Polymyxin B Hemoadsorption efficiently removes Gram-Negative-derived Quorum Sensing molecules responsible for acute kidney tubular epithelial cell injury

preprint OA: closed
Full text JSON View at publisher
Full text 168,144 characters · extracted from preprint-html · click to expand
Polymyxin B Hemoadsorption efficiently removes Gram-Negative-derived Quorum Sensing molecules responsible for acute kidney tubular epithelial cell injury | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Polymyxin B Hemoadsorption efficiently removes Gram-Negative-derived Quorum Sensing molecules responsible for acute kidney tubular epithelial cell injury Davide Medica, Lucia Mirabella, Antonella Cotoia, Claudio Medana, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6032315/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background. Lipopolysaccharide (LPS) is the main driver of sepsis-associated Acute Kidney Injury (SA-AKI) in Gram-Negative infections and its removal by Polymyxin-B Hemoadsorption (PMX-HA) has been evaluated in clinical trials. Quorum Sensing (QS), diffusible signal molecules used by Gram-Positive and Gram-Negative bacteria for intercellular communication, can interact with eukaryotic cells. Study aims were to evaluate: 1) presence of QS molecules in blood and urine of septic patients and their clinical significance; 2) biological effects of QS on human tubular epithelial cells (TEC); 3) role of PMX-HA in reducing QS blood levels and consequently TEC injury. Methods. Thirty-one patients with endotoxemic shock treated by PMX-HA were enrolled. LC-MS was used to detect QS molecules in blood and urine and their concentrations were correlated with clinical data. The effects of QS on TEC in presence or absence of LPS were assessed by studying cytotoxicity (XTT), apoptosis (TUNEL), stress/injury biomarkers (TIMP-2, IGFBP-7, NGAL), ROS generation, mitochondrial dysfunction and cell polarity (TEER, ZO-1/megalin expression). Results. We found different QS molecules belonging to Acyl homoserine lactones (C4- and 3-oxo-C12-AHL) and Hydroxyquinolones (C7 HQ) in blood and urine of septic patients: C4-AHL was the most abundant QS family member. A correlation between QS concentrations and endotoxin activity, inflammatory biomarkers and organ dysfunction parameters (PaO 2 /FiO 2 , serum creatinine) was observed. PMX-HA decreased QS molecules in biofluids: these results were confirmed by ex-vivo hemoadsorption using a PMX-B-loaded minicartridge. In vitro studies on TEC showed that C4-AHL QS induced cytotoxicity, apoptosis, up-regulation of stress and damage biomarkers, ROS production and mitochondrial dysfunction. C4-AHL QS also induced earlier functional alterations of TEC such as loss of polarity and down-regulation of ZO-1 and megalin. The detrimental effects of C4-AHL QS on TEC were enhanced by the presence of LPS. The specificity of C4-AHL QS-induced TEC damage was confirmed by using supernatants derived from isogenic mutants of Pseudomonas aeruginosa not able to produce this molecule. Conclusions. The results of the present study suggested that PMX-HA could remove from blood QS molecules able to synergize with LPS in the triggering of functional alterations and apoptosis of TEC, key pathogenic mechanisms of SA-AKI. Acute Kidney Injury Sepsis Quorum Sensing Endotoxin Gram-Negative Bacteria Tubular Epithelial Cells Apoptosis Inflammation Cellular Senescence Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background In the complex clinical spectrum of Acute Kidney Injury (AKI) affecting critically ill patients admitted to Intensive Care Unit (ICU), sepsis still represents the most frequent cause of renal dysfunction [ 1 ]. As suggested by the 28th Acute Disease Quality Initiative (ADQI) workgroup, sepsis-associated AKI (SA-AKI) can be defined as the presence of a life-threatening organ failure caused by a dysregulated host response to infection (Sepsis-3 definition) [ 2 ] and the concomitant occurrence of an abrupt episode of renal dysfunction based on serum creatinine levels and urinary output in conformity with the KDIGO 2012 criteria [ 3 – 5 ]. Recent clinical observations evidenced that the survival of SA-AKI patients is strongly correlated with the recovery of renal function, Moreover, when compared to other causes of acute loss of renal function in ICU, SA-AKI leads to higher mortality rates, increased length of hospital stays and development of comorbidities including a faster progression toward Chronic Kidney Disease (CKD) [ 6 , 7 ]. Renal damage during sepsis cannot be simply ascribed to tissue hypoperfusion but also to biological mechanisms that are more immunologic in nature. Our group has previously demonstrated that septic plasma contains inflammatory and pro-apoptotic molecules able to induce a direct injury of Tubular Epithelial Cells (TEC) [ 8 ]. This is in accordance with the hypothesis that circulating Pathogen-Associated Molecular Pattern (PAMPs) and Damage-Associated Molecular Pattern (DAMPs) molecules can alter microcirculation and TEC metabolic functions, leading to acute damage and the development of early fibrosis distinctive of a maladaptive kidney repair process [ 9 ]. Among PAMPs, endotoxin (lipopolysaccharide-LPS) is the most studied molecule: higher LPS levels are correlated with a worse outcome and the development of severe multiple-organ failure [ 10 ]. In the kidney, LPS induces a direct cellular damage through the activation of TLR4 and an indirect injury through the enhanced production and release of inflammatory mediators able to bind to specific receptors on TEC surface triggering apoptotic cell death and a further inflammatory reaction [ 11 ]. For this reason, several clinical trials have been conducted with the aim to evaluate the removal of LPS by Polymyxin-B Hemoadsorption (PMX-HA), the most used extracorporeal blood purification therapy for this purpose and based on a veno-venous circuit in which blood comes in direct contact with a polymyxin B-immobilized polystyrene column: however, to date these studies have shown contradictory results [ 12 , 13 ]. Other bacterial fragments may have a role in the pathogenic mechanisms of SA-AKI. Quorum sensing (QS) molecules represent a biological system of transcriptional regulation dependent on cellular density used by both Gram-Negative and Gram-Positive bacteria for intercellular communication. The QS system is composed of a signal molecule (mainly an acylated homoserine lactone) able to diffuse from the cell of origin to the neighboring cells, triggering different metabolic pathways and cellular processes such as production of virulence factors, conjugation of plasmid transfer, bacterial growth, and biofilm formation [ 14 ]. Gram-Negative-derived QS molecules can be directly released by the infection source or by the gut following hypoperfusion-induced increase of permeability, thus reaching the bloodstream where they can interfere with different types of host tissues including kidney resident cells [ 15 ]. Our group has previously developed an analytical model based on liquid chromatography-mass spectrometry (LC-MS) for the detection and quantification of different QS molecules such as Acyl homoserine lactones (AHL) and Hydroxyquinolones (HQ) in biofluids [ 16 ]. The aims of this study were: 1) to confirm the presence of different QS molecules (AHL and HQ families) in blood and urine of septic patients and to investigate their clinical significance; 2) to evaluate the detrimental effects induced by QS on TEC in vitro and the potential interplay between QS and LPS; 3) to assess the role of PMX-HA in reducing QS blood levels and consequently TEC injury. Methods Patients and treatments This is a prospective, observational, and monocentric translational study designed to evaluate the presence of QS family members in biofluids of septic patients and the effectiveness of PMX-HA in removing these bacterial molecules from the bloodstream. All patients admitted to the ICU of the University of Foggia Academic Hospital were considered for enrollment in the study from April 2019 to February 2022. Local ethics committee approved the protocol and written informed consent was obtained from each patient or next of kin. A physician not involved in the study was always present for patient care. Inclusion criteria were: age > 18 years, diagnosis of septic shock (Sepsis-3 criteria [ 2 ] treatment with PMX-HA. Exclusion criteria were: patients younger than 18 years old, pregnant women, patients with confirmed hypersensitivity to PMX-B antibiotic. The following parameters were analyzed at ICU admission: demographic data, SOFA score, procalcitonin (PCT), AKI grading according to KDIGO 2012 criteria based on both serum creatinine and urinary output [ 3 ], WBC, RBC, platelet count and Endotoxin Activity (EA) (Spectral Medical Inc., Toronto, Canada) [ 13 ]. All patients were treated in accordance with the local clinical practice for the management of sepsis and multiple organ failures. Extracorporeal removal of LPS from whole blood was achieved by PMX-HA (Toraymyxin®, Toray Medical Co. Ltd., Tokyo, Japan). Briefly, PMX-HA was performed using a hemoadsorption module (Estorflow®, Estor, Pero, Italy) running at an average blood flow of 100 ml/min and using unfractionated heparin anticoagulation according to manufacturer’s protocol. A double-lumen dialysis catheter (12 French diameter) was inserted into a central vein and used as venous access. PMX-HA was performed twice, the second treatment 24 hours after the first one: each PMX-HA session lasted 2 hours. Blood and urine sample collection Plasma and urine samples were collected at different times as follows: T1: Baseline/Start of the first PMX-HA treatment; T2: End of the first PMX-HA treatment; T3: Start of the second PMX-HA treatment; T4: End of the second PMX-HA treatment. Plasma samples were obtained by two-step centrifugation (first step: 2000×g for 10 minutes; second step: 2500×g for 10 minutes). Urine samples were obtained from the bladder catheter, drawn from each patient with a 20 ml syringe and immediately transferred to sterile tubes. Supernatants were obtained by one-step urine centrifugation at 2500×g for 10 minutes. All biological samples were stored in a controlled cryocontainer at – 80°C until use. Chemicals and Liquid Chromatography-Mass Spectrometry (LC-MS) Analytical standards (purity > 98%) of N-butanoyl-L-homoserine lactone (C4-AHL), N-(3-oxododecanoyl)-L-homoserine lactone (3-oxo-C12-AHL) and 2-Heptyl-3-hydroxy-4(1H)-quinolone (C7 HQ) were purchased from Merck KGaA (Rome, Italy). Stock solutions were prepared with a concentration of 1000 mg/L using methanol and stored at -4°C until use. Further dilutions were obtained in 0.1% formic acid in water/acetonitrile 60:40. All aqueous solutions were prepared with HPLC-grade water from MilliQ System Academic (Millipore, Milan, Italy). Ethyl acetate for HPLC-MS grade, acetonitrile and methanol hyper grade for LC-MS, and formic acid were purchased from VWR International (Milan, Italy). Aliquoys of 200 µL plasma or urine were spiked with ND3 internal standard (IS) with a final concentration of 200 µg/L. Samples were then extracted twice with 1 mL of ethyl acetate. After the addition of organic solvent, each sample was centrifuged at 5000 g × 5 min RT and the organic fractions were collected and dried under a gentle stream of nitrogen heating at 40°C. Finally, the residue was reconstituted in 100 µL of 0.1% formic acid in water/acetonitrile 60:40. The chromatographic separations were run on a Phenomenex Luna C18 column, 150 × 2.0 mm, 3 µm particle size (Phenomenex, Bologna, Italy), thermostated at 45°C. The injection volume was 10 µL and flow rate 200 µL/min. A gradient mobile phase composition was adopted: 40:60 to 0:100 formic acid 0.1% in water/methanol in 19 min. A Shimadzu Nexera (Shimadzu, Kyoto, Japan) X2 UPLC coupled with a Sciex 5500 Q-trap mass spectrometer (Sciex, Framingham, MA, USA) equipped with a Turbo Ion Spray atmospheric pressure interface (ESI ion source) was used. The LC column effluent was delivered into the ion source using nitrogen as sheath and auxiliary gas. The ion source temperature was set at 500°C and the needle voltage at the 5.5 kV value. The acquisition method used was previously optimized in the tuning sections for the analyte ion (capillary, magnetic lenses and collimating multipoles voltages) in order to achieve the maximum of sensitivity. Spectra were acquired in the positive ion MRM mode [ 16 ]. Ex-vivo PMX-HA experimental model An experimental model of PMX-HA was developed ex-vivo to mimic the clinical setting using mini-cartridges containing PMX-B kindly provided by Toray Medical Co. Ltd. Briefly, the circuit was a closed loop hemoadsorption system with sampling sites before and after the PMX-B mini-cartridge. For the experimental purpose, whole blood was treated with 1 mg bacterial LPS for 4h in a water bath at 37°C and then overnight at room temperature [ 17 ]. The day after, blood was heparinized (5000 U), recalcified (calcium chloride 10%, 44 µl/ml blood) and diluted 1:1 with isotonic saline solution before the use for in vitro hemoadsorption. The next step was the addition of the QS molecules C4-AHL, 3-oxo-C12-AHL or C7 HQ in presence or absence of LPS: all chemicals were diluted in activated blood at a final concentration of 50 ng/ml. Circuit anticoagulation was performed with unfractioned heparin (2500U initial bolus and subsequent 1000U/hr). To fully simulate the clinical setting, ex vivo PMX-HA was performed for 2 hr with a blood flow rate (Qb) of 1 ml/min. Blood samples were collected at the start and at the end of PMX-HA and stored at − 80°C until LC-MS analysis as previously described. Bacterial cultures Two different Pseudomonas aeruginosa strains were used for bacterial cultures: wild-type PAO1 strain and its isogenic mutant RhlI defective in the synthesis of C4-AHL QS. All bacterial strains were cultured in Luria-Bertani (LB) broth enriched for nutrients. Bacterial media were prepared as previously described by Orlandi et al. [ 15 ] by centrifugation for 10 min at 12,000 rpm RT, and the supernatants were then collected and filtered using a Minisart RC15 0.20 mm (Sartorius, Gottingen, Germany). In vitro studies on human tubular epithelial cells (TECs) Human tubular epithelial cells (TECs) were isolated from kidneys removed by surgical procedures from patients affected by renal carcinomas and characterized as previously described [ 18 ] before the use for the following in vitro assays. Cytotoxicity TECs were cultured on 24-well plates (Falcon Labware, Oxnard, CA, USA) at a concentration of 5×10 4 cells/ well and incubated with different stimuli in the presence of 250 µg/ml XTT (Sigma, St. Louis, MO, USA) in a medium lacking phenol red. The absorption values at 450 nm were measured in an automated spectrophotometer at different time points. All experiments were performed in triplicate [ 18 , 19 ]. Apoptosis for detection of apoptosis by TUNEL assay, TECs were incubated with different stimuli, fixed with 4% paraformaldehyde, and then subjected to terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay (ApopTag, Oncor, Gaithersburg, MD, USA) that identifies DNA fragmentation, a typical feature of apoptotic cells. Green-stained apoptotic cells were counted in different microscopic fields at ×100 magnification. Each experiment was performed in triplicate and results are given as average number of apoptotic cells/field ± 1SD [ 18 , 19 ]. Quantitative RT-PCR for TIMP-2, IGFBP-7 and NGAL Total RNA was extracted by stimulated TEC using the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA).RNA yield and quality was determined using a NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, Delaware USA). Complementary cDNA was generated by reverse transcription of 2 µg of high quality total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The measurement of TIMP-2. IGFBP-7 and NGAL mRNA levels was performed by SYBR green qRT-PCR analysis using the ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) and SYBR FAST (Applied Biosystems, Foster City, CA). The following primers (Sigma Aldrich, St. Louis, Missouri) were used TIMP-2 forward: 5′CGTAGTGATCAGAGCCAAGC3′, TIMP-2 reverse: 5′TCTGCCTTTCCTGCAATTAGA3′; IGFBP-7 forward: 5′GAACAAGGTAAAAAGGGGTCAC3′; IGFBP-7 reverse: 5′ATGTAAGGCATCAACCACTGTA3′; NGAL forward: 5′GGAAAAAGAAGTGTGACTACTG3′, NGAL reverse: 5′GTAACTCTTAATGTTGCCCAG3′; GAPDH forward 5′ACAGTTGCCATGTAGACC3′, GAPDH reverse 5′TTTTTGGTTGAGCACAGG3′. Relative quantification was performed using the standard curve method. The results for the target gene expression were normalized on GAPDH as endogenous control, and the mean values of the vehicle were set as the calibrator. NGAL ELISA NGAL protein levels were also determined by ELISA in TEC supernatants in different experimental conditions (R&D Systems, Minneapolis, MN). Results were calculated after the generation of a standard curve with appropriate controls and given as average ± 1SD. Trans-epithelial electrical resistance (TEER) Trans-epithelial electrical resistance (TEER) was used as an indicator of TEC polarity. Cells were plated in transwells on collagen-coated polycarbonate membranes (Corning Costar Corp., Cambridge, MA, USA) and allowed to reach confluence before the addition of different stimuli. An epithelial volt-ohm meter (EVOM; World Precision Instruments, Inc., Sarasota, FL, USA) was used to determine TEER values as previously described [ 18 – 20 ]. All measures were performed in triplicate and normalized for the area of the membrane. Detection of FITC-conjugated albumin uptake by TEC : Albumin uptake was studied after incubation of TECs with different stimuli for 12 hrs and then with 50 mg/ml of FITC-conjugated human albumin (Sigma, St. Louis, MO, USA) at 37°C for 2 hrs: after FITC-albumin challenge, TEC were extensively washed twice with cold 1x PBS and analyzed by FACS [ 21 ]. Image-iT LIVE Green Reactive Oxygen Species (ROS) Detection Kit : Image-iT LIVE Green Reactive Oxygen Species (ROS) Detection Kit was used to analyze cellular oxidative stress as suggested by manufacturer (Life Technologies, Carlsbad, CA). Briefly, 5-(and-6)-carboxy-2',7'-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA) was added to TEC cultured in different experimental conditions: after 30 min, cells were fixed with 4% paraformaldehyde and then counterstained with Hoechst and analyzed by Immunofluorescence or FACS analysis [ 22 ]. Immunofluorescence and FACS studies : After appropriate stimuli, cultured TEC were fixed in ethanol/acetic acid 2:1 and stained with appropriate antibodies for immunofluorescence or FACS studies. Briefly, the analysis of the mitochondrial protein PGC-1α, the tight junction protein ZO-1 and the endocytic receptor megalin were performed using primary antibodies (Santa Cruz Biotech, Santa Cruz, CA) and Alexa Fluor 488–conjugated secondary anti-isotype antibodies (Life Technologies, Carlsbad, CA, USA). Immunofluorescence studies for mitochondrial membrane potential was assessed by the fluorescent dye MitoTracker Red 7513 (reduced chloromethyl-X-rosamine from Invitrogen) as previously described [ 18 – 20 ]. Statistical analysis All clinical and experimental data are expressed as mean ± 1SD: continuous data are presented as mean and standard deviation or median and range. Statistical analysis was performed by analysis of variance and multiple comparisons with ANOVA and Newmann-Keuls multicomparison test or Student’s t-test where appropriate. P values < 0.05 were considered as the threshold for statistical significance. Statistical analysis was performed using SPSS-statistical software, version 21.0 (SPSS Inc. Chicago, IL). Results Patients’ characteristics and treatments We enrolled in the study 31 patients with septic shock admitted to the ICU of the University of Foggia Academic Hospital. The baseline demographic and clinical characteristics of patients at study admission are summarized in Table 1: briefly, mean age of the cohort was 64.96±15.1 years and 52% were males. SOFA mean value was 13.14±2.8: of note, 18/31 (58%) showed a SOFA score >12, with an expected mortality rate higher than 50%. At ICU admission, all patients were sedated and ventilated, 29/31 patients (93.5%) required i.v. support with norepinephrine to achieve MAP > 65 mmHg and adequate ventriculo-arterial recoupling. Furthermore, 14/29 patients (48.27%) needed a supplementary cathecolamine administration (dopamine, dobutamine or levosimendan). The mean BMI of the whole population was 28.37±7.2 (Table 1). AKI grading based on serum creatinine levels and urinary output according to the KDIGO criteria is also reported in Table 1: 13/31 patients (42%) were not included in KDIGO criteria (no AKI group), whereas 18/31 (58%) were classified as AKI patients and graded as follows: stage 1: 5/31 (16%); stage 2: 6/31 (19%); stage 3: 7/31 (23%). Moreover, 6/31 patients (19%) required Renal Replacement Therapy (RRT) during ICU stay in accordance with the standard clinical indications of the center. Concerning other organ dysfunction, 11/31 patients (35.5%) showed a PaO 2 /FiO 2 ratio between 100-200 mmHg and 18/31 (58%) between 200-300 mmHg. Table 1. Patients’ characteristics at study enrolment (T0) Ma les Fe males 16/31 (52%) 15/31 (48%) Age (Yrs) 64.96 ± 15.1 BMI (Kg/m 2 ) 28.37 ± 7.2 SOFA score 13.14 ± 2.8 12 18/31 (58%) PaO 2 /FiO 2 (mmHg) < 100 2/31 (6.5%) 100 -200 11/31 (35.5%) 200-300 18/31 (58%) AKI (KDIGO criteria) Stage 0 13/31 (42%) Stage 1 5/31 (16%) Stage 2 6/31 (19%) Stage 3 7/31 (23%) Need of RRT 6/31 (19%) Outcome Discharge from ICU 16 (52%) Death in ICU 15 (48%) Length of ICU stay (days) Survivors 11,8±8.8 Dead 12,2±13,7 The main causes of sepsis and the sources of infections were intestinal perforation, surgical anastomosis dehiscence, fistulae and acute cholangitis. PMX-HA was performed at least once in all 31 patients; 2/31 (6%) received only one PMX-HA treatment, 25/31 (81%) were subjected to two and 4/31 (13%) to four PMX-HA sessions. Of the 31 patients, 16 were transferred to hospital wards, whereas 15 did not survive; the overall survival rate to ICU discharge was 52%. Among the survivors, the average length of ICU stay was 11.8±8.8 days, compared to 12.2±13 days observed for dead patients. In 29/31 enrolled patients, the clinical course of sepsis and organ dysfunction including the response to antibiotics and extracorporeal blood purification therapies was assessed daily by monitoring procalcitonin (PCT) and lactate levels at different time points up to 120 hrs after the first PMX-HA treatment (Table 2). Moreover, in 12/31 patients, we also evaluated Endotoxin Activity (EA) at T1 and T4 (Table 2). Table 2. Blood procalcitonin (PCT), Lactate and Endotoxin Activity (EA) of enrolled patients at different time points (T1: before PMX-HA #1; T2: after PMX-HA #1; T3: before PMX-HA #2; T4: after PMX-HA #2). T1 T2 T3 T4 PCT (pg/ml) (n=29) 41.36±54.3 11.62±19.1 44.25±56.33 26.56±36.4 BLOOD LACTATE LEVELS (mmol/l) (n=29) 2.8±1.8 2.4±2 1.9±1.4 1.9±1.2 EA (n=12) 0.73±0.51 / / 0.48±0.25 QS quantification in blood and urine samples, clinical correlations and effects of PMX-HA As shown in Fig. 1, at study admission (T1) the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ were found in patients’ blood and urine. The most abundant QS family member in blood was C4-AHL (4.11±0.9 ng/ml) followed by C7 HQ (1.35±0.7 ng/ml) and then 3-oxo-C12-AHL (0.38±0.1 ng/ml). Similar results were observed in urinary samples (C4-AHL: 3.49±0.7 ng/ml; C7 HQ: 0.89±0.3 ng/ml; 3-oxo-C12-AHL: 0.11±0.01 ng/ml, respectively). Always at T1, among all the evaluated clinical and laboratory parameters, we found the following significant direct correlations: blood 3-oxo-C12-AHL and blood EA (p=0.0275); blood C7 HQ and blood EA (p=0.0075); urine 3-oxo-C12-AHL and serum procalcitonin (p=0.05); urine C4-AHL and blood WBC (p=0.0123); urine 3-oxo-C12-AHL and serum creatinine (p=0.05). Moreover, we also found an inverse correlation between blood C4-AHL and PaO 2 /FiO 2 (p=0.0284). The first PMX-HA treatment significantly reduced all the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ in blood (Fig. 1A) as well as in urine (Fig. 1B) of enrolled patients. A new increase of all QS molecules was observed between the end of the first and the start of the second PMX-HA treatment (Fig. 1A-B). The second PMX-HA treatment newly reduced plasma and urine QS levels (Fig. 1A-B): the greater reduction of all QS molecules in biofluids was observed between T1 and T4 (Fig. 1A-B). To confirm the significant QS reduction observed after PMX-HA treatment, we set-up an ex-vivo model of hemoadsorption using minicartridges loaded with PMX-B (see Methods and Fig. 2A). For this purpose, we added C4-AHL, 3-oxo-C12-AHL and C7 HQ QS (final concentrations of 50 ng/ml each) to whole blood and we performed hemoadsorption for 2 hrs at 1 ml/min blood flow rate in presence or absence of 50 ng/ml LPS, using heparin as anticoagulation strategy to fully mimic the clinical setting. We observed a significant reduction of all QS molecules in blood after PMX-HA (Fig. 2B-D), but not with a sham device (the same minicartridge without PMX-B, not shown). Of note, the decrease of all the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ was significantly higher in the presence of LPS (Fig. 2 B-D), suggesting a potential interaction between the two bacterial molecules during hemoadsorption. In vitro studies on human Tubular Epithelial Cells (TEC) As a first step to evaluate the biological effects of QS on cultured human TEC, we used supernatants produced by 2 different Pseudomonas aeruginosa strains [15]: wild-type PA01 strain and its isogenic mutant Rh1l defective in the synthesis of C4-AHL, the most abundant QS molecule identified in biofluids of enrolled patients. In respect to experimental control (Luria-Bertani broth alone), supernatants produced by both wild-type PA01 and mutant RhlI strains induced a dose-dependent cytotoxic (Fig. 3A) and pro-apoptotic (Fig. 3B) effect on TEC: however, the deleterious effect of RhlI was significantly lower than that observed in the presence of PA01 supernatant, suggesting that C4-AHL QS knock-down may limit TEC injury (Fig. 3A-B). The following experiments were then performed using the commercially available C4-AHL QS: we first established a dose-response test finding that 100 ng/ml C4-AHL QS induced about a 50% decrease of TEC viability (data not shown) after 24 hr of incubation and we then used this concentration for all the following in vitro experiments. C4-AHL QS induced a cytotoxic (Fig. 4A) and pro-apoptotic (Fig. 4B) effect on TEC like that observed with 50 ng/ml LPS. The co-incubation of C4-AHL QS and LPS resulted in a significant increase of TEC death (Fig. 4A-B). We then investigated the gene expression of the well-established biomarkers of TEC stress or injury TIMP-2/IGFBP-7 and NGAL, respectively: C4-AHL QS and LPS both induced a significant increase of mRNA coding for all tubular biomarkers (Fig. 4C). Also in this case, the association of C4-AHL QS and LPS enhanced TIMP-2, IGFBP-7 and NGAL expression (Fig. 4C). Similar results were observed for the detection of NGAL protein by ELISA in supernatants of TEC challenged with different stimuli (Fig. 4D). As detected by representative immunofluorescence micrographs and relative quantification (Fig. 5A-B) as well as by FACS analysis (Fig. 5C), C4-AHL QS and LPS augmented ROS production by TEC, with a further increase in the presence of both bacterial molecules. One of the key features of SA-AKI is mitochondrial dysfunction: for this reason, we assessed the role of C4-AHL QS in mitochondrial alterations and expression of PGC-1alpha, a protein essential for mitochondrial biogenesis that has been shown to be down-regulated in TEC during SA-AKI. We found that C4-AHL QS induced mitochondrial dysfunction in TEC likewise LPS as confirmed by the specific staining with the red fluorescent dye MitoTracker (Fig. 6A-B), a marker of mitochondrial membrane potential, and by the down-regulation of PGC-1alpha (Fig. 6C). As previously described, also for mitochondrial alterations, C4-AHL QS and LPS exerted an additional negative effect on TEC (Fig. 6A-C). Since we have previously demonstrated that plasma drawn from septic patients induced not only apoptotic cell death but also some functional alterations in TEC, we evaluated the biological effects of a short time exposure (6-12 hr) of 100 ng/ml C4-AHL QS in the presence or absence of 50 ng/ml LPS. We observed that C4-AHL QS as well as LPS significantly reduced trans-epithelial electrical resistance (TEER), a marker of cell polarity defined as the capacity of TEC to maintain two distinct fluid-filled compartments with precise electrolyte concentrations (Fig. 7A). The loss of TEC polarity was associated with the C4-AHL QS-induced down-regulation of the tight junction molecule ZO-1 (Fig. 7B) and of the endocytic receptor megalin (Fig. 7C), a protein located on TEC luminal surface essential for re-absorption of low molecular weight proteins from glomerular ultrafiltrate. The C4-AHL QS-induced decrease of megalin expression was also associated with a significant reduction of albumin uptake by stimulated TEC (Fig. 7D). The co-incubation of TEC with C4-AHL QS and LPS further worsened loss of TEC polarity, albumin uptake, down-regulation of ZO-1 and megalin expression (Fig. 7 A-D). Discussion In the present study, we found that QS bacterial molecules belonging to both the AHL (C4, 3-oxo-C12) and HQ (C7) families are present in blood and urine of septic patients and can be detected by using a specific LC-MS method previously developed by our group. C4-AHL, the most abundant QS molecule found in biofluids, can induce cytotoxicity and apoptotic death of TEC in vitro : this detrimental effect of QS was confirmed by the up-regulation of biomarkers of TEC stress and injury such as TIMP-2, IGFBP-7 and NGAL and by the increased production of ROS leading to mitochondrial dysfunction, oxidative stress and, finally, cell death. Moreover, C4-AHL induced some earlier functional alterations of TEC such as loss of cell polarity, decrease of albumin uptake, down-regulation of the tight junction protein ZO-1 and of the endocytic receptor megalin, all key features of experimental models of SA-AKI. The detrimental properties of QS on TEC were enhanced by the presence of LPS, suggesting an additional negative effect of these two bacterial molecules in SA-AKI. Of note, in vivo and in vitro data suggested that PMX-HA, the most common used extracorporeal blood purification therapy for LPS removal, could also reduce QS levels, thus limiting TEC injury and consequently AKI development and progression. Sepsis, the systemic host response to infections, represents the most frequent cause of AKI and multiple organ dysfunction syndrome in critically ill patients admitted to ICU. Fiorentino et al. recently showed that long-term survival of patients with SA-AKI is strongly influenced by the recovery of renal function [ 23 , 24 ]. The pathogenic mechanisms of SA-AKI have not been yet fully elucidated: however, to date the main working hypothesis is that mediators directly released by bacteria (PAMPs) and/or by injured cells (DAMPs) play a key role in the development of sepsis-induced AKI (SI-AKI), a subphenotype of SA-AKI in which sepsis itself is the primary driver of kidney damage in absence of other causes [ 5 ]. Kidney resident cells including microvascular endothelial cells (EC) located in glomerular and peritubular capillaries and TEC are injured during SA-AKI with different biological mechanisms. Functional alterations of EC are responsible for the enhanced vasoconstriction and for the triggering of the coagulation and complement cascades, key elements of a specific endotype of SA-AKI associated with microvascular derangement [ 9 , 19 , 25 ]. In the presence of an inflammatory microenvironment, EC have been shown to undergo endothelial-to-mesenchymal transition (EndMT), a biological process characterized by the loss of endothelial antigens and the concomitant acquirement of a fibroblast-like phenotype that may favor the progression toward tissue fibrosis [ 26 , 27 ]. In TEC, the above-described inflammatory microenvironment can lead to a series of sublethal and lethal modifications causing metabolic imbalance, functional alterations, triggering of cellular apoptosis or senescence and epithelial-to-mesenchymal transition with consequent tubulo-interstitial fibrosis [ 18 , 20 , 28 , 29 ] These findings are in accordance with the peak concentration hypothesis proposed by Ronco et al. some years ago [ 30 ] and with experimental data from different groups including our showing that plasma derived from patients with sepsis can induce functional alterations and apoptosis of TEC [ 18 , 20 ]. Among PAMPs, LPS, the most studied mediator of SA-AKI, can interact with TLR4 located on TEC inducing a direct cellular dysfunction through the triggering of different intracellular pathways, including the down-regulation of Klotho: Klotho reduction can mediate LPS-induced TEC inflammation and oxidative stress through the decreased activation of the anti-senescent molecule Nrf2 [ 11 , 31 ]. In addition, LPS induced an enhanced release of inflammatory cytokines such as TNF-alpha, Fas-Ligand and CD40-Ligand by circulating immune cells and by local renal resident cells. These inflammatory molecules are biomarkers of worse outcome in sepsis and can interact with their specific receptors (TNF-R, Fas, CD40) located on TEC surface triggering apoptotic cell death [ 19 , 32 ] and inducing the down-regulation of sodium, chloride, glucose and urea transporters, thus leading to the loss of cell polarity, the functional characteristic of mature epithelial cells to maintain two distinct fluid-filled compartments with precise electrolyte concentrations [ 18 , 33 , 34 ]. In addition to LPS, other bacteria-derived molecules can play a pivotal role in the pathogenic mechanisms of SA-AKI. In the early 1970s, signalling among bacteria via self-produced factors was proposed as a chemical form of proto-communication, laying the foundations for “social microbiology”. Microbiologists discovered that luciferase expression in marine Vibrio spp. was auto-induced by molecules released by bacteria themselves [ 35 ]. Ten years later, Eberhard et al. identified in Vibrio fischeri three parts involved in microbial communication: the autoinducer N-3-oxohexanoyl-L-homoserine lactone (3OC6-HSL), luxI gene codifying for the autoinducer synthase and luxR codifying for the transcriptional factor [ 36 , 37 ]. However, further 10 years were necessary to recognize luxI -luxR as the paradigm of Quorum Sensing (QS), the main model of microbial communication at the present time [ 38 ]. QS molecules are produced by both Gram-Positive and Gram-Negative bacteria: however, Gram-Positive bacteria are shown to communicate via chemical signals different from lactones produced by the Gram-Negative ones; for example, Streptococcus pneumoniae and Staphylococcus aureus use small peptides and cyclic peptides, respectively [ 39 , 40 ]. The improvement of knowledge in the QS field was due to deep investigations on Pseudomonas aeruginosa , the most notorious opportunistic pathogen involved in several clinical infections that can result in sepsis. In this Gram-Negative species, the QS machinery influences the expression of toxins and virulence factors, biofilm development, production of secondary metabolites, and stress adaptation mechanisms [ 41 , 42 ]. In P. aeruginosa , and generally in Gram-Negative bacterial species, two of the most relevant molecules for their numerous biological activities are represented by Acyl homoserine lactones (AHL) and Hydroxyquinolones (HQ) [ 43 ]. In this study, we observed that the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ were detected in blood as well as in urine of septic patients: of relevance, C4 AHL was the most abundant QS molecule detected in biofluids. The concentration of the different AHL and HQ QS molecules showed a linear correlation with blood levels of endotoxin detected by EA, inflammatory/sepsis biomarkers such as PCT and WBC count and parameters of organ dysfunction such as PaO 2 /FiO 2 and serum creatinine levels. Another finding of this study is that QS signalling represents a potential way of crosstalk between the prokaryotic and eukaryotic worlds in an intriguing interkingdom communication. QS molecules have been shown to play a role in immune system deregulation frequently observed in sepsis: 3-oxo-C12-AHL triggers apoptosis and functional alterations of dendritic cells and CD4 + T cells modulating cytokine production [ 44 , 45 ]. In addition, 3-oxo-C12-AHL and C4-AHL can accelerate neutrophil and monocyte apoptosis in sepsis models and 3-oxo-C12-AHL combined with LPS, increases the production of IL-10, an anti-inflammatory cytokine that reduces neutrophil phagocytic ability [ 46 , 47 ]. QS molecules can also be involved in sepsis-associated microvascular dysfunction through the induction of endothelial cell death mediated by the RIPK1 pathway and triggering of the coagulation cascade [ 48 ]. To date, little is known about the biological effects of QS molecules on kidney resident cells and their potential role in SA-AKI. We herein demonstrated that C4-AHL, the most abundant QS molecule found in blood and urine of septic patients, induced in vitro TEC injury and functional alterations commonly observed in SA-AKI. C4-AHL triggered a dose-dependent cytotoxic and pro-apoptotic effect on TEC as confirmed by the presence of DNA fragmentation and by the increased expression of mRNA coding for stress and damage biomarkers such as TIMP-2, IGFBP-7 and NGAL. The cytotoxic effect exerted by QS on TEC can be at least in part ascribed to ROS generation and mitochondrial dysfunction. We herein showed that C4-AHL is also able to alter TEC polarity as demonstrated by the down-regulation of the tight junction protein ZO-1 and of the endocytic receptor megalin. These sub-lethal alterations induced by QS in TEC may have a key role in some clinical findings frequently observed during SA-AKI such as the increase of permeability leading to tissue edema and the development of low-molecular weight proteinuria [ 49 ]. The specificity of the detrimental biological activities exerted by QS on TEC was confirmed by using supernatants collected by an isogenic mutant of Pseudomonas aueruginosa (Rh1l) defective in the synthesis of C4-AHL. Moreover, in vitro data suggested that C4-AHL may synergize with LPS in the pathogenic mechanisms of SA-AKI. Based on these observations, we investigated the potential concomitant removal of QS and LPS by PMX-HA, the most used extracorporeal blood purification therapy for endotoxemic shock: the clinical benefits of PMX-HA in this clinical setting have been evaluated by several RCTs with conflicting results over the last years. The EUPHAS study was the first multicenter RCT using PMX-HA: despite the low number of enrolled patients and the premature termination, PMX-HA significantly reduced 28-day mortality in comparison to standard therapy [ 50 ]. These results were not confirmed by the ABDO-MIX RCT in France, in which 28-day mortality was not significantly different between the two groups [ 51 ]: however, some potential bias of this RCT should be emphasized, including the low mortality rate in the control group and the high incidence of circuit clotting in the PMX-HA-treated group. Registry studies like the EUPHAS2 confirmed the feasibility of PMX-HA showing its clinical benefits without significant adverse effects [ 52 ]. In the more recent EUPHRATES RCT, PMX-HA in addition to conventional medical therapy failed to reduce 28-day mortality [ 13 ]: however, a post-hoc analysis of the study revealed that in patients with EA between 0.6 and 0.89, a positive effect on mean arterial pressure, ventilator-free days and mortality was observed [ 53 ]. In this high-risk category of septic patients, the TIGRIS RCT is still ongoing to confirm the potential beneficial effects of PMX-HA [ 54 ]. Furthermore, another post-hoc analysis including 1911 septic patients included in the JSEPTIC-DIC study and 286 patients with endotoxemic septic shock always from the EUPHRATES RCT demonstrated that in subjects with abnormal coagulation (PT-INR > 1.4) and hyperlactatemia (lactate > 3 mmol/L), PMX-HA was significantly associated with a higher 28-day survival rate [ 55 ]. Despite the lack of a definite evidence on mortality, other studies showed some potential clinical benefits of PMX-HA in specific settings such as the modulation of immune system: PMX-HA has been shown to decrease macrophage and monocyte activity and to increase the expression of HLA-DR on monocytes, a critical step of the immune response in sepsis and related to a better outcome [ 44 , 56 ]. Furthermore, our group previously showed a plausible protective effect of PMX-HA on SA-AKI: indeed, PMX-HA significantly reduced the pro-apoptotic activity of septic plasma on cultured human TEC and improved SOFA/RIFLE scores, proteinuria and tubular-derived urinary enzymes [ 8 ]. The limited number of septic patients enrolled in the present study did not allow to define end-points correlated with mortality and organ failure: however, our data advised for a potential role of PMX-HA in the removal of QS molecules belonging to AHL and HQ families and that QS removal by PMX-HA was higher in the presence of LPS, suggesting a protective effect on LPS- and QS-induced TEC damage. We acknowledge that our study presents some limitations: the low number of enrolled patients generated the hypothesis that different QS molecules could be detected in body fluids exerting a potential role in the pathogenic mechanisms of SA-AKI; however, these results should be confirmed in a larger cohort of septic subjects. The association between QS and LPS should also be confirmed, since EA levels were not available for all patients at the time points considered. The physico-chemical mechanisms of QS adsorption by PMX-B are far to be fully elucidated: QS may directly bind to the sorbent; however, considering the enhanced removal rate of QS in the presence of LPS, a possible “sandwich effect” (binding of QS to LPS that in turn binds to PMX-B) could not be excluded, also considering the interactions between QS and LPS already known in the literature [ 57 ]. The present study also has some strengths: first, we confirmed that the LC-MS analytical model for QS developed by our group can identify in biofluids different molecules belonging to both AHL and HQ family members. The follow-up of septic patients at different time points of their ICU stay allowed us to identify some significant correlations between QS blood and urine levels with parameters of infection/inflammation (EA, WBC count, PCT) and organ function (PaO 2 /FiO 2 , serum creatinine). Different in vitro assays using human TEC showed that QS can induce sub-lethal and lethal alterations commonly observed in experimental models of SA-AKI. The specific role of C4 AHL QS in the triggering of TEC damage was confirmed by using supernatants derived from isogenic mutants of Pseudomonas aeruginosa not able to produce this molecule. Conclusions Taking together, the results of the present study suggested that PMX-HA could remove from the bloodstream different QS molecules able to synergize with LPS in the triggering of functional alterations and death of TEC, key pathogenic mechanisms of development and progression of SA-AKI. Abbreviations AKI: Acute Kidney Injury; SA-AKI: Sepsis-Associated Acute Kidney Injury; CKD: Chronic Kidney Disease; TEC: Tubular Epithelial Cells: PAMPs: Pathogen-Associated Molecular Patterns; DAMPs: Damage-Associated Molecular Patterns; LPS: lipopolysaccharide; TLR4: Toll-Like Receptor 4; PMX-HA: Polymyxin B- Hemoadsorption; QS: Quorum Sensing; LC-MS: Liquid Chromatography-Mass Spectrometry; AHL: Acyl Homoserin Lactones; HQ: Hydroxyquinolones; WBC: White Blood Cells; RBC: Red Blood Cells; EA: Endotoxin Activity; LB: Luria-Bertani broth; XTT: (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2 H -Tetrazolium-5-Carboxanilide); TUNEL: Terminal deoxynucleotidyl transferase dUTP nick end labelling; RT-PCR: Real Time-Polymerase Chain Reaction; TIMP-2: Tissue Inhibitor of Matrix Matalloproteinase-2; IGFBP-7: Insulin-like Growth Factor Binding Protein-7; NGAL: Neutrophil Gelatinase-Associated Lipocalin; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; TEER: Trans-Epithelial Electrical Resistance; EVOM: Epithelial Volt-Ohm-Meter; PBS: Phosphate Buffer Saline; ROS: Reactive Oxygen Species; ZO-1: Zonula Occldens-1; MAP: Mean Arterial Pressure; EC: Endothelial cells; EndMT: Endothelial-to-Mesenchymal Transition; TRAF-6: Tumor Necrosis Factor ReceptorAssociated-6; Nrf2: Nuclear factor erythroid 2- related factor 2. Declarations Ethics approval and consent to participate This is a translational study aimed to evaluate the presence of different Gram-Negative bacteria-derived QS molecules in septic patients, their role in the determination of SA-AKI and their potential removal by PMX-HA. All patients admitted to the ICU of the University of Foggia Academic Hospital were considered for enrollment in the study from April 2019 to February 2022. PMX-HA and medical treatments for endotoxemic septic shock were performed in accordance with the standard protocols of the center. Local ethics committee approved the protocol and written informed consent was obtained from each patient or next of kin. The present study was conducted in accordance with the Declaration of Helsinki. Consent for publication Not applicable. Availability of data and materials All clinical and laboratory data of patients enrolled in the study are available in the database of the ICU of the University of Foggia Academic Hospital. All laboratory data generated from LC-MS analysis of biofluids and from in vitro experiments performed on TEC are available in the data center of the Aging Project of Excellence of the Department of Translational Medicine (DIMET), University of Piemonte Orientale (UPO). The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The Authors declare that they have no competing interests for the present study. Funding Part of the present study ( in vitro assays on TEC) was funded by the Italian Ministry of Education, University and Research (MIUR) program “Departments of Excellence on Aging 2018–2022” to the Department of Translational Medicine (DIMET), University of Piemonte Orientale (UPO) and by local university grants (FAR) both to VC. Authors’ contributions VC and GC designed the study, supervised both clinical and laboratory procedures and approved the final version. DM and ADQ performed and interpreted the experiments aimed to evaluate the biological effects of QS on TEC: they conceived in vitro experiments and analyzed data under the supervision of VC. LM, AC and FDP enrolled patients, analyzed and interpreted clinical data together with GC. CM and FDB performed LC-MS experiments in biofluids, interpreted data and wrote part of the article. VO was responsible for microbiological data developing Pseudomonas aeruginosa strains and wrote part of the article. MM, SP and VF performed ex-vivo experiments with PMX-B minicartridges and elaborated statistical analysis of clinical and laboratory data. VC, GC and LM conceived the study, supervised the experiments, wrote the article, analyzed data and approved the final version of the manuscript. CR supervised the conceptual framework of the study and approved the final version of the manuscript. Acknowledgments VC is the Vice-Chair of the ERAKI Working Group, European Renal Association (ERA). Part of these results was presented and awarded as best abstracts at the AKI & CRRT Congresses in San Diego (CA) and in Vicenza (Italy). References Uchino S, Kellum JA, Bellomo R, Doig GS, Morimatsu H, Morgera S et al.. Acute renal failure in critically ill patients: a multinational, multicenter study. Jama, 2005. 294(7): p. 813-8. Singer M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M et al. The third international consensus definitions for sepsis and septic shock (sepsis-3). JAMA, 2016. 315(8): p. 801-810. Kellum JA, Lameire N, KDIGO AKI Guideline Work Group. Kidney disease: Improving global outcomes (KDIGO) acute kidney injury work group. KDIGO clinical practice guideline for acute kidney injury. Kidney International Supplements, 2012. 2(1): p. 1-138. Zarbock A, Koyner JL, Gomez H, Pickkers P, Forni L; Acute Disease Quality Initiative group. Sepsis-associated acute kidney injury-treatment standard. Nephrol Dial Transplant. 2023 Dec 20;39(1):26-35. doi: 10.1093/ndt/gfad142. Erratum in: Nephrol Dial Transplant. 2023 Nov 30;38(12):2858. Zarbock A, Nadim MK, Pickkers P, Gomez H, Bell S, Joannidis M et al. Sepsis-associated acute kidney injury: consensus report of the 28th Acute Disease Quality Initiative workgroup. Nat Rev Nephrol. 2023 Jun;19(6):401-417. Sood MM, Shafer LA, Ho J, Reslerova M, Martinka G, Keenan S et al. Early reversible acute kidney injury is associated with improved survival in septic shock. J Crit Care, 2014. 29(5): p. 711-7. Brothers, TN, Strock J, LeMasters TJ, Pawasauskas J, Reed RC, Al-Mamun MA. Survival and recovery modeling of acute kidney injury in critically ill adults. SAGE Open Med, 2022. 10: p. 20503121221099359. Cantaluppi V, Assenzio B, Pasero D, Romanazzi GM, Pacitti A, Lanfranco G et al. Polymyxin-B hemoperfusion inactivates circulating proapoptotic factors. Intensive Care Med, 2008. 34(9): p. 1638-45. Fani F, Regolisti G, Delsante M, Cantaluppi V, Castellano G, Gesualdo L et al. Recent advances in the pathogenetic mechanisms of sepsis-associated acute kidney injury. J Nephrol, 2018. 31(3): p. 351-359. Marshall JC, Foster D, Vincent JL, Cook DJ, Cohen J, Dellinger RP et al., Diagnostic and prognostic implications of endotoxemia in critical illness: results of the MEDIC study. J Infect Dis, 2004. 190(3): p. 527-34. Cunningham PN, Wang Y, Guo R, He G, Quigg RJ. Role of Toll-like receptor 4 in endotoxin-induced acute renal failure. J Immunol, 2004. 172(4): p. 2629-35. Cruz DN, Antonelli M, Fumagalli R, Foltran F, Brienza N, Donati A et al. Early use of polymyxin B hemoperfusion in abdominal septic shock: the EUPHAS randomized controlled trial. Jama, 2009. 301(23): p. 2445-52. Dellinger RP, Bagshaw SM, Antonelli M, Foster DM, Klein DJ, Marshall JC et al. Effect of Targeted Polymyxin B Hemoperfusion on 28-Day Mortality in Patients With Septic Shock and Elevated Endotoxin Level: The EUPHRATES Randomized Clinical Trial. Jama, 2018. 320(14): p. 1455-1463. Antunes LC, Ferreira RBR, Buckner MMC, Finlay BB. Quorum sensing in bacterial virulence. Microbiology, 2010. 156(Pt 8): p. 2271-82. Orlandi VT, Bolognese F, Martegani E, Cantaluppi V, Medana C, Barbieri P. Response to photo-oxidative stress of Pseudomonas aeruginosa PAO1 mutants impaired in different functions. Microbiology (Reading), 2017. 163(11): p. 1557-1567. Dal Bello F, Zorzi M, Aigotti R, Medica D, Fanelli V, Cantaluppi V et al. Targeted and untargeted quantification of quorum sensing signalling molecules in bacterial cultures and biological samples via HPLC-TQ MS techniques. Anal Bioanal Chem, 2021 413(3): p. 853-864. Cantaluppi V, Medica D, Quercia AD, Dellepiane S, Figliolini F, Virzì GM, et al. Perfluorocarbon solutions limit tubular epithelial cell injury and promote CD133+ kidney progenitor differentiation: potential use in renal assist devices for sepsis-associated acute kidney injury and multiple organ failure. Nephrol Dial Transplant. 2018 Jul 1;33(7):1110-1121. Cantaluppi V, Weber V, Lauritano C, Figliolini F, Beltramo S, Biancone L, et al. Protective effect of resin adsorption on septic plasma-induced tubular injury. Crit Care. 2010;14(1):R4. Medica D, Quercia AD, Marengo M, Fanelli V, Castellano G, Fabbrini P, Migliori M, Merlotti G, Camussi G, Joannes-Boyau O, Honorè PM, Cantaluppi V. High-volume hemofiltration does not protect human kidney endothelial and tubular epithelial cells from septic plasma-induced injury. Sci Rep. 2024 Aug 7;14(1):18323. Mariano F, Cantaluppi V, Stella M, Romanazzi GM, Assenzio B, Cairo M, et al. Circulating plasma factors induce tubular and glomerular alterations in septic burns patients. Crit Care. 2008;12(2):R42. Cantaluppi V, Biancone L, Romanazzi GM, Figliolini F, Beltramo S, Galimi F, et al. Macrophage stimulating protein may promote tubular regeneration after acute injury. J Am Soc Nephrol. 2008 Oct;19(10):1904-18. Migliori M, Cantaluppi V, Mannari C, Bertelli AA, Medica D, Quercia AD, et al. Caffeic acid, a phenol found in white wine, modulates endothelial nitric oxide production and protects from oxidative stress-associated endothelial cell injury. PLoS One. 2015 Apr 8;10(4):e0117530. Fiorentino M, Tohme FA, Murugan R, Kellum JA. Plasma Biomarkers in Predicting Renal Recovery from Acute Kidney Injury in Critically Ill Patients. Blood Purif. 2019;48(3):253-261. Fiorentino M, Tohme FA, Wang S, Murugan R, Angus DC, Kellum JA. Long-term survival in patients with septic acute kidney injury is strongly influenced by renal recovery. PLoS One. 2018 Jun 5;13(6):e0198269. Castellano G, Stasi A, Franzin R, Sallustio F, Divella C, Spinelli A, et al. LPS-Binding Protein Modulates Acute Renal Fibrosis by Inducing Pericyte-to-Myofibroblast Trans-Differentiation through TLR-4 Signaling. Int J Mol Sci. 2019 Jul 27;20(15):3682. Franzin R, Stasi A, Sallustio F, Bruno S, Merlotti G, Quaglia M, et al. Extracellular vesicles derived from patients with antibody-mediated rejection induce tubular senescence and endothelial to mesenchymal transition in renal cells. Am J Transplant. 2022 Sep;22(9):2139-2157 Stasi A, Franzin R, Divella C, Sallustio F, Curci C, Picerno A, et al. PMMA-Based Continuous Hemofiltration Modulated Complement Activation and Renal Dysfunction in LPS-Induced Acute Kidney Injury. Front Immunol. 2021 Apr 1;12:605212. Castellano G, Franzin R, Sallustio F, Stasi A, Banelli B, Romani M, et al. Complement component C5a induces aberrant epigenetic modifications in renal tubular epithelial cells accelerating senescence by Wnt4/βcatenin signaling after ischemia/reperfusion injury. Aging (Albany NY). 2019 Jul 8;11(13):4382-4406. Franzin R, Stasi A, Fiorentino M, Stallone G, Cantaluppi V, Gesualdo L, et al. Inflammaging and Complement System: A Link Between Acute Kidney Injury and Chronic Graft Damage. Front Immunol. 2020 May 7;11:734. Ronco C, Tetta C, Mariano F, Wratten ML, Bonello M, Bordoni V, et al. Interpreting the mechanisms of continuous renal replacement therapy in sepsis: the peak concentration hypothesis. Artif Organs. 2003 Sep;27(9):792-801. Zhou P, Zhao C, Chen Y, Liu X, Wu C, Hu Z. Klotho activation of Nrf2 inhibits the ferroptosis signaling pathway to ameliorate sepsis-associated acute kidney injury. Transl Androl Urol. 2023 Dec 31;12(12):1871-1884. doi: 10.21037/tau-23-573. Epub 2023 Dec 21. Marengo M, Migliori M, Merlotti G, Fabbrini P, Panichi V, Cantaluppi V. Role of the CD40-CD40 Ligand Pathway in Cardiovascular Events, Neurological Alterations, and Other Clinical Complications of Chronic Hemodialysis Patients: Protective Role of Adsorptive Membranes. Blood Purif. 2023;52 Suppl 1(Suppl 1):27-42. Han X, Fink MP, Uchiyama T, Yang R, Delude RL. Increased iNOS activity is essential for pulmonary epithelial tight junction dysfunction in endotoxemic mice. Am J Physiol Lung Cell Mol Physiol. 2004 Feb;286(2):L259-67. Han X, Fink MP, Uchiyama T, Yang R, Delude RL. Increased iNOS activity is essential for hepatic epithelial tight junction dysfunction in endotoxemic mice. Am J Physiol Gastrointest Liver Physiol. 2004 Jan;286(1):G126-36. Nealson KH, Platt T, Hastings JW. Cellular control of the synthesis and activity of the bacterial luminescent system. J Bacteriol. 1970 Oct;104(1):313–22. Eberhard A, Burlingame AL, Eberhard C, Kenyon GL, Nealson KH, Oppenheimer NJ. Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry. 2002;20(9):2444–9. Engebrecht J, Silverman M. Identification of genes and gene products necessary for bacterial bioluminescence (lux genes/recombinant DNA/complementation/minicells). Proc Nati Acad Sci USA. 1984;81:4154–8. Whiteley M, Diggle SP, Greenberg EP. Progress in and promise of bacterial quorum sensing research. Nature. 2017 Nov;551(7680):313–20. Sigve Havarstein L, Coomaraswamyt G, Morrisont DA. An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae (ABC transporter/bacteriocin/peptide signal/comC gene). 1995 [cited 2022 Apr 3]. ;92:11140–4. Ji G, Beavist RC, Novick RP. Cell density control of staphylococcal virulence mediated by an octapeptide pheromone. Biochemistry. 1995;92:12055–9. Lee J, Zhang L. The hierarchy quorum sensing network in Pseudomonas aeruginosa. Protein Cell. 2015 Jan;6(1):26-41. Schuster M, Greenberg EP. A network of networks: Quorum-sensing gene regulation in Pseudomonas aeruginosa. Int J Med Microbiol. 2006 Apr;296(2–3):73–81. Pezzoni M, Meichtry M, Pizarro RA, Costa CS. Role of the Pseudomonas quinolone signal (PQS) in sensitising Pseudomonas aeruginosa to UVA radiation. J Photochem Photobiol B Biol. 2015 Jan;142:129–40. Rimmelé T, Payen D, Cantaluppi V, Marshall J, Gomez H, Gomez A, Murray P, Kellum JA; ADQI XIV Workgroup. IMMUNE CELL PHENOTYPE AND FUNCTION IN SEPSIS. Shock. 2016 Mar;45(3):282-91. Skindersoe ME, Zeuthen LH, Brix S, Fink LN, Lazenby J, Whittall C, et al. Pseudomonas aeruginosa quorum-sensing signal molecules interfere with dendritic cell-induced T-cell proliferation. FEMS Immunol Med Microbiol. 2009 Apr;55(3):335-45. Glucksam-Galnoy Y, Sananes R, Silberstein N, Krief P, Kravchenko V V., Meijler MM, et al. The bacterial quorum-sensing signal molecule N-3-oxo-dodecanoyl-L-homoserine lactone reciprocally modulates pro- and anti-inflammatory cytokines in activated macrophages. J Immunol. 2013 Jul;191(1):337–44. Singh PK, Yadav VK, Kalia M, Sharma D, Pandey D, Agarwal V. Pseudomonas aeruginosa quorum-sensing molecule N-(3-oxo-dodecanoyl)-L-homoserine lactone triggers mitochondrial dysfunction and apoptosis in neutrophils through calcium signaling. Med Microbiol Immunol. 2019 Dec;208(6):855-868. Shin J, Ahn SH, Kim SH, Oh DJ. N-3-oxododecanoyl homoserine lactone exacerbates endothelial cell death by inducing receptor-interacting protein kinase 1-dependent apoptosis. Am J Physiol Cell Physiol. 2021 Oct 1;321(4):C644-C653. Bagshaw SM, Langenberg C, Haase M, Wan L, May CN, Bellomo R. Urinary biomarkers in septic acute kidney injury. Intensive Care Med. 2007 Jul;33(7):1285-1296. Cruz DN, Antonelli M, Fumagalli R, Foltran F, Brienza N, Donati A, et al. Early use of polymyxin B hemoperfusion in abdominal septic shock: the EUPHAS randomized controlled trial. JAMA. 2009 Jun 17;301(23):2445-52. Payen DM, Guilhot J, Launey Y, Lukaszewicz AC, Kaaki M, Veber B, et al. Early use of polymyxin B hemoperfusion in patients with septic shock due to peritonitis: a multicenter randomized control trial. Intensive Care Med. 2015 Jun;41(6):975-84. Cutuli SL, Artigas A, Fumagalli R, Monti G, Ranieri VM, Ronco C, Antonelli M; EUPHAS 2 Collaborative Group. Polymyxin-B hemoperfusion in septic patients: analysis of a multicenter registry. Ann Intensive Care. 2016 Dec;6(1):77. Klein DJ, Foster D, Walker PM, Bagshaw SM, Mekonnen H, Antonelli M. Polymyxin B hemoperfusion in endotoxemic septic shock patients without extreme endotoxemia: a post hoc analysis of the EUPHRATES trial. Intensive Care Med. 2018 Dec;44(12):2205-2212. Iba T, Klein DJ. The wind changed direction and the big river still flows: from EUPHRATES to TIGRIS. J Intensive Care. 2019 May 16;7:31. Osawa I, Goto T, Kudo D, Hayakawa M, Yamakawa K, Kushimoto S, Foster DM, Kellum JA, Doi K. Targeted therapy using polymyxin B hemadsorption in patients with sepsis: a post-hoc analysis of the JSEPTIC-DIC study and the EUPHRATES trial. Crit Care. 2023 Jun 21;27(1):245. Srisawat N, Tungsanga S, Lumlertgul N, Komaenthammasophon C, Peerapornratana S, Thamrongsat N, Tiranathanagul K, Praditpornsilpa K, Eiam-Ong S, Tungsanga K, Kellum JA. The effect of polymyxin B hemoperfusion on modulation of human leukocyte antigen DR in severe sepsis patients. Crit Care. 2018 Oct 26;22(1):279. Avila-Calderón ED, Ruiz-Palma MDS, Aguilera-Arreola MG, Velázquez-Guadarrama N, Ruiz EA, Gomez-Lunar Z, Witonsky S, Contreras-Rodríguez A. Outer Membrane Vesicles of Gram-Negative Bacteria: An Outlook on Biogenesis. Front Microbiol. 2021 Mar 4;12:557902. Additional Declarations No competing interests reported. Supplementary Files Graphicalabstract.pptx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6032315","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":416950419,"identity":"c074d61b-1ae4-4721-9c08-d72f53c5d2bb","order_by":0,"name":"Davide Medica","email":"","orcid":"","institution":"University of Eastern Piedmont Amadeo Avogadro","correspondingAuthor":false,"prefix":"","firstName":"Davide","middleName":"","lastName":"Medica","suffix":""},{"id":416950420,"identity":"6b8a9ced-5cb8-46e0-b13d-787adfdafe9f","order_by":1,"name":"Lucia Mirabella","email":"","orcid":"","institution":"University of Foggia","correspondingAuthor":false,"prefix":"","firstName":"Lucia","middleName":"","lastName":"Mirabella","suffix":""},{"id":416950421,"identity":"6632e263-0e40-44da-9328-410ad17b3e33","order_by":2,"name":"Antonella Cotoia","email":"","orcid":"","institution":"University of Foggia","correspondingAuthor":false,"prefix":"","firstName":"Antonella","middleName":"","lastName":"Cotoia","suffix":""},{"id":416950422,"identity":"2f331d79-e6bc-42f2-bb61-246f10897631","order_by":3,"name":"Claudio Medana","email":"","orcid":"","institution":"University of Turin","correspondingAuthor":false,"prefix":"","firstName":"Claudio","middleName":"","lastName":"Medana","suffix":""},{"id":416950423,"identity":"b459bfd0-7202-45c3-85ea-c4e44ae79fe7","order_by":4,"name":"Federica Dal Bello","email":"","orcid":"","institution":"University of Turin","correspondingAuthor":false,"prefix":"","firstName":"Federica","middleName":"Dal","lastName":"Bello","suffix":""},{"id":416950424,"identity":"cb040122-e15e-4b60-8366-a884339ce266","order_by":5,"name":"Viviana Orlandi","email":"","orcid":"","institution":"University of Insubria","correspondingAuthor":false,"prefix":"","firstName":"Viviana","middleName":"","lastName":"Orlandi","suffix":""},{"id":416950425,"identity":"4775415c-b55a-4ead-80e2-8be853fde814","order_by":6,"name":"Francesco P. Padovano","email":"","orcid":"","institution":"University of Foggia","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"P.","lastName":"Padovano","suffix":""},{"id":416950426,"identity":"32bb6168-ff75-4e1a-be72-1d65883f6291","order_by":7,"name":"Alessandro D. Quercia","email":"","orcid":"","institution":"ASL CN1","correspondingAuthor":false,"prefix":"","firstName":"Alessandro","middleName":"D.","lastName":"Quercia","suffix":""},{"id":416950427,"identity":"952904f5-2232-43d8-bcbb-59b0649081dc","order_by":8,"name":"Marita Marengo","email":"","orcid":"","institution":"ASL CN1","correspondingAuthor":false,"prefix":"","firstName":"Marita","middleName":"","lastName":"Marengo","suffix":""},{"id":416950428,"identity":"0a7e29f4-e2fb-4ccb-9325-45f69b610a07","order_by":9,"name":"Stefania Prenna","email":"","orcid":"","institution":"University of Eastern Piedmont Amadeo Avogadro","correspondingAuthor":false,"prefix":"","firstName":"Stefania","middleName":"","lastName":"Prenna","suffix":""},{"id":416950429,"identity":"14a81be2-2a69-48bc-9b8d-8fb4852c59f2","order_by":10,"name":"Vito Fanelli","email":"","orcid":"","institution":"University of Turin","correspondingAuthor":false,"prefix":"","firstName":"Vito","middleName":"","lastName":"Fanelli","suffix":""},{"id":416950430,"identity":"a0772077-d6a0-4a2f-bcff-7811a9816091","order_by":11,"name":"Claudio Ronco","email":"","orcid":"","institution":"International Renal Research Institute of Vicenza","correspondingAuthor":false,"prefix":"","firstName":"Claudio","middleName":"","lastName":"Ronco","suffix":""},{"id":416950431,"identity":"7cf292ef-00a5-49d9-814d-36ed2bb698fd","order_by":12,"name":"Gilda Cinnella","email":"","orcid":"","institution":"University of Foggia","correspondingAuthor":false,"prefix":"","firstName":"Gilda","middleName":"","lastName":"Cinnella","suffix":""},{"id":416950432,"identity":"1135228c-2473-49c0-a721-7166bec43e19","order_by":13,"name":"Vincenzo Cantaluppi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABOElEQVRIie2RMUvDQBTHLwSS5dKsL0T7GU4CUUihX8UgmCWBgiBBSokEnpPOFfwQTla3hEC7xD0QB4vgHBEKDhavBKRp0s6C+cHB3eP/O+7eI6Sl5S8iVo9HfAmXr2VdCFYlulOJCKySIasoNaeuEAkqV20obKbExcfjqEvk5P2tGII90UO8yHyLsDxEfeCTvf6GknROtNtUMgg9PWTRFOynuxhzN3UIe4lRH6e1h2khNUUFqR0AMSGSwL7PbMw9TAjjG13BZuUbgSvyAqJlqZx5y+2KKnJFQMYVakKMpSJ6wU7F0K7x2JCoew7PN2Dwv4S6O3WoltmhNU6B0qiiSGp6UHzhqKvKswfwF739iX41/3SHVreTOfN84Pf6ctA8Eum3h7A2DT4daM5X2r6eEbfGWlpaWv4RP7JaaX2vl0QLAAAAAElFTkSuQmCC","orcid":"","institution":"University of Eastern Piedmont Amadeo Avogadro","correspondingAuthor":true,"prefix":"","firstName":"Vincenzo","middleName":"","lastName":"Cantaluppi","suffix":""}],"badges":[],"createdAt":"2025-02-14 16:53:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6032315/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6032315/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":76688246,"identity":"b2a6f344-ae09-4ad1-8f7b-95d108b11c57","added_by":"auto","created_at":"2025-02-19 16:32:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":118488,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLC-MS analysis of QS concentrations in blood and urine of septic patients treated by PMX-HA\u003c/strong\u003e. Blood (A) and urine (B) concentrations of the different QS molecules C4-AHL (upper panels), 3-oxo-C12-AHL (median panels) and C7 HQ (lower panels) before (T1 and T3, black columns) and after (T2 and T4, white columns) two different sessions of PMX-HA detected by LC-MS as described in the Methods. Each PMX-HA treatment induced a significant decrease of QS molecules in both blood and urine (*p\u0026lt;0.05 T2 vs. T1 and T4 post vs. T3). All QS molecules significantly decreased in blood and urine from study enrollment to the end of the second PMX-HA treatment (#p\u0026lt;0.05 T4 post vs. T1 pre). Data are expressed as average±1 SD of all the 31 patients enrolled in the study.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/0b9d66f3c1d6163030aab4c7.png"},{"id":76688244,"identity":"570f920a-0637-4d60-b513-17aec544ff35","added_by":"auto","created_at":"2025-02-19 16:32:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":121057,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLC-MS analysis of QS concentrations in the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eex-vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emodel of PMX-HA using LPS-activated blood\u003c/strong\u003e. (A) Set-up and operational procedures of the \u003cem\u003eex-vivo\u003c/em\u003ePMX-HA model: hemoadsorption was performed for 2 hrs using heparin as anticoagulation strategy and with a flow rate (Qb) of 1 ml/min to fully mimic the clinical setting. (B-D) LC-MS analysis of C4-AHL (B), 3-oxo-C12-AHL (C) and C7 HQ (D) QS molecules at the start (black columns) and at the end (white columns) of experimental PMX-HA. All experiments were performed for 3 times in the presence of the single QS molecule alone (100 ng/ml, QS) or with the addition of 50 ng/ml LPS (QS+LPS). PMX-HA significantly reduced all QS molecules independently from the presence of LPS (*p\u0026lt;0.05 C4-AHL, 3-oxo-C12-AHL or C7 HQ QS Pre-PMX-HA or QS + LPS Pre-PMX-HA vs. C4-AHL, 3-oxo-C12-AHL or C7 HQ QS Post-PMX-HA or QS + LPS Post-PMX-HA). However, the reduction of all QS molecules was higher in the presence of LPS (#p\u0026lt;0.05 C4-AHL, 3-oxo-C12-AHL or C7 HQ QS Post-PMX-HA vs. C4-AHL, 3-oxo-C12-AHL or C7 HQ QS + LPS Post-PMX-HA). Data are expressed as average±1 SD of 3 different experimental \u003cem\u003eex-vivo\u003c/em\u003ehemoadsorption procedures.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/3b5f63d600db015e47abd2d7.png"},{"id":76689360,"identity":"ac6b03ba-da5a-4de6-824a-a0b2a385e114","added_by":"auto","created_at":"2025-02-19 16:40:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":135232,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCytotoxic and pro-apoptotic effect of supernatants produced by wild-type or mutant \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eP. aeruginosa \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eon TEC\u003c/strong\u003e. Cytotoxic (XTT assay in A) and pro-apoptotic (TUNEL assay in B) effect of supernatants produced by wild-type P. aeruginosa strain (PAO1 in white columns) or by isogenic mutants defective in C4-AHL QS production (Rh1l in gray columns) on human TEC. In comparison to bacterial culture medium alone used as negative control (Luria-Bertani broth – LB in black columns), supernatants originated from PAO1 strain induced a dose-dependent cytotoxic (A) and pro-apoptotic (B) effect on TEC (*p\u0026lt;0.05 PAO1 5-10-25% vs. 1%). A similar but less marked cytotoxic (A) and pro-apoptotic (B) activity on TEC was observed using supernatants produced by Rh1l isogenic mutants (*p\u0026lt;0.05 Rh1l 5-10-25% vs. 1%). However, the cytotoxic (A) and pro-apoptotic (B) effect was significantly lower using Rh1l in comparison to PAO1 supernatants (#p\u0026lt;0.05 Rh1l 5-10-25% vs. PAO1 5-10-25%). Data are expressed as average±1 SD of three different experiments.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/247b70ee327e58d31a99bf41.png"},{"id":76689642,"identity":"d4d2d4f2-b8fe-4615-8d8b-a3586d68902a","added_by":"auto","created_at":"2025-02-19 16:48:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":165467,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCytotoxic and pro-apoptotic effect of C4-AHL\u003c/strong\u003e \u003cstrong\u003eQS on human TEC\u003c/strong\u003e. (A-B) Cytotoxic (XTT assay in A) and pro-apoptotic (TUNEL assay in B) effect of C4-AHL QS on TEC in presence or absence of 50 ng/ml LPS. In comparison to vehicle alone used as negative control (Vehicle), C4-AHL QS induced a significant decrease of TEC viability (A) and triggering of apoptosis (B) like those observed with 50 ng/ml LPS (*p\u0026lt;0.05 C4-AHL QS or LPS vs. Vehicle). The concomitant incubation of TEC with C4-AHL QS and LPS enhanced their cytotoxic and pro-apoptotic effects (* p\u0026lt;0.05 C4-AHL QS + LPS vs. Vehicle; #p\u0026lt;0.05 C4-AHL QS + LPS vs. C4-AHL QS or LPS). Data are expressed as average±1 SD of three different experiments. (C) Quantitative RT-PCR analysis showing the gene expression of\u003cstrong\u003e \u003c/strong\u003eTIMP-2 (black columns), IGFBP-7 (white columns) and NGAL (gray columns) in TEC challenged with different stimuli. In respect to vehicle alone (Vehicle), both C4-AHL QS and LPS significantly increased TIMP-2, IGFBP-7 and NGAL gene expression (*p\u0026lt;0.05 C4-AHL QS or LPS vs. Vehicle). The concomitant incubation of TEC with C4-AHL QS and LPS enhanced the gene expression of all tubular stress/injury biomarkers (* p\u0026lt;0.05 C4-AHL QS + LPS vs. Vehicle; # p\u0026lt;0.05 C4-AHL QS + LPS vs. C4-AHL QS or LPS). Data are expressed as average±1 SD of three different experiments. (D) ELISA of NGAL release from TEC challenged with different stimuli. In respect to vehicle alone (Vehicle), both C4-AHL QS and LPS significantly increased NGAL protein release from TEC (*p\u0026lt;0.05 C4-AHL QS or LPS vs. Vehicle). The concomitant incubation with C4-AHL QS and LPS enhanced NGAL production (* p\u0026lt;0.05 C4-AHL QS + LPS vs. Vehicle; # p\u0026lt;0.05 C4-AHL QS + LPS vs. C4-AHL QS or LPS). Data are expressed as average±1 SD of three different experiments.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/8f8b85cce051e68b1f0fcd5a.png"},{"id":76688253,"identity":"62d367ba-6491-47e4-ad7d-d487633217cf","added_by":"auto","created_at":"2025-02-19 16:32:51","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":192550,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eROS production induced by C4-AHL QS in TEC\u003c/strong\u003e. (A-B) Quantification (A) and representative micrographs (B) of immunofluorescence studies aimed to evaluate ROS production by TEC challenged with different stimuli. In respect to vehicle alone (Vehicle), C4-AHL QS induced a significant increase of ROS production like that observed in presence of 50 ng/ml LPS (*p\u0026lt;0.05 C4-AHL QS or LPS vs. Vehicle). The concomitant incubation with C4-AHL QS and LPS enhanced ROS production (*p\u0026lt;0.05 C4-AHL QS + LPS vs. Vehicle; #p\u0026lt;0.05 C4-AHL QS + LPS vs. C4-AHL QS or LPS). In A, data are expressed as average±1 SD of three different experiments. Similar results were observed for ROS quantification by FACS analysis (a representative experiment reporting the percentage of fluorescence positivity is shown in C).\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/47487948ceedc10fccc02691.png"},{"id":76688251,"identity":"6bee2180-b7e7-4fb8-87c6-75fb4a3bccd2","added_by":"auto","created_at":"2025-02-19 16:32:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":182732,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eModulation of mitochondrial function induced by C4-AHL QS in TEC\u003c/strong\u003e. (A-B) Representative micrographs (A) and quantification (B) of MitoTracker analysis of TEC in the presence of different stimuli. In comparison to vehicle alone (Vehicle), C4-AHL QS as well as 50 ng/ml LPS induced a significant decrease of mitochondrial membrane potential (*p\u0026lt;0.05 C4-AHL QS or LPS vs. Vehicle). The concomitant incubation with C4-AHL QS and LPS enhanced mitochondrial dysfunction (*p\u0026lt;0.05 C4-AHL QS + LPS vs. Vehicle; #p\u0026lt;0.05 C4-AHL QS + LPS vs. C4-AHL QS or LPS). In B, data are expressed as average±1 SD of three different experiments. (C) Quantification of immunofluorescence studies in TEC aimed to evaluate the expression of PGC-1alpha, a protein involved in mitochondrial biogenesis. In comparison to vehicle alone (Vehicle), C4-AHL QS as well as 50 ng/ml LPS induced a significant decrease of PGC-1alpha expression (*p\u0026lt;0.05 C4-AHL QS or LPS vs. Vehicle). The concomitant incubation with C4-AHL QS and LPS enhanced the loss of PGC-1alpha (*p\u0026lt;0.05 C4-AHL QS + LPS vs. Vehicle; #p\u0026lt;0.05 C4-AHL QS + LPS vs. C4-AHL QS or LPS). Data are expressed as average±1 SD of three different experiments.\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/61c838b6d5c21f6cf2a13de3.png"},{"id":76688255,"identity":"38b501f8-c383-46a0-b1ac-ba19996169e5","added_by":"auto","created_at":"2025-02-19 16:32:51","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":140587,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBiological effects of C4-AHL QS on TEC polarity and dedifferentiation.\u003c/strong\u003e (A-D) Evaluation of cell polarity assessed by trans-epithelial electrical resistance (TEER in A), immunofluorescence analysis of the tight junction molecule ZO-1 (B), of the endocytic receptor megalin (C) and FITC-labeled albumin adsorption (D) of TEC challenged with different stimuli. In comparison to vehicle alone (Vehicle), C4-AHL QS induced a significant decrease of TEER (A), ZO-1 (B) and megalin (C) expression and albumin reabsorption (D) in TEC: similar biological effects were observed in presence of 50 ng/ml LPS (*p\u0026lt;0.05 C4-AHL QS or LPS vs. Vehicle). The concomitant incubation with C4-AHL QS and LPS enhanced the decrease of TEC polarity, ZO-1/megalin staining and albumin uptake (*p\u0026lt;0.05 C4-AHL QS + LPS vs. Vehicle; #p\u0026lt;0.05 C4-AHL QS + LPS vs. C4-AHL QS or LPS). Data are expressed as average±1 SD of three different experiments.\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/a282f7031481de20be080aa8.png"},{"id":79789713,"identity":"6ab510a1-9795-4b5a-b344-d8d231a909c9","added_by":"auto","created_at":"2025-04-02 18:16:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2169789,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/8b296f18-66ae-484b-9aef-78d12da10945.pdf"},{"id":76689361,"identity":"8b4223c0-38fb-497b-9241-51de7b316981","added_by":"auto","created_at":"2025-02-19 16:40:51","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1182896,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6032315/v1/9e1cee189339b2d2fdce6adf.pptx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Polymyxin B Hemoadsorption efficiently removes Gram-Negative-derived Quorum Sensing molecules responsible for acute kidney tubular epithelial cell injury","fulltext":[{"header":"Background","content":"\u003cp\u003eIn the complex clinical spectrum of Acute Kidney Injury (AKI) affecting critically ill patients admitted to Intensive Care Unit (ICU), sepsis still represents the most frequent cause of renal dysfunction [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. As suggested by the 28th Acute Disease Quality Initiative (ADQI) workgroup, sepsis-associated AKI (SA-AKI) can be defined as the presence of a life-threatening organ failure caused by a dysregulated host response to infection (Sepsis-3 definition) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] and the concomitant occurrence of an abrupt episode of renal dysfunction based on serum creatinine levels and urinary output in conformity with the KDIGO 2012 criteria [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Recent clinical observations evidenced that the survival of SA-AKI patients is strongly correlated with the recovery of renal function, Moreover, when compared to other causes of acute loss of renal function in ICU, SA-AKI leads to higher mortality rates, increased length of hospital stays and development of comorbidities including a faster progression toward Chronic Kidney Disease (CKD) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRenal damage during sepsis cannot be simply ascribed to tissue hypoperfusion but also to biological mechanisms that are more immunologic in nature. Our group has previously demonstrated that septic plasma contains inflammatory and pro-apoptotic molecules able to induce a direct injury of Tubular Epithelial Cells (TEC) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. This is in accordance with the hypothesis that circulating Pathogen-Associated Molecular Pattern (PAMPs) and Damage-Associated Molecular Pattern (DAMPs) molecules can alter microcirculation and TEC metabolic functions, leading to acute damage and the development of early fibrosis distinctive of a maladaptive kidney repair process [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAmong PAMPs, endotoxin (lipopolysaccharide-LPS) is the most studied molecule: higher LPS levels are correlated with a worse outcome and the development of severe multiple-organ failure [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In the kidney, LPS induces a direct cellular damage through the activation of TLR4 and an indirect injury through the enhanced production and release of inflammatory mediators able to bind to specific receptors on TEC surface triggering apoptotic cell death and a further inflammatory reaction [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. For this reason, several clinical trials have been conducted with the aim to evaluate the removal of LPS by Polymyxin-B Hemoadsorption (PMX-HA), the most used extracorporeal blood purification therapy for this purpose and based on a veno-venous circuit in which blood comes in direct contact with a polymyxin B-immobilized polystyrene column: however, to date these studies have shown contradictory results [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOther bacterial fragments may have a role in the pathogenic mechanisms of SA-AKI. Quorum sensing (QS) molecules represent a biological system of transcriptional regulation dependent on cellular density used by both Gram-Negative and Gram-Positive bacteria for intercellular communication. The QS system is composed of a signal molecule (mainly an acylated homoserine lactone) able to diffuse from the cell of origin to the neighboring cells, triggering different metabolic pathways and cellular processes such as production of virulence factors, conjugation of plasmid transfer, bacterial growth, and biofilm formation [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Gram-Negative-derived QS molecules can be directly released by the infection source or by the gut following hypoperfusion-induced increase of permeability, thus reaching the bloodstream where they can interfere with different types of host tissues including kidney resident cells [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Our group has previously developed an analytical model based on liquid chromatography-mass spectrometry (LC-MS) for the detection and quantification of different QS molecules such as Acyl homoserine lactones (AHL) and Hydroxyquinolones (HQ) in biofluids [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe aims of this study were: 1) to confirm the presence of different QS molecules (AHL and HQ families) in blood and urine of septic patients and to investigate their clinical significance; 2) to evaluate the detrimental effects induced by QS on TEC \u003cem\u003ein vitro\u003c/em\u003e and the potential interplay between QS and LPS; 3) to assess the role of PMX-HA in reducing QS blood levels and consequently TEC injury.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePatients and treatments\u003c/h2\u003e \u003cp\u003eThis is a prospective, observational, and monocentric translational study designed to evaluate the presence of QS family members in biofluids of septic patients and the effectiveness of PMX-HA in removing these bacterial molecules from the bloodstream. All patients admitted to the ICU of the University of Foggia Academic Hospital were considered for enrollment in the study from April 2019 to February 2022. Local ethics committee approved the protocol and written informed consent was obtained from each patient or next of kin. A physician not involved in the study was always present for patient care. Inclusion criteria were: age\u0026thinsp;\u0026gt;\u0026thinsp;18 years, diagnosis of septic shock (Sepsis-3 criteria [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] treatment with PMX-HA. Exclusion criteria were: patients younger than 18 years old, pregnant women, patients with confirmed hypersensitivity to PMX-B antibiotic.\u003c/p\u003e \u003cp\u003eThe following parameters were analyzed at ICU admission: demographic data, SOFA score, procalcitonin (PCT), AKI grading according to KDIGO 2012 criteria based on both serum creatinine and urinary output [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], WBC, RBC, platelet count and Endotoxin Activity (EA) (Spectral Medical Inc., Toronto, Canada) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. All patients were treated in accordance with the local clinical practice for the management of sepsis and multiple organ failures. Extracorporeal removal of LPS from whole blood was achieved by PMX-HA (Toraymyxin\u0026reg;, Toray Medical Co. Ltd., Tokyo, Japan). Briefly, PMX-HA was performed using a hemoadsorption module (Estorflow\u0026reg;, Estor, Pero, Italy) running at an average blood flow of 100 ml/min and using unfractionated heparin anticoagulation according to manufacturer\u0026rsquo;s protocol. A double-lumen dialysis catheter (12 French diameter) was inserted into a central vein and used as venous access. PMX-HA was performed twice, the second treatment 24 hours after the first one: each PMX-HA session lasted 2 hours.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBlood and urine sample collection\u003c/h3\u003e\n\u003cp\u003ePlasma and urine samples were collected at different times as follows: T1: Baseline/Start of the first PMX-HA treatment; T2: End of the first PMX-HA treatment; T3: Start of the second PMX-HA treatment; T4: End of the second PMX-HA treatment.\u003c/p\u003e \u003cp\u003ePlasma samples were obtained by two-step centrifugation (first step: 2000\u0026times;g for 10 minutes; second step: 2500\u0026times;g for 10 minutes). Urine samples were obtained from the bladder catheter, drawn from each patient with a 20 ml syringe and immediately transferred to sterile tubes. Supernatants were obtained by one-step urine centrifugation at 2500\u0026times;g for 10 minutes. All biological samples were stored in a controlled cryocontainer at \u0026ndash; 80\u0026deg;C until use.\u003c/p\u003e\n\u003ch3\u003eChemicals and Liquid Chromatography-Mass Spectrometry (LC-MS)\u003c/h3\u003e\n\u003cp\u003eAnalytical standards (purity\u0026thinsp;\u0026gt;\u0026thinsp;98%) of N-butanoyl-L-homoserine lactone (C4-AHL), N-(3-oxododecanoyl)-L-homoserine lactone (3-oxo-C12-AHL) and 2-Heptyl-3-hydroxy-4(1H)-quinolone (C7 HQ) were purchased from Merck KGaA (Rome, Italy). Stock solutions were prepared with a concentration of 1000 mg/L using methanol and stored at -4\u0026deg;C until use. Further dilutions were obtained in 0.1% formic acid in water/acetonitrile 60:40. All aqueous solutions were prepared with HPLC-grade water from MilliQ System Academic (Millipore, Milan, Italy). Ethyl acetate for HPLC-MS grade, acetonitrile and methanol hyper grade for LC-MS, and formic acid were purchased from VWR International (Milan, Italy). Aliquoys of 200 \u0026micro;L plasma or urine were spiked with ND3 internal standard (IS) with a final concentration of 200 \u0026micro;g/L. Samples were then extracted twice with 1 mL of ethyl acetate. After the addition of organic solvent, each sample was centrifuged at 5000 g \u0026times; 5 min RT and the organic fractions were collected and dried under a gentle stream of nitrogen heating at 40\u0026deg;C. Finally, the residue was reconstituted in 100 \u0026micro;L of 0.1% formic acid in water/acetonitrile 60:40. The chromatographic separations were run on a Phenomenex Luna C18 column, 150 \u0026times; 2.0 mm, 3 \u0026micro;m particle size (Phenomenex, Bologna, Italy), thermostated at 45\u0026deg;C. The injection volume was 10 \u0026micro;L and flow rate 200 \u0026micro;L/min. A gradient mobile phase composition was adopted: 40:60 to 0:100 formic acid 0.1% in water/methanol in 19 min. A Shimadzu Nexera (Shimadzu, Kyoto, Japan) X2 UPLC coupled with a Sciex 5500 Q-trap mass spectrometer (Sciex, Framingham, MA, USA) equipped with a Turbo Ion Spray atmospheric pressure interface (ESI ion source) was used. The LC column effluent was delivered into the ion source using nitrogen as sheath and auxiliary gas. The ion source temperature was set at 500\u0026deg;C and the needle voltage at the 5.5 kV value. The acquisition method used was previously optimized in the tuning sections for the analyte ion (capillary, magnetic lenses and collimating multipoles voltages) in order to achieve the maximum of sensitivity. Spectra were acquired in the positive ion MRM mode [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eEx-vivo PMX-HA experimental model\u003c/h3\u003e\n\u003cp\u003eAn experimental model of PMX-HA was developed \u003cem\u003eex-vivo\u003c/em\u003e to mimic the clinical setting using mini-cartridges containing PMX-B kindly provided by Toray Medical Co. Ltd. Briefly, the circuit was a closed loop hemoadsorption system with sampling sites before and after the PMX-B mini-cartridge. For the experimental purpose, whole blood was treated with 1 mg bacterial LPS for 4h in a water bath at 37\u0026deg;C and then overnight at room temperature [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The day after, blood was heparinized (5000 U), recalcified (calcium chloride 10%, 44 \u0026micro;l/ml blood) and diluted 1:1 with isotonic saline solution before the use for \u003cem\u003ein vitro\u003c/em\u003e hemoadsorption. The next step was the addition of the QS molecules C4-AHL, 3-oxo-C12-AHL or C7 HQ in presence or absence of LPS: all chemicals were diluted in activated blood at a final concentration of 50 ng/ml. Circuit anticoagulation was performed with unfractioned heparin (2500U initial bolus and subsequent 1000U/hr). To fully simulate the clinical setting, \u003cem\u003eex vivo\u003c/em\u003e PMX-HA was performed for 2 hr with a blood flow rate (Qb) of 1 ml/min. Blood samples were collected at the start and at the end of PMX-HA and stored at \u0026minus;\u0026thinsp;80\u0026deg;C until LC-MS analysis as previously described.\u003c/p\u003e\n\u003ch3\u003eBacterial cultures\u003c/h3\u003e\n\u003cp\u003eTwo different \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e strains were used for bacterial cultures: wild-type PAO1 strain and its isogenic mutant RhlI defective in the synthesis of C4-AHL QS. All bacterial strains were cultured in Luria-Bertani (LB) broth enriched for nutrients. Bacterial media were prepared as previously described by Orlandi et al. [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] by centrifugation for 10 min at 12,000 rpm RT, and the supernatants were then collected and filtered using a Minisart RC15 0.20 mm (Sartorius, Gottingen, Germany).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eIn vitro studies on human tubular epithelial cells (TECs)\u003c/h2\u003e \u003cp\u003eHuman tubular epithelial cells (TECs) were isolated from kidneys removed by surgical procedures from patients affected by renal carcinomas and characterized as previously described [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] before the use for the following \u003cem\u003ein vitro\u003c/em\u003e assays.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCytotoxicity\u003c/strong\u003e \u003cp\u003eTECs were cultured on 24-well plates (Falcon Labware, Oxnard, CA, USA) at a concentration of 5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/ well and incubated with different stimuli in the presence of 250 \u0026micro;g/ml XTT (Sigma, St. Louis, MO, USA) in a medium lacking phenol red. The absorption values at 450 nm were measured in an automated spectrophotometer at different time points. All experiments were performed in triplicate [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eApoptosis\u003c/strong\u003e \u003cp\u003efor detection of apoptosis by TUNEL assay, TECs were incubated with different stimuli, fixed with 4% paraformaldehyde, and then subjected to terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay (ApopTag, Oncor, Gaithersburg, MD, USA) that identifies DNA fragmentation, a typical feature of apoptotic cells. Green-stained apoptotic cells were counted in different microscopic fields at \u0026times;100 magnification. Each experiment was performed in triplicate and results are given as average number of apoptotic cells/field\u0026thinsp;\u0026plusmn;\u0026thinsp;1SD [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eQuantitative RT-PCR for TIMP-2, IGFBP-7 and NGAL\u003c/strong\u003e \u003cp\u003eTotal RNA was extracted by stimulated TEC using the RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA).RNA yield and quality was determined using a NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, Delaware USA). Complementary cDNA was generated by reverse transcription of 2 \u0026micro;g of high quality total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The measurement of TIMP-2. IGFBP-7 and NGAL mRNA levels was performed by SYBR green qRT-PCR analysis using the ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) and SYBR FAST (Applied Biosystems, Foster City, CA). The following primers (Sigma Aldrich, St. Louis, Missouri) were used\u003c/p\u003e \u003c/p\u003e \u003cp\u003eTIMP-2 forward: 5\u0026prime;CGTAGTGATCAGAGCCAAGC3\u0026prime;, TIMP-2 reverse: 5\u0026prime;TCTGCCTTTCCTGCAATTAGA3\u0026prime;;\u003c/p\u003e \u003cp\u003eIGFBP-7 forward: 5\u0026prime;GAACAAGGTAAAAAGGGGTCAC3\u0026prime;; IGFBP-7 reverse: 5\u0026prime;ATGTAAGGCATCAACCACTGTA3\u0026prime;;\u003c/p\u003e \u003cp\u003eNGAL forward: 5\u0026prime;GGAAAAAGAAGTGTGACTACTG3\u0026prime;, NGAL reverse: 5\u0026prime;GTAACTCTTAATGTTGCCCAG3\u0026prime;;\u003c/p\u003e \u003cp\u003eGAPDH forward 5\u0026prime;ACAGTTGCCATGTAGACC3\u0026prime;, GAPDH reverse 5\u0026prime;TTTTTGGTTGAGCACAGG3\u0026prime;.\u003c/p\u003e \u003cp\u003eRelative quantification was performed using the standard curve method. The results for the target gene expression were normalized on GAPDH as endogenous control, and the mean values of the vehicle were set as the calibrator.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNGAL ELISA\u003c/strong\u003e \u003cp\u003eNGAL protein levels were also determined by ELISA in TEC supernatants in different experimental conditions (R\u0026amp;D Systems, Minneapolis, MN). Results were calculated after the generation of a standard curve with appropriate controls and given as average\u0026thinsp;\u0026plusmn;\u0026thinsp;1SD.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTrans-epithelial electrical resistance (TEER)\u003c/strong\u003e \u003cp\u003eTrans-epithelial electrical resistance (TEER) was used as an indicator of TEC polarity. Cells were plated in transwells on collagen-coated polycarbonate membranes (Corning Costar Corp., Cambridge, MA, USA) and allowed to reach confluence before the addition of different stimuli. An epithelial volt-ohm meter (EVOM; World Precision Instruments, Inc., Sarasota, FL, USA) was used to determine TEER values as previously described [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. All measures were performed in triplicate and normalized for the area of the membrane.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eDetection of FITC-conjugated albumin uptake by TEC\u003c/em\u003e: Albumin uptake was studied after incubation of TECs with different stimuli for 12 hrs and then with 50 mg/ml of FITC-conjugated human albumin (Sigma, St. Louis, MO, USA) at 37\u0026deg;C for 2 hrs: after FITC-albumin challenge, TEC were extensively washed twice with cold 1x PBS and analyzed by FACS [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eImage-iT LIVE Green Reactive Oxygen Species (ROS) Detection Kit\u003c/em\u003e: Image-iT LIVE Green Reactive Oxygen Species (ROS) Detection Kit was used to analyze cellular oxidative stress as suggested by manufacturer (Life Technologies, Carlsbad, CA). Briefly, 5-(and-6)-carboxy-2',7'-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA) was added to TEC cultured in different experimental conditions: after 30 min, cells were fixed with 4% paraformaldehyde and then counterstained with Hoechst and analyzed by Immunofluorescence or FACS analysis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eImmunofluorescence and FACS studies\u003c/em\u003e: After appropriate stimuli, cultured TEC were fixed in ethanol/acetic acid 2:1 and stained with appropriate antibodies for immunofluorescence or FACS studies. Briefly, the analysis of the mitochondrial protein PGC-1α, the tight junction protein ZO-1 and the endocytic receptor megalin were performed using primary antibodies (Santa Cruz Biotech, Santa Cruz, CA) and Alexa Fluor 488\u0026ndash;conjugated secondary anti-isotype antibodies (Life Technologies, Carlsbad, CA, USA). Immunofluorescence studies for mitochondrial membrane potential was assessed by the fluorescent dye MitoTracker Red 7513 (reduced chloromethyl-X-rosamine from Invitrogen) as previously described [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll clinical and experimental data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;1SD: continuous data are presented as mean and standard deviation or median and range. Statistical analysis was performed by analysis of variance and multiple comparisons with ANOVA and Newmann-Keuls multicomparison test or Student\u0026rsquo;s t-test where appropriate. P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered as the threshold for statistical significance. Statistical analysis was performed using SPSS-statistical software, version 21.0 (SPSS Inc. Chicago, IL).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cem\u003e\u003cu\u003ePatients\u0026rsquo; characteristics and treatments\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe enrolled in the study 31 patients with septic shock admitted to the ICU of the University of Foggia Academic Hospital. The baseline demographic and clinical characteristics of patients at study admission are summarized in Table 1: briefly, mean age of the cohort was 64.96\u0026plusmn;15.1 years and 52% were males. SOFA mean value was 13.14\u0026plusmn;2.8: of note, 18/31 (58%) showed a SOFA score \u0026gt;12, with an expected mortality rate higher than 50%. At ICU admission, all patients were sedated and ventilated, 29/31 patients (93.5%) required i.v. support with norepinephrine to achieve MAP \u003cu\u003e\u0026gt;\u003c/u\u003e65 mmHg and adequate ventriculo-arterial recoupling. Furthermore, 14/29 patients (48.27%) needed a supplementary cathecolamine administration (dopamine, dobutamine or levosimendan). The mean BMI of the whole population was 28.37\u0026plusmn;7.2 (Table 1). AKI grading based on serum creatinine levels and urinary output according to the KDIGO criteria is also reported in Table 1: 13/31 patients (42%) were not included in KDIGO criteria (no AKI group), whereas 18/31 (58%) were classified as AKI patients and graded as follows: stage 1: 5/31 (16%); stage 2: 6/31 (19%); stage 3: 7/31 (23%). Moreover, 6/31 patients (19%) required Renal Replacement Therapy (RRT) during ICU stay in accordance with the standard clinical indications of the center. Concerning other organ dysfunction, 11/31 patients (35.5%) showed a PaO\u003csub\u003e2\u003c/sub\u003e/FiO\u003csub\u003e2\u003c/sub\u003e ratio between 100-200 mmHg and 18/31 (58%) between 200-300 mmHg.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. Patients\u0026rsquo; characteristics at study enrolment (T0)\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMa\u003c/strong\u003e\u003cstrong\u003eles\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eFe\u003c/strong\u003e\u003cstrong\u003emales\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e16/31 (52%)\u003c/p\u003e\n \u003cp\u003e15/31 (48%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge (Yrs)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e64.96 \u0026plusmn; 15.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBMI (Kg/m\u003csup\u003e2\u003c/sup\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e28.37 \u0026plusmn; 7.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSOFA score\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e13.14 \u0026plusmn; 2.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e\u0026lt; 12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e13/31 (42%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u0026gt; 12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e18/31 (58%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePaO\u003csub\u003e2\u003c/sub\u003e/FiO\u003csub\u003e2\u003c/sub\u003e (mmHg)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e\u0026lt; 100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e2/31 (6.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e100 -200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e11/31 (35.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003e200-300\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e18/31 (58%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAKI (KDIGO criteria)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eStage 0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e13/31 (42%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eStage 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e5/31 (16%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eStage 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e6/31 (19%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eStage 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e7/31 (23%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eNeed of RRT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e6/31 (19%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eOutcome\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eDischarge from ICU\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e16 (52%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eDeath in ICU\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e15 (48%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLength of ICU stay (days)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eSurvivors\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e11,8\u0026plusmn;8.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 34.6154%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 46.4615%;\"\u003e\n \u003cp\u003eDead\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 18.9231%;\"\u003e\n \u003cp\u003e12,2\u0026plusmn;13,7\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe main causes of sepsis and the sources of infections were intestinal perforation, surgical anastomosis dehiscence, fistulae and acute cholangitis. PMX-HA was performed at least once in all 31 patients; 2/31 (6%) received only one PMX-HA treatment, 25/31 (81%) were subjected to two and 4/31 (13%) to four PMX-HA sessions. Of the 31 patients, 16 were transferred to hospital wards, whereas 15 did not survive; the overall survival rate to ICU discharge was 52%. Among the survivors, the average length of ICU stay was 11.8\u0026plusmn;8.8 days, compared to 12.2\u0026plusmn;13 days observed for dead patients. In 29/31 enrolled patients, the clinical course of sepsis and organ dysfunction including the response to antibiotics and extracorporeal blood purification therapies was assessed daily by monitoring procalcitonin (PCT) and lactate levels at different time points up to 120 hrs after the first PMX-HA treatment (Table 2). Moreover, in 12/31 patients, we also evaluated Endotoxin Activity (EA) at T1 and T4 (Table 2).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Blood procalcitonin (PCT), Lactate and Endotoxin Activity (EA) of enrolled patients at different time points (T1: before PMX-HA #1; T2: after PMX-HA #1; T3: before PMX-HA #2; T4: after PMX-HA #2).\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"643\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eT1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eT2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eT3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eT4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePCT (pg/ml)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(n=29)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e41.36\u0026plusmn;54.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e11.62\u0026plusmn;19.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e44.25\u0026plusmn;56.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e26.56\u0026plusmn;36.4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBLOOD LACTATE LEVELS (mmol/l)\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(n=29)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.8\u0026plusmn;1.8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e2.4\u0026plusmn;2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.9\u0026plusmn;1.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e1.9\u0026plusmn;1.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eEA\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e(n=12)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9067%;\"\u003e\n \u003cp\u003e0.73\u0026plusmn;0.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e/\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.0622%;\"\u003e\n \u003cp\u003e0.48\u0026plusmn;0.25\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eQS quantification in blood and urine samples, clinical correlations and effects of PMX-HA\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. 1, at study admission (T1) the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ were found in patients\u0026rsquo; blood and urine. The most abundant QS family member in blood was C4-AHL (4.11\u0026plusmn;0.9 ng/ml) followed by C7 HQ (1.35\u0026plusmn;0.7 ng/ml) and then 3-oxo-C12-AHL (0.38\u0026plusmn;0.1 ng/ml). Similar results were observed in urinary samples (C4-AHL: 3.49\u0026plusmn;0.7 ng/ml; C7 HQ: 0.89\u0026plusmn;0.3 ng/ml; 3-oxo-C12-AHL: 0.11\u0026plusmn;0.01 ng/ml, respectively). Always at T1, among all the evaluated clinical and laboratory parameters, we found the following significant direct correlations: blood 3-oxo-C12-AHL and blood EA (p=0.0275); blood C7 HQ and blood EA (p=0.0075); urine 3-oxo-C12-AHL and serum procalcitonin (p=0.05); urine C4-AHL and blood WBC (p=0.0123); urine 3-oxo-C12-AHL and serum creatinine (p=0.05). Moreover, we also found an inverse correlation between blood C4-AHL and PaO\u003csub\u003e2\u003c/sub\u003e/FiO\u003csub\u003e2\u003c/sub\u003e (p=0.0284).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe first PMX-HA treatment significantly reduced all the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ in blood (Fig. 1A) as well as in urine (Fig. 1B) of enrolled patients. A new increase of all QS molecules was observed between the end of the first and the start of the second PMX-HA treatment (Fig. 1A-B). The second PMX-HA treatment newly reduced plasma and urine QS levels (Fig. 1A-B): the greater reduction of all QS molecules in biofluids was observed between T1 and T4 (Fig. 1A-B).\u003c/p\u003e\n\u003cp\u003eTo confirm the significant QS reduction observed after PMX-HA treatment, we set-up an \u003cem\u003eex-vivo\u003c/em\u003e model of hemoadsorption using minicartridges loaded with PMX-B (see Methods and Fig. 2A). For this purpose, we added C4-AHL, 3-oxo-C12-AHL and C7 HQ QS (final concentrations of 50 ng/ml each) to whole blood and we performed hemoadsorption for 2 hrs at 1 ml/min blood flow rate in presence or absence of 50 ng/ml LPS, using heparin as anticoagulation strategy to fully mimic the clinical setting. We observed a significant reduction of all QS molecules in blood after PMX-HA (Fig. 2B-D), but not with a sham device (the same minicartridge without PMX-B, not shown). Of note, the decrease of all the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ was significantly higher in the presence of LPS (Fig. 2 B-D), suggesting a potential interaction between the two bacterial molecules during hemoadsorption.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eIn vitro studies on human Tubular Epithelial Cells (TEC)\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAs a first step to evaluate the biological effects of QS on cultured human TEC, we used supernatants produced by 2 different \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e strains [15]: wild-type PA01 strain and its isogenic mutant Rh1l defective in the synthesis of C4-AHL, the most abundant QS molecule identified in biofluids of enrolled patients. In respect to experimental control (Luria-Bertani broth alone), supernatants produced by both wild-type PA01 and mutant RhlI strains induced a dose-dependent cytotoxic (Fig. 3A) and pro-apoptotic (Fig. 3B) effect on TEC: however, the deleterious effect of RhlI was significantly lower than that observed in the presence of PA01 supernatant, suggesting that C4-AHL QS knock-down may limit TEC injury (Fig. 3A-B).\u003c/p\u003e\n\u003cp\u003eThe following experiments were then performed using the commercially available C4-AHL QS: we first established a dose-response test finding that 100 ng/ml C4-AHL QS induced about a 50% decrease of TEC viability (data not shown) after 24 hr of incubation and we then used this concentration for all the following \u003cem\u003ein vitro\u003c/em\u003e experiments. C4-AHL QS induced a cytotoxic (Fig. 4A) and pro-apoptotic (Fig. 4B) effect on TEC like that observed with 50 ng/ml LPS. The co-incubation of C4-AHL QS and LPS resulted in a significant increase of TEC death (Fig. 4A-B). We then investigated the gene expression of the well-established biomarkers of TEC stress or injury TIMP-2/IGFBP-7 and NGAL, respectively: C4-AHL QS and LPS both induced a significant increase of mRNA coding for all tubular biomarkers (Fig. 4C). Also in this case, the association of C4-AHL QS and LPS enhanced TIMP-2, IGFBP-7 and NGAL expression (Fig. 4C). Similar results were observed for the detection of NGAL protein by ELISA in supernatants of TEC challenged with different stimuli (Fig. 4D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAs detected by representative immunofluorescence micrographs and relative quantification (Fig. 5A-B) as well as by FACS analysis (Fig. 5C), C4-AHL QS and LPS augmented ROS production by TEC, with a further increase in the presence of both bacterial molecules.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOne of the key features of SA-AKI is mitochondrial dysfunction: for this reason, we assessed the role of C4-AHL QS in mitochondrial alterations and expression of PGC-1alpha, a protein essential for mitochondrial biogenesis that has been shown to be down-regulated in TEC during SA-AKI. We found that C4-AHL QS induced mitochondrial dysfunction in TEC likewise LPS as confirmed by the specific staining with the red fluorescent dye MitoTracker (Fig. 6A-B), a marker of mitochondrial membrane potential, and by the down-regulation of PGC-1alpha (Fig. 6C). \u0026nbsp; As previously described, also for mitochondrial alterations, C4-AHL QS and LPS exerted an additional negative effect on TEC (Fig. 6A-C).\u003c/p\u003e\n\u003cp\u003eSince we have previously demonstrated that plasma drawn from septic patients induced not only apoptotic cell death but also some functional alterations in TEC, we evaluated the biological effects of a short time exposure (6-12 hr) of 100 ng/ml C4-AHL QS in the presence or absence of 50 ng/ml LPS. We observed that C4-AHL QS as well as LPS significantly reduced trans-epithelial electrical resistance (TEER), a marker of cell polarity defined as the capacity of TEC to maintain two distinct fluid-filled compartments with precise electrolyte concentrations (Fig. 7A). The loss of TEC polarity was associated with the C4-AHL QS-induced down-regulation of the tight junction molecule ZO-1 (Fig. 7B) and of the endocytic receptor megalin (Fig. 7C), a protein located on TEC luminal surface essential for re-absorption of low molecular weight proteins from glomerular ultrafiltrate. The C4-AHL QS-induced decrease of megalin expression was also associated with a significant reduction of albumin uptake by stimulated TEC (Fig. 7D). The co-incubation of TEC with C4-AHL QS and LPS further worsened loss of TEC polarity, albumin uptake, down-regulation of ZO-1 and megalin expression (Fig. 7 A-D).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, we found that QS bacterial molecules belonging to both the AHL (C4, 3-oxo-C12) and HQ (C7) families are present in blood and urine of septic patients and can be detected by using a specific LC-MS method previously developed by our group. C4-AHL, the most abundant QS molecule found in biofluids, can induce cytotoxicity and apoptotic death of TEC \u003cem\u003ein vitro\u003c/em\u003e: this detrimental effect of QS was confirmed by the up-regulation of biomarkers of TEC stress and injury such as TIMP-2, IGFBP-7 and NGAL and by the increased production of ROS leading to mitochondrial dysfunction, oxidative stress and, finally, cell death. Moreover, C4-AHL induced some earlier functional alterations of TEC such as loss of cell polarity, decrease of albumin uptake, down-regulation of the tight junction protein ZO-1 and of the endocytic receptor megalin, all key features of experimental models of SA-AKI. The detrimental properties of QS on TEC were enhanced by the presence of LPS, suggesting an additional negative effect of these two bacterial molecules in SA-AKI. Of note, \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e data suggested that PMX-HA, the most common used extracorporeal blood purification therapy for LPS removal, could also reduce QS levels, thus limiting TEC injury and consequently AKI development and progression.\u003c/p\u003e \u003cp\u003eSepsis, the systemic host response to infections, represents the most frequent cause of AKI and multiple organ dysfunction syndrome in critically ill patients admitted to ICU. Fiorentino et al. recently showed that long-term survival of patients with SA-AKI is strongly influenced by the recovery of renal function [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The pathogenic mechanisms of SA-AKI have not been yet fully elucidated: however, to date the main working hypothesis is that mediators directly released by bacteria (PAMPs) and/or by injured cells (DAMPs) play a key role in the development of sepsis-induced AKI (SI-AKI), a subphenotype of SA-AKI in which sepsis itself is the primary driver of kidney damage in absence of other causes [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Kidney resident cells including microvascular endothelial cells (EC) located in glomerular and peritubular capillaries and TEC are injured during SA-AKI with different biological mechanisms. Functional alterations of EC are responsible for the enhanced vasoconstriction and for the triggering of the coagulation and complement cascades, key elements of a specific endotype of SA-AKI associated with microvascular derangement [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In the presence of an inflammatory microenvironment, EC have been shown to undergo endothelial-to-mesenchymal transition (EndMT), a biological process characterized by the loss of endothelial antigens and the concomitant acquirement of a fibroblast-like phenotype that may favor the progression toward tissue fibrosis [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In TEC, the above-described inflammatory microenvironment can lead to a series of sublethal and lethal modifications causing metabolic imbalance, functional alterations, triggering of cellular apoptosis or senescence and epithelial-to-mesenchymal transition with consequent tubulo-interstitial fibrosis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] These findings are in accordance with the peak concentration hypothesis proposed by Ronco et al. some years ago [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and with experimental data from different groups including our showing that plasma derived from patients with sepsis can induce functional alterations and apoptosis of TEC [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAmong PAMPs, LPS, the most studied mediator of SA-AKI, can interact with TLR4 located on TEC inducing a direct cellular dysfunction through the triggering of different intracellular pathways, including the down-regulation of Klotho: Klotho reduction can mediate LPS-induced TEC inflammation and oxidative stress through the decreased activation of the anti-senescent molecule Nrf2 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In addition, LPS induced an enhanced release of inflammatory cytokines such as TNF-alpha, Fas-Ligand and CD40-Ligand by circulating immune cells and by local renal resident cells. These inflammatory molecules are biomarkers of worse outcome in sepsis and can interact with their specific receptors (TNF-R, Fas, CD40) located on TEC surface triggering apoptotic cell death [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and inducing the down-regulation of sodium, chloride, glucose and urea transporters, thus leading to the loss of cell polarity, the functional characteristic of mature epithelial cells to maintain two distinct fluid-filled compartments with precise electrolyte concentrations [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition to LPS, other bacteria-derived molecules can play a pivotal role in the pathogenic mechanisms of SA-AKI. In the early 1970s, signalling among bacteria \u003cem\u003evia\u003c/em\u003e self-produced factors was proposed as a chemical form of proto-communication, laying the foundations for \u0026ldquo;social microbiology\u0026rdquo;. Microbiologists discovered that luciferase expression in marine \u003cem\u003eVibrio\u003c/em\u003e spp. was auto-induced by molecules released by bacteria themselves [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Ten years later, Eberhard et al. identified in \u003cem\u003eVibrio fischeri\u003c/em\u003e three parts involved in microbial communication: the autoinducer N-3-oxohexanoyl-L-homoserine lactone (3OC6-HSL), \u003cem\u003eluxI\u003c/em\u003e gene codifying for the autoinducer synthase and \u003cem\u003eluxR\u003c/em\u003e codifying for the transcriptional factor [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. However, further 10 years were necessary to recognize \u003cem\u003eluxI\u003c/em\u003e-luxR as the paradigm of Quorum Sensing (QS), the main model of microbial communication at the present time [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eQS molecules are produced by both Gram-Positive and Gram-Negative bacteria: however, Gram-Positive bacteria are shown to communicate via chemical signals different from lactones produced by the Gram-Negative ones; for example, \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e use small peptides and cyclic peptides, respectively [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. The improvement of knowledge in the QS field was due to deep investigations on \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e, the most notorious opportunistic pathogen involved in several clinical infections that can result in sepsis. In this Gram-Negative species, the QS machinery influences the expression of toxins and virulence factors, biofilm development, production of secondary metabolites, and stress adaptation mechanisms [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In \u003cem\u003eP. aeruginosa\u003c/em\u003e, and generally in Gram-Negative bacterial species, two of the most relevant molecules for their numerous biological activities are represented by Acyl homoserine lactones (AHL) and Hydroxyquinolones (HQ) [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In this study, we observed that the QS molecules C4-AHL, 3-oxo-C12-AHL and C7 HQ were detected in blood as well as in urine of septic patients: of relevance, C4 AHL was the most abundant QS molecule detected in biofluids. The concentration of the different AHL and HQ QS molecules showed a linear correlation with blood levels of endotoxin detected by EA, inflammatory/sepsis biomarkers such as PCT and WBC count and parameters of organ dysfunction such as PaO\u003csub\u003e2\u003c/sub\u003e/FiO\u003csub\u003e2\u003c/sub\u003e and serum creatinine levels.\u003c/p\u003e \u003cp\u003eAnother finding of this study is that QS signalling represents a potential way of crosstalk between the prokaryotic and eukaryotic worlds in an intriguing interkingdom communication. QS molecules have been shown to play a role in immune system deregulation frequently observed in sepsis: 3-oxo-C12-AHL triggers apoptosis and functional alterations of dendritic cells and CD4\u0026thinsp;+\u0026thinsp;T cells modulating cytokine production [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In addition, 3-oxo-C12-AHL and C4-AHL can accelerate neutrophil and monocyte apoptosis in sepsis models and 3-oxo-C12-AHL combined with LPS, increases the production of IL-10, an anti-inflammatory cytokine that reduces neutrophil phagocytic ability [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. QS molecules can also be involved in sepsis-associated microvascular dysfunction through the induction of endothelial cell death mediated by the RIPK1 pathway and triggering of the coagulation cascade [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. To date, little is known about the biological effects of QS molecules on kidney resident cells and their potential role in SA-AKI. We herein demonstrated that C4-AHL, the most abundant QS molecule found in blood and urine of septic patients, induced \u003cem\u003ein vitro\u003c/em\u003e TEC injury and functional alterations commonly observed in SA-AKI. C4-AHL triggered a dose-dependent cytotoxic and pro-apoptotic effect on TEC as confirmed by the presence of DNA fragmentation and by the increased expression of mRNA coding for stress and damage biomarkers such as TIMP-2, IGFBP-7 and NGAL. The cytotoxic effect exerted by QS on TEC can be at least in part ascribed to ROS generation and mitochondrial dysfunction. We herein showed that C4-AHL is also able to alter TEC polarity as demonstrated by the down-regulation of the tight junction protein ZO-1 and of the endocytic receptor megalin. These sub-lethal alterations induced by QS in TEC may have a key role in some clinical findings frequently observed during SA-AKI such as the increase of permeability leading to tissue edema and the development of low-molecular weight proteinuria [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe specificity of the detrimental biological activities exerted by QS on TEC was confirmed by using supernatants collected by an isogenic mutant of \u003cem\u003ePseudomonas aueruginosa\u003c/em\u003e (Rh1l) defective in the synthesis of C4-AHL. Moreover, \u003cem\u003ein vitro\u003c/em\u003e data suggested that C4-AHL may synergize with LPS in the pathogenic mechanisms of SA-AKI.\u003c/p\u003e \u003cp\u003eBased on these observations, we investigated the potential concomitant removal of QS and LPS by PMX-HA, the most used extracorporeal blood purification therapy for endotoxemic shock: the clinical benefits of PMX-HA in this clinical setting have been evaluated by several RCTs with conflicting results over the last years. The EUPHAS study was the first multicenter RCT using PMX-HA: despite the low number of enrolled patients and the premature termination, PMX-HA significantly reduced 28-day mortality in comparison to standard therapy [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. These results were not confirmed by the ABDO-MIX RCT in France, in which 28-day mortality was not significantly different between the two groups [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]: however, some potential bias of this RCT should be emphasized, including the low mortality rate in the control group and the high incidence of circuit clotting in the PMX-HA-treated group. Registry studies like the EUPHAS2 confirmed the feasibility of PMX-HA showing its clinical benefits without significant adverse effects [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In the more recent EUPHRATES RCT, PMX-HA in addition to conventional medical therapy failed to reduce 28-day mortality [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]: however, a post-hoc analysis of the study revealed that in patients with EA between 0.6 and 0.89, a positive effect on mean arterial pressure, ventilator-free days and mortality was observed [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. In this high-risk category of septic patients, the TIGRIS RCT is still ongoing to confirm the potential beneficial effects of PMX-HA [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Furthermore, another post-hoc analysis including 1911 septic patients included in the JSEPTIC-DIC study and 286 patients with endotoxemic septic shock always from the EUPHRATES RCT demonstrated that in subjects with abnormal coagulation (PT-INR\u0026thinsp;\u0026gt;\u0026thinsp;1.4) and hyperlactatemia (lactate\u0026thinsp;\u0026gt;\u0026thinsp;3 mmol/L), PMX-HA was significantly associated with a higher 28-day survival rate [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Despite the lack of a definite evidence on mortality, other studies showed some potential clinical benefits of PMX-HA in specific settings such as the modulation of immune system: PMX-HA has been shown to decrease macrophage and monocyte activity and to increase the expression of HLA-DR on monocytes, a critical step of the immune response in sepsis and related to a better outcome [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Furthermore, our group previously showed a plausible protective effect of PMX-HA on SA-AKI: indeed, PMX-HA significantly reduced the pro-apoptotic activity of septic plasma on cultured human TEC and improved SOFA/RIFLE scores, proteinuria and tubular-derived urinary enzymes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The limited number of septic patients enrolled in the present study did not allow to define end-points correlated with mortality and organ failure: however, our data advised for a potential role of PMX-HA in the removal of QS molecules belonging to AHL and HQ families and that QS removal by PMX-HA was higher in the presence of LPS, suggesting a protective effect on LPS- and QS-induced TEC damage.\u003c/p\u003e \u003cp\u003eWe acknowledge that our study presents some limitations: the low number of enrolled patients generated the hypothesis that different QS molecules could be detected in body fluids exerting a potential role in the pathogenic mechanisms of SA-AKI; however, these results should be confirmed in a larger cohort of septic subjects. The association between QS and LPS should also be confirmed, since EA levels were not available for all patients at the time points considered. The physico-chemical mechanisms of QS adsorption by PMX-B are far to be fully elucidated: QS may directly bind to the sorbent; however, considering the enhanced removal rate of QS in the presence of LPS, a possible \u0026ldquo;sandwich effect\u0026rdquo; (binding of QS to LPS that in turn binds to PMX-B) could not be excluded, also considering the interactions between QS and LPS already known in the literature [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. The present study also has some strengths: first, we confirmed that the LC-MS analytical model for QS developed by our group can identify in biofluids different molecules belonging to both AHL and HQ family members. The follow-up of septic patients at different time points of their ICU stay allowed us to identify some significant correlations between QS blood and urine levels with parameters of infection/inflammation (EA, WBC count, PCT) and organ function (PaO\u003csub\u003e2\u003c/sub\u003e/FiO\u003csub\u003e2\u003c/sub\u003e, serum creatinine). Different \u003cem\u003ein vitro\u003c/em\u003e assays using human TEC showed that QS can induce sub-lethal and lethal alterations commonly observed in experimental models of SA-AKI. The specific role of C4 AHL QS in the triggering of TEC damage was confirmed by using supernatants derived from isogenic mutants of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e not able to produce this molecule.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eTaking together, the results of the present study suggested that PMX-HA could remove from the bloodstream different QS molecules able to synergize with LPS in the triggering of functional alterations and death of TEC, key pathogenic mechanisms of development and progression of SA-AKI.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAKI: Acute Kidney Injury; SA-AKI: Sepsis-Associated Acute Kidney Injury; CKD: Chronic Kidney Disease; TEC: Tubular Epithelial Cells: PAMPs: Pathogen-Associated Molecular Patterns; DAMPs: Damage-Associated Molecular Patterns; LPS: lipopolysaccharide; TLR4: Toll-Like Receptor 4; PMX-HA: Polymyxin B- Hemoadsorption; QS: Quorum Sensing; LC-MS: Liquid Chromatography-Mass Spectrometry; AHL: Acyl Homoserin Lactones; HQ: Hydroxyquinolones; WBC: White Blood Cells; RBC: Red Blood Cells; EA: Endotoxin Activity; LB: Luria-Bertani broth; XTT: (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2\u003cem\u003eH\u003c/em\u003e-Tetrazolium-5-Carboxanilide); TUNEL: Terminal deoxynucleotidyl transferase dUTP nick end labelling; RT-PCR: Real Time-Polymerase Chain Reaction; TIMP-2: Tissue Inhibitor of Matrix Matalloproteinase-2; IGFBP-7: Insulin-like Growth Factor Binding Protein-7; NGAL: Neutrophil Gelatinase-Associated Lipocalin; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; TEER: Trans-Epithelial Electrical Resistance; EVOM: Epithelial Volt-Ohm-Meter; PBS: Phosphate Buffer Saline; ROS: Reactive Oxygen Species; ZO-1: Zonula Occldens-1; MAP: Mean Arterial Pressure; EC: Endothelial cells; EndMT: Endothelial-to-Mesenchymal Transition; TRAF-6: Tumor Necrosis Factor ReceptorAssociated-6; Nrf2: \u0026nbsp;Nuclear factor erythroid 2- related factor 2.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003eEthics approval and consent to participate\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThis is a translational study aimed to evaluate the presence of different Gram-Negative bacteria-derived QS molecules in septic patients, their role in the determination of SA-AKI and their potential removal by PMX-HA. All patients admitted to the ICU of the University of Foggia Academic Hospital were considered for enrollment in the study\u0026nbsp;from April 2019 to February 2022. PMX-HA and medical treatments for endotoxemic septic shock were performed in accordance with the standard protocols of the center. Local ethics committee approved the protocol and written informed consent was obtained from each patient or next of kin. The present study was conducted in accordance with the Declaration of Helsinki.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAll clinical and laboratory data of patients enrolled in the study are available in the database of the ICU\u0026nbsp;of the University of Foggia Academic Hospital. All laboratory data generated from LC-MS analysis of biofluids and from \u003cem\u003ein vitro\u003c/em\u003e experiments performed on TEC are available in the data center of the Aging Project of Excellence of the Department of Translational Medicine (DIMET), University of Piemonte Orientale (UPO).\u0026nbsp;The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe Authors declare that they have no competing interests for the present study.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePart of the present study (\u003cem\u003ein vitro\u003c/em\u003e assays on TEC) was funded by the\u0026nbsp;Italian Ministry of Education, University and Research (MIUR) program \u0026ldquo;Departments of Excellence on Aging 2018\u0026ndash;2022\u0026rdquo; to the Department of Translational Medicine (DIMET), University of Piemonte Orientale (UPO) and by local university grants (FAR) both to VC.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAuthors\u0026rsquo; contributions\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eVC and GC designed the study, supervised both clinical and laboratory procedures and approved the final version. DM and ADQ performed and interpreted the experiments aimed to evaluate the biological\u0026nbsp;effects of QS on TEC: they\u0026nbsp;conceived \u003cem\u003ein vitro\u003c/em\u003e experiments and analyzed data under the supervision of VC.\u0026nbsp;LM, AC and FDP enrolled patients,\u0026nbsp;analyzed and interpreted clinical data together with GC. CM and FDB performed LC-MS experiments in biofluids, interpreted data and wrote part of the article. VO was responsible for microbiological data developing \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e strains and wrote part of the article.\u0026nbsp;MM, SP and VF performed \u003cem\u003eex-vivo\u003c/em\u003e experiments with PMX-B minicartridges and elaborated statistical analysis of clinical and laboratory data.\u0026nbsp;VC, GC and LM conceived the study,\u0026nbsp;supervised the experiments, wrote the article, analyzed data and approved the final version of the manuscript. CR supervised the conceptual framework of the study and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAcknowledgments\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eVC is the Vice-Chair of the ERAKI Working Group, European Renal Association (ERA). Part of these results was presented and awarded as best abstracts at the AKI \u0026amp; CRRT Congresses in San Diego (CA) and in Vicenza (Italy).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eUchino S, Kellum JA, Bellomo R, Doig GS, Morimatsu H, Morgera S et al.. Acute renal failure in critically ill patients: a multinational, multicenter study. Jama, 2005. 294(7): p. 813-8.\u003c/li\u003e\n\u003cli\u003eSinger M, Deutschman CS, Seymour CW, Shankar-Hari M, Annane D, Bauer M et al. The third international consensus definitions for sepsis and septic shock (sepsis-3). JAMA, 2016. 315(8): p. 801-810.\u003c/li\u003e\n\u003cli\u003eKellum JA, Lameire N, KDIGO AKI Guideline Work Group. Kidney disease: Improving global outcomes (KDIGO) acute kidney injury work group. KDIGO clinical practice guideline for acute kidney injury. Kidney International Supplements, 2012. 2(1): p. 1-138.\u003c/li\u003e\n\u003cli\u003eZarbock A, Koyner JL, Gomez H, Pickkers P, Forni L; Acute Disease Quality Initiative group. Sepsis-associated acute kidney injury-treatment standard. Nephrol Dial Transplant. 2023 Dec 20;39(1):26-35. doi: 10.1093/ndt/gfad142. Erratum in: Nephrol Dial Transplant. 2023 Nov 30;38(12):2858.\u003c/li\u003e\n\u003cli\u003eZarbock A, Nadim MK, Pickkers P, Gomez H, Bell S, Joannidis M et al. Sepsis-associated acute kidney injury: consensus report of the 28th Acute Disease Quality Initiative workgroup. Nat Rev Nephrol. 2023 Jun;19(6):401-417.\u003c/li\u003e\n\u003cli\u003eSood MM, Shafer LA, Ho J, Reslerova M, Martinka G, Keenan S et al. Early reversible acute kidney injury is associated with improved survival in septic shock. J Crit Care, 2014. 29(5): p. 711-7.\u003c/li\u003e\n\u003cli\u003eBrothers, TN, Strock J, LeMasters TJ, Pawasauskas J, Reed RC, Al-Mamun MA. Survival and recovery modeling of acute kidney injury in critically ill adults. SAGE Open Med, 2022. 10: p. 20503121221099359.\u003c/li\u003e\n\u003cli\u003eCantaluppi V, Assenzio B, Pasero D, Romanazzi GM, Pacitti A, Lanfranco G et al. Polymyxin-B hemoperfusion inactivates circulating proapoptotic factors. Intensive Care Med, 2008. 34(9): p. 1638-45.\u003c/li\u003e\n\u003cli\u003eFani F, Regolisti G, Delsante M, Cantaluppi V, Castellano G, Gesualdo L et al. Recent advances in the pathogenetic mechanisms of sepsis-associated acute kidney injury. J Nephrol, 2018. 31(3): p. 351-359.\u003c/li\u003e\n\u003cli\u003eMarshall JC, Foster D, Vincent JL, Cook DJ, Cohen J, Dellinger RP et al., Diagnostic and prognostic implications of endotoxemia in critical illness: results of the MEDIC study. J Infect Dis, 2004. 190(3): p. 527-34.\u003c/li\u003e\n\u003cli\u003eCunningham PN, Wang Y, Guo R, He G, Quigg RJ. Role of Toll-like receptor 4 in endotoxin-induced acute renal failure. J Immunol, 2004. 172(4): p. 2629-35.\u003c/li\u003e\n\u003cli\u003eCruz DN, Antonelli M, Fumagalli R, Foltran F, Brienza N, Donati A et al. Early use of polymyxin B hemoperfusion in abdominal septic shock: the EUPHAS randomized controlled trial. Jama, 2009. 301(23): p. 2445-52.\u003c/li\u003e\n\u003cli\u003eDellinger RP, Bagshaw SM, Antonelli M, Foster DM, Klein DJ, Marshall JC et al. Effect of Targeted Polymyxin B Hemoperfusion on 28-Day Mortality in Patients With Septic Shock and Elevated Endotoxin Level: The EUPHRATES Randomized Clinical Trial. Jama, 2018. 320(14): p. 1455-1463.\u003c/li\u003e\n\u003cli\u003eAntunes LC, Ferreira RBR, Buckner MMC, Finlay BB. Quorum sensing in bacterial virulence. Microbiology, 2010. 156(Pt 8): p. 2271-82.\u003c/li\u003e\n\u003cli\u003eOrlandi VT, Bolognese F, Martegani E, Cantaluppi V, Medana C, Barbieri P. Response to photo-oxidative stress of Pseudomonas aeruginosa PAO1 mutants impaired in different functions. Microbiology (Reading), 2017. 163(11): p. 1557-1567.\u003c/li\u003e\n\u003cli\u003eDal Bello F, Zorzi M, Aigotti R, Medica D, Fanelli V, Cantaluppi V et al. Targeted and untargeted quantification of quorum sensing signalling molecules in bacterial cultures and biological samples via HPLC-TQ MS techniques. Anal Bioanal Chem, 2021 413(3): p. 853-864.\u003c/li\u003e\n\u003cli\u003eCantaluppi V, Medica D, Quercia AD, Dellepiane S, Figliolini F, Virz\u0026igrave; GM, et al. Perfluorocarbon solutions limit tubular epithelial cell injury and promote CD133+ kidney progenitor differentiation: potential use in renal assist devices for sepsis-associated acute kidney injury and multiple organ failure. Nephrol Dial Transplant. 2018 Jul 1;33(7):1110-1121. \u003c/li\u003e\n\u003cli\u003eCantaluppi V, Weber V, Lauritano C, Figliolini F, Beltramo S, Biancone L, et al. Protective effect of resin adsorption on septic plasma-induced tubular injury. Crit Care. 2010;14(1):R4.\u003c/li\u003e\n\u003cli\u003eMedica D, Quercia AD, Marengo M, Fanelli V, Castellano G, Fabbrini P, Migliori M, Merlotti G, Camussi G, Joannes-Boyau O, Honor\u0026egrave; PM, Cantaluppi V. High-volume hemofiltration does not protect human kidney endothelial and tubular epithelial cells from septic plasma-induced injury. Sci Rep. 2024 Aug 7;14(1):18323.\u003c/li\u003e\n\u003cli\u003eMariano F, Cantaluppi V, Stella M, Romanazzi GM, Assenzio B, Cairo M, et al. Circulating plasma factors induce tubular and glomerular alterations in septic burns patients. Crit Care. 2008;12(2):R42. \u003c/li\u003e\n\u003cli\u003eCantaluppi V, Biancone L, Romanazzi GM, Figliolini F, Beltramo S, Galimi F, et al. Macrophage stimulating protein may promote tubular regeneration after acute injury. J Am Soc Nephrol. 2008 Oct;19(10):1904-18.\u003c/li\u003e\n\u003cli\u003eMigliori M, Cantaluppi V, Mannari C, Bertelli AA, Medica D, Quercia AD, et al. Caffeic acid, a phenol found in white wine, modulates endothelial nitric oxide production and protects from oxidative stress-associated endothelial cell injury. PLoS One. 2015 Apr 8;10(4):e0117530.\u003c/li\u003e\n\u003cli\u003eFiorentino M, Tohme FA, Murugan R, Kellum JA. Plasma Biomarkers in Predicting Renal Recovery from Acute Kidney Injury in Critically Ill Patients. Blood Purif. 2019;48(3):253-261. \u003c/li\u003e\n\u003cli\u003eFiorentino M, Tohme FA, Wang S, Murugan R, Angus DC, Kellum JA. Long-term survival in patients with septic acute kidney injury is strongly influenced by renal recovery. PLoS One. 2018 Jun 5;13(6):e0198269. \u003c/li\u003e\n\u003cli\u003eCastellano G, Stasi A, Franzin R, Sallustio F, Divella C, Spinelli A, et al. LPS-Binding Protein Modulates Acute Renal Fibrosis by Inducing Pericyte-to-Myofibroblast Trans-Differentiation through TLR-4 Signaling. Int J Mol Sci. 2019 Jul 27;20(15):3682. \u003c/li\u003e\n\u003cli\u003eFranzin R, Stasi A, Sallustio F, Bruno S, Merlotti G, Quaglia M, et al. Extracellular vesicles derived from patients with antibody-mediated rejection induce tubular senescence and endothelial to mesenchymal transition in renal cells. Am J Transplant. 2022 Sep;22(9):2139-2157 \u003c/li\u003e\n\u003cli\u003eStasi A, Franzin R, Divella C, Sallustio F, Curci C, Picerno A, et al. PMMA-Based Continuous Hemofiltration Modulated Complement Activation and Renal Dysfunction in LPS-Induced Acute Kidney Injury. Front Immunol. 2021 Apr 1;12:605212.\u003c/li\u003e\n\u003cli\u003eCastellano G, Franzin R, Sallustio F, Stasi A, Banelli B, Romani M, et al. Complement component C5a induces aberrant epigenetic modifications in renal tubular epithelial cells accelerating senescence by Wnt4/\u0026beta;catenin signaling after ischemia/reperfusion injury. Aging (Albany NY). 2019 Jul 8;11(13):4382-4406. \u003c/li\u003e\n\u003cli\u003eFranzin R, Stasi A, Fiorentino M, Stallone G, Cantaluppi V, Gesualdo L, et al. Inflammaging and Complement System: A Link Between Acute Kidney Injury and Chronic Graft Damage. Front Immunol. 2020 May 7;11:734. \u003c/li\u003e\n\u003cli\u003eRonco C, Tetta C, Mariano F, Wratten ML, Bonello M, Bordoni V, et al. Interpreting the mechanisms of continuous renal replacement therapy in sepsis: the peak concentration hypothesis. Artif Organs. 2003 Sep;27(9):792-801.\u003c/li\u003e\n\u003cli\u003eZhou P, Zhao C, Chen Y, Liu X, Wu C, Hu Z. Klotho activation of Nrf2 inhibits the ferroptosis signaling pathway to ameliorate sepsis-associated acute kidney injury. Transl Androl Urol. 2023 Dec 31;12(12):1871-1884. doi: 10.21037/tau-23-573. Epub 2023 Dec 21.\u003c/li\u003e\n\u003cli\u003eMarengo M, Migliori M, Merlotti G, Fabbrini P, Panichi V, Cantaluppi V. Role of the CD40-CD40 Ligand Pathway in Cardiovascular Events, Neurological Alterations, and Other Clinical Complications of Chronic Hemodialysis Patients: Protective Role of Adsorptive Membranes. Blood Purif. 2023;52 Suppl 1(Suppl 1):27-42. \u003c/li\u003e\n\u003cli\u003eHan X, Fink MP, Uchiyama T, Yang R, Delude RL. Increased iNOS activity is essential for pulmonary epithelial tight junction dysfunction in endotoxemic mice. Am J Physiol Lung Cell Mol Physiol. 2004 Feb;286(2):L259-67. \u003c/li\u003e\n\u003cli\u003eHan X, Fink MP, Uchiyama T, Yang R, Delude RL. Increased iNOS activity is essential for hepatic epithelial tight junction dysfunction in endotoxemic mice. Am J Physiol Gastrointest Liver Physiol. 2004 Jan;286(1):G126-36.\u003c/li\u003e\n\u003cli\u003eNealson KH, Platt T, Hastings JW. Cellular control of the synthesis and activity of the bacterial luminescent system. J Bacteriol. 1970 Oct;104(1):313\u0026ndash;22.\u003c/li\u003e\n\u003cli\u003eEberhard A, Burlingame AL, Eberhard C, Kenyon GL, Nealson KH, Oppenheimer NJ. Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry. 2002;20(9):2444\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eEngebrecht J, Silverman M. Identification of genes and gene products necessary for bacterial bioluminescence (lux genes/recombinant DNA/complementation/minicells). Proc Nati Acad Sci USA. 1984;81:4154\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eWhiteley M, Diggle SP, Greenberg EP. Progress in and promise of bacterial quorum sensing research. Nature. 2017 Nov;551(7680):313\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eSigve Havarstein L, Coomaraswamyt G, Morrisont DA. An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae (ABC transporter/bacteriocin/peptide signal/comC gene). 1995 [cited 2022 Apr 3]. ;92:11140\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003eJi G, Beavist RC, Novick RP. Cell density control of staphylococcal virulence mediated by an octapeptide pheromone. Biochemistry. 1995;92:12055\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eLee J, Zhang L. The hierarchy quorum sensing network in Pseudomonas aeruginosa. Protein Cell. 2015 Jan;6(1):26-41.\u003c/li\u003e\n\u003cli\u003eSchuster M, Greenberg EP. A network of networks: Quorum-sensing gene regulation in Pseudomonas aeruginosa. Int J Med Microbiol. 2006 Apr;296(2\u0026ndash;3):73\u0026ndash;81.\u003c/li\u003e\n\u003cli\u003ePezzoni M, Meichtry M, Pizarro RA, Costa CS. Role of the Pseudomonas quinolone signal (PQS) in sensitising Pseudomonas aeruginosa to UVA radiation. J Photochem Photobiol B Biol. 2015 Jan;142:129\u0026ndash;40.\u003c/li\u003e\n\u003cli\u003eRimmel\u0026eacute; T, Payen D, Cantaluppi V, Marshall J, Gomez H, Gomez A, Murray P, Kellum JA; ADQI XIV Workgroup. IMMUNE CELL PHENOTYPE AND FUNCTION IN SEPSIS. Shock. 2016 Mar;45(3):282-91. \u003c/li\u003e\n\u003cli\u003eSkindersoe ME, Zeuthen LH, Brix S, Fink LN, Lazenby J, Whittall C, et al. Pseudomonas aeruginosa quorum-sensing signal molecules interfere with dendritic cell-induced T-cell proliferation. FEMS Immunol Med Microbiol. 2009 Apr;55(3):335-45. \u003c/li\u003e\n\u003cli\u003eGlucksam-Galnoy Y, Sananes R, Silberstein N, Krief P, Kravchenko V V., Meijler MM, et al. The bacterial quorum-sensing signal molecule N-3-oxo-dodecanoyl-L-homoserine lactone reciprocally modulates pro- and anti-inflammatory cytokines in activated macrophages. J Immunol. 2013 Jul;191(1):337\u0026ndash;44.\u003c/li\u003e\n\u003cli\u003eSingh PK, Yadav VK, Kalia M, Sharma D, Pandey D, Agarwal V. Pseudomonas aeruginosa quorum-sensing molecule N-(3-oxo-dodecanoyl)-L-homoserine lactone triggers mitochondrial dysfunction and apoptosis in neutrophils through calcium signaling. Med Microbiol Immunol. 2019 Dec;208(6):855-868.\u003c/li\u003e\n\u003cli\u003eShin J, Ahn SH, Kim SH, Oh DJ. N-3-oxododecanoyl homoserine lactone exacerbates endothelial cell death by inducing receptor-interacting protein kinase 1-dependent apoptosis. Am J Physiol Cell Physiol. 2021 Oct 1;321(4):C644-C653.\u003c/li\u003e\n\u003cli\u003eBagshaw SM, Langenberg C, Haase M, Wan L, May CN, Bellomo R. Urinary biomarkers in septic acute kidney injury. Intensive Care Med. 2007 Jul;33(7):1285-1296. \u003c/li\u003e\n\u003cli\u003eCruz DN, Antonelli M, Fumagalli R, Foltran F, Brienza N, Donati A, et al. Early use of polymyxin B hemoperfusion in abdominal septic shock: the EUPHAS randomized controlled trial. JAMA. 2009 Jun 17;301(23):2445-52.\u003c/li\u003e\n\u003cli\u003ePayen DM, Guilhot J, Launey Y, Lukaszewicz AC, Kaaki M, Veber B, et al. Early use of polymyxin B hemoperfusion in patients with septic shock due to peritonitis: a multicenter randomized control trial. Intensive Care Med. 2015 Jun;41(6):975-84. \u003c/li\u003e\n\u003cli\u003eCutuli SL, Artigas A, Fumagalli R, Monti G, Ranieri VM, Ronco C, Antonelli M; EUPHAS 2 Collaborative Group. Polymyxin-B hemoperfusion in septic patients: analysis of a multicenter registry. Ann Intensive Care. 2016 Dec;6(1):77. \u003c/li\u003e\n\u003cli\u003eKlein DJ, Foster D, Walker PM, Bagshaw SM, Mekonnen H, Antonelli M. Polymyxin B hemoperfusion in endotoxemic septic shock patients without extreme endotoxemia: a post hoc analysis of the EUPHRATES trial. Intensive Care Med. 2018 Dec;44(12):2205-2212.\u003c/li\u003e\n\u003cli\u003eIba T, Klein DJ. The wind changed direction and the big river still flows: from EUPHRATES to TIGRIS. J Intensive Care. 2019 May 16;7:31. \u003c/li\u003e\n\u003cli\u003eOsawa I, Goto T, Kudo D, Hayakawa M, Yamakawa K, Kushimoto S, Foster DM, Kellum JA, Doi K. Targeted therapy using polymyxin B hemadsorption in patients with sepsis: a post-hoc analysis of the JSEPTIC-DIC study and the EUPHRATES trial. Crit Care. 2023 Jun 21;27(1):245.\u003c/li\u003e\n\u003cli\u003eSrisawat N, Tungsanga S, Lumlertgul N, Komaenthammasophon C, Peerapornratana S, Thamrongsat N, Tiranathanagul K, Praditpornsilpa K, Eiam-Ong S, Tungsanga K, Kellum JA. The effect of polymyxin B hemoperfusion on modulation of human leukocyte antigen DR in severe sepsis patients. Crit Care. 2018 Oct 26;22(1):279. \u003c/li\u003e\n\u003cli\u003eAvila-Calder\u0026oacute;n ED, Ruiz-Palma MDS, Aguilera-Arreola MG, Vel\u0026aacute;zquez-Guadarrama N, Ruiz EA, Gomez-Lunar Z, Witonsky S, Contreras-Rodr\u0026iacute;guez A. Outer Membrane Vesicles of Gram-Negative Bacteria: An Outlook on Biogenesis. Front Microbiol. 2021 Mar 4;12:557902.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Acute Kidney Injury, Sepsis, Quorum Sensing, Endotoxin, Gram-Negative Bacteria, Tubular Epithelial Cells, Apoptosis, Inflammation, Cellular Senescence","lastPublishedDoi":"10.21203/rs.3.rs-6032315/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6032315/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLipopolysaccharide (LPS) is the main driver of sepsis-associated Acute Kidney Injury (SA-AKI) in Gram-Negative infections and its removal by Polymyxin-B Hemoadsorption (PMX-HA) has been evaluated in clinical trials. Quorum Sensing (QS), diffusible signal molecules used by Gram-Positive and Gram-Negative bacteria for intercellular communication, can interact with eukaryotic cells. Study aims were to evaluate: 1) presence of QS molecules in blood and urine of septic patients and their clinical significance; 2) biological effects of QS on human tubular epithelial cells (TEC); 3) role of PMX-HA in reducing QS blood levels and consequently TEC injury.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThirty-one patients with endotoxemic shock treated by PMX-HA were enrolled. LC-MS was used to detect QS molecules in blood and urine and their concentrations were correlated with clinical data. The effects of QS on TEC in presence or absence of LPS were assessed by studying cytotoxicity (XTT), apoptosis (TUNEL), stress/injury biomarkers (TIMP-2, IGFBP-7, NGAL), ROS generation, mitochondrial dysfunction and cell polarity (TEER, ZO-1/megalin expression).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe found different QS molecules belonging to Acyl homoserine lactones (C4- and 3-oxo-C12-AHL) and Hydroxyquinolones (C7 HQ) in blood and urine of septic patients: C4-AHL was the most abundant QS family member. A correlation between QS concentrations and endotoxin activity, inflammatory biomarkers and organ dysfunction parameters (PaO\u003csub\u003e2\u003c/sub\u003e/FiO\u003csub\u003e2\u003c/sub\u003e, serum creatinine) was observed. PMX-HA decreased QS molecules in biofluids: these results were confirmed by \u003cem\u003eex-vivo\u003c/em\u003e hemoadsorption using a PMX-B-loaded minicartridge. \u003cem\u003eIn vitro\u003c/em\u003e studies on TEC showed that C4-AHL QS induced cytotoxicity, apoptosis, up-regulation of stress and damage biomarkers, ROS production and mitochondrial dysfunction. C4-AHL QS also induced earlier functional alterations of TEC such as loss of polarity and down-regulation of ZO-1 and megalin. The detrimental effects of C4-AHL QS on TEC were enhanced by the presence of LPS. The specificity of C4-AHL QS-induced TEC damage was confirmed by using supernatants derived from isogenic mutants of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e not able to produce this molecule.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of the present study suggested that PMX-HA could remove from blood QS molecules able to synergize with LPS in the triggering of functional alterations and apoptosis of TEC, key pathogenic mechanisms of SA-AKI.\u003c/p\u003e","manuscriptTitle":"Polymyxin B Hemoadsorption efficiently removes Gram-Negative-derived Quorum Sensing molecules responsible for acute kidney tubular epithelial cell injury","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-19 16:32:46","doi":"10.21203/rs.3.rs-6032315/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8126a57a-1d2b-4bea-b53a-7ffee0335e3b","owner":[],"postedDate":"February 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-04-02T18:08:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-19 16:32:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6032315","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6032315","identity":"rs-6032315","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00