliferation and poorer tissue differentiation. Additionally, Bcl-2 and BAX are representative apoptosis-related proteins in this family, with Bcl-2 being an antiapoptotic protein and BAX being a proapoptotic protein. Some studies suggest that the ratio of Bcl-2 to BAX after apoptotic stimulation determines cell survival or death \u003csup\u003e[\u003c/sup\u003e\u003csup\u003e20\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e21\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Caspases, including cysteine aspartate-specific proteinases (caspases), are key mediators of cellular apoptosis. Caspase-3 is\u0026nbsp;an\u0026nbsp;activated protease in the mitochondrial-dependent apoptotic pathway, and its activation is triggered by the release of\u0026nbsp;cytochrome C after mitochondrial membrane permeabilization. Activated Caspase-3 catalyzes the specific cleavage of many key cellular proteins and acts as an executor of cell apoptosis \u003csup\u003e[\u003c/sup\u003e\u003csup\u003e22\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. These results suggest that CaMK IV can significantly promote apoptosis, inhibit cell proliferation, and suppress tumor occurrence and development in GBM cell lines.\u003c/p\u003e\n\u003cp\u003eTo further validate how CaMK IV exerts its inhibitory effect on GBM, Western blot experiments were conducted to detect the phosphorylation levels of MAPK signaling pathway proteins in cells. The overexpression and activation of MAPK pathway-related proteins are\u0026nbsp;two\u0026nbsp;of the main mechanisms by which tumor cells resist apoptosis. The MAPK signaling pathway is a cascade process involving three kinases, with the most upstream kinase (MAPKKK) responding to various extracellular and intracellular signals and activating intermediate kinases (MAPKKs) through direct phosphorylation\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e23\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e24\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. MAPKKs specifically phosphorylate and activate MAPK, which usually has many substrates that execute specific cell fate decisions in response to input signals. There are three major families of MAPKs: extracellular signal-regulated kinases (EKs), c-Jun N-terminal kinases (JNKs), and stress-activated protein kinases (p38/SAPKs). JNK mainly responds to stress such as ionizing radiation and oxidative stress, and is involved in cell apoptosis, cytokine production, inflammation, and metabolism\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e25\u003c/sup\u003e\u003csup\u003e,\u003c/sup\u003e\u003csup\u003e26\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. p38 MAPK is strongly activated by cytokines and cellular stress, and activation of the p38 MAPK pathway contributes to inflammation, cell apoptosis, cell differentiation, and cell cycle regulation\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e27\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Behzad et al.\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e28\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003ereported\u0026nbsp;that HMGA2 activates signaling through the MAPK pathway, affecting different DNA repair mechanisms and promoting epithelial-to-mesenchymal transition. In addition, HMGA2 supports cancer stem cell phenotypes and confers chemoresistance to cancer cells. Fan et al.\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e29\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003ecovered\u0026nbsp;that cell apoptosis and autophagy mediated by\u0026nbsp;bruceine D were significantly inhibited in cells pretreated with the intracellular reactive oxygen species scavenger N-acetylcysteine (NAC),\u0026nbsp;and this change was\u0026nbsp;accompanied by activation of the MAPK signaling pathway. Bruceine D inhibited\u0026nbsp;cell proliferation in non-small cell lung cancer tissues, and NAC eliminated\u0026nbsp;the upregulation of p-ERK and p-JNK. The results of this study indicate that miR-129-5p can inhibit the proliferation of GBM cells and promote cell apoptosis by directly targeting CaMK IV and inhibiting the activation of the MAPK pathway.\u0026nbsp;These findings\u0026nbsp;suggested\u0026nbsp;that CaMK IV may be a better target for potential anti-GBM drugs.\u003c/p\u003e\n\u003cp\u003eResearch on CaMK IV has focused mainly on its role in\u0026nbsp;maintaining\u0026nbsp;neuronal integrity, while its function in tumors has been relatively understudied. A small amount of literature suggests that CaMK IV has tumor-suppressive effects and can inhibit cell proliferation while promoting apoptosis. CaMK IV can inhibit the proliferation of HepG2 and neuroblastoma cells (SH-SY5Y) by binding with coumarin to increase its activity \u003csup\u003e[\u003c/sup\u003e\u003csup\u003e30\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Lin et al \u003csup\u003e[\u003c/sup\u003e\u003csup\u003e31\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e suggested that CaMK IV is an important regulatory factor in liver cancer. In hepatocellular carcinoma, CaMKK2 is necessary for maintaining S6K/S6 phosphorylation and optimal protein translation, while the loss of CaMK IV has the most significant inhibitory effect on protein synthesis. Its downregulation significantly reduces the activity of S6K/S6. The CaMKK2 signaling pathway selectively controls protein translation in liver cancer cells through CaMK IV. However, some studies suggest that the knockdown of CaMK IV has a relatively insignificant promoting effect on hepatocellular carcinoma cell lines, which contradicts the results of Lin et al. This may be due to the relatively low expression of CaMK IV in normal liver tissue and even lower expression in liver cancer cells, and the artificial knockout of CaMK IV in transfection experiments may have led to relatively insignificant results.\u003c/p\u003e\n\u003cp\u003eSummary,molecular targeted therapy for GBM aims to target tumor driver genes, precisely and specifically inhibiting or even killing tumor cells. This approach can provide significant therapeutic effects and fewer adverse reactions for molecular targeted therapy of tumors, with the hope of providing better treatment strategies and improving patient prognosis. This study has certain limitations. First, after in vitro experiments, further in vivo experiments are needed to validate the inhibitory effect of CaMK IV on GBM tumors. Second, cotransfection of miR-129-5p and CaMK IV should be conducted to verify the relationship between miR-129-5p and CaMK IV and their effects on GBM. This study verified the inhibitory effect of CaMK IV on GBM through bioinformatics analysis and subsequent CaMK IV knockout and overexpression, providing certain value for the molecular targeted therapy for GBM and \u0026quot;precision medicine\u0026quot;.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eHG and DL designed the study. HG and TY wrote the manuscript. LJ analyzed the data. FZ, WW,QZ and BL prepared the images and tables. DL reviewed and revised the manuscript. All the authors approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLe Rhun E, Preusser M, Roth P, et al. Molecular targeted therapy of glioblastoma[J]. Cancer Treat Rev, 2019, 80-96.\u003c/li\u003e\n\u003cli\u003eOu A, Yung WKA, Majd N. Molecular Mechanisms of Treatment Resistance in Glioblastoma[J]. Int J Mol Sci, 2020, 22(1).\u003c/li\u003e\n\u003cli\u003eLah TT, Novak M, Breznik B. Brain malignancies: Glioblastoma and brain metastases[J]. Semin Cancer Biol, 2020,60,262-273.\u003c/li\u003e\n\u003cli\u003eGimple RC, Bhargava S, Dixit D, et al. Glioblastoma stem cells: lessons from the tumor hierarchy in a lethal cancer[J]. Genes Dev, 2019, 33(11-12): 591-609.\u003c/li\u003e\n\u003cli\u003eAli Syeda Z, Langden SSS, Munkhzul C, et al. Regulatory Mechanism of MicroRNA Expression in Cancer[J]. Int J Mol Sci, 2020, 21(5).\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;akmak HA, Demir M. MicroRNA and Cardiovascular Diseases[J]. Balkan Med J, 2020, 37(2): 60-71.\u003c/li\u003e\n\u003cli\u003eAbo-Al-Ela HG, Faggio C. MicroRNA-mediated stress response in bivalve species[J]. Ecotoxicol Environ Saf, 2021, 208-222.\u003c/li\u003e\n\u003cli\u003eDeng B, Tang X, Wang Y. Role of microRNA-129 in cancer and noncancerous diseases (Review)[J]. Exp Ther Med, 2021, 22(3): 918.\u003c/li\u003e\n\u003cli\u003eNaz H, Islam A, Ahmad F, et al. Calcium/calmodulin-dependent protein kinase IV: A multifunctional enzyme and potential therapeutic target[J]. Prog Biophys Mol Biol, 2016, 121(1): 54-65.\u003c/li\u003e\n\u003cli\u003eFujisawa H. Regulation of the activities of multifunctional Ca2+/calmodulin-dependent protein kinases[J]. J Biochem, 2001, 129(2): 193-199.\u003c/li\u003e\n\u003cli\u003ePersaud SJ, Liu B, Sampaio HB, et al. Calcium/calmodulin-dependent kinase IV controls glucose-induced Irs2 expression in mouse beta cells via activation of cAMP response element-binding protein[J]. Diabetologia, 2011, 54(5): 1109-1120.\u003c/li\u003e\n\u003cli\u003eJiang K, Yao G, Hu L, et al. MOB2 suppresses GBM cell migration and invasion via regulation of FAK/Akt and cAMP/PKA signaling[J]. Cell Death Dis, 2020, 11(4): 230.\u003c/li\u003e\n\u003cli\u003eWitthayanuwat S, Pesee M, Supaadirek C, et al. Survival Analysis of Glioblastoma Multiforme[J]. Asian Pac J Cancer Prev. 2018 Sep 26;19(9):2613-2617. \u003c/li\u003e\n\u003cli\u003eTom MC, Cahill DP, Buckner JC, et al. Management for Different Glioma Subtypes: Are All Low-Grade Gliomas Created Equal?[J]. Am Soc Clin Oncol Educ Book, 2019, 39,133-145.\u003c/li\u003e\n\u003cli\u003eTsitlakidis A, Aifantis EC, Kritis A, et al. Mechanical properties of human glioma[J]. Neurol Res, 2020, 42(12): 1018-1026.\u003c/li\u003e\n\u003cli\u003eWang TJC, Mehta MP. Low-Grade Glioma Radiotherapy Treatment and Trials[J]. Neurosurg Clin N Am, 2019, 30(1): 111-118.\u003c/li\u003e\n\u003cli\u003eFeng J, Guo J, Wang JP, et al. MiR-129-5p inhibits proliferation of gastric cancer cells through targeted inhibition on HMGB1 expression[J]. Eur Rev Med Pharmacol Sci. 2020 Apr;24(7):3665-3673.\u003c/li\u003e\n\u003cli\u003eYan L, Sun K, Liu Y, et al. MiR-129-5p influences the progression of gastric cancer cells through interacting with SPOCK1[J]. Tumor Biol. 2017 Jun;39(6):1010428317706916.\u003c/li\u003e\n\u003cli\u003eLi Z, Lu J, Zeng G, et al. MiR-129-5p inhibits liver cancer growth by targeting calcium calmodulin-dependent protein kinase IV (CAMK4)[J]. Cell Death Dis, 2019, 10(11): 789.\u003c/li\u003e\n\u003cli\u003eSpitz AZ, Gavathiotis E. Physiological and pharmacological modulation of BAX[J]. Trends Pharmacol Sci. 2022 Mar;43(3):206-220.\u003c/li\u003e\n\u003cli\u003eSun X, Kaufman PD. Ki-67: more than a proliferation marker[J]. Chromosoma. 2018 Jun;127(2):175-186. \u003c/li\u003e\n\u003cli\u003eJiang M, Qi L, Li L, Li Y. The caspase-3/GSDME signal pathway as a switch between apoptosis and pyroptosis in cancer[J]. Cell Death Discov. 2020 Oct 28;6:112. \u003c/li\u003e\n\u003cli\u003eYong HY, Koh MS, Moon A. The p38 MAPK inhibitors for the treatment of inflammatory diseases and cancer[J]. Expert Opin Investig Drugs, 2009, 18(12): 1893-1905.\u003c/li\u003e\n\u003cli\u003eZhang W, Liu HT. MAPK signal pathways in the regulation of cell proliferation in mammalian cells[J]. Cell Res, 2002, 12(1): 9-18.\u003c/li\u003e\n\u003cli\u003eHammouda MB, Ford AE, Liu Y, et al. The JNK Signaling Pathway in Inflammatory Skin Disorders and Cancer[J]. Cells, 2020, 9(4).\u003c/li\u003e\n\u003cli\u003eLi G, Qi W, Li X, et al. Recent Advances in c-Jun N-Terminal Kinase (JNK) Inhibitors[J]. Curr Med Chem, 2021, 28(3): 607-627.\u003c/li\u003e\n\u003cli\u003eCuadrado A, Nebreda AR. Mechanisms and functions of p38 MAPK signalling[J]. Biochem J, 2010, 429(3): 403-417.\u003c/li\u003e\n\u003cli\u003eMansoori B, Mohammadi A, Ditzel HJ, et al. HMGA2 as a Critical Regulator in Cancer Development[J]. Genes (Basel), 2021, 12(2).\u003c/li\u003e\n\u003cli\u003eFan J, Ren D, Wang J, et al. Bruceine D induces lung cancer cell apoptosis and autophagy via the ROS/MAPK signaling pathway in vitro and in vivo[J]. Cell Death Dis, 2020, 11(2): 126.\u003c/li\u003e\n\u003cli\u003eRakoczy K, Szlasa W, Saczko J, Kulbacka J. Therapeutic role of vanillin receptors in cancer[J]. Adv Clin Exp Med. 2021 Dec;30(12):1293-1301.\u003c/li\u003e\n\u003cli\u003eLin F, Marcelo KL, Rajapakshe K, et al. The camKK2/camKIV relay is an essential regulator of hepatic cancer[J]. Hepatology. 2015 Aug;62(2):505-20.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Glioblastoma, U87 cells, CaMK IV, miR-129-5p, Targeted therapy","lastPublishedDoi":"10.21203/rs.3.rs-3905658/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3905658/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eThe purpose was to investigate the expression of CaMK IV in glioblastoma (GBM) and its specific role in GBM cell proliferation, invasion, migration, and other malignant phenotypes. Furthermore, this study aimed to validate the functional relationship between miR-129-5p and CaMK IV, then explore the underlying molecular mechanisms involved.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eBioinformatics analysis revealed that CaMK IV was expressed at higher levels in normal brain tissues than in GBM tissues. qRT-PCR demonstrated significantly lower expression of CaMK IV in GBM cell samples than in the control tissue. CCK-8 assays indicated that overexpression of CaMK IV significantly inhibited the activity and proliferation of U87 GBM cells, while knockdown of CaMK IV had the opposite effect. Similarly, the introduction of miR-129-5p mimics inhibited the activity and proliferation of U87 GBM cells, while the use of a miR-129-5p inhibitor yielded the opposite results. The scratch assay revealed that, compared with control treatment, CaMK IV overexpression led to larger scratch areas at 12 and 24 hours, indicating that CaMK IV has an inhibitory effect on the migration ability of the GBM cell line U87. Conversely, knockdown of CaMK IV had the opposite effect. Moreover, Transwell assays demonstrated that the overexpression of CaMK IV resulted in significantly fewer penetrating cells than was observed in the control group, suggesting that CaMK IV has an inhibitory effect on the invasion ability of U87 GBM cells. Again, knockdown of CaMK IV yielded the opposite results. Western blot analysis revealed that the overexpression of CaMK IV significantly suppressed the expression of proliferation-related proteins while promoting the activity of apoptosis-related proteins in the U87 GBM cell line. Moreover, overexpression of CaMK IV inhibited the phosphorylation of the MAPK pathway-related proteins JNK and P38, indicating CaMK IV has an inhibitory effect on GBM cells via the MAPK signaling pathway.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eMiR-129-5p selectively inhibits the proliferation, migration, and invasion of U87 cells by targeting CaMK IV via the MAPK signaling pathway. MiR-129-5p and CaMK IV play an important inhibitory roles in GBM and may serve as potential therapeutic targets for GBM treatment.\u003c/p\u003e","manuscriptTitle":"MiR-129-5p inhibits the proliferation, migration, and invasion of U87 glioblastoma cells by targeting CaMK IV via the MAPK signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-07 09:19:48","doi":"10.21203/rs.3.rs-3905658/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7ff5401c-b52a-4092-82bc-3eb5f7d8b2d8","owner":[],"postedDate":"February 7th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-08T04:06:35+00:00","versionOfRecord":[],"versionCreatedAt":"2024-02-07 09:19:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3905658","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3905658","identity":"rs-3905658","version":["v1"]},"buildId":"rHA-KDH7Qsr4HCuvH75dn","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.