Pax6 Drives Orbital Fibrosis in Thyroid-Associated Orbitopathy via Fatty Acid Metabolism-Mediated Epithelial-Mesenchymal Transition in Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Pax6 Drives Orbital Fibrosis in Thyroid-Associated Orbitopathy via Fatty Acid Metabolism-Mediated Epithelial-Mesenchymal Transition in Mice Yunyan Ye, Qiao Kong, Juntao Zhang, Hengqian He This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8645473/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Thyroid-associated orbitopathy (TAO) is an autoimmune disorder characterized by inflammation, fibrosis, and adipogenesis in the orbital tissues, driven primarily by activated orbital fibroblasts (OFs).This study aims to investigated the link between fatty acid metabolism, Pax6 expression, and EMT/fibrosis in TAO; determine the functional role of Pax6 in regulating OF activation, proliferation, migration, and fibrogenesis both in vivo and in vitro ; and explore Pax6 as a potential therapeutic target. Methods Our study employs single-cell RNA sequencing (scRNA-seq) to characterize cellular heterogeneity and identify pathogenic subpopulations and their metabolic profiles, aiming to elucidate the relationship between fatty acid metabolism, Pax6 expression, and EMT in the context of TAO. Results Using scRNA-seq on TAO and normal mouse orbital tissues, we identified distinct cellular populations, including a pathogenic epithelial-like cell subcluster (EPC1) marked by enhanced fatty acid metabolism and EMT markers. Pax6 expression increased along the EMT trajectory, especially in mesenchymal cells. In vivo experiments using a TAO mouse model demonstrated that Pax6 knockdown reduced orbital fibrosis, decreased pro-fibrotic markers (α-SMA, COL1A1, FN1), and inhibited OF activation and migration. Additionally, primary OF cultures showed that Pax6 regulates cellular proliferation and fibrogenesis in vitro . Conclusion Our findings suggest that dysregulated fatty acid metabolism in TAO enhances Pax6 expression. This, in turn, promotes EMT and contributes to orbital fibrosis. Targeting the Pax6–fatty acid metabolism axis represents a novel therapeutic strategy to mitigate the TAO-related orbital fibrosis. This study establishes Pax6 as a key driver of EMT and fibrosis in TAO and highlights its potential as a future therapeutic target. Epithelial-mesenchymal transition Fatty acid metabolism Fibrosis Orbital fibroblasts Pax6 Thyroid-associated orbitopathy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Thyroid-associated orbitopathy (TAO) is an autoimmune disorder affecting retro-orbital tissues, often linked to hyperthyroidism and Graves’ disease, causing proptosis, diplopia, and ocular discomfort that affects quality of life.( 1 , 2 ) The pathogenesis of TAO involves immune mechanisms with inflammation, fibrosis, and adipogenesis, where orbital fibroblasts (OFs) are key effector cells.( 3 , 4 ) Recent investigations show that OFs in TAO activate and proliferate, contributing to extracellular matrix (ECM) deposition and promoting fibrosis.( 5 ) The epithelial-mesenchymal transition (EMT) is crucial in the fibrotic response in various tissues, including the orbit, and is a key factor in tissue fibrosis progression.( 6 ) EMT involves losing epithelial markers and gaining mesenchymal traits, enhancing migration and proliferation. Key markers like Vimentin, N-cadherin, and Alpha-smooth muscle actin (α-SMA) link EMT to fibrotic diseases like TAO.( 7 ) Pax6 is a key transcription factor in eye development and is linked to ocular diseases like fibrosis, with metabolic cues influencing its expression, indicating a connection to metabolic dysregulation in TAO.( 8 – 10 ) However, the specific mechanisms through which Pax6 affects EMT and fibrosis in TAO remain unclear. Therefore, we hypothesize that a dysregulated interplay between fatty acid metabolism and Pax6 expression contributes to EMT and fibrosis in TAO. Our study uses single-cell RNA sequencing (scRNA-seq) to analyze cellular heterogeneity, identify pathogenic subpopulations, and examine their metabolic profiles, focusing on the relationship between fatty acid metabolism, Pax6 expression, and EMT in TAO. We will investigate Pax6 's role in regulating OFs activation, proliferation, migration, and fibrogenesis through in vivo and in vitro studies, aiming to uncover TAO's molecular mechanisms and explore Pax6 as a potential therapy for orbital fibrosis. Materials and Methods Single-cell RNA Sequencing (scRNA-seq) Data Analysis scRNA-seq data from one TAO sample and one control mouse were processed with Seurat (v4.1.0) in R, identifying highly variable genes (HVGs) and conducting principal component analysis (PCA) for dimensionality reduction. Clustering of cells using the top 50 principal components resulted in 24 clusters, which were annotated into 10 cell populations based on marker genes from CellMarker 2.0 and literature. Differential expression analysis was performed with FindMarkers, followed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses and Gene Set Enrichment Analysis (GSEA) to explore biological processes. Finally, pseudotime trajectory analysis was conducted using Monocle2 to infer cellular transitions. Mouse Model of TAO Female BALB/c mice aged 6 to 8 weeks were obtained from Hangzhou HanSI Biotechnology and kept in a specific pathogen-free (SPF) environment. All experiments were approved by Zhejiang Luoxi Medical Technology's Ethics Committee (No. LX482 4122701). To induce TAO, mice were anesthetized with 3% sodium pentobarbital and immunized with 1×10¹⁰ plaque-forming units (PFU) of a recombinant adenovirus carrying the human thyroid-stimulating hormone receptor A subunit (Ad-TSHR A) in the tibialis anterior muscle, while controls received a negative control adenovirus (Ad-NC). Immunizations occurred at weeks 0, 3, 6, and 9, with blood samples taken before and two weeks post-immunization for analysis. After 16 weeks, mice were euthanized, and blood, thyroid, and orbital tissues were collected for further studies. In Vivo Pax6 Knockdown TAO model mice were randomly divided into two groups of 10 mice each. The first group, named sh-NC, received a tail vein injection of 100 µL control lentivirus at 1×10⁷ TU/mL. The second group, named sh- Pax6 , received 100 µL of Pax6 -targeting shRNA lentivirus at the same concentration via tail vein injection. Both lentiviruses were supplied by Genomeditech (China). After four weeks, all mice were euthanized for tissue analysis. Isolation and Culture of Orbital Fibroblasts (OFs) Orbital tissues from both TAO and control mice were minced and placed onto plastic culture dishes, where OFs migrated from the tissue fragments and established a monolayer in Dulbecco's Modified Eagle Medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% antibiotics. The cells were incubated at 37°C in 5% CO₂ and serially passaged with trypsin/EDTA solution. For all in vitro experiments, OFs from passages 4 to 10 were used. Cell Transfection and Treatment OFs were isolated from TAO mice. These cells were transfected with either a PLKO.1- Pax6 knockdown vector (sh- Pax6 ) or a PLKO.1 negative control vector (sh-NC), both from Genomeditech, China. Transfection was performed using Lipofectamine® 3000 (Invitrogen, USA) according to the manufacturer's instructions. Stable transfectants were selected using puromycin and expanded for further experiments. The efficiency of Pax6 knockdown was confirmed by quantitative PCR (qPCR). They were treated with 10 ng/mL transforming growth factor-β1 (TGF-β1, Jiatian Bio, China) for 48 hours to induce fibrosis. Quantitative Real-Time PCR (qPCR) Total RNA was extracted from cells or tissues using TRIzol reagent (Beyotime, China). RNA concentration and purity were measured with a NanoDrop spectrophotometer (Thermo Scientific, USA). For cDNA synthesis, 1 µg of total RNA was used with the PrimeScript RT reagent kit (Takara, Japan). Quantitative PCR (qPCR) was performed using TB Green Premix Ex Taq II (Takara, Japan) on an ABI 7500 Real-Time PCR System (Thermo Scientific, USA). The relative expression levels of target genes, including Pax6 , α-SMA, FN1, and COL1A1, were calculated using the 2 −ΔΔCt method, with GAPDH as the internal control. The primer sequences are provided in Table 1 . Table 1 The primer sequences of qPCR. Gene Name Sequence (5' to 3') PAX6 -F TGGGCAGGTATTACGAGACTG PAX6 -R ACTCCCGCTTATACTGGGCTA α-SMA -F GCTCCCAGGCTAGAGAGCATA α-SMA -R ACACATAGCTGGAGCTGCTT FN1 -F GCTCAAGTGGTCCTGTCGAA FN1 -R TGGGTGGGATACTCACAGGT COL1A1 -F AAAGATGGACTCAACGGTCTC COL1A1 -R CATCGTGAGCCTTCTCTTGAG GAPDH -F TCCTCCGGGTGATGCTTTTC GAPDH -R TGAAGGGGTCATTGATGGCA Western Blotting (WB) Proteins were extracted using RIPA buffer (Beyotime, China) with protease inhibitors, and their concentration was measured with a BCA kit (Beyotime, China). For analysis, 20 µg of protein was separated by SDS-PAGE, transferred to PVDF membranes, blocked with 5% milk, and incubated overnight at 4°C with primary antibodies: anti- Pax6 (12323-1-AP, Proteintech; 1:1000), anti-Acsbg1 (16077-1-AP, Proteintech; 1:1000), anti-Elovl6 (ab69857, Abcam; 1:1000), anti-Vimentin (10366-1-AP, Proteintech; 1:2000), anti-N-cadherin (22018-1-AP, Proteintech; 1:2000), and anti-GAPDH (10494-1-AP, Proteintech; 1:5000). After washing, membranes were treated with an HRP-conjugated secondary antibody, and protein bands were visualized using ECL substrate (Beyotime, China). Cell Proliferation and Migration In the CCK-8 assay, OFs were plated at 2,000 cells/well in 96-well plates, and absorbance was measured after adding CCK-8 solution at various time points. For the EdU assay, OFs were plated at 50,000 cells/well in 24-well plates, treated with EdU, fixed, and stained for imaging. Fibrosis Morphology Observation OFs were seeded in 24-well plates at a density of 60,000 cells per well. Once the cells adhered, they were treated with TGF-β1 under specified conditions. Changes in cell morphology were observed and recorded using an inverted microscope (Olympus, Japan). Transwell Migration Assay We assessed cell migration in 24-well Transwell chambers by adding OFs to the upper chamber and medium with FBS to the lower chamber. After 48 hours, we removed non-migrated cells, fixed the migrated ones, stained them, and counted under a microscope. Histopathological Examination Thyroid and orbital tissues were fixed in 4% paraformaldehyde, embedded, sectioned, and stained with Hematoxylin and Eosin (H&E) using a Beyotime kit (C0105S, China) for morphology and inflammation assessment, while collagen deposition was examined using Masson's Trichrome staining (Solarbio, G1340, China), with images captured via a light microscope (Nikon, Japan). Immunofluorescence (IF) Staining For tissue sections, samples were deparaffinized, rehydrated, and underwent antigen retrieval with EDTA buffer and microwave heating. After BSA blocking, sections were incubated overnight at 4°C with primary antibodies against Vimentin (HY-P80371, MCE, USA) and N-cadherin (22018-1-AP, Proteintech, USA), followed by Alexa Fluor 555-conjugated secondary antibody (A27039, Invitrogen, USA) for 1 hour at room temperature, with nuclei stained by DAPI. For cultured cells, OFs on coverslips were fixed, permeabilized, blocked, and incubated with primary antibodies against (60330-1-Ig, Proteintech, USA) and N-cadherin (22018-1-AP, Proteintech, USA), then treated with Alexa Fluor 488 or 594-conjugated secondary antibodies (A28175 and A-11012, Invitrogen, USA), with nuclei stained by DAPI. Fluorescent images were captured using a Nikon fluorescence microscope (Nikon, Japan). Immunohistochemistry (IHC) Staining Deparaffinized orbital tissue sections were treated with 3% H₂O₂, followed by antigen retrieval with citrate buffer. Sections were incubated overnight at 4°C with primary antibodies against Pax6 , α-SMA , FN1 (all from Proteintech), an d COL1A1 (CST, USA), then treated with an HRP-conjugated secondary antibody (ab205718, Abcam, UK) for 2 hours. DAB substrate visualized signals, nuclei were counterstained with hematoxylin (Beyotime, China), and sections were dehydrated, mounted (Sinopharm, China), and imaged (Nikon, Japan). Enzyme-Linked Immunosorbent Assay (ELISA) Serum levels of free thyroxine (FT4, CB10813-Mu), thyroid-stimulating hormone (TSH, CB10236-Mu), and TSH receptor antibody (TRAb, CB11059-Mu) were measured using commercial ELISA kits (Coibo, China), strictly according to the manufacturer's protocols. Absorbance was measured at 450 nm on a Multiskan FC microplate reader (Thermo Scientific, USA), and concentrations were calculated based on the standard curves. Detection of Fatty Acid Metabolism Indicators Orbital connective tissues were homogenized or sonicated in cold PBS, then centrifuged at 8000 g for 10 min at 4°C to collect the supernatants. The levels of triglycerides (TG, E-BC-K261-M), total cholesterol (TC, E-BC-K109-M), high-density lipoprotein (HDL, E-EL-M1402), and low-density lipoprotein (LDL, E-EL-M1363) were quantified using commercial assay kits (Elabscience, China) according to the manufacturer’s instructions. Absorbance for TG and TC was measured at 510 nm, while that for HDL and LDL was measured at 450 nm using a Multiskan FC microplate reader (Invitrogen, USA). Statistical Analysis Statistical analyses were conducted using GraphPad Prism (version 8.0.2). All data are presented as the mean ± standard deviation (SD). Differences between two groups were analyzed using Student's unpaired t -test. Comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA). A P -value of less than 0.05 was considered statistically significant. Results scRNA-seq Reveals TAO-Specific Cellular Heterogeneity and a Pathogenic Epithelial Subpopulation with Dysregulated Metabolism We conducted scRNA-seq on tissues from one TAO mouse and one control, filtering to retain 22,723 high-quality cells and 47,362 genes for analysis (Fig. 1 A-D). First, the HVGs between cells were identified (Fig. 2 A), followed by PCA (Fig. 2 B). The t-distributed stochastic neighbor embedding (t-SNE) revealed 24 distinct clusters (Fig. 2 C), which were annotated into 10 major cell types—including endothelial cells, epithelial cells (EPCs), fibroblasts, immune cells, and mesenchymal cells (MESCs)—based on canonical marker genes (Fig. 2 D-F). Epithelial cells exhibited significant heterogeneity, subdividing into EPC1 and EPC2 subpopulations (Fig. 3 A-D). The EPC1 subpopulation was almost exclusively present in the TAO sample and showed upregulation of fatty acid metabolism genes (Acsbg1, Elovl6) and EMT markers (vimentin, N-cadherin) (Fig. 3 C-E). In contrast, EPC2 was found in both samples and expressed genes for normal epithelial function. Functional enrichment analysis of differentially expressed genes (DEGs) revealed fatty acid metabolism as the most enriched process in EPC1 (Fig. 4 A-D), further validated by GSEA (Fig. 4 E-F). These results identify a TAO-specific epithelial subpopulation with a dysregulated metabolic profile likely contributing to fibrosis via EMT. Identification of a Pax6 + Mesenchymal Subpopulation Associated with EMT Trajectory Because EPCs are linked to EMT, we next examined heterogeneity within the mesenchymal compartment. Further clustering of MES revealed two main subsets (Fig. 5 A-B): Epcam + Mes cells retaining epithelial markers (Epcam, Cd24, Krt18) and Pax6 + Mes cells showing a fibroblast-like phenotype with high expression of Pax6 , Kit, Cdh4, and the fibrotic marker Col1a1 (Fig. 5 C-F). We used Monocle2 for pseudotime analysis to reconstruct cell development, positioning Epcam + Mes and Pax6 + Mes populations at opposite ends of an EMT spectrum (Fig. 6 A-F), with Pax6 expression increasing along this trajectory in normal and TAO samples (Fig. 6 G-H), indicating its role as a marker and potential driver of fibrogenic transition. Successful Validation of the TAO Mouse Model We established a TAO mouse model by immunizing BALB/c mice with an adenovirus encoding the human TSHR A subunit (Ad-TSHR A), showing classic histopathological features of TAO despite no significant weight difference (Fig. 7 A). H&E staining revealed structural abnormalities in the thyroid, including follicular necrosis, destruction of cuboidal EPCs, and significant inflammation infiltration (Fig. 7 B). Orbital tissues from the model exhibited acinar cell degeneration in the lacrimal gland and mild stromal inflammation (Fig. 7 C). Serologically, the model showed a significant increase in serum levels of FT4 and TRAb, alongside a decrease in TSH (Fig. 7 D-F), indicating hyperthyroidism and autoimmune activity. Confirmation of Dysregulated Fatty Acid Metabolism and Elevated Pax6 Expression in TAO Next, we aimed to validate the key molecular signatures identified by scRNA-seq at both protein and functional levels. Western blot analysis of orbital tissues confirmed that the protein levels of Acsbg1 and Elovl6 were significantly higher in TAO mice compared to controls (Fig. 8 A). Quantitative assays showed a substantial lipid accumulation in TAO orbits, including increased levels of triglycerides (TG), total cholesterol (TC), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) (Fig. 8 B-C), consistent with active fatty acid metabolism. Moreover, IHC demonstrated a marked increase in Pax6 protein expression in the orbital connective tissues of TAO mice (Fig. 8 D). Pax6 Knockdown Reduces Orbital Fibrosis and Inhibits EMT In Vivo To directly assess Pax6 ’s role in TAO pathogenesis, we delivered a Pax6 -targeting shRNA lentivirus (sh- Pax6 ) via tail vein injection to established TAO mice, achieving in vivo knockdown. Masson's trichrome staining showed that Pax6 knockdown markedly reduced collagen deposition and fibrosis in the orbital tissue compared to the sh-NC control group (Fig. 9 A). IHC and qPCR analyses consistently showed that sh- Pax6 treatment significantly reduced Pax6 expression along with key fibrotic markers α-SMA, FN1, and COL1A1 (Fig. 9 B-C). Western blot and IF analyses further showed that Pax6 knockdown significantly reduced the expression of core EMT markers Vimentin and N-cadherin (Fig. 9 D-E). These results provide direct in vivo evidence that Pax6 is a critical promoter of fibrosis and EMT in TAO. Pax6 Drives Activation, Proliferation, Migration, and Fibrosis in Orbital Fibroblasts In Vitro We studied Pax6 in OFs, confirming its higher expression in TAO-derived OFs versus controls and its efficient knockdown using sh- Pax6 (Fig. 10 A-B). TGF-β1-induced transformation of control OFs into myofibroblasts was inhibited in sh- Pax6 OFs (Fig. 10 C-D), which also showed reduced mRNA expression of the fibrotic markers α-SMA, FN1 , and COL1A1 (Fig. 10 E). Functionally, Pax6 knockdown significantly impaired OF proliferation (Fig. 10 F-G) and drastically reduced migratory capacity (Fig. 10 H). Molecularly, Pax6 depletion abolished the TGF-β1-induced upregulation of the EMT markers Vimentin and N-cadherin (Fig. 10 I-J). These results establish Pax6 as a master regulator driving pro-fibrotic activation, proliferation, migration, and EMT of OFs in TAO. Discussion Clinical intervention for TAO relies on glucocorticoids and immunosuppressants, which can cause adverse reactions, necessitating further research into TAO's mechanisms and new therapeutic targets.( 11 , 12 ) We explored TAO's cellular heterogeneity using an in-house dataset, focusing on an epithelial subpopulation in fatty acid metabolism. Pax6 was crucial in MESCs during EMT progression. A TAO mouse model and in vitro experiments validated our findings, supporting our analysis. This study clarifies TAO's mechanisms, laying a foundation for targeted therapies and diagnostics. EMT is vital for healing and fibrosis, as EPCs become fibroblast-like cells for repair and produce myofibroblasts.( 13 , 14 ) EMT in RPE is key to subretinal fibrosis in neovascular age-related macular degeneration (nAMD).( 15 , 16 ) Research links fibrosis to autoimmune diseases like TAO, prompting our analysis of EPCs and MESCs to explore the EMT pathway in TAO and its fibrosis mechanisms. Single-cell sequencing of TAO and control mouse samples revealed upregulation of fatty acid metabolism genes and EMT markers in the EPC1 subpopulation of TAO, indicating enrichment in fatty acid metabolism. Abnormal lipid metabolism is linked to various pathologies, and changes in fatty acid metabolism are associated with retinal dysfunction and ocular diseases.( 17 ) , ( 18 ) Inhibition of PGC-1α leads to lipid metabolic disorders causing RPE and retina degeneration.( 19 ) While the link between fatty acid metabolism and TAO is unclear, TAO model mice exhibited increased expression of fatty acid metabolism genes and lipid content, suggesting its involvement in TAO pathogenesis. Future research should investigate lipid deposition mechanisms in TAO for prevention and treatment insights. This study identified a Pax6 + Mes subpopulation from MESCs via single-cell sequencing, which shows high fibroblast-like expression of the Pax6 gene. Pax6 is a crucial gene in eye development, serving as a master regulator of morphogenesis in the regulatory network.( 20 ) While previous studies primarily focused on Pax6 ’s regulatory roles in eye development, recent research indicates that upregulation of Pax6 facilitates activation and proliferation of hepatic stellate cells (HSCs), contributing to liver fibrosis. Conversely, in cardiac fibrosis studies, Pax6 inhibits fibrotic progression.( 21 ) These findings underscore the pivotal role of Pax6 in modulating fibrotic responses. Furthermore, within oncology research, Pax6 is also acknowledged as a key molecule promoting EMT.( 22 , 23 ) Our analysis indicated that Pax6 expression rises during EMT, leading us to hypothesize its role in fibrotic responses in TAO. Knockdown experiments in a TAO mouse model showed reduced EMT markers and less fibrosis compared to controls, supporting Li et al.'s findings that Pax6 regulates Vimentin and N-cadherin to activate TAO-related fibrosis.( 24 ) Orbital fibrosis is a characteristic feature of tissue remodeling in TAO. TAO is a chronic and progressive orbital disease, and currently, there are no effective treatment options available.( 25 ) In the pathological process of TAO, OF play a pivotal role, with TGF-β1 serving as a crucial inducer of myofibroblast differentiation and subsequent tissue fibrosis.( 26 – 28 ) We knocked down Pax6 in OFs and treated them with TGF-β1 to study its role in TAO-related fibrosis, finding that reduced Pax6 inhibited OF proliferation, migration, and fibrosis, underscoring its importance in TAO pathogenesis and aligning with studies on SOX9 's role via the MAPK/ERK1/2 pathway.( 29 ) We observed a significant reduction in EMT marker levels in Pax6 knockdown OFs, concluding that Pax6 activates fibroblasts and promotes their growth via EMT signaling during TGF-β1-induced fibrosis. This study focused on OFs, without addressing interactions with immune cells, which could be explored in future research. In summary, our research used single-cell sequencing to reveal epithelial and MESC heterogeneity in TAO, offering insights into cellular changes. We analyzed fatty acid metabolism in a TAO mouse model and identified Pax6 's regulatory role in fibrosis during TAO progression, planning further investigations into its influence and potential for anti-fibrotic treatments. Conclusion Our findings show that Pax6 regulates EMT and fibrosis in TAO, influenced by fatty acid metabolism. This study highlights Pax6 's role in fibroblast activation and fibrogenesis, emphasizing metabolic reprogramming's impact on fibrosis, which could offer valuable insights for therapeutic strategies. Targeting the Pax6 -fatty acid metabolism axis may prevent or treat TAO-related orbital fibrosis and guide future clinical applications. Declarations Acknowledgements Not applicable. Disclosures Ethics approval and consent to participate All experiments were approved by Zhejiang Luoxi Medical Technology's Ethics Committee (No. LX482 4122701). Consent for publication All authors have given consent to publish. Conflict of Interest None of the authors has any conflicts of interest to disclose. Funding This work was supported by the fund Ningbo Clinical Research Center for Ophthalmology(2022L003) Authors and Affiliations Author list Yunyan Ye Ph. D 1 ( [email protected] ) Qiao Kong M.D 1 ( [email protected] ) Juntao Zhang Ph. D 2 ( [email protected] ) Hengqian He M.D 2 ( [email protected] ) Affiliations 1 Department of Ophthalmology, Ningbo Medical Center Lihuili Hospital, Xingning Road-57, Yinzhou District, Ningbo City, Zhejiang Province, China 2 Department of Ophthalmology, The Affiliated People's Hospital of Ningbo University, The Eye Hospital of Wenzhou Medical University (Ningbo Branch), Ningbo City, Zhejiang Province, China Contributions Yunyan Ye : Conceptualization (lead); writing – original draft (lead); formal analysis (lead); writing – review and editing (lead). Qiao Ko ng : Writing – review and editing (supporting). J untao Zhang, Hengqian He : Software (equal). All the authors read and approved the final version of the manuscript. Disclosure statement Author 1: Yunyan Ye has no conflict of interest exists. Author 2: Qiao Kong has no conflict of interest exists. Author 3: Juntao Zhang has no conflict of interest exists. Author 4: Hengqian He has no conflict of interest exists. Funding statement Author 1: Author 1: Yunyan was supported by the fund Ningbo Clinical Research Center for Ophthalmology (No.2022L003), and the sponsor or funding organization had no role in the design or conduct of this research. Author 2: Qiao Kong: No funding was received for this study. Author 3: Juntao Zhang: No funding was received for this study. Author 4: Hengqian He: No funding was received for this study. Additional information Publisher’s note Springer Nature remains neutral regarding jurisdictional claims in published maps and institutional affiliations. Data availability statement The datasets supporting the conclusions of this article are included within the article and its additional files. References Alves M, Neves C, Carvalho D, Medina JL. (2011) [Thyroid associated orbitopathy]. Acta Med Port 24: 1041–1050. Hennein L, Robbins SL. (2022) Thyroid-Associated Orbitopathy: Management and Treatment. J Binocul Vis Ocul Motil 72: 32–46. Buonfiglio F, Ponto KA, Pfeiffer N, Kahaly GJ, Gericke A. (2024) Redox mechanisms in autoimmune thyroid eye disease. Autoimmun Rev 23: 103534. Lee ACH, Kahaly GJ. (2023) Pathophysiology of thyroid-associated orbitopathy. Best Pract Res Clin Endocrinol Metab 37: 101620. Cruz AA, Akaishi PM, Vargas MA, de Paula SA. (2007) Association between thyroid autoimmune dysfunction and non-thyroid autoimmune diseases. Ophthalmic Plast Reconstr Surg 23: 104–108. Manfioletti G, Fedele M. (2022) Epithelial-Mesenchymal Transition (EMT) 2021. Int J Mol Sci 23. Lamouille S, Subramanyam D, Blelloch R, Derynck R. (2013) Regulation of epithelial-mesenchymal and mesenchymal-epithelial transitions by microRNAs. Curr Opin Cell Biol 25: 200–207. Ashery-Padan R, Gruss P. (2001) Pax6 lights-up the way for eye development. Curr Opin Cell Biol 13: 706–714. Li G, et al. (2015) Transcription Factor PAX6 (Paired Box 6) Controls Limbal Stem Cell Lineage in Development and Disease. J Biol Chem 290: 20448–20454. Chen YT, et al. (2013) Pax6 downregulation mediates abnormal lineage commitment of the ocular surface epithelium in aqueous-deficient dry eye disease. PLoS One 8: e77286. Li Z. (2024) Novel perspectives on the pharmacological treatment of thyroid-associated ophthalmopathy. Front Endocrinol (Lausanne) 15: 1469268. Lanzolla G, Marinò M, Menconi F. (2024) Graves disease: latest understanding of pathogenesis and treatment options. Nat Rev Endocrinol 20: 647–660. Sarrand J, Soyfoo MS. (2023) Involvement of Epithelial-Mesenchymal Transition (EMT) in Autoimmune Diseases. Int J Mol Sci 24. Hughes D, et al. (2025) Nintedanib Induces Mesenchymal-to-Epithelial Transition and Reduces Subretinal Fibrosis Through Metabolic Reprogramming. Int J Mol Sci 26. Jiang Y, Wen X, Jian X, Chen Q, Li Y. (2025) Klotho attenuates epithelial–mesenchymal transition of retinal pigment epithelial cells in subretinal fibrosis by suppressing the ERK1/2 and Wnt/β–catenin signaling pathways. Int J Mol Med 55. Yang Y, et al. (2025) AZGP1 Attenuates Subretinal Fibrosis and Inhibits Epithelial-Mesenchymal Transition by Blocking the PI3K/AKT Signaling Pathway. Invest Ophthalmol Vis Sci 66: 83. Yousri NA, et al. (2022) Metabolic and Metabo-Clinical Signatures of Type 2 Diabetes, Obesity, Retinopathy, and Dyslipidemia. Diabetes 71: 184–205. Song W, Chen W, Chi J, Liu X, Zhu W. (2025) The role of lipid metabolism disorder in the progression and treatment of ocular vascular diseases. Surv Ophthalmol . Zhou S, et al. (2024) PGC-1α repression dysregulates lipid metabolism and induces lipid droplet accumulation in retinal pigment epithelium. Cell Death Dis 15: 385. Ma R, et al. (2024) PAX6/CXCL14 regulatory axis promotes the repair of corneal injury by enhancing corneal epithelial cell proliferation. J Transl Med 22: 458. Feng Y, et al. (2020) Paired box 6 inhibits cardiac fibroblast differentiation. Biochem Biophys Res Commun 528: 561–566. Díaz-Carballo D, et al. (2024) The neuroepithelial origin of ovarian carcinomas explained through an epithelial-mesenchymal-ectodermal transition enhanced by cisplatin. Sci Rep 14: 29286. Lin Q, et al. (2021) Exosomal circular RNA hsa_circ_007293 promotes proliferation, migration, invasion, and epithelial-mesenchymal transition of papillary thyroid carcinoma cells through regulation of the microRNA-653-5p/paired box 6 axis. Bioengineered 12: 10136–10149. Li C, Tan YH, Sun J, Deng FM, Liu YL. (2020) PAX6 contributes to the activation and proliferation of hepatic stellate cells via activating Hedgehog/GLI1 pathway. Biochem Biophys Res Commun 526: 314–320. Xu S, Mao H. (2024) Crocin Inhibits Orbital Fibroblasts Fibrosis in Thyroid-Associated Ophthalmopathy. Curr Eye Res 49: 330–337. Ouyang P, et al. (2025) Butyrate Ameliorates Graves' Orbitopathy Through Regulating Orbital Fibroblast Phenotypes and Gut Microbiota. Invest Ophthalmol Vis Sci 66: 5. Chiu HI, Wu SB, Wu AY, Tsai CC. (2024) Endoplasmic reticulum protein TXNDC5 modulates thyroid eye disease TGF-β1-induced myofibroblast transdifferentiation. BMJ Open Ophthalmol 9. Wang X, et al. (2022) Disulfiram Exerts Antifibrotic and Anti-Inflammatory Therapeutic Effects on Perimysial Orbital Fibroblasts in Graves' Orbitopathy. Int J Mol Sci 23. Zhou M, et al. (2024) SOX9 Induces Orbital Fibroblast Activation in Thyroid Eye Disease Via MAPK/ERK1/2 Pathway. Invest Ophthalmol Vis Sci 65: 25. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8645473","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":592114969,"identity":"2a83ae14-732c-4910-b229-61c67bcf2575","order_by":0,"name":"Yunyan Ye","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYBACPgnmBhib8QEjmJ2AXwubBCNcC7MByVpgbEJapBvbJD62Hc4zOH72WHXhjsMM/Ow5Bgw/d+DRInOwTXJm2+FigzN5abdnnjnMINnzxoCx9ww+hyW2SfO2HU7ccCDH7DaQwWBwI8eAmbGNgJa/IC3n35gVg7TYE6WFEaTlRo4ZM9gWCcJami17zqUnzrzxxlia90w6j8SZZwUHe/Fo4ZdIPnjjR5l1Yt/5HMPPvDus5fjbkzc++IlHCxCwSDCyMTAoHIDweEDEAbwagJH+geEPA4N8AwFlo2AUjIJRMHIBACtpVDBxbiY/AAAAAElFTkSuQmCC","orcid":"","institution":"Ningbo Medical Center Lihuili Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yunyan","middleName":"","lastName":"Ye","suffix":""},{"id":592114970,"identity":"ecc5829e-d570-4cd6-aac0-702014995912","order_by":1,"name":"Qiao Kong","email":"","orcid":"","institution":"Ningbo Medical Center Lihuili Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qiao","middleName":"","lastName":"Kong","suffix":""},{"id":592114971,"identity":"7beff20e-f020-484e-a07f-914b2baf0d26","order_by":2,"name":"Juntao Zhang","email":"","orcid":"","institution":"The Affiliated People’s Hospital of Ningbo University, The Eye Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Juntao","middleName":"","lastName":"Zhang","suffix":""},{"id":592114976,"identity":"37c80721-8826-41b5-9101-550a8a3a0e14","order_by":3,"name":"Hengqian He","email":"","orcid":"","institution":"The Affiliated People’s Hospital of Ningbo University, The Eye Hospital of Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hengqian","middleName":"","lastName":"He","suffix":""}],"badges":[],"createdAt":"2026-01-20 06:08:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8645473/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8645473/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102850566,"identity":"81653878-65b7-407d-8166-0fe55f37984f","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1248088,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eQuality control metrics for the scRNA-seq dataset.\u003c/strong\u003e\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e Violin plots showing the distribution of nFeature_RNA (number of genes per cell), nCount_RNA (number of UMIs per cell), and percent.mt (percentage of mitochondrial genes) across all cells before QC filtering.\u003cbr\u003e\n \u003cstrong\u003e(B)\u003c/strong\u003e Scatter-density plots visualizing the relationship between nCount_RNA and percent.mt (left); and the relationship between nCount_RNA and nFeature_RNA (right) prior to QC filtering.\u003cbr\u003e\n \u003cstrong\u003e(C)\u003c/strong\u003e Violin plots showing the distribution of nFeature_RNA, nCount_RNA, and percent.mt across all cells after QC filtering (nFeature_RNA \u0026gt; 100, percent.mt \u0026lt; 20, nCount_RNA \u0026lt; 30,000).\u003cbr\u003e\n \u003cstrong\u003e(D)\u003c/strong\u003e Scatter-density plots visualizing the relationship between nCount_RNA and percent.mt (left) and between nCount_RNA and nFeature_RNA (right) after QC filtering; the 22,723 cells that passed the QC filters were used for all subsequent analyses.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/0f34addf7e8c94bfd5149964.png"},{"id":102850557,"identity":"b3f34350-f30b-4fa7-a2fe-d4962d91282d","added_by":"auto","created_at":"2026-02-17 14:11:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":512465,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIdentification of highly variable genes, dimensionality reduction, and cell type annotation.\u003c/strong\u003e\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e Plot of the 3,000 most highly variable genes (HVGs) identified in the dataset. Genes are plotted by average expression (x-axis) and expression variance (y-axis).\u003cbr\u003e\n \u003cstrong\u003e(B)\u003c/strong\u003e Principal Component Analysis (PCA) plot of the integrated scRNA-seq dataset. The plot shows the top principal components capturing the main sources of variation.\u003cbr\u003e\n \u003cstrong\u003e(C)\u003c/strong\u003e t-distributed Stochastic Neighbor Embedding (t-SNE) visualization of the 24 unsupervised cell clusters identified based on the top 50 principal components.\u003cbr\u003e\n \u003cstrong\u003e(D)\u003c/strong\u003e Dot plot displaying the expression levels of canonical marker genes used to annotate the 24 clusters into major cell types.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E)\u003c/strong\u003e t-SNE plot showing the final annotation of cells into 10 major cell types: Endothelial cells, Epithelial cells (EPCs), Fibroblasts, Immune cells, Keratinocytes, Mesenchymal cells (MES), MKI67+ epithelial cells (MKI67+ EPCs), Schwann cells, Smooth muscle cells, and Others.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F)\u003c/strong\u003e Stacked bar chart showing the proportional distribution of each annotated cell type in both TAO and normal control samples.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/807ffe444f484e27f1045f63.png"},{"id":102850568,"identity":"d0df571a-54d5-41e0-87fe-e3c09d1ccf17","added_by":"auto","created_at":"2026-02-17 14:11:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1759396,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnalysis of heterogeneity within epithelial cell (EPC) populations.\u003cbr\u003e\n(A)\u003c/strong\u003e PCA plot of cells re-clustered from the EPC population.\u003cbr\u003e\n \u003cstrong\u003e(B)\u003c/strong\u003e UMAP plot illustrating sub-clustering of EPCs into two distinct subpopulations: EPC1 and EPC2.\u003cbr\u003e\n \u003cstrong\u003e(C)\u003c/strong\u003e Dot plot showing the expression of select marker genes defining the EPC1 (e.g., Acsbg1, Elovl6, Vim, Cdh2) and EPC2 (e.g., \u003cem\u003eIL-20\u003c/em\u003e) subpopulations.\u003cbr\u003e\n \u003cstrong\u003e(D)\u003c/strong\u003e UMAP plot displaying the annotated EPC1 and EPC2 subpopulations.\u003cbr\u003e\n \u003cstrong\u003e(E)\u003c/strong\u003e Bar plot quantifies the proportional abundance of EPC1 and EPC2 subpopulations in TAO and normal control samples. It demonstrates the specific enrichment of EPC1 in TAO.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/20c5f001cfac49c50928bb8d.png"},{"id":102850564,"identity":"51ad1007-78ec-49c1-8519-6589f3112e29","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1873036,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional enrichment analysis of the EPC1 subpopulation.\u003c/strong\u003e\u003cbr\u003e\n \u003cstrong\u003e(A-B)\u003c/strong\u003e Top significantly enriched Gene Ontology (GO) Biological Process terms for genes upregulated in EPC1 compared to EPC2.\u003cbr\u003e\n \u003cstrong\u003e(C-D)\u003c/strong\u003e Top significantly enriched KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways for genes upregulated in EPC1.\u003cbr\u003e\n \u003cstrong\u003e(E-F)\u003c/strong\u003e Gene Set Enrichment Analysis (GSEA) plots that confirm the significant upregulation of fatty acid metabolism and biosynthesis pathways in the EPC1 subpopulation.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/5f59e5aecb8172a00d2879da.png"},{"id":102850559,"identity":"15a295c5-3888-4af2-9279-324ce1021227","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2902723,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHeterogeneity analysis of mesenchymal cells (MES).\u003c/strong\u003e\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e PCA plot of cells re-clustered from the mesenchymal cell population.\u003cbr\u003e\n \u003cstrong\u003e(B)\u003c/strong\u003e UMAP visualization showing the sub-clustering of MES cells.\u003cbr\u003e\n \u003cstrong\u003e(C)\u003c/strong\u003e Dot plot showing the expression of key marker genes that identify the Epcam+Mes (epithelial-like) and Pax6+Mes (fibroblast-like) subpopulations.\u003cbr\u003e\n \u003cstrong\u003e(D)\u003c/strong\u003e t-SNE plot of the MES population annotated with the two identified subpopulations.\u003cbr\u003e\n \u003cstrong\u003e(E)\u003c/strong\u003e Bar plot showing the relative proportions of MES subpopulations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F)\u003c/strong\u003e Feature plots visualizing the expression patterns of Pax6, Kit, and Cdh4, showing their specific enrichment at the gene expression level in the Pax6+Mes subpopulation.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/fd124cb225d99bcc9d51dfbb.png"},{"id":102850563,"identity":"22b08ae8-e377-492d-8a52-f0e0fafd06d5","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3408847,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePseudotime trajectory analysis depicting the developmental progression of mesenchymal cells\u003cbr\u003e\n(A-C)\u003c/strong\u003e Pseudotime trajectory of MES cells from a normal control sample, colored by cell state (A), subpopulation (B), and pseudotime (C).\u003cbr\u003e\n \u003cstrong\u003e(D-F)\u003c/strong\u003e Pseudotime trajectory of MES cells from a TAO sample, colored by cell state (D), subpopulation (E), and pseudotime (F).\u003cbr\u003e\n \u003cstrong\u003e(G)\u003c/strong\u003e Expression dynamics of genes (Ddx5, Nrxn1, Pax6, Slc4a8) along the pseudotime trajectory in the normal control sample.\u003cbr\u003e\n \u003cstrong\u003e(H)\u003c/strong\u003e Expression dynamics of the aforementioned genes along the pseudotime trajectory in the TAO sample. A consistent increase in Pax6 expression is observed as cells progress along the EMT trajectory in both conditions.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/d2af85573ad6cecb22fbf09e.png"},{"id":102850560,"identity":"0aa5c877-d8f9-43ba-90cb-d2ccbb72a3e7","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2890315,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCharacterization of the TAO mouse model.\u003c/strong\u003e\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e Body weight of control (Ad-NC) and TAO (Ad-TSHR A) mice during the 16-week immunization. Data are presented as mean ± SD; n.s., not significant (unpaired t-test).\u003cbr\u003e\n \u003cstrong\u003e(B)\u003c/strong\u003e H\u0026amp;E-stained thyroid tissue images from control and TAO mice. Red arrows indicate necrotic/atrophic follicles; yellow arrows indicate damaged cuboidal epithelium; black arrows indicate inflammatory cell infiltration. Scale bar, 100 μm.\u003cbr\u003e\n \u003cstrong\u003e(C)\u003c/strong\u003e Representative H\u0026amp;E-stained images of orbital connective tissues. Black arrows indicate degenerated lacrimal gland acinar cells; red arrows indicate stromal inflammatory infiltration. Scale bar = 100 μm.\u003cbr\u003e\n \u003cstrong\u003e(D-F)\u003c/strong\u003e Panels show serum levels of free thyroxine (FT4) (D), thyroid-stimulating hormone (TSH) (E), and TSH receptor antibodies (TRAb) (F) measured by ELISA. Data are presented as mean ± SD; *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 versus the Ad-NC group (unpaired t-test).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/fe14f063a09361406370649e.png"},{"id":102850565,"identity":"ea6c943e-2e68-4be4-b0a1-f265e567e618","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":3444442,"visible":true,"origin":"","legend":"\u003cp\u003eValidation of altered fatty acid metabolism and increased PAX6 expression in TAO.\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e Western blot and quantification of Acsbg1 and Elovl6 in orbital connective tissues from control and TAO mice. GAPDH was used as a loading control.\u003cbr\u003e\n \u003cstrong\u003e(B-C)\u003c/strong\u003e Quantitative analysis of lipid levels in orbital tissues: (B) Triglycerides (TG) and total cholesterol (TC); (C) High-Density Lipoprotein (HDL) and Low-Density Lipoprotein (LDL).\u003cbr\u003e\n \u003cstrong\u003e(D)\u003c/strong\u003e Representative immunohistochemistry (IHC) images of PAX6 protein expression in orbital tissues, accompanied by quantitative analysis. Scale bar, 50 μm.\u003cbr\u003e\nData in panels A–C are presented as mean ± SD; *p \u0026lt; 0.05, **p \u0026lt; 0.01 vs. control group (unpaired t-test).\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/b3bd447311951bc89d94f3f6.png"},{"id":102850558,"identity":"5f12b0cd-6db7-4f09-8d27-2c2d5190f214","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":5314505,"visible":true,"origin":"","legend":"\u003cp\u003ePAX6 knockdown reduces orbital fibrosis and EMT in vivo.\u003cbr\u003e\nTAO mice received control (sh-NC) or PAX6-targeting (sh-PAX6) lentivirus.\u003cbr\u003e\n \u003cstrong\u003e(A)\u003c/strong\u003e Representative Masson’s trichrome-stained sections of orbital tissues. Collagen deposition is indicated by blue staining. Scale bar, 50 μm.\u003cbr\u003e\n \u003cstrong\u003e(B)\u003c/strong\u003e Representative immunohistochemistry (IHC) images and quantification showing protein expression of PAX6, α-SMA, FN1, and COL1A1. Scale bar, 50 μm.\u003cbr\u003e\n \u003cstrong\u003e(C)\u003c/strong\u003e qPCR analysis of \u003cem\u003eα-SMA\u003c/em\u003e, \u003cem\u003eFN1\u003c/em\u003e, and \u003cem\u003eCOL1A1\u003c/em\u003e mRNA expression in orbital tissues.\u003cbr\u003e\n \u003cstrong\u003e(D)\u003c/strong\u003e Western blot analysis and quantification of the EMT markers Vimentin and N-cadherin. GAPDH was used as a loading control.\u003cbr\u003e\n \u003cstrong\u003e(E)\u003c/strong\u003e Representative immunofluorescence (IF) staining images for Vimentin (red) and N-cadherin (green) in orbital tissues. Nuclei are counterstained with DAPI (blue). Scale bar, 25 μm.\u003cbr\u003e\nData are presented as mean ± SD. Statistical significance was determined by unpaired t-test (*p \u0026lt; 0.05, **p \u0026lt; 0.01) compared to the sh-NC group.\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/9c276f09df6bf75f47a02001.png"},{"id":102850561,"identity":"ddbe336a-9dce-4a01-a6a9-eb2d718acfbe","added_by":"auto","created_at":"2026-02-17 14:11:42","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":1904484,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePAX6 regulates proliferation, migration, and fibrogenic activation of orbital fibroblasts (OFs) in vitro.\u003cbr\u003e\n(A-B)\u003c/strong\u003e PAX6 expression in orbital fibroblasts (OFs) isolated from normal and thyroid-associated ophthalmopathy (TAO) mice, as determined by (A) qPCR and (B) Western blot.\u003cbr\u003e\n \u003cstrong\u003e(C)\u003c/strong\u003e qPCR validation of PAX6 knockdown efficiency in TAO-derived OFs 24 h post-transfection with sh-NC or sh-PAX6.\u003cbr\u003e\n \u003cstrong\u003eD-J shows OFs transfected with sh-NC or sh-PAX6 were treated with 10 ng/mL TGF-β1 for 48 h.\u003c/strong\u003e\u003cbr\u003e\n \u003cstrong\u003e(D)\u003c/strong\u003e Representative phase-contrast images showing cell morphology. Scale bar, 100 μm.\u003cbr\u003e\n \u003cstrong\u003e(E)\u003c/strong\u003e qPCR analysis of fibrotic marker (\u003cem\u003eα-SMA\u003c/em\u003e, \u003cem\u003eFN1\u003c/em\u003e, \u003cem\u003eCOL1A1\u003c/em\u003e) mRNA expression.\u003cbr\u003e\n \u003cstrong\u003e(F)\u003c/strong\u003e Cell proliferation measured by CCK-8 assay at indicated time points.\u003cbr\u003e\n \u003cstrong\u003e(G)\u003c/strong\u003e Representative images (left) and quantification (right) of EdU incorporation assay (EdU, red; DAPI, blue). Scale bar, 100 μm.\u003cbr\u003e\n \u003cstrong\u003e(H)\u003c/strong\u003e Representative images (left) and quantification (right) of Transwell migration assay. Scale bar, 100 μm.\u003cbr\u003e\n \u003cstrong\u003e(I)\u003c/strong\u003e Western blot analysis of Vimentin and N-cadherin protein expression.\u003cbr\u003e\n \u003cstrong\u003e(J)\u003c/strong\u003e Representative immunofluorescence images for Vimentin (green) and N-cadherin (red). Nuclei are counterstained with DAPI (blue). Scale bar, 25 μm.\u003cbr\u003e\nData are presented as mean ± SD. Statistical significance is indicated as *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001 versus the sh-NC group; #p \u0026lt; 0.05, ##p \u0026lt; 0.01 versus the sh-NC + TGF-β1 group (one-way ANOVA or unpaired t-test as appropriate).\u003c/p\u003e","description":"","filename":"Figure10.png","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/f2ef88c596d86163b1870f35.png"},{"id":105833975,"identity":"ce892165-2405-4db6-b706-f3b073d6d815","added_by":"auto","created_at":"2026-03-31 15:13:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":23945822,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8645473/v1/64a71cb9-bb50-49a4-ab6e-02c0ac306f8e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003ePax6 Drives Orbital Fibrosis in Thyroid-Associated Orbitopathy via Fatty Acid Metabolism-Mediated Epithelial-Mesenchymal Transition in Mice\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThyroid-associated orbitopathy (TAO) is an autoimmune disorder affecting retro-orbital tissues, often linked to hyperthyroidism and Graves\u0026rsquo; disease, causing proptosis, diplopia, and ocular discomfort that affects quality of life.(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) The pathogenesis of TAO involves immune mechanisms with inflammation, fibrosis, and adipogenesis, where orbital fibroblasts (OFs) are key effector cells.(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eRecent investigations show that OFs in TAO activate and proliferate, contributing to extracellular matrix (ECM) deposition and promoting fibrosis.(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e) The epithelial-mesenchymal transition (EMT) is crucial in the fibrotic response in various tissues, including the orbit, and is a key factor in tissue fibrosis progression.(\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) EMT involves losing epithelial markers and gaining mesenchymal traits, enhancing migration and proliferation. Key markers like Vimentin, N-cadherin, and Alpha-smooth muscle actin (α-SMA) link EMT to fibrotic diseases like TAO.(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003cem\u003ePax6\u003c/em\u003e is a key transcription factor in eye development and is linked to ocular diseases like fibrosis, with metabolic cues influencing its expression, indicating a connection to metabolic dysregulation in TAO.(\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e) However, the specific mechanisms through which \u003cem\u003ePax6\u003c/em\u003e affects EMT and fibrosis in TAO remain unclear. Therefore, we hypothesize that a dysregulated interplay between fatty acid metabolism and \u003cem\u003ePax6\u003c/em\u003e expression contributes to EMT and fibrosis in TAO.\u003c/p\u003e \u003cp\u003eOur study uses single-cell RNA sequencing (scRNA-seq) to analyze cellular heterogeneity, identify pathogenic subpopulations, and examine their metabolic profiles, focusing on the relationship between fatty acid metabolism, \u003cem\u003ePax6\u003c/em\u003e expression, and EMT in TAO. We will investigate \u003cem\u003ePax6\u003c/em\u003e's role in regulating OFs activation, proliferation, migration, and fibrogenesis through \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e studies, aiming to uncover TAO's molecular mechanisms and explore \u003cem\u003ePax6\u003c/em\u003e as a potential therapy for orbital fibrosis.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSingle-cell RNA Sequencing (scRNA-seq) Data Analysis\u003c/h2\u003e \u003cp\u003escRNA-seq data from one TAO sample and one control mouse were processed with Seurat (v4.1.0) in R, identifying highly variable genes (HVGs) and conducting principal component analysis (PCA) for dimensionality reduction. Clustering of cells using the top 50 principal components resulted in 24 clusters, which were annotated into 10 cell populations based on marker genes from CellMarker 2.0 and literature. Differential expression analysis was performed with FindMarkers, followed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses and Gene Set Enrichment Analysis (GSEA) to explore biological processes. Finally, pseudotime trajectory analysis was conducted using Monocle2 to infer cellular transitions.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMouse Model of TAO\u003c/h3\u003e\n\u003cp\u003eFemale BALB/c mice aged 6 to 8 weeks were obtained from Hangzhou HanSI Biotechnology and kept in a specific pathogen-free (SPF) environment. All experiments were approved by Zhejiang Luoxi Medical Technology's Ethics Committee (No. LX482 4122701). To induce TAO, mice were anesthetized with 3% sodium pentobarbital and immunized with 1\u0026times;10\u0026sup1;⁰ plaque-forming units (PFU) of a recombinant adenovirus carrying the human thyroid-stimulating hormone receptor A subunit (Ad-TSHR A) in the tibialis anterior muscle, while controls received a negative control adenovirus (Ad-NC). Immunizations occurred at weeks 0, 3, 6, and 9, with blood samples taken before and two weeks post-immunization for analysis. After 16 weeks, mice were euthanized, and blood, thyroid, and orbital tissues were collected for further studies.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn Vivo Pax6\u003c/b\u003e \u003cb\u003eKnockdown\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTAO model mice were randomly divided into two groups of 10 mice each. The first group, named sh-NC, received a tail vein injection of 100 \u0026micro;L control lentivirus at 1\u0026times;10⁷ TU/mL. The second group, named sh-\u003cem\u003ePax6\u003c/em\u003e, received 100 \u0026micro;L of \u003cem\u003ePax6\u003c/em\u003e-targeting shRNA lentivirus at the same concentration via tail vein injection. Both lentiviruses were supplied by Genomeditech (China). After four weeks, all mice were euthanized for tissue analysis.\u003c/p\u003e\n\u003ch3\u003eIsolation and Culture of Orbital Fibroblasts (OFs)\u003c/h3\u003e\n\u003cp\u003eOrbital tissues from both TAO and control mice were minced and placed onto plastic culture dishes, where OFs migrated from the tissue fragments and established a monolayer in Dulbecco's Modified Eagle Medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% antibiotics. The cells were incubated at 37\u0026deg;C in 5% CO₂ and serially passaged with trypsin/EDTA solution. For all \u003cem\u003ein vitro\u003c/em\u003e experiments, OFs from passages 4 to 10 were used.\u003c/p\u003e\n\u003ch3\u003eCell Transfection and Treatment\u003c/h3\u003e\n\u003cp\u003eOFs were isolated from TAO mice. These cells were transfected with either a PLKO.1-\u003cem\u003ePax6\u003c/em\u003e knockdown vector (sh-\u003cem\u003ePax6\u003c/em\u003e) or a PLKO.1 negative control vector (sh-NC), both from Genomeditech, China. Transfection was performed using Lipofectamine\u0026reg; 3000 (Invitrogen, USA) according to the manufacturer's instructions. Stable transfectants were selected using puromycin and expanded for further experiments. The efficiency of \u003cem\u003ePax6\u003c/em\u003e knockdown was confirmed by quantitative PCR (qPCR). They were treated with 10 ng/mL transforming growth factor-β1 (TGF-β1, Jiatian Bio, China) for 48 hours to induce fibrosis.\u003c/p\u003e\n\u003ch3\u003eQuantitative Real-Time PCR (qPCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from cells or tissues using TRIzol reagent (Beyotime, China). RNA concentration and purity were measured with a NanoDrop spectrophotometer (Thermo Scientific, USA). For cDNA synthesis, 1 \u0026micro;g of total RNA was used with the PrimeScript RT reagent kit (Takara, Japan). Quantitative PCR (qPCR) was performed using TB Green Premix Ex Taq II (Takara, Japan) on an ABI 7500 Real-Time PCR System (Thermo Scientific, USA). The relative expression levels of target genes, including \u003cem\u003ePax6\u003c/em\u003e, α-SMA, FN1, and COL1A1, were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method, with GAPDH as the internal control. The primer sequences are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences of qPCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5' to 3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePAX6\u003c/b\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGCAGGTATTACGAGACTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePAX6\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTCCCGCTTATACTGGGCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eα-SMA\u003c/b\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCCCAGGCTAGAGAGCATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eα-SMA\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACACATAGCTGGAGCTGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFN1\u003c/b\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCAAGTGGTCCTGTCGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFN1\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGTGGGATACTCACAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCOL1A1\u003c/b\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAAGATGGACTCAACGGTCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCOL1A1\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATCGTGAGCCTTCTCTTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH\u003c/b\u003e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCTCCGGGTGATGCTTTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGAPDH\u003c/b\u003e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAAGGGGTCATTGATGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern Blotting (WB)\u003c/h2\u003e \u003cp\u003eProteins were extracted using RIPA buffer (Beyotime, China) with protease inhibitors, and their concentration was measured with a BCA kit (Beyotime, China). For analysis, 20 \u0026micro;g of protein was separated by SDS-PAGE, transferred to PVDF membranes, blocked with 5% milk, and incubated overnight at 4\u0026deg;C with primary antibodies: anti-\u003cem\u003ePax6\u003c/em\u003e (12323-1-AP, Proteintech; 1:1000), anti-Acsbg1 (16077-1-AP, Proteintech; 1:1000), anti-Elovl6 (ab69857, Abcam; 1:1000), anti-Vimentin (10366-1-AP, Proteintech; 1:2000), anti-N-cadherin (22018-1-AP, Proteintech; 1:2000), and anti-GAPDH (10494-1-AP, Proteintech; 1:5000). After washing, membranes were treated with an HRP-conjugated secondary antibody, and protein bands were visualized using ECL substrate (Beyotime, China).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCell Proliferation and Migration\u003c/h3\u003e\n\u003cp\u003eIn the CCK-8 assay, OFs were plated at 2,000 cells/well in 96-well plates, and absorbance was measured after adding CCK-8 solution at various time points. For the EdU assay, OFs were plated at 50,000 cells/well in 24-well plates, treated with EdU, fixed, and stained for imaging.\u003c/p\u003e\n\u003ch3\u003eFibrosis Morphology Observation\u003c/h3\u003e\n\u003cp\u003eOFs were seeded in 24-well plates at a density of 60,000 cells per well. Once the cells adhered, they were treated with TGF-β1 under specified conditions. Changes in cell morphology were observed and recorded using an inverted microscope (Olympus, Japan).\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTranswell Migration Assay\u003c/h2\u003e \u003cp\u003eWe assessed cell migration in 24-well Transwell chambers by adding OFs to the upper chamber and medium with FBS to the lower chamber. After 48 hours, we removed non-migrated cells, fixed the migrated ones, stained them, and counted under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological Examination\u003c/h2\u003e \u003cp\u003eThyroid and orbital tissues were fixed in 4% paraformaldehyde, embedded, sectioned, and stained with Hematoxylin and Eosin (H\u0026amp;E) using a Beyotime kit (C0105S, China) for morphology and inflammation assessment, while collagen deposition was examined using Masson's Trichrome staining (Solarbio, G1340, China), with images captured via a light microscope (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IF) Staining\u003c/h2\u003e \u003cp\u003eFor tissue sections, samples were deparaffinized, rehydrated, and underwent antigen retrieval with EDTA buffer and microwave heating. After BSA blocking, sections were incubated overnight at 4\u0026deg;C with primary antibodies against Vimentin (HY-P80371, MCE, USA) and N-cadherin (22018-1-AP, Proteintech, USA), followed by Alexa Fluor 555-conjugated secondary antibody (A27039, Invitrogen, USA) for 1 hour at room temperature, with nuclei stained by DAPI. For cultured cells, OFs on coverslips were fixed, permeabilized, blocked, and incubated with primary antibodies against (60330-1-Ig, Proteintech, USA) and N-cadherin (22018-1-AP, Proteintech, USA), then treated with Alexa Fluor 488 or 594-conjugated secondary antibodies (A28175 and A-11012, Invitrogen, USA), with nuclei stained by DAPI. Fluorescent images were captured using a Nikon fluorescence microscope (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC) Staining\u003c/h2\u003e \u003cp\u003eDeparaffinized orbital tissue sections were treated with 3% H₂O₂, followed by antigen retrieval with citrate buffer. Sections were incubated overnight at 4\u0026deg;C with primary antibodies against \u003cem\u003ePax6\u003c/em\u003e, \u003cem\u003eα-SMA\u003c/em\u003e, \u003cem\u003eFN1\u003c/em\u003e (all from Proteintech), an\u003cem\u003ed COL1A1\u003c/em\u003e (CST, USA), then treated with an HRP-conjugated secondary antibody (ab205718, Abcam, UK) for 2 hours. DAB substrate visualized signals, nuclei were counterstained with hematoxylin (Beyotime, China), and sections were dehydrated, mounted (Sinopharm, China), and imaged (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-Linked Immunosorbent Assay (ELISA)\u003c/h2\u003e \u003cp\u003eSerum levels of free thyroxine (FT4, CB10813-Mu), thyroid-stimulating hormone (TSH, CB10236-Mu), and TSH receptor antibody (TRAb, CB11059-Mu) were measured using commercial ELISA kits (Coibo, China), strictly according to the manufacturer's protocols. Absorbance was measured at 450 nm on a Multiskan FC microplate reader (Thermo Scientific, USA), and concentrations were calculated based on the standard curves.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eDetection of Fatty Acid Metabolism Indicators\u003c/h2\u003e \u003cp\u003eOrbital connective tissues were homogenized or sonicated in cold PBS, then centrifuged at 8000 g for 10 min at 4\u0026deg;C to collect the supernatants. The levels of triglycerides (TG, E-BC-K261-M), total cholesterol (TC, E-BC-K109-M), high-density lipoprotein (HDL, E-EL-M1402), and low-density lipoprotein (LDL, E-EL-M1363) were quantified using commercial assay kits (Elabscience, China) according to the manufacturer\u0026rsquo;s instructions. Absorbance for TG and TC was measured at 510 nm, while that for HDL and LDL was measured at 450 nm using a Multiskan FC microplate reader (Invitrogen, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were conducted using GraphPad Prism (version 8.0.2). All data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Differences between two groups were analyzed using Student's unpaired \u003cem\u003et\u003c/em\u003e-test. Comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA). A \u003cem\u003eP\u003c/em\u003e-value of less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003escRNA-seq Reveals TAO-Specific Cellular Heterogeneity and a Pathogenic Epithelial Subpopulation with Dysregulated Metabolism\u003c/h2\u003e \u003cp\u003eWe conducted scRNA-seq on tissues from one TAO mouse and one control, filtering to retain 22,723 high-quality cells and 47,362 genes for analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-D). First, the HVGs between cells were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), followed by PCA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The t-distributed stochastic neighbor embedding (t-SNE) revealed 24 distinct clusters (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), which were annotated into 10 major cell types\u0026mdash;including endothelial cells, epithelial cells (EPCs), fibroblasts, immune cells, and mesenchymal cells (MESCs)\u0026mdash;based on canonical marker genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eEpithelial cells exhibited significant heterogeneity, subdividing into EPC1 and EPC2 subpopulations (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-D). The EPC1 subpopulation was almost exclusively present in the TAO sample and showed upregulation of fatty acid metabolism genes (Acsbg1, Elovl6) and EMT markers (vimentin, N-cadherin) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-E). In contrast, EPC2 was found in both samples and expressed genes for normal epithelial function. Functional enrichment analysis of differentially expressed genes (DEGs) revealed fatty acid metabolism as the most enriched process in EPC1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-D), further validated by GSEA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-F). These results identify a TAO-specific epithelial subpopulation with a dysregulated metabolic profile likely contributing to fibrosis via EMT.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIdentification of a\u003c/b\u003e \u003cb\u003ePax6\u003c/b\u003e\u0026thinsp;\u003cb\u003e+\u0026thinsp;Mesenchymal Subpopulation Associated with EMT Trajectory\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBecause EPCs are linked to EMT, we next examined heterogeneity within the mesenchymal compartment. Further clustering of MES revealed two main subsets (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B): Epcam\u0026thinsp;+\u0026thinsp;Mes cells retaining epithelial markers (Epcam, Cd24, Krt18) and \u003cem\u003ePax6\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Mes cells showing a fibroblast-like phenotype with high expression of \u003cem\u003ePax6\u003c/em\u003e, Kit, Cdh4, and the fibrotic marker Col1a1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe used Monocle2 for pseudotime analysis to reconstruct cell development, positioning Epcam\u0026thinsp;+\u0026thinsp;Mes and \u003cem\u003ePax6\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Mes populations at opposite ends of an EMT spectrum (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-F), with \u003cem\u003ePax6\u003c/em\u003e expression increasing along this trajectory in normal and TAO samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-H), indicating its role as a marker and potential driver of fibrogenic transition.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eSuccessful Validation of the TAO Mouse Model\u003c/h2\u003e \u003cp\u003eWe established a TAO mouse model by immunizing BALB/c mice with an adenovirus encoding the human TSHR A subunit (Ad-TSHR A), showing classic histopathological features of TAO despite no significant weight difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eH\u0026amp;E staining revealed structural abnormalities in the thyroid, including follicular necrosis, destruction of cuboidal EPCs, and significant inflammation infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Orbital tissues from the model exhibited acinar cell degeneration in the lacrimal gland and mild stromal inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Serologically, the model showed a significant increase in serum levels of FT4 and TRAb, alongside a decrease in TSH (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD-F), indicating hyperthyroidism and autoimmune activity.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConfirmation of Dysregulated Fatty Acid Metabolism and Elevated\u003c/b\u003e \u003cb\u003ePax6\u003c/b\u003e \u003cb\u003eExpression in TAO\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNext, we aimed to validate the key molecular signatures identified by scRNA-seq at both protein and functional levels. Western blot analysis of orbital tissues confirmed that the protein levels of Acsbg1 and Elovl6 were significantly higher in TAO mice compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Quantitative assays showed a substantial lipid accumulation in TAO orbits, including increased levels of triglycerides (TG), total cholesterol (TC), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB-C), consistent with active fatty acid metabolism. Moreover, IHC demonstrated a marked increase in \u003cem\u003ePax6\u003c/em\u003e protein expression in the orbital connective tissues of TAO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePax6\u003c/b\u003e \u003cb\u003eKnockdown Reduces Orbital Fibrosis and Inhibits EMT\u003c/b\u003e \u003cb\u003eIn Vivo\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo directly assess \u003cem\u003ePax6\u003c/em\u003e\u0026rsquo;s role in TAO pathogenesis, we delivered a \u003cem\u003ePax6\u003c/em\u003e-targeting shRNA lentivirus (sh-\u003cem\u003ePax6\u003c/em\u003e) via tail vein injection to established TAO mice, achieving \u003cem\u003ein vivo\u003c/em\u003e knockdown. Masson's trichrome staining showed that \u003cem\u003ePax6\u003c/em\u003e knockdown markedly reduced collagen deposition and fibrosis in the orbital tissue compared to the sh-NC control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA). IHC and qPCR analyses consistently showed that sh-\u003cem\u003ePax6\u003c/em\u003e treatment significantly reduced \u003cem\u003ePax6\u003c/em\u003e expression along with key fibrotic markers α-SMA, FN1, and COL1A1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB-C). Western blot and IF analyses further showed that \u003cem\u003ePax6\u003c/em\u003e knockdown significantly reduced the expression of core EMT markers Vimentin and N-cadherin (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eD-E). These results provide direct \u003cem\u003ein vivo\u003c/em\u003e evidence that \u003cem\u003ePax6\u003c/em\u003e is a critical promoter of fibrosis and EMT in TAO.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePax6\u003c/b\u003e \u003cb\u003eDrives Activation, Proliferation, Migration, and Fibrosis in Orbital Fibroblasts\u003c/b\u003e \u003cb\u003eIn Vitro\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe studied \u003cem\u003ePax6\u003c/em\u003e in OFs, confirming its higher expression in TAO-derived OFs versus controls and its efficient knockdown using sh-\u003cem\u003ePax6\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA-B). TGF-β1-induced transformation of control OFs into myofibroblasts was inhibited in sh-\u003cem\u003ePax6\u003c/em\u003e OFs (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC-D), which also showed reduced mRNA expression of the fibrotic markers \u003cem\u003eα-SMA, FN1\u003c/em\u003e, and \u003cem\u003eCOL1A1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eE). Functionally, \u003cem\u003ePax6\u003c/em\u003e knockdown significantly impaired OF proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eF-G) and drastically reduced migratory capacity (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eH). Molecularly, \u003cem\u003ePax6\u003c/em\u003e depletion abolished the TGF-β1-induced upregulation of the EMT markers Vimentin and N-cadherin (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eI-J). These results establish \u003cem\u003ePax6\u003c/em\u003e as a master regulator driving pro-fibrotic activation, proliferation, migration, and EMT of OFs in TAO.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eClinical intervention for TAO relies on glucocorticoids and immunosuppressants, which can cause adverse reactions, necessitating further research into TAO's mechanisms and new therapeutic targets.(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e) We explored TAO's cellular heterogeneity using an in-house dataset, focusing on an epithelial subpopulation in fatty acid metabolism. \u003cem\u003ePax6\u003c/em\u003e was crucial in MESCs during EMT progression. A TAO mouse model and \u003cem\u003ein vitro\u003c/em\u003e experiments validated our findings, supporting our analysis. This study clarifies TAO's mechanisms, laying a foundation for targeted therapies and diagnostics.\u003c/p\u003e \u003cp\u003eEMT is vital for healing and fibrosis, as EPCs become fibroblast-like cells for repair and produce myofibroblasts.(\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e) EMT in RPE is key to subretinal fibrosis in neovascular age-related macular degeneration (nAMD).(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) Research links fibrosis to autoimmune diseases like TAO, prompting our analysis of EPCs and MESCs to explore the EMT pathway in TAO and its fibrosis mechanisms.\u003c/p\u003e \u003cp\u003eSingle-cell sequencing of TAO and control mouse samples revealed upregulation of fatty acid metabolism genes and EMT markers in the EPC1 subpopulation of TAO, indicating enrichment in fatty acid metabolism. Abnormal lipid metabolism is linked to various pathologies, and changes in fatty acid metabolism are associated with retinal dysfunction and ocular diseases.(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e)\u003csup\u003e,\u003c/sup\u003e(\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e) Inhibition of PGC-1α leads to lipid metabolic disorders causing RPE and retina degeneration.(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e) While the link between fatty acid metabolism and TAO is unclear, TAO model mice exhibited increased expression of fatty acid metabolism genes and lipid content, suggesting its involvement in TAO pathogenesis. Future research should investigate lipid deposition mechanisms in TAO for prevention and treatment insights.\u003c/p\u003e \u003cp\u003eThis study identified a \u003cem\u003ePax6\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Mes subpopulation from MESCs via single-cell sequencing, which shows high fibroblast-like expression of the \u003cem\u003ePax6\u003c/em\u003e gene. \u003cem\u003ePax6\u003c/em\u003e is a crucial gene in eye development, serving as a master regulator of morphogenesis in the regulatory network.(\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e) While previous studies primarily focused on \u003cem\u003ePax6\u003c/em\u003e\u0026rsquo;s regulatory roles in eye development, recent research indicates that upregulation of \u003cem\u003ePax6\u003c/em\u003e facilitates activation and proliferation of hepatic stellate cells (HSCs), contributing to liver fibrosis. Conversely, in cardiac fibrosis studies, \u003cem\u003ePax6\u003c/em\u003e inhibits fibrotic progression.(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e) These findings underscore the pivotal role of \u003cem\u003ePax6\u003c/em\u003e in modulating fibrotic responses. Furthermore, within oncology research, \u003cem\u003ePax6\u003c/em\u003e is also acknowledged as a key molecule promoting EMT.(\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e) Our analysis indicated that \u003cem\u003ePax6\u003c/em\u003e expression rises during EMT, leading us to hypothesize its role in fibrotic responses in TAO. Knockdown experiments in a TAO mouse model showed reduced EMT markers and less fibrosis compared to controls, supporting Li et al.'s findings that \u003cem\u003ePax6\u003c/em\u003e regulates Vimentin and N-cadherin to activate TAO-related fibrosis.(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e)\u003c/p\u003e \u003cp\u003eOrbital fibrosis is a characteristic feature of tissue remodeling in TAO. TAO is a chronic and progressive orbital disease, and currently, there are no effective treatment options available.(\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e) In the pathological process of TAO, OF play a pivotal role, with TGF-β1 serving as a crucial inducer of myofibroblast differentiation and subsequent tissue fibrosis.(\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e) We knocked down \u003cem\u003ePax6\u003c/em\u003e in OFs and treated them with TGF-β1 to study its role in TAO-related fibrosis, finding that reduced \u003cem\u003ePax6\u003c/em\u003e inhibited OF proliferation, migration, and fibrosis, underscoring its importance in TAO pathogenesis and aligning with studies on \u003cem\u003eSOX9\u003c/em\u003e's role via the MAPK/ERK1/2 pathway.(\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e) We observed a significant reduction in EMT marker levels in \u003cem\u003ePax6\u003c/em\u003e knockdown OFs, concluding that \u003cem\u003ePax6\u003c/em\u003e activates fibroblasts and promotes their growth via EMT signaling during TGF-β1-induced fibrosis. This study focused on OFs, without addressing interactions with immune cells, which could be explored in future research.\u003c/p\u003e \u003cp\u003eIn summary, our research used single-cell sequencing to reveal epithelial and MESC heterogeneity in TAO, offering insights into cellular changes. We analyzed fatty acid metabolism in a TAO mouse model and identified \u003cem\u003ePax6\u003c/em\u003e's regulatory role in fibrosis during TAO progression, planning further investigations into its influence and potential for anti-fibrotic treatments.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur findings show that \u003cem\u003ePax6\u003c/em\u003e regulates EMT and fibrosis in TAO, influenced by fatty acid metabolism. This study highlights \u003cem\u003ePax6\u003c/em\u003e's role in fibroblast activation and fibrogenesis, emphasizing metabolic reprogramming's impact on fibrosis, which could offer valuable insights for therapeutic strategies. Targeting the \u003cem\u003ePax6\u003c/em\u003e-fatty acid metabolism axis may prevent or treat TAO-related orbital fibrosis and guide future clinical applications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Disclosures\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eAll experiments were approved by Zhejiang Luoxi Medical Technology\u0026apos;s Ethics Committee (No. LX482 4122701).\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eAll authors have given consent to publish.\u003c/p\u003e\n\u003cp\u003eConflict of Interest\u003c/p\u003e\n\u003cp\u003eNone of the authors has any conflicts of interest to disclose.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was supported by the fund Ningbo Clinical Research Center for Ophthalmology(2022L003)\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Authors and Affiliations\u003c/p\u003e\n\u003cp\u003eAuthor list\u003cbr\u003eYunyan Ye Ph. D\u003csup\u003e1\u003c/sup\u003e (
[email protected])\u003cbr\u003eQiao Kong M.D\u003csup\u003e1\u003c/sup\u003e (
[email protected])\u003cbr\u003eJuntao Zhang Ph. D\u003csup\u003e2\u003c/sup\u003e(
[email protected])\u003cbr\u003eHengqian He M.D\u003csup\u003e2\u003c/sup\u003e (
[email protected])\u003c/p\u003e\n\u003cp\u003eAffiliations\u003cbr\u003e\u003csup\u003e1\u003c/sup\u003e Department of Ophthalmology, Ningbo Medical Center Lihuili Hospital, Xingning Road-57, Yinzhou District, Ningbo City, Zhejiang Province, China\u003cbr\u003e\u003csup\u003e2\u003c/sup\u003e Department of Ophthalmology, The Affiliated People\u0026apos;s Hospital of Ningbo University, The Eye Hospital of Wenzhou Medical University (Ningbo Branch), Ningbo City, Zhejiang Province, China\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Contributions\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eYunyan Ye\u003c/strong\u003e: Conceptualization (lead); writing \u0026ndash; original draft (lead); formal analysis (lead); writing \u0026ndash; review and editing (lead). \u003cstrong\u003eQiao Ko\u003c/strong\u003e\u003cstrong\u003eng\u003c/strong\u003e:\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eWriting \u0026ndash; review and editing (supporting).\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eJ\u003c/strong\u003e\u003cstrong\u003euntao Zhang, Hengqian He\u003c/strong\u003e:\u0026nbsp;Software (equal). All the authors read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Disclosure statement\u003c/p\u003e\n\u003cp\u003eAuthor 1:\u0026nbsp;Yunyan Ye\u0026nbsp;has\u0026nbsp;no conflict of interest exists.\u003c/p\u003e\n\u003cp\u003eAuthor 2:\u0026nbsp;Qiao Kong\u0026nbsp;has\u0026nbsp;no conflict of interest exists.\u003c/p\u003e\n\u003cp\u003eAuthor 3:\u0026nbsp;Juntao Zhang\u0026nbsp;has\u0026nbsp;no conflict of interest exists.\u003c/p\u003e\n\u003cp\u003eAuthor\u0026nbsp;4:\u0026nbsp;Hengqian He\u0026nbsp;has\u0026nbsp;no conflict of interest exists.\u003cbr\u003e\u0026nbsp;\u003cbr\u003e\u0026nbsp;Funding statement\u003cbr\u003e\u0026nbsp;Author 1: Author 1: Yunyan was supported by the fund Ningbo Clinical Research Center for Ophthalmology (No.2022L003), and the sponsor or funding organization had no role in the design or conduct of this research.\u003c/p\u003e\n\u003cp\u003eAuthor 2:\u0026nbsp;Qiao Kong:\u0026nbsp;No funding was received for this study.\u003c/p\u003e\n\u003cp\u003eAuthor 3:\u0026nbsp;Juntao Zhang:\u0026nbsp;No funding was received for this study.\u003c/p\u003e\n\u003cp\u003eAuthor 4:\u0026nbsp;Hengqian He:\u0026nbsp;No funding was received for this study.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Additional information\u003c/p\u003e\n\u003cp\u003ePublisher\u0026rsquo;s note\u003c/p\u003e\n\u003cp\u003eSpringer Nature remains neutral regarding jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e\n\u003cp\u003eData availability statement\u003c/p\u003e\n\u003cp\u003eThe datasets supporting the conclusions of this article are included within the article and its additional files.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlves M, Neves C, Carvalho D, Medina JL. (2011) [Thyroid associated orbitopathy]. \u003cem\u003eActa Med Port\u003c/em\u003e 24: 1041\u0026ndash;1050.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHennein L, Robbins SL. (2022) Thyroid-Associated Orbitopathy: Management and Treatment. \u003cem\u003eJ Binocul Vis Ocul Motil\u003c/em\u003e 72: 32\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuonfiglio F, Ponto KA, Pfeiffer N, Kahaly GJ, Gericke A. (2024) Redox mechanisms in autoimmune thyroid eye disease. \u003cem\u003eAutoimmun Rev\u003c/em\u003e 23: 103534.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee ACH, Kahaly GJ. (2023) Pathophysiology of thyroid-associated orbitopathy. \u003cem\u003eBest Pract Res Clin Endocrinol Metab\u003c/em\u003e 37: 101620.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCruz AA, Akaishi PM, Vargas MA, de Paula SA. (2007) Association between thyroid autoimmune dysfunction and non-thyroid autoimmune diseases. \u003cem\u003eOphthalmic Plast Reconstr Surg\u003c/em\u003e 23: 104\u0026ndash;108.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManfioletti G, Fedele M. (2022) Epithelial-Mesenchymal Transition (EMT) 2021. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamouille S, Subramanyam D, Blelloch R, Derynck R. (2013) Regulation of epithelial-mesenchymal and mesenchymal-epithelial transitions by microRNAs. \u003cem\u003eCurr Opin Cell Biol\u003c/em\u003e 25: 200\u0026ndash;207.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshery-Padan R, Gruss P. (2001) Pax6 lights-up the way for eye development. \u003cem\u003eCurr Opin Cell Biol\u003c/em\u003e 13: 706\u0026ndash;714.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, \u003cem\u003eet al.\u003c/em\u003e (2015) Transcription Factor PAX6 (Paired Box 6) Controls Limbal Stem Cell Lineage in Development and Disease. \u003cem\u003eJ Biol Chem\u003c/em\u003e 290: 20448\u0026ndash;20454.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen YT, \u003cem\u003eet al.\u003c/em\u003e (2013) Pax6 downregulation mediates abnormal lineage commitment of the ocular surface epithelium in aqueous-deficient dry eye disease. \u003cem\u003ePLoS One\u003c/em\u003e 8: e77286.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z. (2024) Novel perspectives on the pharmacological treatment of thyroid-associated ophthalmopathy. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e 15: 1469268.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLanzolla G, Marin\u0026ograve; M, Menconi F. (2024) Graves disease: latest understanding of pathogenesis and treatment options. \u003cem\u003eNat Rev Endocrinol\u003c/em\u003e 20: 647\u0026ndash;660.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarrand J, Soyfoo MS. (2023) Involvement of Epithelial-Mesenchymal Transition (EMT) in Autoimmune Diseases. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHughes D, \u003cem\u003eet al.\u003c/em\u003e (2025) Nintedanib Induces Mesenchymal-to-Epithelial Transition and Reduces Subretinal Fibrosis Through Metabolic Reprogramming. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Y, Wen X, Jian X, Chen Q, Li Y. (2025) Klotho attenuates epithelial\u0026ndash;mesenchymal transition of retinal pigment epithelial cells in subretinal fibrosis by suppressing the ERK1/2 and Wnt/β\u0026ndash;catenin signaling pathways. \u003cem\u003eInt J Mol Med\u003c/em\u003e 55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Y, \u003cem\u003eet al.\u003c/em\u003e (2025) AZGP1 Attenuates Subretinal Fibrosis and Inhibits Epithelial-Mesenchymal Transition by Blocking the PI3K/AKT Signaling Pathway. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e 66: 83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYousri NA, \u003cem\u003eet al.\u003c/em\u003e (2022) Metabolic and Metabo-Clinical Signatures of Type 2 Diabetes, Obesity, Retinopathy, and Dyslipidemia. \u003cem\u003eDiabetes\u003c/em\u003e 71: 184\u0026ndash;205.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong W, Chen W, Chi J, Liu X, Zhu W. (2025) The role of lipid metabolism disorder in the progression and treatment of ocular vascular diseases. \u003cem\u003eSurv Ophthalmol\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou S, \u003cem\u003eet al.\u003c/em\u003e (2024) PGC-1α repression dysregulates lipid metabolism and induces lipid droplet accumulation in retinal pigment epithelium. \u003cem\u003eCell Death Dis\u003c/em\u003e 15: 385.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa R, \u003cem\u003eet al.\u003c/em\u003e (2024) PAX6/CXCL14 regulatory axis promotes the repair of corneal injury by enhancing corneal epithelial cell proliferation. \u003cem\u003eJ Transl Med\u003c/em\u003e 22: 458.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng Y, \u003cem\u003eet al.\u003c/em\u003e (2020) Paired box 6 inhibits cardiac fibroblast differentiation. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e 528: 561\u0026ndash;566.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026iacute;az-Carballo D, \u003cem\u003eet al.\u003c/em\u003e (2024) The neuroepithelial origin of ovarian carcinomas explained through an epithelial-mesenchymal-ectodermal transition enhanced by cisplatin. \u003cem\u003eSci Rep\u003c/em\u003e 14: 29286.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin Q, \u003cem\u003eet al.\u003c/em\u003e (2021) Exosomal circular RNA hsa_circ_007293 promotes proliferation, migration, invasion, and epithelial-mesenchymal transition of papillary thyroid carcinoma cells through regulation of the microRNA-653-5p/paired box 6 axis. \u003cem\u003eBioengineered\u003c/em\u003e 12: 10136\u0026ndash;10149.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, Tan YH, Sun J, Deng FM, Liu YL. (2020) PAX6 contributes to the activation and proliferation of hepatic stellate cells via activating Hedgehog/GLI1 pathway. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e 526: 314\u0026ndash;320.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu S, Mao H. (2024) Crocin Inhibits Orbital Fibroblasts Fibrosis in Thyroid-Associated Ophthalmopathy. \u003cem\u003eCurr Eye Res\u003c/em\u003e 49: 330\u0026ndash;337.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuyang P, \u003cem\u003eet al.\u003c/em\u003e (2025) Butyrate Ameliorates Graves' Orbitopathy Through Regulating Orbital Fibroblast Phenotypes and Gut Microbiota. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e 66: 5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChiu HI, Wu SB, Wu AY, Tsai CC. (2024) Endoplasmic reticulum protein TXNDC5 modulates thyroid eye disease TGF-β1-induced myofibroblast transdifferentiation. \u003cem\u003eBMJ Open Ophthalmol\u003c/em\u003e 9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, \u003cem\u003eet al.\u003c/em\u003e (2022) Disulfiram Exerts Antifibrotic and Anti-Inflammatory Therapeutic Effects on Perimysial Orbital Fibroblasts in Graves' Orbitopathy. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 23.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou M, \u003cem\u003eet al.\u003c/em\u003e (2024) SOX9 Induces Orbital Fibroblast Activation in Thyroid Eye Disease Via MAPK/ERK1/2 Pathway. \u003cem\u003eInvest Ophthalmol Vis Sci\u003c/em\u003e 65: 25.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Epithelial-mesenchymal transition, Fatty acid metabolism, Fibrosis, Orbital fibroblasts, Pax6, Thyroid-associated orbitopathy","lastPublishedDoi":"10.21203/rs.3.rs-8645473/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8645473/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eThyroid-associated orbitopathy (TAO) is an autoimmune disorder characterized by inflammation, fibrosis, and adipogenesis in the orbital tissues, driven primarily by activated orbital fibroblasts (OFs).This study aims to investigated the link between fatty acid metabolism, \u003cem\u003ePax6\u003c/em\u003e expression, and EMT/fibrosis in TAO; determine the functional role of \u003cem\u003ePax6\u003c/em\u003e in regulating OF activation, proliferation, migration, and fibrogenesis both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e; and explore \u003cem\u003ePax6\u003c/em\u003e as a potential therapeutic target.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eOur study employs single-cell RNA sequencing (scRNA-seq) to characterize cellular heterogeneity and identify pathogenic subpopulations and their metabolic profiles, aiming to elucidate the relationship between fatty acid metabolism, \u003cem\u003ePax6\u003c/em\u003e expression, and EMT in the context of TAO.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eUsing scRNA-seq on TAO and normal mouse orbital tissues, we identified distinct cellular populations, including a pathogenic epithelial-like cell subcluster (EPC1) marked by enhanced fatty acid metabolism and EMT markers. \u003cem\u003ePax6\u003c/em\u003e expression increased along the EMT trajectory, especially in mesenchymal cells. \u003cem\u003eIn vivo\u003c/em\u003e experiments using a TAO mouse model demonstrated that \u003cem\u003ePax6\u003c/em\u003e knockdown reduced orbital fibrosis, decreased pro-fibrotic markers (α-SMA, COL1A1, FN1), and inhibited OF activation and migration. Additionally, primary OF cultures showed that \u003cem\u003ePax6\u003c/em\u003e regulates cellular proliferation and fibrogenesis \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOur findings suggest that dysregulated fatty acid metabolism in TAO enhances \u003cem\u003ePax6\u003c/em\u003e expression. This, in turn, promotes EMT and contributes to orbital fibrosis. Targeting the Pax6\u0026ndash;fatty acid metabolism axis represents a novel therapeutic strategy to mitigate the TAO-related orbital fibrosis. This study establishes \u003cem\u003ePax6\u003c/em\u003e as a key driver of EMT and fibrosis in TAO and highlights its potential as a future therapeutic target.\u003c/p\u003e","manuscriptTitle":"Pax6 Drives Orbital Fibrosis in Thyroid-Associated Orbitopathy via Fatty Acid Metabolism-Mediated Epithelial-Mesenchymal Transition in Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-17 14:11:08","doi":"10.21203/rs.3.rs-8645473/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cafa7e9e-d709-44cb-a227-287a9180cbe9","owner":[],"postedDate":"February 17th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-31T15:12:25+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-17 14:11:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8645473","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8645473","identity":"rs-8645473","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.