Association of IRX4 synonymous variants with congenital heart disease: Leveraging in-silico approaches to predict the functional impact | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Association of IRX4 synonymous variants with congenital heart disease: Leveraging in-silico approaches to predict the functional impact Jyoti Maddhesiya, Dharmendra Jain, Ashok Kumar, Bhagyalaxmi Mohapatra This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7192653/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Synonymous variants are often overlooked during genetic screening, however current reports forecasted their significant biological impact and inevitably considered pathogenic. These silent changes in genome significantly affect the mRNA structure and stability and hence, alter the protein expression and function. IRX4 is an essential transcription factor for cardiogenesis and reported to be associated with congenital heart disease (CHD). In our study, we have performed genetic screening of IRX4 in 205 isolated cases of CHD. Five synonymous variants c.90 A > C , c.240 G > A , c.381 A > G , c.1281 G > A , and c.1509 C > T , six intronic variants c.1-139G>A, c.21-107G>C, c.46-107G>C, c.297+6T>G, c.815-130C>A, c.1638+62C>T were identified. A computed analysis by diverse tools namely RNAfold, MutaRNA, Human Splicing Finder (HSF), and RNA22 was applied to predict the substantial effect on downstream function. RNAfold analysis indicated that all five variants impacted RNA structure and stability. Further, notable changes in the base-pairing probability and RNA accessibility were induced by c.90 A > C , c.240 G > A , c.381 A > G , c.1281 G > A , and c.1509 C > T variants as shown by MutaRNA. Moreover, the effect on the cis-acting regulatory element of splicing was speculated due to c.1281 G > A variant only. Likewise, various modes of the RNA22 tool indicated changes in miRNA binding sites, showing that 61.5% of targets were altered and 38.5% were completely lost as a result of the c.1281 G > A variant. Our findings provide an insight into the molecular effect on mRNA structure and stability, splicing and miRNA target binding sites that potentially impair the transcription and translation and consequently might be associated with the pathogenesis of CHD. Congenital heart disease IRX4 Synonymous isolated mRNA· in-silico variations Figures Figure 1 Figure 2 Figure 3 Figure 4 Highlights Association of synonymous variants of IRX4 was observed in isolated congenital heart disease. In silico functional characterization was performed of all the 5 identified synonymous variants. Changes in RNA structures and base-pairing probabilities impair the RNA stability. miRNA target binding sites and splicing of pre-mRNA potentially affect the transcription and translational process. 1. Introduction Congenital heart disease (CHD) is an umbrella term that includes a wide range of cardiovascular malformations that manifest at the time of birth. With a global prevalence rate of 8 per 1000 liveborn, it represents the most common birth defects (Hoffman and Kaplan 2002 ). Advance molecular genetic technique have brought up identification of more than 100 genes responsible to give rise CHD in isolated cases (Maddhesiya and Mohapatra 2024 ). Genetic variations in highly conserved transcription factors namely NKX2-5 (Dixit et al. 2021 ), GATA4 (Dixit et al. 2019 ), TBX5 (Zhang et al. 2020 ), and signaling molecules NODAL (Mohapatra et al. 2009 ), CRELD1 (Robinson et al. 2003 ) as well as contractile proteins ACTC − 1, MYH11 (Fahed et al. 2013 ) affect different stages of cardiogenesis leading to CHD. Most of the studies till date reported the role of non-synonymous variations in candidate genes responsible for the causation of this developmental defect. In recent time, the disease-causing potential of synonymous variants has been recognised. However, only few studies available depicting pathogenic potential of synonymous variants. As synonymous variations do affect the stability and structure of mRNA, pre-mRNA splicing, miRNA targeted gene expression, mRNA and protein folding. Only few studies reported the role of synonymous variants in causing cardiovascular diseases (Dixit et al. 2019 ; Yadav et al. 2022 ; Giri et al. 2023 ). IRX4 is a homeobox transcription factor belongs to the Iroquois (IRO) family, with diverse expression pattern (Cavodeassi et al. 2001 ). IRX4 has been reported a crucial mediator of ventricular differentiation in animal models and a candidate gene for Ventricular Septal Defects (VSD) in humans (Bao et al. 1999 ; Bruneau et al. 2001 ; Cheng et al. 2011 ; Nelson et al. 2016 ; Ahn et al. 2020 ). In mice, chickens and xenopus, Irx4 is the earliest marker of the ventricular precursors and is predominantly expressed in the ventricles during all stages of cardiogenesis (Bao et al. 1999 ; Bruneau et al. 2000 ; Garriock et al. 2001 ). The expression of Irx4 is remarkably decreased in the heart of the Nkx2.5-/- and dHand-/- mice embryos, while the expression of eHand is altered in Irx4 -deficient mice (Bruneau et al. 2001 ; Anderson et al. 2018 ). The deficiency of Irx4 leads to abnormal ventricular gene expression and causes cardiomyopathy in mice (Bruneau et al. 2001 ). Irx4 directly activates VMHC1, while indirectly suppressing AMHC1, possibly by activating a negative transcriptional regulator of the AMHC1 promoter, in the heart of mouse (Kim et al. 2012 ). Moreover, at 6 weeks stage, Irx4 - deficient adult heart mice exhibit increased expression of cardiac disease specific markers, such as BNP, α-skeletal actin, and β-MHC. The simultaneous deletion of Irx3 and Irx4 results in elevated expression of cardiac failure markers, increased Bmp10 signaling activity, and irregular cardiomyocyte proliferation—each contributing to the pathogenesis of left ventricular noncompaction (LVNC) (Liu, 2017). Another study reported that knockdown of IRX4 inhibited cell proliferation, sphere formation, and the expression of CD133 , Aldh1A1 , Nanog , Sox2 and Notch1 (Jia et al. 2020 ). Further, Smyd1 null mice was shown to reduce the expression of Hand2 and Irx4 in the developing heart at E9.0 (Gordon et al. 2022 ). Transcriptomic analysis based on cardiac tissue revealed that IRX4 regulate the expression of NPPA , HAND1 , MYL3 , and BMP10 in chamber-specific manner (Ahn et al. 2020 ). Non-synonymous variants in IRX4 has been shown to be associated with VSD (Cheng et al. 2011 ). Study by SiJie Wei 2023 identified a common SNV (c.230A > G) in IRX4 in familial case with QT interval prolongation/ sinus tachycardia (Wei et al. 2023 ). Besides, there are 430 synonymous variants in IRX4 reported in database, however neither of it has been published and shown to be associated with any disease ( https://gnomad.broadinstitute.org/transcript/ENST00000613726?dataset=gnomad_r4 ). The association of IRX4 synonymous variants with CHD has not been reported till date. To the best of our knowledge, this is the first study to unveil the association of IRX4 synonymous variants with CHD. In this study, five synonymous and six intronic variants were detected in isolated cases of CHD which are absent in the healthy individuals. By performing the computational analysis using in-silico tools, we have uncovered the possible effects of synonymous variants on mRNA structure and stability along with pre-mRNA splicing and miRNA target binding sites that could vitiate the expression and function of IRX4 protein. 2. Materials and Methods 2.1 Enrolment and collections of study subjects A total of 205 clinically diagnosed isolated CHD cases (median age of 3 years) were recruited from the Departments of Pediatric-Medicine and Cardiology, S.S. Hospital, Institute of Medical Sciences, Banaras Hindu University, Varanasi. A written informed consent was obtained from all the patients or their authorized guardians, before collection of blood samples. The CHD patients were diagnosed by physical examination, 2D-echocardiography, ECG and chest X-ray. Institutional human ethics committee approved the study protocol. 2.2 Genetic screening and Mutational analysis Genomic DNA was extracted from 3-5ml whole blood of patient using standard ethanol precipitation protocol. For genetic screening, primers were designed in the exon-intron boundaries of human IRX4 gene (NM_001278635.2) and all the extended exons were amplified by polymerase chain reaction (PCR) in a 20ul reaction volume comprising of 10X PCR buffer (2µl), 50mM MgCl2 (0.8µl), 10mM dNTP mix (0.5µl), 10µM forward and reverse primers (0.2µl each) and Taq DNA polymerase (1U) with sterile nuclease-free distilled water for volume adjustment. All the amplified PCR products were enzymatically purified prior to sequencing by incubating amplicons at 37ºC with 3U of Exonuclease I (USB Products, Affymetrix, Inc, Cleveland, Ohio, US) and 0.6U of Shrimp Alkaline Phosphatase (USB Products, Affymetrix, Inc, Cleveland, Ohio, US) by incubating at 37˚C for 60min, following heat-inactivation of enzymes at 80˚C for 15min. 2.3 Sanger’s sequencing of purified products The purified amplicons were sequenced bi-directionally by Sanger sequencing method using Big Dye Terminator Kit V3.1 (Applied Biosystems, Massachusetts, US) on ABI 3500 genetic analyser as per the manufacturer’s instructions. The sequence chromatograms were analysed using Finch TV software ( http://www.geospiza.com/ftvdlinfo . html, Geospiza). The identified variants were further confirmed by resequencing the mutation carrying DNA samples with reverse primer as well as with independently amplified PCR amplicon from respective subjects. The novelty of the confirmed variants was queried in different database namely, dbSNP ( https://www.ncbi.nlm.nih.gov/snp/ ), ClinVar ( http://www.ncbi.nlm.nih.gov/clinvar/ ), GenomeAsia100K ( https://browser.genomeasia100k.org/ ), 1000G ( https://www.internationalgenome.org/ ), and INDEX-db ( http://indexdb.ncbs.res.in/ ). 2.4 Characterization of functional deficit using in-silico tools 2.4.1 Evolutionary conservation analysis To elucidate the phylogenetic conservation of codon for the respective identified variants, cDNA sequences of IRX4 were retrieved from NCBI database for the transcript ID NM_001278635.2. By using Clustal Omega tool ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ) multiple sequence alignment of human IRX4 cDNA sequence was performed with different mammalian species such as Pan paniscus, Hylobates moloch, Gorilla gorilla, Macaca fascicularis, Macaca mulatta, Mus musculus, Rattus norvegicus, Canis lupus, Pan troglodytes . 2.4.2 Prediction of mRNA structure and stability by RNAfold The altered secondary and tertiary structures of RNA modulate the expression of gene by influencing the transcript stability and translation efficiency. Synonymous variants cause silent mutations but these mutations can change the mRNA sequence and hence affect the secondary structures of the transcripts. Therefore, the impact of synonymous variants on the secondary structure and stability of IRX4 mRNAs were predicted by a stochastic nucleic acid folding web server RNAfold. The selected input sequences were mRNA fragment of two different lengths i.e., 75 and 151nts with the variant of nucleotide placed in the centre of the mRNA fragment. However, we have chosen the short length fragments 75nts for analysis as the prediction accuracy in terms of structure and stability of the mRNA fragments were decreases with increase in length. The minimum free energy change was also noted using the same server for further statistical calculation. Further, the minimum free energy change (δδG) (δδG = δGMutant - δGWild type) was also calculated. The more positive is the δδG, the less stable is the mutated mRNA structure in comparison with the wild-type (WT) mRNA and vice-versa. 2.4.3 Prediction of mutational effect on RNA features To further delve into the mutational analysis of the structural alterations induced by the silent mutations, MutaRNA tool (version (5.0.10) was utilized (Miladi et al. 2020 ). This analysis encompassed assessing the intra-molecular base pairing potential, base pairing probabilities of the mutant (MUT) mRNA, and RNA accessibility (single-strandedness) in comparison to the WT counterpart (Bernhart et al. 2011 ). By amalgamating remuRNA (Salari et al. 2013 ) and RNAsnp, changes induced by mutations in RNA structures could be statistically figured out. 2.4.4 Analysis by Human splicing finder The Human Splicing Finder (HSF) version 3.0 ( http://www.umd.be/HSF3/ ) is a web server for online analysis of the putative splicing effects caused by synonymous and intronic variants. It is based on twelve different algorithms (HSF, MaxEntScan, ESE Finder, RESCUE ESE hexamers, HSF hnRNP-A1, Sironi motifs, ESS decamers, PESE & PESS Octamers, ESR Sequences, EIEs & IIEs Hexamers) to predict the effect of mutation on splicing motifs enclosing the acceptor and donor splice sites, the branch point, Exonic Splicing Enhancers (ESE) and Exonic Splicing Silencers (ESS) along with other exonic/intronic regulatory sequence elements. Position Weight Matrices, Maximum Entropy principle or Motif Comparison method are the different parameters of these algorithms. 2.4.5 Prediction of miRNAs targeting the variant site of mRNA miRNAs play vital role in post-translational mechanisms by binding to the target mRNA in the 3′UTR resulting in repression of translation or in degradation of the targeted mRNA hence modulating the function of protein. Synonymous variants could change the sequence of mRNA which might lead to change/lost binding sites of many miRNAs. To predict miRNA target, a web interface RNA22 ( https://cm.jefferson.edu/rna22/ ) was used. Using the ‘Pre-computed predictions’ mode ( https://cm.jefferson.edu/rna22/Precomputed/ ) of RNA22, all the miRNAs binding targets in IRX4 were predicted followed by identifying the miRNA binding targets for the mutated sequence using ‘Interactive predictions’ mode ( https://cm.jefferson.edu/rna22/Interactive/ ). All the miRNAs which bind to the target region that harbouring the mutation were selected and their sequence was used as input miRNA sequences in the ‘Interactive predictions’ mode while in the target sequence, complete coding domain sequence of IRX4 with deliberately introduced mutation was used as input to visualize the effect of genetic variants on the binding of miRNAs. 3. Results 3.1 Genetic analysis of identified variants of IRX4 After screening of the 6 coding exons and the exon-intron boundaries of IRX4 gene by Sanger sequencing in 205 isolated CHD cases, a total of five synonymous variants namely c.90 A > C (Gly30=) and c.240 G > A (Ser80=) both in exon 3, c.381 A > G (Pro127=) in exon 4, c.1281 G > A (Ala427=) and c.1509 C > T (Gly303=) in exon 7 was revealed ( Fig. 1 B ) . The patient harbouring a novel variant c. A > C (Gly30=) was detected in a 25yrs old female diagnosed with VSD and Patent Ductus Arteriosus (PDA). Further, another novel variant c.240 G > A (Ser80=) was identified in four unrelated CHD cases with diverse phenotype, such as Atrial Septal Defects (ASD), VSD, Tetralogy of Fallot (ToF) and dextrocardia with situs solitus . The variant c.381 A > G (Pro127=) was found in 46 CHD cases with different phenotypes. The variant was previously reported in dbSNP database. A 5yrs old male harbouring the novel variant c.1281 G > A (Ala427=) was diagnosed with ToF. The exon 7 variant c.1509 C > T (Gly303=) was identified in 15 cases with heterogenous CHD phenotypes. All three novel variants were absent in 200 ethical aged-matched control chromosomes. These were submitted to ClinVar database ( https://submit.ncbi.nlm.nih.gov/clinvar/ ) having submission Ids: c.90 A > C (SCV005044988), c.240 G > A (SCV005044989) and c.1281 G > A (SCV005044990) respectively. Minor allele frequencies (MAF) of these variants were G (Pro127=) (rs4975753) and c.1509 C > T (Gly503) (rs2279589) were also identified in 46/205 and 15/205 isolated CHD cases respectively. Besides these, six intronic variants (c.297 + 6T > G, c.1-139G > A, c.21-107G > C, c.46-107G > C, c.815-130C > A, c.1638 + 62C > T) were also identified ( Table 1 ). Table 1 List of synonymous variants identified and studied in isolated cases of CHD with their associated phenotypes and novelty status Nucleotide change AA change CHD Phenotype CHD Cases (205) dbSNP ClinVar Genome Asia100K 1000 Genome database c.90A > C Gly30= VSD, PDA 1 (0.005) NR Novel (SCV005044988) NR NR c.240G > A Ser80= ASD, VSD, ToF & dextrocardia 1 (0.005) NR Novel (SCV005044989) NR NR c.381A > G Pro127= VSD, PDA, ToF, ASD 46 (0.0723) rs4975753 Reported Reported Reported c.1281G > A Ala427= ToF 1 (0.005) NR Novel (SCV005044990) NR NR c.1509C > T Gly503= ToF-VSD, ToF, ASD 15 (0.005) rs2279589 Reported Reported Reported AA- Amino acid, NR- Not reported, 3.2 Evolutionary significance Evolutionary significance of the residues harbouring the variants were analysed using ‘Homologene’. IRX4 was observed to be highly conserved across different vertebrate species ( Fig. 1 C ) . Through multiple sequence alignment using ‘Clustal omega’, we also observed that the mutated synonymous codons were highly phylogenetically conserved in case of three rare variants (c.240 G > A , c.1281 G > A and c. 1509 C > T ) while the two other known variants (c.90 A > C and c.381 A > G) were least conserved ( Fig. 1 C ) . 3.3 Potential effect of synonymous variants on the structure and stability of mRNA RNAfold predicted the impact of synonymous variants on the structure and stability of mRNA. The alterations in structures of mutated mRNA were compared with WT structures and the δδG was calculated by comparing the δG of mutated mRNA with the WT. More positive the δδG value, less stable the mutated mRNA structures. Intriguingly, our structural analysis postulated that c.90 A > C , c.381 A > G , and c.1509 C > T variants are more stable which decrease the rate of translation and this observation is further supported by the difference in δG which are − 3.2, -6.4, and − 1.9 Kcal/mol for 75 nts ( Fig. 2 A-E ) . The predicted structure for variant c.90 A > C showed a shortening of loop and formation of small internal loop. The MUT mRNA structure of variant c.381 A > G represent the widening of loop and formation of additional open loop. Additionally, the δδG values for 151 nts was − 3.2, -6.4, and − 1.9 Kcal/mol for the variants c.90 A > C , c.381 A > G , and c.1509 C > T respectively. Consequently, the predicted structures and the δG speculated that the increase stability of these variants are independent of the fragment length of mRNA ( Fig. 2 F ) . Contrarily, the variants c.240 G > A and c.1281 G > A are predicted to decrease the stability of mRNA which facilitate the high rate of translation. The difference in δG was observed to be 4.7 and 6.6 Kcal/mol for 75 nts and 1.1 and 4.5 Kcal/mol for 151 nts for the variants c.240 G > A and c.1281 G > A respectively ( Fig. 2 A-E ) . The predicted δG again anticipated that the stability of mRNA is independent of the fragment length. 3.4 Impact of IRX4 variants on RNA structural features The effect of silent variants on the RNA structural features viz., the intra-molecular base pairing potential, base pairing probabilities of the MUT RNA, and assessment of accessibility (single-strandedness) were analysed for each identified variant which disclosed acceptable alterations. The dot plot matrices illustrating the base- pair probability of IRX4 WT and MUT RNA snippets with darker the dots specifying higher base pairing potential. Similarly, base pairing probabilities was also depicted by the circos plot with visualization of darker hue of gray depicting higher probability. The change in base pair probability (Pr (bp in WT) – Pr (bp in MUT)), were also represented by dot plot matrices (differential dot plot) which defined the difference in base pairing patterns between WT and MUT RNAs at specific locations. Interestingly, the comparative analysis of variant c.381 A > G and c.1509 C > T exhibited a major alteration in base pairing probabilities as portrayed by the dot plot, circos plot and differential dot plot ( Fig. 3 A-E ) . However, distinguished modifications in base pairing probabilities were observed for variants c.90 A > C , c.240 G > A , and c.1281 G > A as displayed by dot plot, circos plot and differential dot plot ( Fig. 3 A-E ) . Further, the accessibility profile of RNA structures which is the probability of being unpaired at each base position have also been checked for each variant. The RNA-protein or RNA-RNA interactions which is considered critical for translation of the protein, was found to be influenced. The analysis results revealed a significant difference in RNA accessibility due to variants c.381 A > G and c.1509 C > T . Contrarily, negligible alteration in RNA accessibility induced by variants c.90 A > C , c.240 G > A , and c.1281 G > A ( Fig. 3 A-E ) . Additionally, the increased probabilities of base pairing and the weakened base pairing potential within each MT RNA are also depicted. 3.5 Effect of IRX4 variants on splicing of pre-mRNA Genetics variants also disrupt normal splicing of pre-mRNA that might be responsible for disease. We have also predicted splicing elements using an online server HSF3.1. There was no significant effect observed on splicing signals due to variants c.90 A > C , c.240 G > A , c.381 A > G , and c.1509 C > T . However, for variant c.1281 G > A , six strongly predicted ESE Site were broken which were motif for PESE, ESE_ASFB, ESE_ASFB, PESE, PESE, PESE and one ESS Site was also disrupted which was motif for PESS. This variant also created four new ESE site i.e. EIE, EIE, ESE_9G8, ESE_ASFB as well as one new ESS site, this was the motif for Sironi_motif3. Therefore, the cumulative effect of significant changes in ESE/ESS motif recognition, disruption of enhancer motif and formation of new potential splice site caused by this variant may lead to skipping of exon 7 which could become damaging for IRX4 proteins Table 2 . Table 2 List of intronic variants identified in isolated cases of CHD cDNA position Location dbSNP id No.of Cases (MAF) No. of Controls (MAF) c.1-139G > A Intron2 NR 1/205 0/200 c.21-107G > C Intron2 NR 1/205 0/200 c.46-107G > C Intron3 NR 16/205 0/200 c.297 + 6T > G Intron4 rs2307118 3/205 0/200 c.815-130C > A Intron7 NR 1/205 0/200 c.1638 + 62C > T Intron7 NR 1/205 0/200 3.6 Impact of IRX4 synonymous variants on miRNA target binding sites As it is well established that any nucleotide change in the binding site of miRNA could alter the miRNA mediated gene regulation. Thus, nucleotide alterations in the target binding sites of miRNA were also investigated for all the five synonymous variants (c.90 A > C , c.240 G > A , c.381 A > G , c.1281 G > A and c.1509 C > T ) using miRNA-based web server ‘RNA22’. This server was used to retrieve all the miRNA binding sites in the coding domain sequence (CDS) of IRX4 . For residues 90A, 240G, 381A and 1509C, we observed that these were not part of the target sites for miRNA, however residue 1281G was part of miRNA target site. Therefore, further analysis was performed to check the changes in the target sites of miRNAs due to variant c.1281 G > A and identified the miRNAs that bound to WT versus the variant c.1281 G > A . A total of 13 different miRNAs were identified which bound to the WT IRX4 at CDS position 336th viz., hsa_miR_1908_5p, hsa_miR_202_3p, hsa_miR_2277_5p, hsa_miR_3126_5p, hsa_miR_3180_3p, hsa_miR_3197, hsa_miR_3605_5p, hsa_miR_4253, hsa_miR_4525, hsa_miR_4697_5p, hsa_miR_4751, hsa_miR_6088, and hsa_miR_642a_3p. However, due to variant c.1281G > A, while five miRNAs (hsa_miR_202_3p, hsa_miR_3126_5p, hsa_miR_4751, hsa_miR_6088, and hsa_miR_642a_3p) lost their target binding site at CDS position 1281 in WT mRNA. Additionally, the predicted target binding sites of most of the miRNAs were changed from CDS position 336 to different respective sites. The binding site of hsa_miR_1908_5p miRNA was replaced from CDS position (1281–1303) for WT IRX4 mRNA to (153–174) and (821–842) for MUT. Similarly, the target binding site of hsa_miR_2277_5p miRNA was (1281–1307) which was changed to (51–75). Further hsa_miR_3180_3p bound at CDS position (1281–1301) in WT mRNA but bound at (1218–1240) CDS position in MUT mRNA. Moreover, there was one binding site for hsa_miR_3197 in WT mRNA at CDS position (1281–1302) which was replaced to three sites i.e., (340–363), (817–840), (1122–1145) in MUT. Along with this, the binding site of hsa_miR_3605_5p was changed from (1281–1302) to (522–545) and (1324–1347). The binding site of another miRNA hsa_miR_4253 was also replaced from (1281–1299) to (1225–1243). There was one predicted binding site for hsa_miR_4525 in WT IRX4 mRNA but due to nucleotide change at CDS 1281, this miRNA bound to three different sites namely (817–838), (1137–1158), and (1189–1210) in MUT mRNA. The target binding site of hsa_miR_4697_5p miRNA was also changed from (1281–1302) to (817–839) and (1224–1246) Table 3 . Table 3 Prediction analysis of synonymous variants using Human Splicing Finder (HSF) Variant Name HSF Prediction Motif Position SR proteins/ Regulatory Elements c.90A > C No significant impact on splicing signals - - - c.240G > A No significant impact on splicing signals - - - c.381A > G No significant impact on splicing signals - - - c.1281G > A New ESE Site New ESE Site New ESE Site New ESE Site ESE Site Broken ESE Site Broken ESE Site Broken ESE Site Broken ESE Site Broken New ESE Site ESE Site Broken ESE Site Broken AGCCCC CAGCCC GCAGCC CGCAGCC CGCGGCCC CCGCGGC CCGCGGCC CCCGCGG CCCGCGGC TCCCGCAG TCCCGCGG GTCCCGCG chr5:1878326 chr5:1878327 chr5:1878328 chr5:1878329 chr5:1878329 chr5:1878330 chr5:1878330 chr5:1878331 chr5:1878331 chr5:1878332 chr5:1878332 chr5:1878333 EIE EIE ESE_9G8 ESE_ASFB PESE ESE_ASFB PESS ESE_ASFB PESE Sironi_motif3 PESE PESE c.1509C > T No significant impact on splicing signals - - - Table 4 RNA22 prediction representing the changes in miRNA target binding sites due to variant c.1281G > A miRNA (Sequence) WT vs Mutant Predicted Target Site (5’-3’) Region of mRNA (CDS position) Folding Energy (Kcal/Mol) Base Pairs in Putative Heteropduplex Target Length hsa_miR_1908_5p CGGCGGGGACGGCGATTGGTC IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCCG TACGAGAGCCGGCTGCTGGCC AGCTGAAGCCGCCCTTCCACT 1281–1303 153–174 821–842 -20.20 -16.70 -19.20 16 15 15 23 21 21 hsa_miR_202_3p AGAGGTATAGGGCATGGGAA IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCC Lost binding site 1281–1302 - -16.70 - 15 - 22 - hsa_miR_2277_5p AGCGCGGGCTGAGCGCTGCCAGTC IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCCGCGCC ATGGCCACCAACTCCCTGAGCACG 1281–1307 51–75 -22.10 -12.90 17 16 27 24 hsa_miR_3126_5p TGAGGGACAGATGCCAGAAGCA IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCC Lost binding site 1281–1302 - -15.60 - 16 - 22 - hsa_miR_3180_3p TGGGGCGGAGCTTCCGGAGGCC IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTC GTCCTCCGCGCCCGCCACGTCC 1281–1301 1218–1240 -25.50 -23.70 17 16 21 22 hsa_miR_3197 GGAGGCGCAGGCTCGGAAAGGCG IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCC GGCCTGGCACCAGCCACTGCCGC TGCGAGCTGAAGCCGCCCTTCCA GCCACCGCCGCCGCCGCCGCCGC 1281–1302 340–363 817–840 1122–1145 -24.30 -21.70 -19.40 -21.50 17 17 16 16 22 21 21 21 hsa_miR_3605_5p TGAGGATGGATAGCAAGGAAGCC IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCC AAGATCATGCTGGCCATCATCAC GTCTTCCACGACCCCATCCTCAG 1281–1302 522–545 1324–1347 -20.20 -15.10 -14.30 17 16 17 22 hsa_miR_4253 AGGGCATGTCCAGGGGGT IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCT GCGCCCGCCACGTCCCCG 1281–1299 1225–1243 -24.00 -15.10 17 15 20 hsa_miR_4525 GGGGGGATGTGCATGCTGGTT IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCCG TGCGAGCTGAAGCCGCCCTTC CGCCGCCGCCACCTCCCTGAG GCCAAGGTCCCGCGGCCCCTG 1281–1302 817–838 1137–1158 1189–1210 -18.50 -16.00 -17.90 -15.90 16 15 16 15 23 hsa_miR_4697_5p AGGGGGCGCAGTCACTGACGTG IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCC TGCGAGCTGAAGCCGCCCTTCC CGCGCCCGCCACGTCCCCGTCT 1281–1302 817–839 1224–1246 -19.70 15 16 15 22 hsa_miR_4751 AGAGGACCCGTAGCTGCTAGAAGG IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCTCC Lost binding site 1281–1302 - -18.30 - 13 - 22 - hsa_miR_6088 AGAGATGAAGCGGGGGGGCG IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCCT Lost binding site 1281–1300 - -19.30 - 16 - 20 - hsa_miR_642a_3p AGACACATTTGGAGAGGGAACC IRX4_WT IRX4_c.1281G > A GGCCCCTGCGGCTGTGTCC Lost binding site 1281–1299 - -16.80 - 16 - 19 - 4. Discussion IRX4 is a TALE (three amino acid loop extension)- homeobox transcription factor, which is chamber-specific in expression. During cardiogenesis, it positively regulates the ventricular gene expression while suppressing the atrial genes (Wang et al. 2001 ). The fully developed heart showed exclusive expression of IRX4 in ventricles only. Only one study till date reported the association of IRX4 missense variations in CHD. Besides missense variations, numerous synonymous, 3’ and 5’ UTR and intronic variants are also pointed out during genetic screening which are often neglected. Since these variants do not alter the amino acid sequence in protein but accumulating evidences have revealed that these variants imperviously affect the structure and stability of RNA along with expression and function of protein (Cuevas et al. 2012 ; Bailey et al. 2014 ; Hunt et al. 2014 ; Lebeuf-Taylor et al. 2019 ). Advance improvements in computational platforms have evolve numerous in-silico tools which can be used to speculate the effect of synonymous variants. The most prominent impacts incorporate alterations to RNA structure and stability (Duan et al. 2003 ), splicing (Savisaar and Hurst 2018 ; Katneni et al. 2019 ), miRNA binding (Brest et al. 2011 ; Wang et al. 2015 ) and codon usage bias (translation efficiency) (Lin et al. 2023 ). As synonymous alterations are the results of nucleotide change only, various in-silico tools can be applied to predict the pathogenesis and their functional characterization (Hamasaki-Katagiri et al. 2017 ; Holcomb et al. 2021 ). To date, synonymous variants have been identified in cancers (Sharma et al. 2019 ) and are associated with > 85 genetic diseases (Sperling et al. 2005 ; Belvís et al. 2009 ; Sauna and Kimchi-Sarfaty 2011 ; Wang et al. 2013 ; Töpf et al. 2014 ; Cao et al. 2015 ; Mattapally et al. 2015 ; Borkar et al. 2017 ; El Bouchikhi et al. 2017 ). These are available in Database of Deleterious Synonymous Mutation (Sauna and Kimchi-Sarfaty 2011 ; Wen et al. 2016 ; Diederichs et al. 2016 ). In the current study, we have screened IRX4 gene in 205 isolated CHD. A total of eleven genetic variants (five synonymous, and six intronic variants) were detected. Literature study showed that three synonymous variants (Pro127=, Ala401 = and Gly477=) were identified in IRX4 in hypertrophic cardiomyopathy, however their functional characterization was not performed to elucidate its association with the disease (Bayrak et al. 2008 ). One variant out of these, (Pro127=) was also detected in our study. The other candidate genes of CHD were also reported to harbour synonymous variants viz., NKX2.5 (Dixit et al. 2021 ), GATA4 (Dixit et al. 2019 ), TBX20 (Töpf et al. 2014 ), CITED2 (Sperling et al. 2005 ), TGFβ (Yadav et al. 2022 ) and CRELD1 (our unpublished data) which were associated with different phenotype of CHD. Several of these studies have speculated their association with disease pathogenesis by deciphering their molecular mechanism based on computational approaches and consider as potential risk factors for CHD. Along with synonymous, numerous intronic variants were also gaining attention for characterizing their functional effect which strengthen their role in disease pathogenesis. Previously, intronic variants incorporating splice site were reported in NKX2-5 (Benson et al. 1999 ), GATA4 (Dixit et al. 2019 ), ISL1 (Töpf et al. 2014 ). In our case-control study, five synonymous variants (c.90A > C, (Gly30=); c.240G > A, (Ser80=); c.381A > G, (Pro127=); c.1281G > A, (Ala427=); c.1509C > T, (Gly503=) along with six intronic variants (c.1-139G > A, c.21-107G > C, c.46-107G > C, c.297 + 6T > G, c.815-130C > A and c.1638 + 62C > T) were detected in isolated CHD. Therefore, by leveraging various computational tools based on in-silico , their prominent and milder effect on RNA and protein were unveiled. Several features of RNA (stability, structure, base paring probability and accessibility), splicing process and miRNA binding targets were presumed. Recently, computational analysis of synonymous variants on RNA structures, stability, base pair probability and accessibility have been shown to be associated with a diverse range of genetic disorders (Bertalovitz et al. 2018 ; Sharma et al. 2019 ; Dixit et al. 2021 ). The nucleotide sequence of mRNA plays a crucial role in folding and formation of secondary structures which also regulates the expression of gene. The number of hydrogen bonds between the nucleotides determine to which extent the secondary structure formed is complex which is assumed to be more stable. Formation of stable structures is directly proportional to number of pairings between (G) and (C). These stable structures have high melting points which obstruct ribosome to unpair the nucleotides (Hall et al. 1982 ; Kozak 1986 ; de Smit and van Duin 1994 ; Studer and Joseph 2006 ; Gaspar et al. 2013 ) which results in reduction of the speed of ribosome and subsequently impaired the co-translational folding of newly formed protein. In our present study, the comprehensive analysis of the secondary structures of RNA predicted an increase in the stability of mRNA due to all the five variants (c.90 A > C , (Gly30=); c.240 G > A , (Ser80=); c.381 A > G , (Pro127=); c.1281 G > A , (Ala427=), and c.1509 C > T , (Gly503=) which speculated a decrease in the rate of translation. Overall, all the synonymous variations affected the translation rate which causes imparity in RNA and protein folding which was implicated in the potential functional characterization of variants at molecular level. Several studies conducted on synonymous variants are also validated our observed results. In a study conducted on GATA4 in CHD, the synonymous variant c.1263C > T showed increase in stability (δδG = -1 Kcal/mol for both 75 and 150 nts long mRNA) (Dixit et al. 2019 ). In a Gel-shift and UV-crosslinking study on the synonymous variant of SOD1 gene Ge WW et al, 2006 reported reduce mRNA formation which leads to decreased stability of the mRNAs in ALS patients (Ge et al. 2006 ). Further, another study also provides experimental evidence for disturbed mRNA folding in which a synonymous variant close to ΔF508 site (c.1521C > T; Ile507=) in CFTR gene caused decrease mRNA stability after the creation of two enlarged single-stranded loops as predicted by the Mfold server. Functional evidence based on Circular dichroism spectroscopy (CD) and mRNA folding assay additionally validated the RNA misfolding and damaged co-translational protein folding (Bartoszewski et al. 2010 ). Similarly, synonymous variants in ADAMTS13 are reported to affect the mRNA stability irrespective of the mRNA length being evaluated (Edwards et al. 2012 ). Another study by (Khabou et al. 2016 ) also deciphered the pathogenic effect of synonymous variants in Progressive Familial Intra-Hepatic Cholestasis type 3 (PFIC3) patients with synonymous polymorphisms in ATP binding cassette subfamily B member 4 (ABCB4) gene (Khabou et al. 2016 ). Likewise, synonymous variations in the ABCB1 or MDR1 (multidrug resistance 1) gene which affect protein folding and as a result substantially alter the conformation and function of the multidrug transporter (Kimchi-Sarfaty et al. 2007 ; Fung et al. 2016 ). Further, these structural alterations were substantiated by additional computational analysis by MutaRNA tool which incorporated base pair probabilities dot plots, circos plots, differential base pairing probabilities dot plots and RNA accessibility to unravel the mRNA structural changes due to synonymous variants (Miladi et al. 2020 ). The two variants viz, c.381 A > G , (Pro127=); and c.1509 C > T , (Gly503=) exhibited more pronounced alterations as represented by base pair probabilities dot plots, circos plots, and differential base pairing probabilities dot plots which suggest disruption in RNA folding that may affect stability and function. Meanwhile, the increased probabilities of base-pairing and weakened base pairing potential within each MUT RNA was also analysed. However, the other variants (c.90 A > C , (Gly30=); c.240 G > A , (Ser80=); and c.1281 G > A (Ala427=) induce minor changes in these features albeit even slight variations can also influence RNA-protein interactions. A similar result was also observed in the RNA accessibility profile of c.381 A > G , (Pro127=); and c.1509 C > T , (Gly503=) variants with prominent differences. Moreover, (c.90 A > C , (Gly30=); c.240 G > A , (Ser80=); and c.1281 G > A (Ala427=) variants illustrated negligible changes. Each nucleotide's tendency to stay unpaired was evaluated through the RNA accessibility profile. It assisted in evaluating how change in nucleotide in mRNA sequence could affect its interactions with other RNAs and protein. Base pairing probabilities and accessibility profile of variants c.403G > T in WNT10A and c.656T > C in TSPEAR reported to alter the RNA folding that may affect function and stability in tooth agenesis (Ranjan et al. 2024 ). In addition to these, synonymous variants also affect the splicing which is required for the expression of genes in eukaryotes. Splicing is the orderly process by which introns are excised from RNA transcripts. During the process, the spliceosome complex directly binds to the short consensus sequences in the exons (exonic splicing enhancers/silencers) for precise splicing. Different splicing outcomes are the results of alterations induced in the splicing regulatory elements which incorporate ESEs and ESSs, as well as intronic splicing enhancers and silencers (ISEs and ISSs) (Cartegni et al. 2002 ; Adamson et al. 2018 ). Recognition of exons and the regulation of pre-mRNA sequence inclusion in mature mRNA are guided by the balance between ESE and ESS motifs. This ratio is altered by the synonymous mutations which either create ESS or remove ESE or both and has resulted in altered exon recognition (Ke et al. 2011 ; Pengelly et al. 2022 ). A good number of studies reported the association of disease with changes in splicing regulatory elements (Cartegni et al. 2002 ; Scotti and Swanson 2016 ; Adamson et al. 2018 ; Dixit et al. 2019 ; Giri et al. 2023 ). HSF was used to analyse the effect of synonymous variants on splicing, aiming to better understand their impact on splice site recognition. The results interpreted significant alterations in the both ESEs and ESSs due to variant c.1281 G > A (Ala427=). The other variants have no alteration in ESE/ESS motifs ratios. Furthermore, the impact of synonymous variants on the binding sites of targeted mRNA was also delineated. As some studies already reported the association of miRNA with different cardiovascular diseases (Latronico et al. 2007 ; Giri et al. 2023 ). The miRNA binds to the 3' untranslated region (3'UTR) of its target mRNAs to regulate the expression of genes. The synonymous variants affect the binding sites which either get changed or lost. The variant c.1281 G > A (Ala427=) only showed significant alterations in the target binding sites of miRNAs in IRX4 CDS. The WT IRX4 exhibited 13 target binding sites of which 8 sites (61.5%) were changed and 5 sites (38.5%) were lost due to variant c.1281 G > A (Ala427=). However, other variants (c.90 A > C , (Gly30=); c.240 G > A , (Ser80=); c.381 A > G , (Pro127=); c.1509 C > T , (Gly503=) showed no significant changes on the target binding sites. The study of Brest et al, 2011 in Crohn’s disease, revealed that a synonymous variant in IRGM gene could change the binding site for miR-196 which results in deregulation of IRGM-dependent xenophagy (Brest et al. 2011 ). Another study, investigated that synonymous variant (c.51C > T) in BCL2L12 , identified in melanoma tumours, causes loss of the miR-671-5p binding site that stimulates protein expression (Gartner et al. 2013 ). This depicts that change in nucleotide of target binding sites of miRNA could potentially affect the miRNA regulation mechanism which could alter the expression of gene and presumed to be a risk factor for the disease. 5. Conclusion This study provides an insight in the molecular mechanisms by in-silico functional characterization of synonymous variants in CHD. We have implemented different computational tools based to correlate the association of synonymous variants with CHD. We have examined the potential effects of all the identified synonymous variants on IRX4 mRNA structure, stability, base pairing probability, accessibility and miRNA binding which could results in the altered rate of transcription and translation, ribosome pausing, protein aggregation, and unfolded protein accumulation. Our results are parallelly corroborated by other previously published reports which implicated the pathogenic effects of synonymous variants on WT mRNA folding, precise splicing and rate of translation. Therefore, this study aids another wing in unfolding the molecular functions of synonymous variants by using the current in-silico tools. However, in vitro functional analysis could further provide a better scenario for the pathogenic effect of these synonymous variants in the pathogenesis of the disease. Abbreviations CHD- Congenital heart disease, ASD- Atrial Septal Defects; VSD- Ventricular Septal Defects; ToF- Tetralogy of Fallot, PDA- Patent Ductus Arteriosus, MAF- Minor Allele Frequency, THSF- Human Splice Finder; ESE- Exonic Splicing Enhancers; ESS- Exonic Splicing Silencers; ISE- Intronic Splicing Enhancers; ISS- Intronic Splicing Silencers; PESE- Putative Exonic Splicing Enhancers; PESS- Putative Exonic Splicing Silencers; ESR Splicing Regulatory Elements; EIE- Exon Identity Elements. Declarations Conflict of interest: On behalf of all the authors, the corresponding author states that there is no conflict of interest. All the authors have read the manuscript and approved the submission of current version of the manuscript. Acknowledgements: We are grateful to all the patients, their family members and control individuals for their participation in the present study. We are extremely thankful to Dr. Dharmendra Jain from Department of Cardio-vascular and Thoracic Surgery, IMS, BHU and Prof. Ashok Kumar from Neonatal Intensive Care Unit (NICU) from IMS, BHU, Varanasi for their constant support and encouragement in enrolment of patients. We acknowledge University Grants Commission (UGC) for research fellowship (JRF and SRF) to Jyoti Maddhesiya. Conflict of interest: On behalf of all the authors, the corresponding author states that there is no conflict of interest. All the authors have read the manuscript and approved the submission of current version of the manuscript. Author Contribution: Bhagyalaxmi Mohapatra: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Project administration, Resources, Supervision, Visualization, Writing – review & editing. Jyoti Maddhesiya : Conceptualization, Data curation, Formal analysis, Methodology, Software, Validation, Visualization, Writing – original draft, Writing – review & editing. Dharmendra Jain: Investigation. Ashok Kumar: Investigation. Source of funding- This study was funded through an Incentive Grant under the Institute of Eminence (IoE) initiative at Banaras Hindu University (BHU). The funding agency had no involvement in the study design, sample collection, data analysis or interpretation, manuscript preparation, or the decision to submit the article for publication. References Adamson SI, Zhan L, Graveley BR (2018) Vex-seq: high-throughput identification of the impact of genetic variation on pre-mRNA splicing efficiency. Genome Biol 19:71. https://doi.org/10.1186/s13059-018-1437-x Ahn J, Wu H, Lee K (2020) Integrative analysis revealing human heart-specific genes and consolidating heart-related phenotypes. Frontiers in genetics 11:777 Anderson DJ, Kaplan DI, Bell KM, et al (2018) NKX2-5 regulates human cardiomyogenesis via a HEY2 dependent transcriptional network. Nature communications 9:1373 Bailey SF, Hinz A, Kassen R (2014) Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population. Nature Communications 5:4076 Bao Z-Z, Bruneau BG, Seidman JG, et al (1999) Regulation of Chamber-Specific Gene Expression in the Developing Heart by Irx4 . Science 283:1161–1164. https://doi.org/10.1126/science.283.5405.1161 Bartoszewski RA, Jablonsky M, Bartoszewska S, et al (2010) A synonymous single nucleotide polymorphism in ΔF508 CFTR alters the secondary structure of the mRNA and the expression of the mutant protein. Journal of Biological Chemistry 285:28741–28748 Bayrak F, Kömürcü-Bayrak E, Mutlu B, et al (2008) Genetic analysis of the Irx4 gene in hypertrophic cardiomyopathy. Turk Kardiyol Dern Ars 36:90–95 Belvís R, Tizzano EF, Martí-Fàbregas J, et al (2009) Mutations in the NKX2-5 gene in patients with stroke and patent foramen ovale. Clinical neurology and neurosurgery 111:574–578 Benson DW, Silberbach GM, Kavanaugh-McHugh A, et al (1999) Mutations in the cardiac transcription factor NKX2. 5 affect diverse cardiac developmental pathways. The Journal of clinical investigation 104:1567–1573 Bernhart SH, Mückstein U, Hofacker IL (2011) RNA Accessibility in cubic time. Algorithms Mol Biol 6:3. https://doi.org/10.1186/1748-7188-6-3 Bertalovitz AC, Badhey MLO, McDonald TV (2018) Synonymous nucleotide modification of the KCNH2 gene affects both mRNA characteristics and translation of the encoded hERG ion channel. Journal of Biological Chemistry 293:12120–12136 Borkar Y, Nayak K, Shetty RK, et al (2017) Gerbode Ventricular Septal Defect–A Rare Cardiac Anomaly Associated with Genetic Variants in Indian Population-A Case Series. Journal of Clinical and Diagnostic Research: JCDR 11:GR01 Brest P, Lapaquette P, Souidi M, et al (2011) A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn’s disease. Nature genetics 43:242–245 Bruneau BG, Bao Z-Z, Fatkin D, et al (2001) Cardiomyopathy in Irx4 -Deficient Mice Is Preceded by Abnormal Ventricular Gene Expression. Molecular and Cellular Biology 21:1730–1736. https://doi.org/10.1128/MCB.21.5.1730-1736.2001 Bruneau BG, Bao Z-Z, Tanaka M, et al (2000) Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2-5 and dHand. Developmental biology 217:266–277 Cao Y, Lan W, Li Y, et al (2015) Single nucleotide polymorphism of NKX2-5 gene with sporadic congenital heart disease in Chinese Bai population. International journal of clinical and experimental pathology 8:14917 Cartegni L, Chew SL, Krainer AR (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nature reviews genetics 3:285–298 Cavodeassi F, Modolell J, Gómez-Skarmeta JL (2001) The Iroquois family of genes: from body building to neural patterning Cheng Z, Wang J, Su D, et al (2011) Two novel mutations of the IRX4 gene in patients with congenital heart disease. Hum Genet 130:657–662. https://doi.org/10.1007/s00439-011-0996-7 Cuevas JM, Domingo-Calap P, Sanjuán R (2012) The fitness effects of synonymous mutations in DNA and RNA viruses. Molecular biology and evolution 29:17–20 de Smit MH, van Duin J (1994) Control of translation by mRNA secondary structure in Escherichia coli: a quantitative analysis of literature data. Journal of molecular biology 244:144–150 Diederichs S, Bartsch L, Berkmann JC, et al (2016) The dark matter of the cancer genome: aberrations in regulatory elements, untranslated regions, splice sites, non‐coding RNA and synonymous mutations. EMBO Mol Med 8:442–457. https://doi.org/10.15252/emmm.201506055 Dixit R, Kumar A, Mohapatra B (2019) Implication of GATA4 synonymous variants in congenital heart disease: A comprehensive in-silico approach. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 813:31–38 Dixit R, Narasimhan C, Balekundri VI, et al (2021) Functional analysis of novel genetic variants of NKX2 ‐5 associated with nonsyndromic congenital heart disease. American J of Med Genetics Pt A 185:3644–3663. https://doi.org/10.1002/ajmg.a.62413 Duan J, Wainwright MS, Comeron JM, et al (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Human molecular genetics 12:205–216 Edwards NC, Hing ZA, Perry A, et al (2012) Characterization of coding synonymous and non-synonymous variants in ADAMTS13 using ex vivo and in silico approaches. Plos one 7:e38864 El Bouchikhi I, Bouguenouch L, Moufid FZ, et al (2017) NKX2-5 molecular screening and assessment of variant rate and risk factors of secundum atrial septal defect in a Moroccan population. Anatolian Journal of Cardiology/Anadolu Kardiyoloji Dergisi 17: Fahed AC, Gelb BD, Seidman JG, Seidman CE (2013) Genetics of congenital heart disease: the glass half empty. Circulation research 112:707–720 Fung KL, Hunt RC, Kimchi-Sarfaty C, Gottesman MM (2016) Genetic polymorphisms of P-glycoprotein: echoes of silence. ABC Transporters-40 years on 105–134 Garriock RJ, Vokes SA, Small EM, et al (2001) Developmental expression of the Xenopus Iroquois-family homeobox genes, Irx4 and Irx5. Dev Genes Evol 211:257–260. https://doi.org/10.1007/s004270100147 Gartner JJ, Parker SCJ, Prickett TD, et al (2013) Whole-genome sequencing identifies a recurrent functional synonymous mutation in melanoma. Proc Natl Acad Sci USA 110:13481–13486. https://doi.org/10.1073/pnas.1304227110 Gaspar P, Moura G, Santos MA, Oliveira JL (2013) mRNA secondary structure optimization using a correlated stem–loop prediction. Nucleic acids research 41:e73–e73 Ge W, Leystra-Lantz C, Sanelli TR, et al (2006) Neuronal tissue-specific ribonucleoprotein complex formation on SOD1 mRNA: alterations by ALS SOD1 mutations. Neurobiology of disease 23:342–350 Giri P, Jain D, Kumar A, Mohapatra B (2023) Identification and in silico characterization of CSRP3 synonymous variants in dilated cardiomyopathy. Mol Biol Rep 50:4105–4117. https://doi.org/10.1007/s11033-023-08314-7 Gordon DM, Cunningham D, Zender G, et al (2022) Exome sequencing in multiplex families with left-sided cardiac defects has high yield for disease gene discovery. PLoS Genetics 18:e1010236 Hall MN, Gabay J, Débarbouillé M, Schwartz M (1982) A role for mRNA secondary structure in the control of translation initiation. Nature 295:616–618 Hamasaki‐Katagiri N, Lin BC, Simon J, et al (2017) The importance of mRNA structure in determining the pathogenicity of synonymous and non‐synonymous mutations in haemophilia. Haemophilia 23:. https://doi.org/10.1111/hae.13107 Hoffman JI, Kaplan S (2002) The incidence of congenital heart disease. Journal of the American college of cardiology 39:1890–1900 Holcomb D, Hamasaki-Katagiri N, Laurie K, et al (2021) New approaches to predict the effect of co-occurring variants on protein characteristics. The American Journal of Human Genetics 108:1502–1511 Hunt RC, Simhadri VL, Iandoli M, et al (2014) Exposing synonymous mutations. Trends in Genetics 30:308–321 Jia Z, Zhang Y, Yan A, et al (2020) 1, 25-dihydroxyvitamin D3 signaling-induced decreases in IRX4 inhibits NANOG-mediated cancer stem-like properties and gefitinib resistance in NSCLC cells. Cell Death & Disease 11:670 Katneni UK, Liss A, Holcomb D, et al (2019) Splicing dysregulation contributes to the pathogenicity of several F9 exonic point variants. Molecular Genetics & Genomic Medicine 7:e840 Ke S, Shang S, Kalachikov SM, et al (2011) Quantitative evaluation of all hexamers as exonic splicing elements. Genome research 21:1360–1374 Khabou B, Siala-Sahnoun O, Gargouri L, et al (2016) In silico investigation of the impact of synonymous variants in ABCB4 gene on mRNA stability/structure, splicing accuracy and codon usage: Potential contribution to PFIC3 disease. Computational Biology and Chemistry 65:103–109 Kim K-H, Rosen A, Bruneau BG, et al (2012) Iroquois homeodomain transcription factors in heart development and function. Circulation research 110:1513–1524 Kimchi-Sarfaty C, Oh JM, Kim I-W, et al (2007) A “Silent” Polymorphism in the MDR 1 Gene Changes Substrate Specificity. Science 315:525–528. https://doi.org/10.1126/science.1135308 Kozak M (1986) Influences of mRNA secondary structure on initiation by eukaryotic ribosomes. Proc Natl Acad Sci USA 83:2850–2854. https://doi.org/10.1073/pnas.83.9.2850 Latronico MVG, Catalucci D, Condorelli G (2007) Emerging Role of MicroRNAs in Cardiovascular Biology. Circulation Research 101:1225–1236. https://doi.org/10.1161/CIRCRESAHA.107.163147 Lebeuf-Taylor E, McCloskey N, Bailey SF, et al (2019) The distribution of fitness effects among synonymous mutations in a gene under directional selection. Elife 8:e45952 Lin BC, Katneni U, Jankowska KI, et al (2023) In silico methods for predicting functional synonymous variants. Genome Biol 24:126. https://doi.org/10.1186/s13059-023-02966-1 Maddhesiya J, Mohapatra B (2024) Understanding the Genetic and Non-genetic Interconnections in the Aetiology of Isolated Congenital Heart Disease: An Updated Review: Part 1. Current cardiology reports 26:147–165 Mattapally S, Nizamuddin S, Murthy KS, et al (2015) c.620C>T mutation in GATA4 is associated with congenital heart disease in South India. BMC Med Genet 16:7. https://doi.org/10.1186/s12881-015-0152-7 Miladi M, Raden M, Diederichs S, Backofen R (2020) MutaRNA: analysis and visualization of mutation-induced changes in RNA structure. Nucleic acids research 48:W287–W291 Mohapatra B, Casey B, Li H, et al (2009) Identification and functional characterization of NODAL rare variants in heterotaxy and isolated cardiovascular malformations. Human molecular genetics 18:861–871 Nelson DO, Lalit PA, Biermann M, et al (2016) Irx4 marks a multipotent, ventricular-specific progenitor cell. Stem Cells 34:2875–2888 Pengelly RJ, Bakhtiar D, Borovská I, et al (2022) Exonic splicing code and protein binding sites for calcium. Nucleic acids research 50:5493–5512 Ranjan P, Devi C, Verma N, et al (2024) Whole Exome Sequencing Uncovers Key Genetic Variants in Congenital Tooth Agenesis: An Integrative Omics Approach. medRxiv 2024–11 Robinson SW, Morris CD, Goldmuntz E, et al (2003) Missense mutations in CRELD1 are associated with cardiac atrioventricular septal defects. The American Journal of Human Genetics 72:1047–1052 Salari R, Kimchi-Sarfaty C, Gottesman MM, Przytycka TM (2013) Sensitive measurement of single-nucleotide polymorphism-induced changes of RNA conformation: application to disease studies. Nucleic acids research 41:44–53 Sauna ZE, Kimchi-Sarfaty C (2011) Understanding the contribution of synonymous mutations to human disease. Nature Reviews Genetics 12:683–691 Savisaar R, Hurst LD (2018) Exonic splice regulation imposes strong selection at synonymous sites. Genome research 28:1442–1454 Scotti MM, Swanson MS (2016) RNA mis-splicing in disease. Nature Reviews Genetics 17:19–32 Sharma Y, Miladi M, Dukare S, et al (2019) A pan-cancer analysis of synonymous mutations. Nature communications 10:2569 Sperling S, Grimm CH, Dunkel I, et al (2005) Identification and functional analysis ofCITED2 mutations in patients with congenital heart defects. Hum Mutat 26:575–582. https://doi.org/10.1002/humu.20262 Studer SM, Joseph S (2006) Unfolding of mRNA secondary structure by the bacterial translation initiation complex. Molecular cell 22:105–115 Töpf A, Griffin HR, Glen E, et al (2014) Functionally significant, rare transcription factor variants in tetralogy of Fallot. PLoS One 9:e95453 Wang F, Reece EA, Yang P (2013) Superoxide dismutase 1 overexpression in mice abolishes maternal diabetes–induced endoplasmic reticulum stress in diabetic embryopathy. American journal of obstetrics and gynecology 209:345-e1 Wang GF, Nikovits W, Bao Z-Z, Stockdale FE (2001) Irx4 forms an inhibitory complex with the vitamin D and retinoic X receptors to regulate cardiac chamber-specific slow MyHC3Expression. Journal of Biological Chemistry 276:28835–28841 Wang Y, Qiu C, Cui Q (2015) A large-scale analysis of the relationship of synonymous SNPs changing microRNA regulation with functionality and disease. International journal of molecular sciences 16:23545–23555 Wei S-J, Du J-L, Wang Y-B, et al (2023) Whole exome sequencing with a focus on cardiac disease-associated genes in families of sudden unexplained deaths in Yunnan, southwest of China. BMC Genomics 24:57. https://doi.org/10.1186/s12864-022-09097-0 Wen P, Xiao P, Xia J (2016) dbDSM: a manually curated database for deleterious synonymous mutations. Bioinformatics 32:1914–1916 Yadav ML, Bhasker AN, Kumar A, Mohapatra B (2022) Identification and characterization of genetic variants of TGFB1 in patients with congenital heart disease. Meta Gene 31:100987 Yadav ML, Ranjan P, Das P, et al (2021) Implication of rare genetic variants of NODAL and ACVR1B in congenital heart disease patients from Indian population. Experimental Cell Research 409:112869 Zhang Y, Sun Y-M, Xu Y-J, et al (2020) A new TBX5 loss-of-function mutation contributes to congenital heart defect and atrioventricular block. International Heart Journal 61:761–768 Supplementary Files GraphicalAbstract.jpg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7192653","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":495840872,"identity":"24522f63-74b8-484b-a000-6b5eb035f2a8","order_by":0,"name":"Jyoti Maddhesiya","email":"","orcid":"","institution":"Banaras Hindu University Faculty of Science","correspondingAuthor":false,"prefix":"","firstName":"Jyoti","middleName":"","lastName":"Maddhesiya","suffix":""},{"id":495840873,"identity":"a66b8815-11d3-40e5-864c-e16c7cb2017d","order_by":1,"name":"Dharmendra Jain","email":"","orcid":"","institution":"Banaras Hindu University Institute of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Dharmendra","middleName":"","lastName":"Jain","suffix":""},{"id":495840874,"identity":"a68927f5-b588-4b0e-a231-cf14d01068dd","order_by":2,"name":"Ashok Kumar","email":"","orcid":"","institution":"Banaras Hindu University Institute of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Ashok","middleName":"","lastName":"Kumar","suffix":""},{"id":495840875,"identity":"160217f9-4e33-414b-8bdf-2e2999f57be6","order_by":3,"name":"Bhagyalaxmi Mohapatra","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIiWNgGAWjYBACA3YwaSPHwMBDrBZmMJlmTKoWhsOJDURrMWdmfiZ1o4A5fcPxswcffGCwk9NtIKDFspnN2DjHgC13w5m8ZMMZDMnGZgcIOewwg+HjHAOe3A0HcsykeRgOJG4jrIX9w+EcA4l0g/NviNbCA7LFIMHgBrG2WDbzFAP9kmA488YbY8MZBkT4xZy9fZt0zp//8nzncwwffKiwkyOoBQ4UwCoNiFUOAvINpKgeBaNgFIyCEQUAm/Y+KKcVXcAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-9249-2441","institution":"Banaras Hindu University","correspondingAuthor":true,"prefix":"","firstName":"Bhagyalaxmi","middleName":"","lastName":"Mohapatra","suffix":""}],"badges":[],"createdAt":"2025-07-23 06:19:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7192653/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7192653/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88628225,"identity":"5db3d0d0-6e8f-4ba3-9442-dc35c7e86998","added_by":"auto","created_at":"2025-08-08 13:20:33","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":207367,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(1-A) Pictorial representation of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIRX4\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ewhich is a 545 amino acids long protein with different domains. The relative positions of all five synonymous variants are marked with stars in domain-wise manner. (B) The chromatogram of sequencing peak for the identified variants. (C) Phylogenetic conservation of mutated nucleotides (featured in red) across various species of vertebrates for all the detected synonymous variants (c.90A\u0026gt;C (Gly30=), c.240G\u0026gt;A (Ser80=), c.381A\u0026gt;G (Pro127=), c.1281G\u0026gt;A (Ala427=) and c.1509C\u0026gt;T (Gly303=).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7192653/v1/fee03e8b69164d8dfdba83fd.jpg"},{"id":88628220,"identity":"85a9ba2a-21bd-4595-b922-0ada59848528","added_by":"auto","created_at":"2025-08-08 13:20:33","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":133134,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDiagrammatic representation of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIRX4\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emRNA structures and stability. The illustrations are predicted using RNAfold server with 75 nucleotide long fragment of (A) c.90A\u0026gt;C (Gly30=), (B) c.240G\u0026gt;A (Ser80=), (C) c.381A\u0026gt;G (Pro127=), (D) c.1281G\u0026gt;A (Ala427=) and (E) c.1509C\u0026gt;T (Gly303=). The WT and MUT structures are allocated side by side for comparison. The WT and mutated nucleotide are pointed out with blue asterisk and the regions harbouring the structural alteration in the MUT mRNA in response to variants are indicated with blue arrows. (F) The graph showing the δδG values of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIRX4\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esynonymous variants. The fragment length of RNA with 75 nucleotides and 151 nucleotides were given as input sequence in RNAfold server. The difference in δG (δGMutant – δGWild-type) for each of the variants was calculated and plotted here. The more negative is the δδG value, the more stable is the mutated mRNA compared to WT mRNA and vice-versa.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7192653/v1/a9ae1ded1c8b942dd0e714a0.jpg"},{"id":88629166,"identity":"84d4c9e8-eb6e-4af0-b52c-96a6970560f5","added_by":"auto","created_at":"2025-08-08 13:28:33","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":128593,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A-E) Comparative visualization of various RNA structural features of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIRX4 \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eMUT RNA with WT. The dot plot matrices depicted the base-pairing probability of p(WT) and p(MUT) structures. The darker dots symbolize more chance of the base pairing between corresponding sequence position. The top-right portion of the matrix representing the WT sequence while the bottom left with the MUT sequence. The circos plots represent the base-pairing probability of p(WT) and p(MUT) RNA structures, with WT plot at upper and MUT at lower. The sequence starting from 5’ end at the bottom-left and extending clockwise reaching to the 3’ end. Each MUT circos plot is featuring the mutated nucleotide in red at position 21 at the top. The differential dot plot matrices illustrating the differences in base-pairing probabilities between the WT and MUT RNA which is computed as [Pr (bp in WT) – Pr (bp in mut)]. The blue color dots are indicating the weak base-pairing and the red color dots are denoting the strong base-pairing. The accessibility profile of WT and MUT are described in terms of unpaired probabilities. The blue line indicating the variation in accessibility (WT-MUT) with negative values revealed the positions more prone to be unpaired in the MUT vs WT.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7192653/v1/0f29a3091e8b208cecb5df40.jpg"},{"id":88629168,"identity":"41490e0e-5953-43cd-abee-26f505f521e3","added_by":"auto","created_at":"2025-08-08 13:28:33","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":90950,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A-E) Graphical demonstration of impact of mutations on Circos plots. The comparative analysis of circos plot in the above figure assist in distinct identification and comparison of the effect of mutations. The upper panel is representing the increased base pairs probability while the lower panel indicating the weakened base pairs probabilities between the nucleotides within the RNA sequence for each variant. Darker shades of gray depicted higher absolute changes. The variant position is marked by a red bar in each plot.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7192653/v1/ca0bf0b940b48aa8d119127e.jpg"},{"id":102295678,"identity":"5eabbea5-705a-4805-a6ca-9bb38f8d7f1d","added_by":"auto","created_at":"2026-02-10 10:13:49","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3445399,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7192653/v1/8edc27f9-c23b-45fa-b213-56b9a997ac86.pdf"},{"id":88628221,"identity":"4582c79b-a7e0-4a46-b014-7f68641d95b7","added_by":"auto","created_at":"2025-08-08 13:20:33","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":232191,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7192653/v1/43eef6e73bc49af1b7ec9ed0.jpg"}],"financialInterests":"","formattedTitle":"Association of IRX4 synonymous variants with congenital heart disease: Leveraging in-silico approaches to predict the functional impact","fulltext":[{"header":"Highlights","content":"\u003cul\u003e\n \u003cli\u003eAssociation of synonymous variants of \u003cem\u003eIRX4\u003c/em\u003e was observed in isolated congenital heart disease.\u003c/li\u003e\n \u003cli\u003e\u003cem\u003eIn silico\u003c/em\u003e functional characterization was performed of all the 5 identified synonymous variants.\u003c/li\u003e\n \u003cli\u003eChanges in RNA structures and base-pairing probabilities impair the RNA stability.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003emiRNA target binding sites and splicing of pre-mRNA potentially affect the transcription and translational process.\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eCongenital heart disease (CHD) is an umbrella term that includes a wide range of cardiovascular malformations that manifest at the time of birth. With a global prevalence rate of 8 per 1000 liveborn, it represents the most common birth defects (Hoffman and Kaplan \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Advance molecular genetic technique have brought up identification of more than 100 genes responsible to give rise CHD in isolated cases (Maddhesiya and Mohapatra \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Genetic variations in highly conserved transcription factors namely \u003cem\u003eNKX2-5\u003c/em\u003e (Dixit et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), \u003cem\u003eGATA4\u003c/em\u003e (Dixit et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), \u003cem\u003eTBX5\u003c/em\u003e (Zhang et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and signaling molecules \u003cem\u003eNODAL\u003c/em\u003e (Mohapatra et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), \u003cem\u003eCRELD1\u003c/em\u003e (Robinson et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) as well as contractile proteins \u003cem\u003eACTC\u003c/em\u003e \u0026minus;\u0026thinsp;1, \u003cem\u003eMYH11\u003c/em\u003e (Fahed et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) affect different stages of cardiogenesis leading to CHD. Most of the studies till date reported the role of non-synonymous variations in candidate genes responsible for the causation of this developmental defect. In recent time, the disease-causing potential of synonymous variants has been recognised. However, only few studies available depicting pathogenic potential of synonymous variants. As synonymous variations do affect the stability and structure of mRNA, pre-mRNA splicing, miRNA targeted gene expression, mRNA and protein folding. Only few studies reported the role of synonymous variants in causing cardiovascular diseases (Dixit et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Yadav et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Giri et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cem\u003eIRX4\u003c/em\u003e is a homeobox transcription factor belongs to the \u003cem\u003eIroquois\u003c/em\u003e (IRO) family, with diverse expression pattern (Cavodeassi et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). \u003cem\u003eIRX4\u003c/em\u003e has been reported a crucial mediator of ventricular differentiation in animal models and a candidate gene for Ventricular Septal Defects (VSD) in humans (Bao et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Bruneau et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Cheng et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Nelson et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ahn et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In mice, chickens and xenopus, \u003cem\u003eIrx4\u003c/em\u003e is the earliest marker of the ventricular precursors and is predominantly expressed in the ventricles during all stages of cardiogenesis (Bao et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Bruneau et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Garriock et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). The expression of \u003cem\u003eIrx4\u003c/em\u003e is remarkably decreased in the heart of the \u003cem\u003eNkx2.5-/-\u003c/em\u003e and \u003cem\u003edHand-/-\u003c/em\u003e mice embryos, while the expression of \u003cem\u003eeHand\u003c/em\u003e is altered in \u003cem\u003eIrx4\u003c/em\u003e-deficient mice (Bruneau et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Anderson et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The deficiency of \u003cem\u003eIrx4\u003c/em\u003e leads to abnormal ventricular gene expression and causes cardiomyopathy in mice (Bruneau et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). \u003cem\u003eIrx4\u003c/em\u003e directly activates VMHC1, while indirectly suppressing AMHC1, possibly by activating a negative transcriptional regulator of the AMHC1 promoter, in the heart of mouse (Kim et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Moreover, at 6 weeks stage, \u003cem\u003eIrx4\u003c/em\u003e- deficient adult heart mice exhibit increased expression of cardiac disease specific markers, such as BNP, α-skeletal actin, and β-MHC. The simultaneous deletion of \u003cem\u003eIrx3\u003c/em\u003e and \u003cem\u003eIrx4\u003c/em\u003e results in elevated expression of cardiac failure markers, increased Bmp10 signaling activity, and irregular cardiomyocyte proliferation\u0026mdash;each contributing to the pathogenesis of left ventricular noncompaction (LVNC) (Liu, 2017).\u003c/p\u003e\u003cp\u003eAnother study reported that knockdown of \u003cem\u003eIRX4\u003c/em\u003e inhibited cell proliferation, sphere formation, and the expression of \u003cem\u003eCD133\u003c/em\u003e, \u003cem\u003eAldh1A1\u003c/em\u003e, \u003cem\u003eNanog\u003c/em\u003e, \u003cem\u003eSox2\u003c/em\u003e and \u003cem\u003eNotch1\u003c/em\u003e (Jia et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Further, \u003cem\u003eSmyd1\u003c/em\u003e null mice was shown to reduce the expression of \u003cem\u003eHand2\u003c/em\u003e and \u003cem\u003eIrx4\u003c/em\u003e in the developing heart at E9.0 (Gordon et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Transcriptomic analysis based on cardiac tissue revealed that \u003cem\u003eIRX4\u003c/em\u003e regulate the expression of \u003cem\u003eNPPA\u003c/em\u003e, \u003cem\u003eHAND1\u003c/em\u003e, \u003cem\u003eMYL3\u003c/em\u003e, and \u003cem\u003eBMP10\u003c/em\u003e in chamber-specific manner (Ahn et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Non-synonymous variants in \u003cem\u003eIRX4\u003c/em\u003e has been shown to be associated with VSD (Cheng et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Study by SiJie Wei 2023 identified a common SNV (c.230A\u0026thinsp;\u0026gt;\u0026thinsp;G) in \u003cem\u003eIRX4\u003c/em\u003e in familial case with QT interval prolongation/ sinus tachycardia (Wei et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Besides, there are 430 synonymous variants in \u003cem\u003eIRX4\u003c/em\u003e reported in database, however neither of it has been published and shown to be associated with any disease (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://gnomad.broadinstitute.org/transcript/ENST00000613726?dataset=gnomad_r4\u003c/span\u003e\u003cspan address=\"https://gnomad.broadinstitute.org/transcript/ENST00000613726?dataset=gnomad_r4\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The association of \u003cem\u003eIRX4\u003c/em\u003e synonymous variants with CHD has not been reported till date. To the best of our knowledge, this is the first study to unveil the association of \u003cem\u003eIRX4\u003c/em\u003e synonymous variants with CHD. In this study, five synonymous and six intronic variants were detected in isolated cases of CHD which are absent in the healthy individuals. By performing the computational analysis using \u003cem\u003ein-silico\u003c/em\u003e tools, we have uncovered the possible effects of synonymous variants on mRNA structure and stability along with pre-mRNA splicing and miRNA target binding sites that could vitiate the expression and function of IRX4 protein.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Enrolment and collections of study subjects\u003c/h2\u003e\u003cp\u003eA total of 205 clinically diagnosed isolated CHD cases (median age of 3 years) were recruited from the Departments of Pediatric-Medicine and Cardiology, S.S. Hospital, Institute of Medical Sciences, Banaras Hindu University, Varanasi. A written informed consent was obtained from all the patients or their authorized guardians, before collection of blood samples. The CHD patients were diagnosed by physical examination, 2D-echocardiography, ECG and chest X-ray. Institutional human ethics committee approved the study protocol.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Genetic screening and Mutational analysis\u003c/h2\u003e\u003cp\u003eGenomic DNA was extracted from 3-5ml whole blood of patient using standard ethanol precipitation protocol. For genetic screening, primers were designed in the exon-intron boundaries of human \u003cem\u003eIRX4\u003c/em\u003e gene (NM_001278635.2) and all the extended exons were amplified by polymerase chain reaction (PCR) in a 20ul reaction volume comprising of 10X PCR buffer (2\u0026micro;l), 50mM MgCl2 (0.8\u0026micro;l), 10mM dNTP mix (0.5\u0026micro;l), 10\u0026micro;M forward and reverse primers (0.2\u0026micro;l each) and Taq DNA polymerase (1U) with sterile nuclease-free distilled water for volume adjustment. All the amplified PCR products were enzymatically purified prior to sequencing by incubating amplicons at 37\u0026ordm;C with 3U of Exonuclease I (USB Products, Affymetrix, Inc, Cleveland, Ohio, US) and 0.6U of Shrimp Alkaline Phosphatase (USB Products, Affymetrix, Inc, Cleveland, Ohio, US) by incubating at 37˚C for 60min, following heat-inactivation of enzymes at 80˚C for 15min.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Sanger\u0026rsquo;s sequencing of purified products\u003c/h2\u003e\u003cp\u003eThe purified amplicons were sequenced bi-directionally by Sanger sequencing method using Big Dye Terminator Kit V3.1 (Applied Biosystems, Massachusetts, US) on ABI 3500 genetic analyser as per the manufacturer\u0026rsquo;s instructions. The sequence chromatograms were analysed using Finch TV software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.geospiza.com/ftvdlinfo\u003c/span\u003e\u003cspan address=\"http://www.geospiza.com/ftvdlinfo\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. html, Geospiza). The identified variants were further confirmed by resequencing the mutation carrying DNA samples with reverse primer as well as with independently amplified PCR amplicon from respective subjects. The novelty of the confirmed variants was queried in different database namely, dbSNP (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/snp/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/snp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), ClinVar (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/clinvar/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/clinvar/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), GenomeAsia100K (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://browser.genomeasia100k.org/\u003c/span\u003e\u003cspan address=\"https://browser.genomeasia100k.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), 1000G (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.internationalgenome.org/\u003c/span\u003e\u003cspan address=\"https://www.internationalgenome.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and INDEX-db (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://indexdb.ncbs.res.in/\u003c/span\u003e\u003cspan address=\"http://indexdb.ncbs.res.in/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e\u003cb\u003e2.4 Characterization of functional deficit using\u003c/b\u003e \u003cb\u003ein-silico\u003c/b\u003e \u003cb\u003etools\u003c/b\u003e\u003c/h2\u003e\u003cdiv id=\"Sec7\" class=\"Section3\"\u003e\u003ch2\u003e2.4.1 Evolutionary conservation analysis\u003c/h2\u003e\u003cp\u003eTo elucidate the phylogenetic conservation of codon for the respective identified variants, cDNA sequences of \u003cem\u003eIRX4\u003c/em\u003e were retrieved from NCBI database for the transcript ID NM_001278635.2. By using Clustal Omega tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/Tools/msa/clustalo/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/Tools/msa/clustalo/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) multiple sequence alignment of human IRX4 cDNA sequence was performed with different mammalian species such as \u003cem\u003ePan paniscus, Hylobates moloch, Gorilla gorilla, Macaca fascicularis, Macaca mulatta, Mus musculus, Rattus norvegicus, Canis lupus, Pan troglodytes\u003c/em\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section3\"\u003e\u003ch2\u003e2.4.2 Prediction of mRNA structure and stability by RNAfold\u003c/h2\u003e\u003cp\u003eThe altered secondary and tertiary structures of RNA modulate the expression of gene by influencing the transcript stability and translation efficiency. Synonymous variants cause silent mutations but these mutations can change the mRNA sequence and hence affect the secondary structures of the transcripts. Therefore, the impact of synonymous variants on the secondary structure and stability of \u003cem\u003eIRX4\u003c/em\u003e mRNAs were predicted by a stochastic nucleic acid folding web server RNAfold. The selected input sequences were mRNA fragment of two different lengths i.e., 75 and 151nts with the variant of nucleotide placed in the centre of the mRNA fragment. However, we have chosen the short length fragments 75nts for analysis as the prediction accuracy in terms of structure and stability of the mRNA fragments were decreases with increase in length. The minimum free energy change was also noted using the same server for further statistical calculation. Further, the minimum free energy change (δδG) (δδG\u0026thinsp;=\u0026thinsp;δGMutant - δGWild type) was also calculated. The more positive is the δδG, the less stable is the mutated mRNA structure in comparison with the wild-type (WT) mRNA and vice-versa.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\u003ch2\u003e2.4.3 Prediction of mutational effect on RNA features\u003c/h2\u003e\u003cp\u003eTo further delve into the mutational analysis of the structural alterations induced by the silent mutations, MutaRNA tool (version (5.0.10) was utilized (Miladi et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). This analysis encompassed assessing the intra-molecular base pairing potential, base pairing probabilities of the mutant (MUT) mRNA, and RNA accessibility (single-strandedness) in comparison to the WT counterpart (Bernhart et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). By amalgamating remuRNA (Salari et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) and RNAsnp, changes induced by mutations in RNA structures could be statistically figured out.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section3\"\u003e\u003ch2\u003e2.4.4 Analysis by Human splicing finder\u003c/h2\u003e\u003cp\u003eThe Human Splicing Finder (HSF) version 3.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.umd.be/HSF3/\u003c/span\u003e\u003cspan address=\"http://www.umd.be/HSF3/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) is a web server for online analysis of the putative splicing effects caused by synonymous and intronic variants. It is based on twelve different algorithms (HSF, MaxEntScan, ESE Finder, RESCUE ESE hexamers, HSF hnRNP-A1, Sironi motifs, ESS decamers, PESE \u0026amp; PESS Octamers, ESR Sequences, EIEs \u0026amp; IIEs Hexamers) to predict the effect of mutation on splicing motifs enclosing the acceptor and donor splice sites, the branch point, Exonic Splicing Enhancers (ESE) and Exonic Splicing Silencers (ESS) along with other exonic/intronic regulatory sequence elements. Position Weight Matrices, Maximum Entropy principle or Motif Comparison method are the different parameters of these algorithms.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section3\"\u003e\u003ch2\u003e2.4.5 Prediction of miRNAs targeting the variant site of mRNA\u003c/h2\u003e\u003cp\u003emiRNAs play vital role in post-translational mechanisms by binding to the target mRNA in the 3\u0026prime;UTR resulting in repression of translation or in degradation of the targeted mRNA hence modulating the function of protein. Synonymous variants could change the sequence of mRNA which might lead to change/lost binding sites of many miRNAs. To predict miRNA target, a web interface RNA22 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cm.jefferson.edu/rna22/\u003c/span\u003e\u003cspan address=\"https://cm.jefferson.edu/rna22/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used. Using the \u0026lsquo;Pre-computed predictions\u0026rsquo; mode (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cm.jefferson.edu/rna22/Precomputed/\u003c/span\u003e\u003cspan address=\"https://cm.jefferson.edu/rna22/Precomputed/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) of RNA22, all the miRNAs binding targets in \u003cem\u003eIRX4\u003c/em\u003e were predicted followed by identifying the miRNA binding targets for the mutated sequence using \u0026lsquo;Interactive predictions\u0026rsquo; mode (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cm.jefferson.edu/rna22/Interactive/\u003c/span\u003e\u003cspan address=\"https://cm.jefferson.edu/rna22/Interactive/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). All the miRNAs which bind to the target region that harbouring the mutation were selected and their sequence was used as input miRNA sequences in the \u0026lsquo;Interactive predictions\u0026rsquo; mode while in the target sequence, complete coding domain sequence of \u003cem\u003eIRX4\u003c/em\u003e with deliberately introduced mutation was used as input to visualize the effect of genetic variants on the binding of miRNAs.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Genetic analysis of identified variants of \u003cem\u003eIRX4\u003c/em\u003e\u003c/h2\u003e\u003cp\u003eAfter screening of the 6 coding exons and the exon-intron boundaries of \u003cem\u003eIRX4\u003c/em\u003e gene by Sanger sequencing in 205 isolated CHD cases, a total of five synonymous variants namely c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e (Gly30=) and c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ser80=) both in exon 3, c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e (Pro127=) in exon 4, c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ala427=) and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e (Gly303=) in exon 7 was revealed \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. The patient harbouring a novel variant c.\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e (Gly30=) was detected in a 25yrs old female diagnosed with VSD and Patent Ductus Arteriosus (PDA). Further, another novel variant c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ser80=) was identified in four unrelated CHD cases with diverse phenotype, such as Atrial Septal Defects (ASD), VSD, Tetralogy of Fallot (ToF) and dextrocardia with \u003cem\u003esitus solitus\u003c/em\u003e. The variant c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e (Pro127=) was found in 46 CHD cases with different phenotypes. The variant was previously reported in dbSNP database. A 5yrs old male harbouring the novel variant c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ala427=) was diagnosed with ToF. The exon 7 variant c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e (Gly303=) was identified in 15 cases with heterogenous CHD phenotypes. All three novel variants were absent in 200 ethical aged-matched control chromosomes. These were submitted to ClinVar database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://submit.ncbi.nlm.nih.gov/clinvar/\u003c/span\u003e\u003cspan address=\"https://submit.ncbi.nlm.nih.gov/clinvar/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) having submission Ids: c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e (SCV005044988), c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (SCV005044989) and c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (SCV005044990) respectively. Minor allele frequencies (MAF) of these variants were \u0026lt;\u0026thinsp;0.005 in our study (Table). Additionally, the other two reported synonymous variants c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e (Pro127=) (rs4975753) and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e (Gly503) (rs2279589) were also identified in 46/205 and 15/205 isolated CHD cases respectively. Besides these, six intronic variants (c.297\u0026thinsp;+\u0026thinsp;6T\u0026thinsp;\u0026gt;\u0026thinsp;G, c.1-139G\u0026thinsp;\u0026gt;\u0026thinsp;A, c.21-107G\u0026thinsp;\u0026gt;\u0026thinsp;C, c.46-107G\u0026thinsp;\u0026gt;\u0026thinsp;C, c.815-130C\u0026thinsp;\u0026gt;\u0026thinsp;A, c.1638\u0026thinsp;+\u0026thinsp;62C\u0026thinsp;\u0026gt;\u0026thinsp;T) were also identified \u003cb\u003e(\u003c/b\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of synonymous variants identified and studied in isolated cases of CHD with their associated phenotypes and novelty status\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"10\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNucleotide change\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAA change\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCHD Phenotype\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCHD Cases\u003c/p\u003e\u003cp\u003e(205)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003edbSNP\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003eClinVar\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eGenome Asia100K\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c10\" namest=\"c9\"\u003e\u003cp\u003e1000 Genome database\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.90A\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGly30=\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVSD, PDA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003cp\u003e(0.005)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNovel\u003c/p\u003e\u003cp\u003e(SCV005044988)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.240G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSer80=\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eASD, VSD, ToF \u0026amp; dextrocardia\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003cp\u003e(0.005)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNovel\u003c/p\u003e\u003cp\u003e(SCV005044989)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.381A\u0026thinsp;\u0026gt;\u0026thinsp;G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePro127=\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eVSD, PDA, ToF, ASD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e46\u003c/p\u003e\u003cp\u003e(0.0723)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ers4975753\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eReported\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e\u003cp\u003eReported\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003eReported\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAla427=\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eToF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003cp\u003e(0.005)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNovel\u003c/p\u003e\u003cp\u003e(SCV005044990)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.1509C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGly503=\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eToF-VSD, ToF, ASD\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15\u003c/p\u003e\u003cp\u003e(0.005)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ers2279589\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eReported\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e\u003cp\u003eReported\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c10\"\u003e\u003cp\u003eReported\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"10\"\u003eAA- Amino acid, NR- Not reported,\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Evolutionary significance\u003c/h2\u003e\u003cp\u003eEvolutionary significance of the residues harbouring the variants were analysed using \u0026lsquo;Homologene\u0026rsquo;. \u003cem\u003eIRX4\u003c/em\u003e was observed to be highly conserved across different vertebrate species \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e. Through multiple sequence alignment using \u0026lsquo;Clustal omega\u0026rsquo;, we also observed that the mutated synonymous codons were highly phylogenetically conserved in case of three rare variants (c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e and \u003cb\u003ec.\u003c/b\u003e1509\u003cb\u003eC\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/b\u003e) while the two other known variants (c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e and c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG)\u003c/b\u003e were least conserved \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Potential effect of synonymous variants on the structure and stability of mRNA\u003c/h2\u003e\u003cp\u003eRNAfold predicted the impact of synonymous variants on the structure and stability of mRNA. The alterations in structures of mutated mRNA were compared with WT structures and the δδG was calculated by comparing the δG of mutated mRNA with the WT. More positive the δδG value, less stable the mutated mRNA structures. Intriguingly, our structural analysis postulated that c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, and c.1509\u003cb\u003eC\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/b\u003e variants are more stable which decrease the rate of translation and this observation is further supported by the difference in δG which are \u0026minus;\u0026thinsp;3.2, -6.4, and \u0026minus;\u0026thinsp;1.9 Kcal/mol for 75 nts \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-E\u003cb\u003e)\u003c/b\u003e. The predicted structure for variant c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e showed a shortening of loop and formation of small internal loop. The MUT mRNA structure of variant c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e represent the widening of loop and formation of additional open loop. Additionally, the δδG values for 151 nts was \u0026minus;\u0026thinsp;3.2, -6.4, and \u0026minus;\u0026thinsp;1.9 Kcal/mol for the variants c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, and c.1509\u003cb\u003eC\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/b\u003e respectively. Consequently, the predicted structures and the δG speculated that the increase stability of these variants are independent of the fragment length of mRNA \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eContrarily, the variants c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e and c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e are predicted to decrease the stability of mRNA which facilitate the high rate of translation. The difference in δG was observed to be 4.7 and 6.6 Kcal/mol for 75 nts and 1.1 and 4.5 Kcal/mol for 151 nts for the variants c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e and c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e respectively \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-E\u003cb\u003e)\u003c/b\u003e. The predicted δG again anticipated that the stability of mRNA is independent of the fragment length.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Impact of \u003cem\u003eIRX4\u003c/em\u003e variants on RNA structural features\u003c/h2\u003e\u003cp\u003eThe effect of silent variants on the RNA structural features viz., the intra-molecular base pairing potential, base pairing probabilities of the MUT RNA, and assessment of accessibility (single-strandedness) were analysed for each identified variant which disclosed acceptable alterations. The dot plot matrices illustrating the base- pair probability of \u003cem\u003eIRX4\u003c/em\u003e WT and MUT RNA snippets with darker the dots specifying higher base pairing potential. Similarly, base pairing probabilities was also depicted by the circos plot with visualization of darker hue of gray depicting higher probability. The change in base pair probability (Pr (bp in WT) \u0026ndash; Pr (bp in MUT)), were also represented by dot plot matrices (differential dot plot) which defined the difference in base pairing patterns between WT and MUT RNAs at specific locations. Interestingly, the comparative analysis of variant c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e exhibited a major alteration in base pairing probabilities as portrayed by the dot plot, circos plot and differential dot plot \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-E\u003cb\u003e)\u003c/b\u003e. However, distinguished modifications in base pairing probabilities were observed for variants c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, and c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e as displayed by dot plot, circos plot and differential dot plot \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-E\u003cb\u003e)\u003c/b\u003e. Further, the accessibility profile of RNA structures which is the probability of being unpaired at each base position have also been checked for each variant. The RNA-protein or RNA-RNA interactions which is considered critical for translation of the protein, was found to be influenced. The analysis results revealed a significant difference in RNA accessibility due to variants c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e. Contrarily, negligible alteration in RNA accessibility induced by variants c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, and c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA (\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-E\u003cb\u003e)\u003c/b\u003e. Additionally, the increased probabilities of base pairing and the weakened base pairing potential within each MT RNA are also depicted.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Effect of \u003cem\u003eIRX4\u003c/em\u003e variants on splicing of pre-mRNA\u003c/h2\u003e\u003cp\u003eGenetics variants also disrupt normal splicing of pre-mRNA that might be responsible for disease. We have also predicted splicing elements using an online server HSF3.1. There was no significant effect observed on splicing signals due to variants c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e. However, for variant c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, six strongly predicted ESE Site were broken which were motif for PESE, ESE_ASFB, ESE_ASFB, PESE, PESE, PESE and one ESS Site was also disrupted which was motif for PESS. This variant also created four new ESE site i.e. EIE, EIE, ESE_9G8, ESE_ASFB as well as one new ESS site, this was the motif for Sironi_motif3. Therefore, the cumulative effect of significant changes in ESE/ESS motif recognition, disruption of enhancer motif and formation of new potential splice site caused by this variant may lead to skipping of exon 7 which could become damaging for IRX4 proteins Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of intronic variants identified in isolated cases of CHD\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecDNA position\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLocation\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003edbSNP id\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo.of\u003c/p\u003e\u003cp\u003eCases\u003c/p\u003e\u003cp\u003e(MAF)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eNo. of\u003c/p\u003e\u003cp\u003eControls\u003c/p\u003e\u003cp\u003e(MAF)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.1-139G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntron2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1/205\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.21-107G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntron2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1/205\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.46-107G\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntron3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e16/205\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.297\u0026thinsp;+\u0026thinsp;6T\u0026thinsp;\u0026gt;\u0026thinsp;G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntron4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ers2307118\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3/205\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.815-130C\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntron7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1/205\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.1638\u0026thinsp;+\u0026thinsp;62C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIntron7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1/205\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0/200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.6 Impact of \u003cem\u003eIRX4\u003c/em\u003e synonymous variants on miRNA target binding sites\u003c/h2\u003e\u003cp\u003eAs it is well established that any nucleotide change in the binding site of miRNA could alter the miRNA mediated gene regulation. Thus, nucleotide alterations in the target binding sites of miRNA were also investigated for all the five synonymous variants (c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e) using miRNA-based web server \u0026lsquo;RNA22\u0026rsquo;. This server was used to retrieve all the miRNA binding sites in the coding domain sequence (CDS) of \u003cem\u003eIRX4\u003c/em\u003e. For residues 90A, 240G, 381A and 1509C, we observed that these were not part of the target sites for miRNA, however residue 1281G was part of miRNA target site. Therefore, further analysis was performed to check the changes in the target sites of miRNAs due to variant c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e and identified the miRNAs that bound to WT versus the variant c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e. A total of 13 different miRNAs were identified which bound to the WT \u003cem\u003eIRX4\u003c/em\u003e at CDS position 336th viz., hsa_miR_1908_5p, hsa_miR_202_3p, hsa_miR_2277_5p, hsa_miR_3126_5p, hsa_miR_3180_3p, hsa_miR_3197, hsa_miR_3605_5p, hsa_miR_4253, hsa_miR_4525, hsa_miR_4697_5p, hsa_miR_4751, hsa_miR_6088, and hsa_miR_642a_3p. However, due to variant c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A, while five miRNAs (hsa_miR_202_3p, hsa_miR_3126_5p, hsa_miR_4751, hsa_miR_6088, and hsa_miR_642a_3p) lost their target binding site at CDS position 1281 in WT mRNA. Additionally, the predicted target binding sites of most of the miRNAs were changed from CDS position 336 to different respective sites. The binding site of hsa_miR_1908_5p miRNA was replaced from CDS position (1281\u0026ndash;1303) for WT \u003cem\u003eIRX4\u003c/em\u003e mRNA to (153\u0026ndash;174) and (821\u0026ndash;842) for MUT. Similarly, the target binding site of hsa_miR_2277_5p miRNA was (1281\u0026ndash;1307) which was changed to (51\u0026ndash;75). Further hsa_miR_3180_3p bound at CDS position (1281\u0026ndash;1301) in WT mRNA but bound at (1218\u0026ndash;1240) CDS position in MUT mRNA. Moreover, there was one binding site for hsa_miR_3197 in WT mRNA at CDS position (1281\u0026ndash;1302) which was replaced to three sites i.e., (340\u0026ndash;363), (817\u0026ndash;840), (1122\u0026ndash;1145) in MUT. Along with this, the binding site of hsa_miR_3605_5p was changed from (1281\u0026ndash;1302) to (522\u0026ndash;545) and (1324\u0026ndash;1347). The binding site of another miRNA hsa_miR_4253 was also replaced from (1281\u0026ndash;1299) to (1225\u0026ndash;1243). There was one predicted binding site for hsa_miR_4525 in WT \u003cem\u003eIRX4\u003c/em\u003e mRNA but due to nucleotide change at CDS 1281, this miRNA bound to three different sites namely (817\u0026ndash;838), (1137\u0026ndash;1158), and (1189\u0026ndash;1210) in MUT mRNA. The target binding site of hsa_miR_4697_5p miRNA was also changed from (1281\u0026ndash;1302) to (817\u0026ndash;839) and (1224\u0026ndash;1246) Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrediction analysis of synonymous variants using Human Splicing Finder (HSF)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eVariant Name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eHSF Prediction\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMotif\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePosition\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSR proteins/ Regulatory Elements\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.90A\u0026thinsp;\u0026gt;\u0026thinsp;C\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNo significant impact on splicing signals\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.240G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNo significant impact on splicing signals\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.381A\u0026thinsp;\u0026gt;\u0026thinsp;G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNo significant impact on splicing signals\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNew ESE Site\u003c/p\u003e\u003cp\u003eNew ESE Site\u003c/p\u003e\u003cp\u003eNew ESE Site\u003c/p\u003e\u003cp\u003eNew ESE Site\u003c/p\u003e\u003cp\u003eESE Site Broken\u003c/p\u003e\u003cp\u003eESE Site Broken\u003c/p\u003e\u003cp\u003eESE Site Broken\u003c/p\u003e\u003cp\u003eESE Site Broken\u003c/p\u003e\u003cp\u003eESE Site Broken\u003c/p\u003e\u003cp\u003eNew ESE Site\u003c/p\u003e\u003cp\u003eESE Site Broken\u003c/p\u003e\u003cp\u003eESE Site Broken\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGCCCC\u003c/p\u003e\u003cp\u003eCAGCCC\u003c/p\u003e\u003cp\u003eGCAGCC\u003c/p\u003e\u003cp\u003eCGCAGCC\u003c/p\u003e\u003cp\u003eCGCGGCCC\u003c/p\u003e\u003cp\u003eCCGCGGC\u003c/p\u003e\u003cp\u003eCCGCGGCC\u003c/p\u003e\u003cp\u003eCCCGCGG\u003c/p\u003e\u003cp\u003eCCCGCGGC\u003c/p\u003e\u003cp\u003eTCCCGCAG\u003c/p\u003e\u003cp\u003eTCCCGCGG\u003c/p\u003e\u003cp\u003eGTCCCGCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003echr5:1878326\u003c/p\u003e\u003cp\u003echr5:1878327\u003c/p\u003e\u003cp\u003echr5:1878328\u003c/p\u003e\u003cp\u003echr5:1878329\u003c/p\u003e\u003cp\u003echr5:1878329\u003c/p\u003e\u003cp\u003echr5:1878330\u003c/p\u003e\u003cp\u003echr5:1878330\u003c/p\u003e\u003cp\u003echr5:1878331\u003c/p\u003e\u003cp\u003echr5:1878331\u003c/p\u003e\u003cp\u003echr5:1878332\u003c/p\u003e\u003cp\u003echr5:1878332\u003c/p\u003e\u003cp\u003echr5:1878333\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eEIE\u003c/p\u003e\u003cp\u003eEIE\u003c/p\u003e\u003cp\u003eESE_9G8\u003c/p\u003e\u003cp\u003eESE_ASFB\u003c/p\u003e\u003cp\u003ePESE\u003c/p\u003e\u003cp\u003eESE_ASFB\u003c/p\u003e\u003cp\u003ePESS\u003c/p\u003e\u003cp\u003eESE_ASFB\u003c/p\u003e\u003cp\u003ePESE\u003c/p\u003e\u003cp\u003eSironi_motif3\u003c/p\u003e\u003cp\u003ePESE\u003c/p\u003e\u003cp\u003ePESE\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ec.1509C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNo significant impact on splicing signals\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eRNA22 prediction representing the changes in miRNA target binding sites due to variant c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003emiRNA (Sequence)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWT vs Mutant\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePredicted Target Site (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eRegion of mRNA (CDS position)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eFolding Energy (Kcal/Mol)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eBase Pairs in Putative Heteropduplex\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eTarget Length\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_1908_5p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCGGCGGGGACGGCGATTGGTC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCCG\u003c/p\u003e\u003cp\u003eTACGAGAGCCGGCTGCTGGCC\u003c/p\u003e\u003cp\u003eAGCTGAAGCCGCCCTTCCACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1303\u003c/p\u003e\u003cp\u003e153\u0026ndash;174\u003c/p\u003e\u003cp\u003e821\u0026ndash;842\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-20.20\u003c/p\u003e\u003cp\u003e-16.70\u003c/p\u003e\u003cp\u003e-19.20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e15\u003c/p\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e23\u003c/p\u003e\u003cp\u003e21\u003c/p\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_202_3p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAGAGGTATAGGGCATGGGAA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCC\u003c/p\u003e\u003cp\u003eLost binding site\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1302\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-16.70\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e15\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e22\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_2277_5p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAGCGCGGGCTGAGCGCTGCCAGTC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCCGCGCC\u003c/p\u003e\u003cp\u003eATGGCCACCAACTCCCTGAGCACG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1307\u003c/p\u003e\u003cp\u003e51\u0026ndash;75\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-22.10\u003c/p\u003e\u003cp\u003e-12.90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e17\u003c/p\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e27\u003c/p\u003e\u003cp\u003e24\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_3126_5p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTGAGGGACAGATGCCAGAAGCA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCC\u003c/p\u003e\u003cp\u003eLost binding site\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1302\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-15.60\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e22\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_3180_3p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTGGGGCGGAGCTTCCGGAGGCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTC\u003c/p\u003e\u003cp\u003eGTCCTCCGCGCCCGCCACGTCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1301\u003c/p\u003e\u003cp\u003e1218\u0026ndash;1240\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-25.50\u003c/p\u003e\u003cp\u003e-23.70\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e17\u003c/p\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e21\u003c/p\u003e\u003cp\u003e22\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_3197\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eGGAGGCGCAGGCTCGGAAAGGCG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCC\u003c/p\u003e\u003cp\u003eGGCCTGGCACCAGCCACTGCCGC\u003c/p\u003e\u003cp\u003eTGCGAGCTGAAGCCGCCCTTCCA\u003c/p\u003e\u003cp\u003eGCCACCGCCGCCGCCGCCGCCGC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1302\u003c/p\u003e\u003cp\u003e340\u0026ndash;363\u003c/p\u003e\u003cp\u003e817\u0026ndash;840\u003c/p\u003e\u003cp\u003e1122\u0026ndash;1145\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-24.30\u003c/p\u003e\u003cp\u003e-21.70\u003c/p\u003e\u003cp\u003e-19.40\u003c/p\u003e\u003cp\u003e-21.50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e17\u003c/p\u003e\u003cp\u003e17\u003c/p\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e22\u003c/p\u003e\u003cp\u003e21\u003c/p\u003e\u003cp\u003e21\u003c/p\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_3605_5p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTGAGGATGGATAGCAAGGAAGCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCC\u003c/p\u003e\u003cp\u003eAAGATCATGCTGGCCATCATCAC\u003c/p\u003e\u003cp\u003eGTCTTCCACGACCCCATCCTCAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1302\u003c/p\u003e\u003cp\u003e522\u0026ndash;545\u003c/p\u003e\u003cp\u003e1324\u0026ndash;1347\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-20.20\u003c/p\u003e\u003cp\u003e-15.10\u003c/p\u003e\u003cp\u003e-14.30\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e17\u003c/p\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e22\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_4253\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAGGGCATGTCCAGGGGGT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCT\u003c/p\u003e\u003cp\u003eGCGCCCGCCACGTCCCCG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1299\u003c/p\u003e\u003cp\u003e1225\u0026ndash;1243\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-24.00\u003c/p\u003e\u003cp\u003e-15.10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e17\u003c/p\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_4525\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eGGGGGGATGTGCATGCTGGTT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCCG\u003c/p\u003e\u003cp\u003eTGCGAGCTGAAGCCGCCCTTC\u003c/p\u003e\u003cp\u003eCGCCGCCGCCACCTCCCTGAG\u003c/p\u003e\u003cp\u003eGCCAAGGTCCCGCGGCCCCTG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1302\u003c/p\u003e\u003cp\u003e817\u0026ndash;838\u003c/p\u003e\u003cp\u003e1137\u0026ndash;1158\u003c/p\u003e\u003cp\u003e1189\u0026ndash;1210\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-18.50\u003c/p\u003e\u003cp\u003e-16.00\u003c/p\u003e\u003cp\u003e-17.90\u003c/p\u003e\u003cp\u003e-15.90\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e15\u003c/p\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e23\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_4697_5p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAGGGGGCGCAGTCACTGACGTG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCC\u003c/p\u003e\u003cp\u003eTGCGAGCTGAAGCCGCCCTTCC\u003c/p\u003e\u003cp\u003eCGCGCCCGCCACGTCCCCGTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1302\u003c/p\u003e\u003cp\u003e817\u0026ndash;839\u003c/p\u003e\u003cp\u003e1224\u0026ndash;1246\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-19.70\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e15\u003c/p\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e22\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_4751\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAGAGGACCCGTAGCTGCTAGAAGG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCTCC\u003c/p\u003e\u003cp\u003eLost binding site\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1302\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-18.30\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e13\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e22\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_6088\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAGAGATGAAGCGGGGGGGCG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCCT\u003c/p\u003e\u003cp\u003eLost binding site\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1300\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-19.30\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e20\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003ehsa_miR_642a_3p\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eAGACACATTTGGAGAGGGAACC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIRX4_WT\u003c/p\u003e\u003cp\u003e\u003cb\u003eIRX4_c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGGCCCCTGCGGCTGTGTCC\u003c/p\u003e\u003cp\u003eLost binding site\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1281\u0026ndash;1299\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e-16.80\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e16\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e19\u003c/p\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e\u003cem\u003eIRX4\u003c/em\u003e is a TALE (three amino acid loop extension)- homeobox transcription factor, which is chamber-specific in expression. During cardiogenesis, it positively regulates the ventricular gene expression while suppressing the atrial genes (Wang et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). The fully developed heart showed exclusive expression of \u003cem\u003eIRX4\u003c/em\u003e in ventricles only. Only one study till date reported the association of \u003cem\u003eIRX4\u003c/em\u003e missense variations in CHD. Besides missense variations, numerous synonymous, 3\u0026rsquo; and 5\u0026rsquo; UTR and intronic variants are also pointed out during genetic screening which are often neglected. Since these variants do not alter the amino acid sequence in protein but accumulating evidences have revealed that these variants imperviously affect the structure and stability of RNA along with expression and function of protein (Cuevas et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Bailey et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Hunt et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Lebeuf-Taylor et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Advance improvements in computational platforms have evolve numerous \u003cem\u003ein-silico\u003c/em\u003e tools which can be used to speculate the effect of synonymous variants. The most prominent impacts incorporate alterations to RNA structure and stability (Duan et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), splicing (Savisaar and Hurst \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Katneni et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), miRNA binding (Brest et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) and codon usage bias (translation efficiency) (Lin et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). As synonymous alterations are the results of nucleotide change only, various \u003cem\u003ein-silico\u003c/em\u003e tools can be applied to predict the pathogenesis and their functional characterization (Hamasaki-Katagiri et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Holcomb et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). To date, synonymous variants have been identified in cancers (Sharma et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and are associated with \u0026gt;\u0026thinsp;85 genetic diseases (Sperling et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Belv\u0026iacute;s et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Sauna and Kimchi-Sarfaty \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; T\u0026ouml;pf et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Cao et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Mattapally et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Borkar et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; El Bouchikhi et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). These are available in Database of Deleterious Synonymous Mutation (Sauna and Kimchi-Sarfaty \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Wen et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Diederichs et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In the current study, we have screened \u003cem\u003eIRX4\u003c/em\u003e gene in 205 isolated CHD. A total of eleven genetic variants (five synonymous, and six intronic variants) were detected.\u003c/p\u003e\u003cp\u003eLiterature study showed that three synonymous variants (Pro127=, Ala401\u0026thinsp;=\u0026thinsp;and Gly477=) were identified in \u003cem\u003eIRX4\u003c/em\u003e in hypertrophic cardiomyopathy, however their functional characterization was not performed to elucidate its association with the disease (Bayrak et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). One variant out of these, (Pro127=) was also detected in our study. The other candidate genes of CHD were also reported to harbour synonymous variants viz., \u003cem\u003eNKX2.5\u003c/em\u003e (Dixit et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), \u003cem\u003eGATA4\u003c/em\u003e (Dixit et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), \u003cem\u003eTBX20\u003c/em\u003e (T\u0026ouml;pf et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), \u003cem\u003eCITED2\u003c/em\u003e (Sperling et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), \u003cem\u003eTGFβ\u003c/em\u003e (Yadav et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and \u003cem\u003eCRELD1\u003c/em\u003e (our unpublished data) which were associated with different phenotype of CHD. Several of these studies have speculated their association with disease pathogenesis by deciphering their molecular mechanism based on computational approaches and consider as potential risk factors for CHD.\u003c/p\u003e\u003cp\u003eAlong with synonymous, numerous intronic variants were also gaining attention for characterizing their functional effect which strengthen their role in disease pathogenesis. Previously, intronic variants incorporating splice site were reported in \u003cem\u003eNKX2-5\u003c/em\u003e (Benson et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1999\u003c/span\u003e), \u003cem\u003eGATA4\u003c/em\u003e (Dixit et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), \u003cem\u003eISL1\u003c/em\u003e (T\u0026ouml;pf et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In our case-control study, five synonymous variants (c.90A\u0026thinsp;\u0026gt;\u0026thinsp;C, (Gly30=); c.240G\u0026thinsp;\u0026gt;\u0026thinsp;A, (Ser80=); c.381A\u0026thinsp;\u0026gt;\u0026thinsp;G, (Pro127=); c.1281G\u0026thinsp;\u0026gt;\u0026thinsp;A, (Ala427=); c.1509C\u0026thinsp;\u0026gt;\u0026thinsp;T, (Gly503=) along with six intronic variants (c.1-139G\u0026thinsp;\u0026gt;\u0026thinsp;A, c.21-107G\u0026thinsp;\u0026gt;\u0026thinsp;C, c.46-107G\u0026thinsp;\u0026gt;\u0026thinsp;C, c.297\u0026thinsp;+\u0026thinsp;6T\u0026thinsp;\u0026gt;\u0026thinsp;G, c.815-130C\u0026thinsp;\u0026gt;\u0026thinsp;A and c.1638\u0026thinsp;+\u0026thinsp;62C\u0026thinsp;\u0026gt;\u0026thinsp;T) were detected in isolated CHD. Therefore, by leveraging various computational tools based on \u003cem\u003ein-silico\u003c/em\u003e, their prominent and milder effect on RNA and protein were unveiled. Several features of RNA (stability, structure, base paring probability and accessibility), splicing process and miRNA binding targets were presumed.\u003c/p\u003e\u003cp\u003eRecently, computational analysis of synonymous variants on RNA structures, stability, base pair probability and accessibility have been shown to be associated with a diverse range of genetic disorders (Bertalovitz et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Sharma et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Dixit et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The nucleotide sequence of mRNA plays a crucial role in folding and formation of secondary structures which also regulates the expression of gene. The number of hydrogen bonds between the nucleotides determine to which extent the secondary structure formed is complex which is assumed to be more stable. Formation of stable structures is directly proportional to number of pairings between (G) and (C). These stable structures have high melting points which obstruct ribosome to unpair the nucleotides (Hall et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1982\u003c/span\u003e; Kozak \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e1986\u003c/span\u003e; de Smit and van Duin \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Studer and Joseph \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Gaspar et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) which results in reduction of the speed of ribosome and subsequently impaired the co-translational folding of newly formed protein.\u003c/p\u003e\u003cp\u003eIn our present study, the comprehensive analysis of the secondary structures of RNA predicted an increase in the stability of mRNA due to all the five variants (c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, (Gly30=); c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, (Ser80=); c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, (Pro127=); c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, (Ala427=), and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e, (Gly503=) which speculated a decrease in the rate of translation. Overall, all the synonymous variations affected the translation rate which causes imparity in RNA and protein folding which was implicated in the potential functional characterization of variants at molecular level. Several studies conducted on synonymous variants are also validated our observed results. In a study conducted on \u003cem\u003eGATA4\u003c/em\u003e in CHD, the synonymous variant c.1263C\u0026thinsp;\u0026gt;\u0026thinsp;T showed increase in stability (δδG = -1 Kcal/mol for both 75 and 150 nts long mRNA) (Dixit et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In a Gel-shift and UV-crosslinking study on the synonymous variant of \u003cem\u003eSOD1\u003c/em\u003egene Ge WW et al, 2006 reported reduce mRNA formation which leads to decreased stability of the mRNAs in ALS patients (Ge et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Further, another study also provides experimental evidence for disturbed mRNA folding in which a synonymous variant close to ΔF508 site (c.1521C\u0026thinsp;\u0026gt;\u0026thinsp;T; Ile507=) in \u003cem\u003eCFTR\u003c/em\u003e gene caused decrease mRNA stability after the creation of two enlarged single-stranded loops as predicted by the Mfold server. Functional evidence based on Circular dichroism spectroscopy (CD) and mRNA folding assay additionally validated the RNA misfolding and damaged co-translational protein folding (Bartoszewski et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Similarly, synonymous variants in \u003cem\u003eADAMTS13\u003c/em\u003e are reported to affect the mRNA stability irrespective of the mRNA length being evaluated (Edwards et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Another study by (Khabou et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) also deciphered the pathogenic effect of synonymous variants in Progressive Familial Intra-Hepatic Cholestasis type 3 (PFIC3) patients with synonymous polymorphisms in ATP binding cassette subfamily B member 4 \u003cem\u003e(ABCB4)\u003c/em\u003e gene (Khabou et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Likewise, synonymous variations in the \u003cem\u003eABCB1\u003c/em\u003e or \u003cem\u003eMDR1\u003c/em\u003e (multidrug resistance 1) gene which affect protein folding and as a result substantially alter the conformation and function of the multidrug transporter (Kimchi-Sarfaty et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Fung et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eFurther, these structural alterations were substantiated by additional computational analysis by MutaRNA tool which incorporated base pair probabilities dot plots, circos plots, differential base pairing probabilities dot plots and RNA accessibility to unravel the mRNA structural changes due to synonymous variants (Miladi et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The two variants viz, c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, (Pro127=); and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e, (Gly503=) exhibited more pronounced alterations as represented by base pair probabilities dot plots, circos plots, and differential base pairing probabilities dot plots which suggest disruption in RNA folding that may affect stability and function. Meanwhile, the increased probabilities of base-pairing and weakened base pairing potential within each MUT RNA was also analysed. However, the other variants (c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, (Gly30=); c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, (Ser80=); and c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ala427=) induce minor changes in these features albeit even slight variations can also influence RNA-protein interactions. A similar result was also observed in the RNA accessibility profile of c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, (Pro127=); and c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e, (Gly503=) variants with prominent differences. Moreover, (c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, (Gly30=); c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, (Ser80=); and c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;A (Ala427=) variants illustrated negligible changes. Each nucleotide's tendency to stay unpaired was evaluated through the RNA accessibility profile. It assisted in evaluating how change in nucleotide in mRNA sequence could affect its interactions with other RNAs and protein. Base pairing probabilities and accessibility profile of variants c.403G\u0026thinsp;\u0026gt;\u0026thinsp;T in \u003cem\u003eWNT10A\u003c/em\u003e and c.656T\u0026thinsp;\u0026gt;\u0026thinsp;C in \u003cem\u003eTSPEAR\u003c/em\u003e reported to alter the RNA folding that may affect function and stability in tooth agenesis (Ranjan et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn addition to these, synonymous variants also affect the splicing which is required for the expression of genes in eukaryotes. Splicing is the orderly process by which introns are excised from RNA transcripts. During the process, the spliceosome complex directly binds to the short consensus sequences in the exons (exonic splicing enhancers/silencers) for precise splicing. Different splicing outcomes are the results of alterations induced in the splicing regulatory elements which incorporate ESEs and ESSs, as well as intronic splicing enhancers and silencers (ISEs and ISSs) (Cartegni et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Adamson et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Recognition of exons and the regulation of pre-mRNA sequence inclusion in mature mRNA are guided by the balance between ESE and ESS motifs. This ratio is altered by the synonymous mutations which either create ESS or remove ESE or both and has resulted in altered exon recognition (Ke et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Pengelly et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). A good number of studies reported the association of disease with changes in splicing regulatory elements (Cartegni et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Scotti and Swanson \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Adamson et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Dixit et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Giri et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). HSF was used to analyse the effect of synonymous variants on splicing, aiming to better understand their impact on splice site recognition. The results interpreted significant alterations in the both ESEs and ESSs due to variant c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ala427=). The other variants have no alteration in ESE/ESS motifs ratios.\u003c/p\u003e\u003cp\u003eFurthermore, the impact of synonymous variants on the binding sites of targeted mRNA was also delineated. As some studies already reported the association of miRNA with different cardiovascular diseases (Latronico et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Giri et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). The miRNA binds to the 3' untranslated region (3'UTR) of its target mRNAs to regulate the expression of genes. The synonymous variants affect the binding sites which either get changed or lost. The variant c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ala427=) only showed significant alterations in the target binding sites of miRNAs in \u003cem\u003eIRX4\u003c/em\u003e CDS. The WT \u003cem\u003eIRX4\u003c/em\u003e exhibited 13 target binding sites of which 8 sites (61.5%) were changed and 5 sites (38.5%) were lost due to variant c.1281\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e (Ala427=). However, other variants (c.90\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eC\u003c/b\u003e, (Gly30=); c.240\u003cb\u003eG\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eA\u003c/b\u003e, (Ser80=); c.381\u003cb\u003eA\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eG\u003c/b\u003e, (Pro127=); c.1509\u003cb\u003eC\u003c/b\u003e\u0026thinsp;\u0026gt;\u0026thinsp;\u003cb\u003eT\u003c/b\u003e, (Gly503=) showed no significant changes on the target binding sites. The study of Brest et al, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e in Crohn\u0026rsquo;s disease, revealed that a synonymous variant in \u003cem\u003eIRGM\u003c/em\u003e gene could change the binding site for miR-196 which results in deregulation of IRGM-dependent xenophagy (Brest et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Another study, investigated that synonymous variant (c.51C\u0026thinsp;\u0026gt;\u0026thinsp;T) in \u003cem\u003eBCL2L12\u003c/em\u003e, identified in melanoma tumours, causes loss of the miR-671-5p binding site that stimulates protein expression (Gartner et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This depicts that change in nucleotide of target binding sites of miRNA could potentially affect the miRNA regulation mechanism which could alter the expression of gene and presumed to be a risk factor for the disease.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study provides an insight in the molecular mechanisms by \u003cem\u003ein-silico\u003c/em\u003e functional characterization of synonymous variants in CHD. We have implemented different computational tools based to correlate the association of synonymous variants with CHD. We have examined the potential effects of all the identified synonymous variants on \u003cem\u003eIRX4\u003c/em\u003e mRNA structure, stability, base pairing probability, accessibility and miRNA binding which could results in the altered rate of transcription and translation, ribosome pausing, protein aggregation, and unfolded protein accumulation. Our results are parallelly corroborated by other previously published reports which implicated the pathogenic effects of synonymous variants on WT mRNA folding, precise splicing and rate of translation. Therefore, this study aids another wing in unfolding the molecular functions of synonymous variants by using the current \u003cem\u003ein-silico\u003c/em\u003e tools. However, \u003cem\u003ein vitro\u003c/em\u003e functional analysis could further provide a better scenario for the pathogenic effect of these synonymous variants in the pathogenesis of the disease.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCHD- Congenital heart disease, ASD- Atrial Septal Defects; VSD- Ventricular Septal Defects; ToF- Tetralogy of Fallot, PDA- Patent Ductus Arteriosus, MAF- Minor Allele Frequency, THSF- Human Splice Finder; ESE- Exonic Splicing Enhancers; ESS- Exonic Splicing Silencers; ISE- Intronic Splicing Enhancers; ISS- Intronic Splicing Silencers; PESE- Putative Exonic Splicing Enhancers; PESS- Putative Exonic Splicing Silencers; ESR Splicing Regulatory Elements; EIE- Exon Identity Elements.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of interest:\u003c/strong\u003e On behalf of all the authors, the corresponding author states that there is no conflict of interest. All the authors have read the manuscript and approved the submission of current version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u003c/strong\u003e We are grateful to all the patients, their family members and control individuals for their participation in the present study. We are extremely thankful to Dr. Dharmendra Jain from Department of Cardio-vascular and Thoracic Surgery, IMS, BHU and Prof. Ashok Kumar from Neonatal Intensive Care Unit (NICU) from IMS, BHU, Varanasi for their constant support and encouragement in enrolment of patients. We acknowledge University Grants Commission (UGC) for research fellowship (JRF and SRF) to Jyoti Maddhesiya.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest:\u003c/strong\u003e On behalf of all the authors, the corresponding author states that there is no conflict of interest. All the authors have read the manuscript and approved the submission of current version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution:\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eBhagyalaxmi Mohapatra:\u0026nbsp;\u003c/strong\u003eConceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Project administration, Resources, Supervision, Visualization, Writing \u0026ndash; review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eJyoti Maddhesiya\u003c/strong\u003e: Conceptualization, Data curation, Formal analysis, Methodology, Software, Validation, Visualization, Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDharmendra Jain:\u003c/strong\u003e Investigation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAshok Kumar:\u003c/strong\u003e Investigation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSource of funding-\u0026nbsp;\u003c/strong\u003eThis study was funded through an Incentive Grant under the Institute of Eminence (IoE) initiative at Banaras Hindu University (BHU). The funding agency had no involvement in the study design, sample collection, data analysis or interpretation, manuscript preparation, or the decision to submit the article for publication.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAdamson SI, Zhan L, Graveley BR (2018) Vex-seq: high-throughput identification of the impact of genetic variation on pre-mRNA splicing efficiency. Genome Biol 19:71. https://doi.org/10.1186/s13059-018-1437-x\u003c/li\u003e\n\u003cli\u003eAhn J, Wu H, Lee K (2020) Integrative analysis revealing human heart-specific genes and consolidating heart-related phenotypes. Frontiers in genetics 11:777\u003c/li\u003e\n\u003cli\u003eAnderson DJ, Kaplan DI, Bell KM, et al (2018) NKX2-5 regulates human cardiomyogenesis via a HEY2 dependent transcriptional network. Nature communications 9:1373\u003c/li\u003e\n\u003cli\u003eBailey SF, Hinz A, Kassen R (2014) Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population. Nature Communications 5:4076\u003c/li\u003e\n\u003cli\u003eBao Z-Z, Bruneau BG, Seidman JG, et al (1999) Regulation of Chamber-Specific Gene Expression in the Developing Heart by \u003cem\u003eIrx4\u003c/em\u003e. Science 283:1161\u0026ndash;1164. https://doi.org/10.1126/science.283.5405.1161\u003c/li\u003e\n\u003cli\u003eBartoszewski RA, Jablonsky M, Bartoszewska S, et al (2010) A synonymous single nucleotide polymorphism in \u0026Delta;F508 CFTR alters the secondary structure of the mRNA and the expression of the mutant protein. Journal of Biological Chemistry 285:28741\u0026ndash;28748\u003c/li\u003e\n\u003cli\u003eBayrak F, K\u0026ouml;m\u0026uuml;rc\u0026uuml;-Bayrak E, Mutlu B, et al (2008) Genetic analysis of the Irx4 gene in hypertrophic cardiomyopathy. Turk Kardiyol Dern Ars 36:90\u0026ndash;95\u003c/li\u003e\n\u003cli\u003eBelv\u0026iacute;s R, Tizzano EF, Mart\u0026iacute;-F\u0026agrave;bregas J, et al (2009) Mutations in the NKX2-5 gene in patients with stroke and patent foramen ovale. Clinical neurology and neurosurgery 111:574\u0026ndash;578\u003c/li\u003e\n\u003cli\u003eBenson DW, Silberbach GM, Kavanaugh-McHugh A, et al (1999) Mutations in the cardiac transcription factor NKX2. 5 affect diverse cardiac developmental pathways. The Journal of clinical investigation 104:1567\u0026ndash;1573\u003c/li\u003e\n\u003cli\u003eBernhart SH, M\u0026uuml;ckstein U, Hofacker IL (2011) RNA Accessibility in cubic time. Algorithms Mol Biol 6:3. https://doi.org/10.1186/1748-7188-6-3\u003c/li\u003e\n\u003cli\u003eBertalovitz AC, Badhey MLO, McDonald TV (2018) Synonymous nucleotide modification of the KCNH2 gene affects both mRNA characteristics and translation of the encoded hERG ion channel. Journal of Biological Chemistry 293:12120\u0026ndash;12136\u003c/li\u003e\n\u003cli\u003eBorkar Y, Nayak K, Shetty RK, et al (2017) Gerbode Ventricular Septal Defect\u0026ndash;A Rare Cardiac Anomaly Associated with Genetic Variants in Indian Population-A Case Series. Journal of Clinical and Diagnostic Research: JCDR 11:GR01\u003c/li\u003e\n\u003cli\u003eBrest P, Lapaquette P, Souidi M, et al (2011) A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn\u0026rsquo;s disease. Nature genetics 43:242\u0026ndash;245\u003c/li\u003e\n\u003cli\u003eBruneau BG, Bao Z-Z, Fatkin D, et al (2001) Cardiomyopathy in \u003cem\u003eIrx4\u003c/em\u003e -Deficient Mice Is Preceded by Abnormal Ventricular Gene Expression. Molecular and Cellular Biology 21:1730\u0026ndash;1736. https://doi.org/10.1128/MCB.21.5.1730-1736.2001\u003c/li\u003e\n\u003cli\u003eBruneau BG, Bao Z-Z, Tanaka M, et al (2000) Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2-5 and dHand. Developmental biology 217:266\u0026ndash;277\u003c/li\u003e\n\u003cli\u003eCao Y, Lan W, Li Y, et al (2015) Single nucleotide polymorphism of NKX2-5 gene with sporadic congenital heart disease in Chinese Bai population. International journal of clinical and experimental pathology 8:14917\u003c/li\u003e\n\u003cli\u003eCartegni L, Chew SL, Krainer AR (2002) Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nature reviews genetics 3:285\u0026ndash;298\u003c/li\u003e\n\u003cli\u003eCavodeassi F, Modolell J, G\u0026oacute;mez-Skarmeta JL (2001) The Iroquois family of genes: from body building to neural patterning\u003c/li\u003e\n\u003cli\u003eCheng Z, Wang J, Su D, et al (2011) Two novel mutations of the IRX4 gene in patients with congenital heart disease. Hum Genet 130:657\u0026ndash;662. https://doi.org/10.1007/s00439-011-0996-7\u003c/li\u003e\n\u003cli\u003eCuevas JM, Domingo-Calap P, Sanju\u0026aacute;n R (2012) The fitness effects of synonymous mutations in DNA and RNA viruses. Molecular biology and evolution 29:17\u0026ndash;20\u003c/li\u003e\n\u003cli\u003ede Smit MH, van Duin J (1994) Control of translation by mRNA secondary structure in Escherichia coli: a quantitative analysis of literature data. Journal of molecular biology 244:144\u0026ndash;150\u003c/li\u003e\n\u003cli\u003eDiederichs S, Bartsch L, Berkmann JC, et al (2016) The dark matter of the cancer genome: aberrations in regulatory elements, untranslated regions, splice sites, non‐coding RNA and synonymous mutations. EMBO Mol Med 8:442\u0026ndash;457. https://doi.org/10.15252/emmm.201506055\u003c/li\u003e\n\u003cli\u003eDixit R, Kumar A, Mohapatra B (2019) Implication of GATA4 synonymous variants in congenital heart disease: A comprehensive in-silico approach. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 813:31\u0026ndash;38\u003c/li\u003e\n\u003cli\u003eDixit R, Narasimhan C, Balekundri VI, et al (2021) Functional analysis of novel genetic variants of \u003cem\u003e NKX2 ‐5 \u003c/em\u003e associated with nonsyndromic congenital heart disease. American J of Med Genetics Pt A 185:3644\u0026ndash;3663. https://doi.org/10.1002/ajmg.a.62413\u003c/li\u003e\n\u003cli\u003eDuan J, Wainwright MS, Comeron JM, et al (2003) Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Human molecular genetics 12:205\u0026ndash;216\u003c/li\u003e\n\u003cli\u003eEdwards NC, Hing ZA, Perry A, et al (2012) Characterization of coding synonymous and non-synonymous variants in ADAMTS13 using ex vivo and in silico approaches. Plos one 7:e38864\u003c/li\u003e\n\u003cli\u003eEl Bouchikhi I, Bouguenouch L, Moufid FZ, et al (2017) NKX2-5 molecular screening and assessment of variant rate and risk factors of secundum atrial septal defect in a Moroccan population. Anatolian Journal of Cardiology/Anadolu Kardiyoloji Dergisi 17:\u003c/li\u003e\n\u003cli\u003eFahed AC, Gelb BD, Seidman JG, Seidman CE (2013) Genetics of congenital heart disease: the glass half empty. Circulation research 112:707\u0026ndash;720\u003c/li\u003e\n\u003cli\u003eFung KL, Hunt RC, Kimchi-Sarfaty C, Gottesman MM (2016) Genetic polymorphisms of P-glycoprotein: echoes of silence. ABC Transporters-40 years on 105\u0026ndash;134\u003c/li\u003e\n\u003cli\u003eGarriock RJ, Vokes SA, Small EM, et al (2001) Developmental expression of the Xenopus Iroquois-family homeobox genes, Irx4 and Irx5. Dev Genes Evol 211:257\u0026ndash;260. https://doi.org/10.1007/s004270100147\u003c/li\u003e\n\u003cli\u003eGartner JJ, Parker SCJ, Prickett TD, et al (2013) Whole-genome sequencing identifies a recurrent functional synonymous mutation in melanoma. Proc Natl Acad Sci USA 110:13481\u0026ndash;13486. https://doi.org/10.1073/pnas.1304227110\u003c/li\u003e\n\u003cli\u003eGaspar P, Moura G, Santos MA, Oliveira JL (2013) mRNA secondary structure optimization using a correlated stem\u0026ndash;loop prediction. Nucleic acids research 41:e73\u0026ndash;e73\u003c/li\u003e\n\u003cli\u003eGe W, Leystra-Lantz C, Sanelli TR, et al (2006) Neuronal tissue-specific ribonucleoprotein complex formation on SOD1 mRNA: alterations by ALS SOD1 mutations. Neurobiology of disease 23:342\u0026ndash;350\u003c/li\u003e\n\u003cli\u003eGiri P, Jain D, Kumar A, Mohapatra B (2023) Identification and in silico characterization of CSRP3 synonymous variants in dilated cardiomyopathy. Mol Biol Rep 50:4105\u0026ndash;4117. https://doi.org/10.1007/s11033-023-08314-7\u003c/li\u003e\n\u003cli\u003eGordon DM, Cunningham D, Zender G, et al (2022) Exome sequencing in multiplex families with left-sided cardiac defects has high yield for disease gene discovery. PLoS Genetics 18:e1010236\u003c/li\u003e\n\u003cli\u003eHall MN, Gabay J, D\u0026eacute;barbouill\u0026eacute; M, Schwartz M (1982) A role for mRNA secondary structure in the control of translation initiation. Nature 295:616\u0026ndash;618\u003c/li\u003e\n\u003cli\u003eHamasaki‐Katagiri N, Lin BC, Simon J, et al (2017) The importance of mRNA structure in determining the pathogenicity of synonymous and non‐synonymous mutations in haemophilia. Haemophilia 23:. https://doi.org/10.1111/hae.13107\u003c/li\u003e\n\u003cli\u003eHoffman JI, Kaplan S (2002) The incidence of congenital heart disease. Journal of the American college of cardiology 39:1890\u0026ndash;1900\u003c/li\u003e\n\u003cli\u003eHolcomb D, Hamasaki-Katagiri N, Laurie K, et al (2021) New approaches to predict the effect of co-occurring variants on protein characteristics. The American Journal of Human Genetics 108:1502\u0026ndash;1511\u003c/li\u003e\n\u003cli\u003eHunt RC, Simhadri VL, Iandoli M, et al (2014) Exposing synonymous mutations. Trends in Genetics 30:308\u0026ndash;321\u003c/li\u003e\n\u003cli\u003eJia Z, Zhang Y, Yan A, et al (2020) 1, 25-dihydroxyvitamin D3 signaling-induced decreases in IRX4 inhibits NANOG-mediated cancer stem-like properties and gefitinib resistance in NSCLC cells. Cell Death \u0026amp; Disease 11:670\u003c/li\u003e\n\u003cli\u003eKatneni UK, Liss A, Holcomb D, et al (2019) Splicing dysregulation contributes to the pathogenicity of several F9 exonic point variants. Molecular Genetics \u0026amp; Genomic Medicine 7:e840\u003c/li\u003e\n\u003cli\u003eKe S, Shang S, Kalachikov SM, et al (2011) Quantitative evaluation of all hexamers as exonic splicing elements. Genome research 21:1360\u0026ndash;1374\u003c/li\u003e\n\u003cli\u003eKhabou B, Siala-Sahnoun O, Gargouri L, et al (2016) In silico investigation of the impact of synonymous variants in ABCB4 gene on mRNA stability/structure, splicing accuracy and codon usage: Potential contribution to PFIC3 disease. Computational Biology and Chemistry 65:103\u0026ndash;109\u003c/li\u003e\n\u003cli\u003eKim K-H, Rosen A, Bruneau BG, et al (2012) Iroquois homeodomain transcription factors in heart development and function. Circulation research 110:1513\u0026ndash;1524\u003c/li\u003e\n\u003cli\u003eKimchi-Sarfaty C, Oh JM, Kim I-W, et al (2007) A \u0026ldquo;Silent\u0026rdquo; Polymorphism in the \u003cem\u003eMDR\u003c/em\u003e 1 Gene Changes Substrate Specificity. Science 315:525\u0026ndash;528. https://doi.org/10.1126/science.1135308\u003c/li\u003e\n\u003cli\u003eKozak M (1986) Influences of mRNA secondary structure on initiation by eukaryotic ribosomes. Proc Natl Acad Sci USA 83:2850\u0026ndash;2854. https://doi.org/10.1073/pnas.83.9.2850\u003c/li\u003e\n\u003cli\u003eLatronico MVG, Catalucci D, Condorelli G (2007) Emerging Role of MicroRNAs in Cardiovascular Biology. Circulation Research 101:1225\u0026ndash;1236. https://doi.org/10.1161/CIRCRESAHA.107.163147\u003c/li\u003e\n\u003cli\u003eLebeuf-Taylor E, McCloskey N, Bailey SF, et al (2019) The distribution of fitness effects among synonymous mutations in a gene under directional selection. Elife 8:e45952\u003c/li\u003e\n\u003cli\u003eLin BC, Katneni U, Jankowska KI, et al (2023) In silico methods for predicting functional synonymous variants. Genome Biol 24:126. https://doi.org/10.1186/s13059-023-02966-1\u003c/li\u003e\n\u003cli\u003eMaddhesiya J, Mohapatra B (2024) Understanding the Genetic and Non-genetic Interconnections in the Aetiology of Isolated Congenital Heart Disease: An Updated Review: Part 1. Current cardiology reports 26:147\u0026ndash;165\u003c/li\u003e\n\u003cli\u003eMattapally S, Nizamuddin S, Murthy KS, et al (2015) c.620C\u0026gt;T mutation in GATA4 is associated with congenital heart disease in South India. BMC Med Genet 16:7. https://doi.org/10.1186/s12881-015-0152-7\u003c/li\u003e\n\u003cli\u003eMiladi M, Raden M, Diederichs S, Backofen R (2020) MutaRNA: analysis and visualization of mutation-induced changes in RNA structure. Nucleic acids research 48:W287\u0026ndash;W291\u003c/li\u003e\n\u003cli\u003eMohapatra B, Casey B, Li H, et al (2009) Identification and functional characterization of NODAL rare variants in heterotaxy and isolated cardiovascular malformations. Human molecular genetics 18:861\u0026ndash;871\u003c/li\u003e\n\u003cli\u003eNelson DO, Lalit PA, Biermann M, et al (2016) Irx4 marks a multipotent, ventricular-specific progenitor cell. Stem Cells 34:2875\u0026ndash;2888\u003c/li\u003e\n\u003cli\u003ePengelly RJ, Bakhtiar D, Borovsk\u0026aacute; I, et al (2022) Exonic splicing code and protein binding sites for calcium. Nucleic acids research 50:5493\u0026ndash;5512\u003c/li\u003e\n\u003cli\u003eRanjan P, Devi C, Verma N, et al (2024) Whole Exome Sequencing Uncovers Key Genetic Variants in Congenital Tooth Agenesis: An Integrative Omics Approach. medRxiv 2024\u0026ndash;11\u003c/li\u003e\n\u003cli\u003eRobinson SW, Morris CD, Goldmuntz E, et al (2003) Missense mutations in CRELD1 are associated with cardiac atrioventricular septal defects. The American Journal of Human Genetics 72:1047\u0026ndash;1052\u003c/li\u003e\n\u003cli\u003eSalari R, Kimchi-Sarfaty C, Gottesman MM, Przytycka TM (2013) Sensitive measurement of single-nucleotide polymorphism-induced changes of RNA conformation: application to disease studies. Nucleic acids research 41:44\u0026ndash;53\u003c/li\u003e\n\u003cli\u003eSauna ZE, Kimchi-Sarfaty C (2011) Understanding the contribution of synonymous mutations to human disease. Nature Reviews Genetics 12:683\u0026ndash;691\u003c/li\u003e\n\u003cli\u003eSavisaar R, Hurst LD (2018) Exonic splice regulation imposes strong selection at synonymous sites. Genome research 28:1442\u0026ndash;1454\u003c/li\u003e\n\u003cli\u003eScotti MM, Swanson MS (2016) RNA mis-splicing in disease. Nature Reviews Genetics 17:19\u0026ndash;32\u003c/li\u003e\n\u003cli\u003eSharma Y, Miladi M, Dukare S, et al (2019) A pan-cancer analysis of synonymous mutations. Nature communications 10:2569\u003c/li\u003e\n\u003cli\u003eSperling S, Grimm CH, Dunkel I, et al (2005) Identification and functional analysis ofCITED2 mutations in patients with congenital heart defects. Hum Mutat 26:575\u0026ndash;582. https://doi.org/10.1002/humu.20262\u003c/li\u003e\n\u003cli\u003eStuder SM, Joseph S (2006) Unfolding of mRNA secondary structure by the bacterial translation initiation complex. Molecular cell 22:105\u0026ndash;115\u003c/li\u003e\n\u003cli\u003eT\u0026ouml;pf A, Griffin HR, Glen E, et al (2014) Functionally significant, rare transcription factor variants in tetralogy of Fallot. PLoS One 9:e95453\u003c/li\u003e\n\u003cli\u003eWang F, Reece EA, Yang P (2013) Superoxide dismutase 1 overexpression in mice abolishes maternal diabetes\u0026ndash;induced endoplasmic reticulum stress in diabetic embryopathy. American journal of obstetrics and gynecology 209:345-e1\u003c/li\u003e\n\u003cli\u003eWang GF, Nikovits W, Bao Z-Z, Stockdale FE (2001) Irx4 forms an inhibitory complex with the vitamin D and retinoic X receptors to regulate cardiac chamber-specific slow MyHC3Expression. Journal of Biological Chemistry 276:28835\u0026ndash;28841\u003c/li\u003e\n\u003cli\u003eWang Y, Qiu C, Cui Q (2015) A large-scale analysis of the relationship of synonymous SNPs changing microRNA regulation with functionality and disease. International journal of molecular sciences 16:23545\u0026ndash;23555\u003c/li\u003e\n\u003cli\u003eWei S-J, Du J-L, Wang Y-B, et al (2023) Whole exome sequencing with a focus on cardiac disease-associated genes in families of sudden unexplained deaths in Yunnan, southwest of China. BMC Genomics 24:57. https://doi.org/10.1186/s12864-022-09097-0\u003c/li\u003e\n\u003cli\u003eWen P, Xiao P, Xia J (2016) dbDSM: a manually curated database for deleterious synonymous mutations. Bioinformatics 32:1914\u0026ndash;1916\u003c/li\u003e\n\u003cli\u003eYadav ML, Bhasker AN, Kumar A, Mohapatra B (2022) Identification and characterization of genetic variants of TGFB1 in patients with congenital heart disease. Meta Gene 31:100987\u003c/li\u003e\n\u003cli\u003eYadav ML, Ranjan P, Das P, et al (2021) Implication of rare genetic variants of NODAL and ACVR1B in congenital heart disease patients from Indian population. Experimental Cell Research 409:112869\u003c/li\u003e\n\u003cli\u003eZhang Y, Sun Y-M, Xu Y-J, et al (2020) A new TBX5 loss-of-function mutation contributes to congenital heart defect and atrioventricular block. International Heart Journal 61:761\u0026ndash;768\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Congenital heart disease, IRX4, Synonymous, isolated, mRNA· in-silico, variations","lastPublishedDoi":"10.21203/rs.3.rs-7192653/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7192653/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSynonymous variants are often overlooked during genetic screening, however current reports forecasted their significant biological impact and inevitably considered pathogenic. These silent changes in genome significantly affect the mRNA structure and stability and hence, alter the protein expression and function. \u003cem\u003eIRX4\u003c/em\u003e is an essential transcription factor for cardiogenesis and reported to be associated with congenital heart disease (CHD). In our study, we have performed genetic screening of \u003cem\u003eIRX4\u003c/em\u003e in 205 isolated cases of CHD. Five synonymous variants c.90\u003cstrong\u003eA\u003c/strong\u003e\u0026gt;\u003cstrong\u003eC\u003c/strong\u003e, c.240\u003cstrong\u003eG\u003c/strong\u003e\u0026gt;\u003cstrong\u003eA\u003c/strong\u003e, c.381\u003cstrong\u003eA\u003c/strong\u003e\u0026gt;\u003cstrong\u003eG\u003c/strong\u003e, c.1281\u003cstrong\u003eG\u003c/strong\u003e\u0026gt;\u003cstrong\u003eA\u003c/strong\u003e, and c.1509\u003cstrong\u003eC\u003c/strong\u003e\u0026gt;\u003cstrong\u003eT\u003c/strong\u003e, six intronic variants c.1-139G\u0026gt;A, c.21-107G\u0026gt;C, c.46-107G\u0026gt;C, c.297+6T\u0026gt;G, c.815-130C\u0026gt;A, c.1638+62C\u0026gt;T were identified. A computed analysis by diverse tools namely RNAfold, MutaRNA, Human Splicing Finder (HSF), and RNA22 was applied to predict the substantial effect on downstream function. RNAfold analysis indicated that all five variants impacted RNA structure and stability. Further, notable changes in the base-pairing probability and RNA accessibility were induced by c.90\u003cstrong\u003eA\u003c/strong\u003e\u0026gt;\u003cstrong\u003eC\u003c/strong\u003e, c.240\u003cstrong\u003eG\u003c/strong\u003e\u0026gt;\u003cstrong\u003eA\u003c/strong\u003e, c.381\u003cstrong\u003eA\u003c/strong\u003e\u0026gt;\u003cstrong\u003eG\u003c/strong\u003e, c.1281\u003cstrong\u003eG\u003c/strong\u003e\u0026gt;\u003cstrong\u003eA\u003c/strong\u003e, and c.1509\u003cstrong\u003eC\u003c/strong\u003e\u0026gt;\u003cstrong\u003eT \u003c/strong\u003evariants as shown by\u003cstrong\u003e \u003c/strong\u003eMutaRNA. Moreover, the effect on the cis-acting regulatory element of splicing was speculated due to c.1281\u003cstrong\u003eG\u003c/strong\u003e\u0026gt;\u003cstrong\u003eA \u003c/strong\u003evariant only. Likewise, various modes of the RNA22 tool indicated changes in miRNA binding sites, showing that 61.5% of targets were altered and 38.5% were completely lost as a result of the c.1281\u003cstrong\u003eG\u003c/strong\u003e\u0026gt;\u003cstrong\u003eA\u003c/strong\u003e variant. Our findings provide an insight into the molecular effect on mRNA structure and stability, splicing and miRNA target binding sites that potentially impair the transcription and translation and consequently might be associated with the pathogenesis of CHD.\u003c/p\u003e","manuscriptTitle":"Association of IRX4 synonymous variants with congenital heart disease: Leveraging in-silico approaches to predict the functional impact","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-08 13:20:28","doi":"10.21203/rs.3.rs-7192653/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9db23f98-0cea-4553-9b94-4df59a352606","owner":[],"postedDate":"August 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-06T18:40:34+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-08 13:20:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7192653","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7192653","identity":"rs-7192653","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.