Epigallocatechin Gallate Attenuates High-Fat Emulsion–Induced Pyroptosis in HepG2 Cells by Inhibiting the NLRP3–Caspase-1–GSDMD Pathway

preprint OA: closed
Full text JSON View at publisher
Full text 125,169 characters · extracted from preprint-html · click to expand
Epigallocatechin Gallate Attenuates High-Fat Emulsion–Induced Pyroptosis in HepG2 Cells by Inhibiting the NLRP3–Caspase-1–GSDMD Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Epigallocatechin Gallate Attenuates High-Fat Emulsion–Induced Pyroptosis in HepG2 Cells by Inhibiting the NLRP3–Caspase-1–GSDMD Pathway Dan-Ting Mao, Kun-Li Yang, Jiao-Jiao Peng, Pu Yu, Xu Jia, Yan-Lin Zhu, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8314367/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Objective To investigate the role of the pyroptosis pathway in high-fat emulsion–induced injury of HepG2 cells and to evaluate the protective effect of epigallocatechin gallate (EGCG). Methods An in vitro NAFLD model was established by exposing HepG2 cells to a high-fat emulsion, followed by treatment with varying concentrations of EGCG. Anti-NAFLD effects were assessed by evaluating cell viability, lipid accumulation, lipoprotein levels, inflammatory cytokines, and LDH release. The underlying mechanism was explored using flow cytometry, transmission electron microscopy, scanning electron microscopy, RT-PCR, Western blotting, and immunofluorescence. Results EGCG treatment markedly improved cell viability, reduced lipid accumulation, normalized lipoprotein profiles, and decreased inflammatory cytokine levels and LDH release. EGCG also ameliorated morphological and biochemical features of high-fat emulsion–induced pyroptosis, lowering the proportion of pyroptotic cells. Furthermore, EGCG significantly downregulated the mRNA and protein expression of NLRP3, Caspase-1, and GSDMD, reduced fluorescence intensity, and diminished GSDMD localization to the plasma membrane. Conclusions High-fat emulsion induces HepG2 cell pyroptosis via the NLRP3–Caspase-1–GSDMD pathway. EGCG attenuates lipid deposition and pyroptosis in this model, potentially through inhibition of the classical NLRP3–Caspase-1–GSDMD signaling axis. Biological sciences/Biochemistry Biological sciences/Cell biology Health sciences/Diseases Biological sciences/Molecular biology Epigallocatechin gallate NAFLD pyroptosis GSDMD Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Non-alcoholic fatty liver disease (NAFLD) is one of the most prevalent chronic liver disorders worldwide [ 1 ] . In recent years, with improvements in living standards and changes in dietary patterns, its incidence has continued to rise, and the proportion of affected young individuals has increased markedly [ 2 – 3 ] . The etiology of NAFLD remains incompletely understood, but its pathogenesis is thought to be closely associated with lipid metabolism disorders, insulin resistance, chronic inflammation, and various forms of programmed cell death [ 4 ] . Currently, the management of NAFLD primarily relies on lifestyle interventions such as dietary restriction and regular physical activity, in addition to pharmacological agents including insulin sensitizers and lipid-lowering drugs [ 5 ] . However, these approaches often yield limited efficacy and may be accompanied by adverse effects such as weight gain, osteoporosis, and hepatotoxicity [ 6 ] . Therefore, there is an urgent need to develop novel therapeutic strategies with clearly defined mechanisms, proven efficacy, and favorable safety profiles for the prevention and treatment of NAFLD. In recent years, natural compounds have attracted increasing attention in the prevention and treatment of metabolic and chronic inflammatory diseases owing to their wide availability, chemical diversity, favorable safety profiles, and ability to modulate multiple pathological pathways simultaneously [ 7 ] . Epigallocatechin gallate (EGCG), the most abundant catechin-derived polyphenol in green tea, possesses high bioavailability and a broad spectrum of biological activities [ 8 ] . Accumulating evidence has demonstrated that EGCG exerts antioxidant, anti-inflammatory, antifibrotic, lipid metabolism–regulating, and immunomodulatory effects, and confers protective benefits in cardiovascular diseases, diabetes, cancer, and neurodegenerative disorders [ 9 – 11 ] . Several studies have also investigated its potential in NAFLD, showing that EGCG can alleviate hepatic lipid metabolic disturbances by scavenging reactive oxygen species, enhancing mitochondrial respiration, and thereby reducing oxidative stress [ 12 ] . In addition, EGCG has been reported to modulate the composition and metabolic activity of gut microbiota, improve gut–liver axis function, and further regulate hepatic lipid homeostasis by influencing bile acid synthesis and transport [ 13 ] . Collectively, these findings highlight the considerable therapeutic potential of EGCG in NAFLD. In our preliminary work, analysis of publicly available databases combined with network pharmacology suggested that EGCG may also modulate the process of pyroptosis [ 14 ] . Pyroptosis is an inflammation-dependent form of programmed cell death triggered by inflammasome activation, characterized by pore formation in the plasma membrane, disruption of osmotic balance, release of intracellular contents, and abundant secretion of proinflammatory cytokines such as interleukin IL-1β and IL-18 [ 15 ] . Previous studies have shown that a high-fat diet can activate the NLRP3 inflammasome in hepatocytes and Kupffer cells, thereby promoting lipid deposition and inflammatory responses [ 16 ] ; moreover, in a murine model of non-alcoholic steatohepatitis (NASH), genetic deletion of caspase-1 significantly alleviated hepatic steatosis and inflammation [ 17 ] . Importantly, accumulating evidence indicates that the progression of NAFLD is accompanied by a marked increase in hepatocyte pyroptosis, which is positively correlated with dysregulated lipid metabolism [ 18 ] . However, whether EGCG can attenuate NAFLD-associated pathological injury by suppressing NLRP3/caspase-1/GSDMD-mediated pyroptosis remains unknown. In summary, this study aims to establish an in vitro NAFLD cell model by treating HepG2 cells with 1% medical fat emulsion, and to systematically evaluate the effects of EGCG on cell viability, lipid accumulation, inflammatory responses, and pyroptosis. Using CCK-8 assays, flow cytometry, biochemical measurements, immunofluorescence, and molecular biology techniques, we seek to determine whether EGCG can attenuate pathological injury in the NAFLD cell model by inhibiting the canonical NLRP3/caspase-1/GSDMD pyroptosis pathway. This work will not only provide new insights into the potential molecular mechanisms of EGCG in the prevention and treatment of NAFLD but also offer a theoretical basis and experimental evidence for the development of safe and effective natural-product-based therapeutic strategies. Materials and Methods Cell culture The human hepatocellular carcinoma (HCC) cell line HepG2 (CL-0103) was purchased from Wuhan Pricella Biotechnology Co., Ltd. (Wuhan, China). Cells were cultured in high-glucose Dulbecco’s modified Eagle’s medium (DMEM; C11995500BT, Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco). Cultures were maintained at 37 °C in a humidified atmosphere containing 5% CO2. Cell treatment When the cell density in 6-cm culture dishes reached approximately 70%, HepG2 cells were seeded into 96-well plates at a density of 5 × 10³ cells/well in 100 μL of complete medium. After cell attachment, 10 μL of EGCG(Shanghai Macklin Biochemical Technology Co., Ltd.E885861) at different concentrations (10, 20, 40, 80, 160, and 320 μM) was added to the designated wells, followed by incubation for 24 h. Subsequently, medical fat emulsion (20%) was diluted with complete medium to a final concentration of 1% and applied to the cells for 36 h. Cells were assigned to the following experimental groups: normal control (NC), model group (MD; 1% fat emulsion only), and EGCG treatment groups with low (E1), medium (E2), and high (E3) doses. At the end of the treatments, cells were collected for subsequent assays. Cell viability assay Cell viability was assessed using a Cell Counting Kit-8 (CCK-8; MF128-02, Mei5 Biotechnology Co., Ltd., Beijing, China). HepG2 cells were treated with EGCG at various concentrations (10, 20, 40, 80, 160, and 320 μM) for 24 h. Subsequently, 10 μL of CCK-8 solution was added to each well, and the cells were incubated at 37 °C for 30 min. Absorbance was measured at 450 nm using a microplate reader (SpectraMax, Molecular Devices, USA). Cell viability was calculated using the following formula: [A (dosing) - A (blank)]/[A (0 dosing) - A (blank)] × 100%. Oil Red O staining Oil Red O staining was performed to assess intracellular lipid accumulation. HepG2 cells were washed three times with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde for 30 min at room temperature, and then stained with Oil Red O working solution (Oil Red O stock solution diluted with its matching diluent at a ratio of 3:2) for 20 min in the dark at 4 °C. The cells were subsequently washed with 60% isopropanol to remove excess dye, followed by two washes with PBS. For quantitative analysis, stained lipid droplets were eluted with 200 μL of isopropanol per well (three replicate wells per group), and the optical density (OD) was measured at 490 nm using a microplate reader. Measurement of triglycerides, total cholesterol, low-density lipoprotein, and high-density lipoprotein Intracellular lipid profiles were determined by commercially available assay kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China). Total cholesterol (TC) levels were measured using the cholesterol oxidase–p-aminophenazone (COD-PAP) method (Cat. No. A111-1-1), and triglycerides (TG) were quantified using the glycerol phosphate oxidase–p-aminophenazone (GPO-PAP) method (Cat. No. A110-1-1). High-density lipoprotein cholesterol (HDL-C; Cat. No. A112-1-1) and low-density lipoprotein cholesterol (LDL-C; Cat. No. A113-1-1) were measured according to the manufacturer’s protocols. All measurements were performed on HepG2 cell lysates, and absorbance was read with a microplate reader as specified in the kit instructions. Enzyme-linked immunosorbent assay (ELISA) Interleukin-18 (IL-18), a key pro-inflammatory cytokine, was quantified using a commercial ELISA kit (Jiangsu Enzyme Immunoassay Industry Co., Ltd., Jiangsu, China) according to the manufacturer’s instructions. Absorbance was measured at the wavelength specified in the kit protocol using a microplate reader, and concentrations were calculated from a standard curve. Lactate dehydrogenase (LDH) release assay Lactate dehydrogenase (LDH) release was measured to evaluate the effect of EGCG on NAFLD-induced pyroptosis in HepG2 cells. LDH levels in the culture supernatant were determined using an LDH assay kit (Beyotime Biotechnology, Shanghai, China) following the manufacturer’s instructions. Absorbance was recorded at 490 nm, and LDH release was expressed as a percentage of total cellular LDH, calculated according to the kit formula. Detection of pyroptotic cells Following drug treatment, cells were harvested and resuspended in PBS. FAM-YVAD-FMK (a fluorescently labeled caspase-1 inhibitor peptide; final volume 5 µl; Beyotime Biotechnology, Shanghai, China) was added to the cell suspension and incubated at 37 °C in a humidified atmosphere containing 5% CO₂ for 1 h in the dark. Cells were then centrifuged at 1000 rpm for 5 min, washed twice with 1 ml washing buffer, and resuspended in 500 µl washing buffer. Propidium iodide (PI) was subsequently added according to the manufacturer’s protocol. The samples were analyzed by flow cytometry (within 1 h after staining) to detect FAM-YVAD-FMK and PI signals, and the percentage of pyroptotic cells was quantified [19,20] . Transmission electron microscopy (TEM) observation Cells were collected and fixed in 3% glutaraldehyde at room temperature, followed by post-fixation in 1% osmium tetroxide. The samples were dehydrated sequentially in graded acetone for 2 h, embedded in Epon812 resin, and polymerized. Ultrathin sections were prepared using an ultramicrotome, stained with 4% uranyl acetate and 0.5% lead citrate, and examined under a transmission electron microscope (JEM-1400FLASH; JEOL Ltd., Tokyo, Japan) to assess mitochondrial morphology in HepG2 cells. Microscopy and scanning electron microscopy (SEM) observation To evaluate cisplatin-induced morphological changes in HepG2 cells, scanning electron microscopy (JSM-IT700HR; JEOL Ltd., Tokyo, Japan) was used to visualize pore formation associated with pyroptosis. Following drug treatment, cells were washed with PBS, fixed in 3% glutaraldehyde at 4 °C for 1 h, and post-fixed in 1% osmium tetroxide for 1 h. Samples were rinsed three times with distilled water, dehydrated through a graded ethanol series (30%, 50%, 70%, 80%, 90%, 95%, and 100%), and dried. The specimens were then mounted and examined under a scanning electron microscope. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was extracted, and 1 µg of RNA was reverse transcribed into cDNA using a commercially available reverse transcription kit, following the manufacturer’s instructions. One microliter of cDNA was used as the template for quantitative real-time PCR (qRT-PCR) in a 10 µL reaction system. GAPDH served as the internal reference gene, and relative mRNA expression levels were calculated using the 2 −ΔΔCt method. Primer sequences are listed in Table 1, the qPCR reaction system is shown in Table 2, and the qPCR cycling program is presented in Table 3. Table 1. Primer sequence Primer Upstream Primer Downstream Primer NLRP3 AGGGATGAGAGTGTTGTGTGAAACG GCTTCTGGTTGCTGCTGAGGAC GSDMD GCCTCCACAACTTCCTGACAGATG GGTCTCCACCTCTGCCCGTAG Caspase-1 TCCTCAGGCTCAGAAGGGAATGTC GTGCGGCTTGACTTGTCCATTATTG IL-1β GGACAGGATATGGAGCAACAAGTGG TCATCTTTCAACACGCAGGACAGG GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Table 2. Real time fluorescence quantitative PCR reaction system(10μl) Reagent Dose Final Concentration TB Green(2×) 5.0μl 1× Forward Primer 0.4μl 10uM Reverse Primer 0.4μl 10uM cDNA 1.0μl ddH2O 3.2μl Total 10.0μl Table 3.Real time fluorescence quantitative PCR reaction system Number of cycles Step Temperature Duration Detection or not 1 Pre denaturation 95℃ 30sec No Denaturation 95℃ 5sec No 40 Anneal 60℃ 30sec No Extension 72℃ 10sec Yes Western blot Total protein from HepG2 cells was extracted using a commercial Protein Extraction Kit (BSC29S1; Bioer Technology, Hangzhou, China), following the manufacturer’s protocol. Equal amounts of protein were separated by SDS–PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes. After transfer, the membranes were blocked with 5% non-fat milk in Tris-buffered saline with 0.1% Tween-20 (TBST) for 1 h at room temperature, and subsequently incubated overnight at 4 °C with the following primary antibodies: β-actin (Proteintech, 66009-1-Ig), NLRP3 (Abcam, ab263899), caspase-1 (Cell Signaling Technology, 4199S), and GSDMD (Cell Signaling Technology, 69469S). The membranes were then washed three times with TBST (10 min each) and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Hangzhou Hua’an Biotechnology, HA1031) for 1 h at room temperature. Protein bands were visualized using the Tanon imaging system and quantified with the accompanying analysis software. Immunofluorescence of GSDMD Following treatment with EGCG for 24 h, HepG2 cells were fixed with 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.5% Triton X-100 for 20 min, and blocked with blocking buffer for 30 min. The cells were then incubated overnight at 4 °C with a primary antibody against gasdermin D (CST, 69469S; 1:800), followed by incubation with an IF488-conjugated secondary antibody (Hangzhou Hua’an Biotechnology Co., Ltd., HA1121; 1:500) for 1 h at room temperature. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI), and fluorescence images were captured using an immunofluorescence microscope (Nikon, Tokyo, Japan). Statistics and Data Analysis Statistical analyses were performed using SPSS version 26.0 (IBM Corp., Armonk, NY, USA) and GraphPad Prism version 9.0 (GraphPad Software, San Diego, CA, USA). Data are presented as the mean ± standard deviation (SD). Comparisons between two groups were conducted using an independent-samples t -test, while comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA) followed by Tukey post hoc tests. A p -value of < 0.05 was considered statistically significant. Results 1 EGCG enhances HepG2 cell viability and alleviates fat emulsion-induced cytotoxicity To evaluate the effects of EGCG on hepatocyte viability, we first examined its influence on HepG2 cells across a concentration gradient. As shown in Figure 1A, EGCG significantly increased cell viability at concentrations ranging from 10 to 80μM, with the most pronounced enhancement observed at 40μM ( P < 0.01). However, higher concentrations (160 μM and above) resulted in a marked decrease in cell viability ( P < 0.01), suggesting a biphasic, dose-dependent effect of EGCG on cell proliferation. We then determined the optimal exposure time for high-fat emulsion-induced cytotoxicity in HepG2 cells. Treatment with 1% high-fat emulsion for 12 hours did not significantly affect cell viability, whereas prolonged exposure for 36 hours led to an approximately 50% reduction in viability compared to untreated controls ( P < 0.05, Figure 1B), establishing 36 hours as the appropriate time point for subsequent modeling. Next, we assessed the protective effects of EGCG on high-fat emulsion-treated HepG2 cells. As expected, high-fat emulsion significantly suppressed cell viability (MD group, P < 0.01), whereas EGCG treatment partially reversed this suppression in a dose-dependent manner. The most robust rescue effect was observed at 40 μM ( P < 0.01, Figure 1C). These findings demonstrate that EGCG enhances HepG2 cell viability within a safe concentration range and significantly alleviates high-fat emulsion-induced cellular damage. 2 EGCG suppresses lipid accumulation and lipoprotein dysregulation induced by high-fat emulsion in HepG2 cells To assess the effects of EGCG on lipid accumulation and lipoprotein production under high-fat emulsion stimulation, Oil Red O staining was performed. As shown in Figure 2A, a large number of red-stained lipid droplets of varying sizes were observed throughout the cytoplasm in MD group, indicating significant intracellular lipid deposition. In contrast, EGCG treatment markedly reduced lipid droplet formation in a dose-dependent manner. Quantitative analysis further revealed that exposure to fat emulsion significantly increased the levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein (LDL), and high-density lipoprotein (HDL) in HepG2 cells (Figure 2B–F, P <0.01). EGCG administration effectively reduced the elevated TC, TG, and LDL levels, and notably reversed the abnormal increase in HDL toward baseline levels observed in the control group. These findings suggest that EGCG attenuates high-fat emulsion-induced steatosis by suppressing intracellular lipid accumulation and correcting lipoprotein imbalances. 3 EGCG attenuates high-fat emulsion induced inflammatory cytokine expression qPCR analysis revealed that exposure to high-fat emulsion markedly increased IL-1β and IL-18 transcripts in HepG2 cells. EGCG treatment reduced the mRNA levels of both cytokines in a dose-dependent manner, with the most pronounced suppression observed at 40μM ( P <0.01 versus MD,Figure 3D). Consistent with these findings, western blot demonstrated a substantial increase in total and cleaved IL-1β protein in the MD, and ELISA confirmed elevated IL-18 secretion. EGCG effectively reversed these changes: at 40μM, the abundance of IL-1β and IL-18 returned to near-baseline values ( P <0.01 Figure 3A-C;Figure 3E), whereas a moderate reduction was evident at 20μM and a minimal effect at 10μM. Collectively, these data indicate that EGCG exerts a potent anti-inflammatory effect against high-fat emulsion-induced injury. 4 EGCG ameliorates high-fat emulsion induced ultrastructural damage in HepG2 cells Scanning electron microscopy revealed that 36h exposure to high-fat emulsion caused extensive ultrastructural lesions characteristic of pyroptosis: abundant membrane pores of heterogeneous diameter, pronounced membrane blebbing and overt cellular swelling (Figure4A). EGCG markedly mitigated these defects in a concentration-dependent manner. At 10μM the number of pores and blebs was partially reduced; 20μM further decreased membrane protrusions; and 40μM almost completely restored a smooth, continuous plasma membrane with a regular cellular outline and no detectable swelling. Transmission electron microscopy further corroborated these findings (Figure 4B). HepG2 cells exposed to high-fat emulsion displayed prominent pyroptotic ultrastructural alterations, including swollen mitochondria with disrupted cristae, cytoplasmic vacuolization, and nuclear chromatin condensation. Treatment with EGCG alleviated these injuries in a dose-dependent manner: 10μM partially preserved mitochondrial morphology and reduced vacuole formation; 20μM further restored mitochondrial integrity and decreased cytoplasmic vacuoles; while 40μM nearly normalized subcellular architecture, showing intact mitochondria, continuous nuclear membranes, and markedly diminished pyroptotic features. 5 EGCG attenuates high-fat emulsion induced pyroptosis via suppression of the NLRP3/caspase1/GADMD axis Flow-cytometric analysis of active caspase-1/PI dual-positive cells revealed a pronounced increase in pyroptosis after 36 h exposure to 1 % fat emulsion ( P < 0.01; Fig. 5A). EGCG mitigated this effect in a concentration-dependent fashion, reducing the pyroptotic fraction to 17.9 %, 12.9% and 10.30% at 10, 20 and 40 µM, respectively ( P < 0.01 vs. MD). Consistent with the cytometric findings, extracellular LDH activity was markedly elevated in the MD group and progressively lowered by EGCG, with maximal suppression at 40 µM ( P < 0.01; Fig. 5B). Immunofluorescence corroborated these observations: robust membrane translocation of GSDMD was evident after fat-emulsion treatment, whereas 40 µM EGCG almost completely abolished the GSDMD signal (Fig. 5C). At the transcriptional level, high-fat emulsion up-regulated mRNA expression of NLRP3, GSDMD ( P < 0.01). EGCG dose-dependently suppressed the induction of all three genes and restored their expression to near-baseline values at 40 µM (Fig. 6A–C). These changes were mirrored at the protein level: the MD group showed marked accumulation of NLRP3, GSDMD-N, pro-caspase-1 and cleaved caspase-1, whereas EGCG sharply attenuated each of these increases, again with greatest efficacy at 40 µM (Fig. 6D, 6E–H). Collectively, the data demonstrate that EGCG confers potent protection against fat-emulsion–induced pyroptosis in HepG2 cells, an effect closely associated with inhibition of the canonical NLRP3/caspase-1/GSDMD signaling pathway. Discussion In the present study, we successfully established an in vitro NAFLD model in HepG2 cells by treatment with 1% medical high-fat emulsion, which induced marked lipid accumulation and activation of the canonical pyroptotic pathway [21] . Our data demonstrated that stimulation with EGCG markedly alleviated lipid deposition, suppressed pyroptosis, and downregulated the expression of the NLRP3/Caspase-1/GSDMD signaling axis. These findings suggest that EGCG may exert protective effects against the progression of NAFLD, at least in part, by inhibiting inflammasome-mediated pyroptosis [22] . NAFLD is pathologically characterized by hepatic steatosis and may progress to non-alcoholic steatohepatitis (NASH), a process closely associated with chronic hepatic inflammation [23] . Increasing evidence indicates that pyroptosis plays a critical role in the initiation and maintenance of this inflammatory microenvironment [24] . Upon pyroptotic activation, the NLRP3 inflammasome promotes the cleavage of pro-caspase-1 into its active form, which in turn facilitates the maturation and secretion of IL-18 and IL-1β, and drives GSDMD-mediated membrane pore formation [25] . These events synergistically lead to hepatocellular swelling, membrane rupture, and the release of inflammatory mediators, thereby amplifying both local and systemic inflammation. In our in vitro model, high-fat emulsion exposure significantly induced lipid accumulation and steatosis in HepG2 cells, accompanied by robust upregulation of NLRP3, Caspase-1, and GSDMD at both mRNA and protein levels, as well as increased secretion of IL-1β and IL-18. These findings are consistent with previous in vivo studies in NAFLD models reporting elevated GSDMD expression in liver tissues, further supporting the notion that activation of the NLRP3/Caspase-1/GSDMD axis contributes to hepatic lipid accumulation and inflammation [26] . EGCG, the most abundant catechin in green tea, possesses potent antioxidant, anti-inflammatory, and metabolic regulatory activities [27] . Previous studies have reported its hepatoprotective effects in diverse liver injury models, including alcoholic liver disease, immune-mediated liver injury, and metabolic syndrome-related hepatic damage [28] . Our findings extend these observations by showing that EGCG suppresses lipid accumulation and attenuates pyroptosis in hepatocytes under lipotoxic stress. Mechanistically, EGCG treatment reduced NLRP3, Caspase-1, and GSDMD expression, lowered LDH release, and diminished IL-1β and IL-18 secretion, suggesting inhibition of the canonical pyroptotic cascade [29] . While the direct molecular targets remain to be elucidated, EGCG has been shown to modulate upstream regulators such as ROS production, NF-κB signaling, and AMP-activated protein kinase (AMPK), all of which may converge on NLRP3 inflammasome activation [30] . Further studies involving specific inhibitors or gene silencing are warranted to confirm these mechanistic links. In this study, we for the first time, employed a medical high-fat emulsion–induced in vitro NAFLD model. Although high-fat emulsion has been predominantly applied in vivo , we found that diluting a 20% fat emulsion to 1% was sufficient to induce steatosis and pyroptosis in HepG2 cells. Notably, EGCG treatment ameliorated both the morphological and biochemical alterations associated with pyroptosis induced by the 1% high-fat emulsion [31] . This was evidenced by a reduction in membrane pore formation observed under scanning electron microscopy and decreased membrane localization of GSDMD as detected by immunofluorescence. These findings are in line with previous reports showing that suppression of hepatocyte pyroptosis not only alleviates inflammatory injury but also reduces lipid accumulation, highlighting the bidirectional interplay between metabolic stress and inflammatory cell death [32] . Several limitations should be acknowledged in the present study. First, the experiments were conducted exclusively in HepG2 cells, which may not fully recapitulate the complex cellular and metabolic interactions in the liver in vivo . Second, while the medical high-fat emulsion–based model is reproducible, it may not completely mimic the long-term dietary and metabolic milieu of NAFLD [33] . Third, the precise upstream signaling events by which EGCG suppresses NLRP3 activation remain to be elucidated. Future studies should employ NAFLD animal models to validate our findings and utilize molecular interventions—such as siRNA-mediated knockdown or CRISPR/Cas9 genome editing—to clarify the causal role of NLRP3/Caspase-1/GSDMD inhibition in the hepatoprotective effects of EGCG [34] . Furthermore, investigating the pharmacokinetics and bioavailability of EGCG will be essential for facilitating clinical translation [35] . In summary, our study demonstrates that EGCG alleviates lipid accumulation and suppresses pyroptosis in an in vitro NAFLD model, at least in part by inhibiting the canonical NLRP3–Caspase-1–GSDMD pathway [36] . These findings provide mechanistic insight into the hepatoprotective actions of EGCG and suggest its potential as a therapeutic candidate for preventing NAFLD progression. Declarations Author contributions Z.Q and S.Y was involved in the study concepts. Z.Q, M.D.Tand Y.K.L were involved in the study design. J.X, Z.Y.L, K.J.Y, Y. E.J, L.H.T, L.L, G. J.W, L.Z.R, L.H, were involved in the experiments.M.D.T and Y.K.L was involved in the original manuscript. M.D.T was involved in the data analysis.All authors contributed to the article and approved the submitted version. Funding This current research was supported by the Sichuan Provincial Administration of Traditional Chinese Medicine (2023MS563) and Scientific Research and Development Fund project of North Sichuan Medical College(CBY24-QNA14);Strategic Cooperation Project of Nanchong City(22SXQT0129);Affiliated Hospital of North Sichuan Medical College Project(2024OPTZK012);Medical Imaging Key Laborary of Province(MIKL202402);Sichuan Hospital Association Youth Pharmacist Research Special Fund(YP2202424);National Undergraduate Innovation and Entrepreneurship Project(202210634181);Sichuan Undergraduate Innovation and Entrepreneurship Project(202410634081) Compliance with ethical standards Conflict of interest The authors declare no competing interests. Data availability The datasets used and/or analysed during the current study available from the corresponding author on reasonable request. References Younossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L , Wymer M,et al. Global Epidemiology of Nonalcoholic Fatty Liver disease-Meta-analytic Assessment of prevalence, incidence, and Outcomes. Hepatology 2016 64 73–84. Duseja A , Chalasani N. Epidemiology and risk factors of nonalcoholic fatty liver disease (NAFLD). Hepatology International 2013 7 755–64. Teng M, Cheng Han Ng, Huang DQ, En Chan K, Jun D ,Wen Kwang Lim,et al. Global incidence and prevalence of nonalcoholic fatty liver disease. Clinical and Molecular Hepatology 2022 29 S32–42. Sanyal AJ. Past, present and future perspectives in nonalcoholic fatty liver disease. Nature Reviews Gastroenterology & Hepatology 2019 16 377–86. Maurice J , Manousou P. Non-alcoholic fatty liver disease. Clinical Medicine 2018 18 245–50. Yu L, Hong W, Lu S, Li Y, Guan Y, Weng X, et al. The NLRP3 Inflammasome in Non-Alcoholic Fatty Liver Disease and Steatohepatitis: Therapeutic Targets and Treatment. Frontiers in Pharmacology 2022 13. Colak Y, Hasan B, Banu Erkalma, Tandon K, Zervos X, Menzo EL, et al. Pathogenetic mechanisms of nonalcoholic fatty liver disease and inhibition of the inflammasome as a new therapeutic target. Clinics and Research in Hepatology and Gastroenterology 2021 45 101710–0. Capasso L, Masi LD, Sirignano C, Maresca V, Basile A, Nebbioso A, et al. Epigallocatechin Gallate (EGCG): Pharmacological Properties, Biological Activities and Therapeutic Potential. Molecules 2025 30 654–4. Gui L, Wang F, Hu X, Liu X, Yang H, Cai Z, et al. Epigallocatechin Gallate Protects Diabetes Mellitus Rats Complicated with Cardiomyopathy through TGF-β1/JNK Signaling Pathway. Current Pharmaceutical Design 2022 28 2758–70. Karimi-Shahri M, Alalikhan A, hashemian P, Hashemzadeh A, Javid DrH. The applications of epigallocatechin gallate (EGCG)-nanogold conjugate in cancer therapy. Nanotechnology 2022. Sergi CM. Epigallocatechin gallate for Parkinson’s disease. Clinical and Experimental Pharmacology & Physiology 2022 49 1029–41. Yang M, Yan R, Sha R, Wang X, Zhou S, Li B, et al. Epigallocatechin gallate alleviates Non-alcoholic fatty liver disease through the inhibition of the expression and activity of Dipeptide kinase 4. Clinical Nutrition 2024 43 1769–80. Zuo G, Chen M, Zuo Y, Liu F, Yang Y, Li J, et al. Tea Polyphenol Epigallocatechin Gallate Protects Against Nonalcoholic Fatty Liver Disease and Associated Endotoxemia in Rats via Modulating Gut Microbiota Dysbiosis and Alleviating Intestinal Barrier Dysfunction and Related Inflammation. Journal of Agricultural and Food Chemistry 2024. Mao D, Guo J, Yang K, Yang F, Peng J, Jia X, et al. Mechanism of epigallocatechin gallate in treating non-alcoholic fatty liver disease: Insights from network pharmacology and experimental validation. Biochemical and Biophysical Research Communications 2024 734 150424. Rao Z, Zhu Y, Yang P, Chen Z, Xia Y, Qiao C, et al. Pyroptosis in inflammatory diseases and cancer. Theranostics 2022 12 4310–29. Thornton P, Reader V, Digby Z, Smolak P, Lindsay N, Harrison D, et al. Reversal of High Fat Diet-Induced Obesity, Systemic Inflammation, and Astrogliosis by the NLRP3 Inflammasome Inhibitors NT-0249 and NT-0796. The Journal of Pharmacology and Experimental Therapeutics 2024 388 813–26. Feng Y, Li W, Wang Z, Zhang R, Li Y, Zang L, et al. The p-STAT3/ANXA2 axis promotes caspase-1-mediated hepatocyte pyroptosis in non-alcoholic steatohepatitis. Journal of Translational Medicine 2022 20. Koh EH, Yoon JE, Ko MS, Jaechan Leem, Yun J-Y, Hong CH, et al. Sphingomyelin synthase 1 mediates hepatocyte pyroptosis to trigger non-alcoholic steatohepatitis. Gut 2020 70 1954–64. Manohar SM, Shah P, Nair A. Flow cytometry: principles, Applications and Recent Advances. Bioanalysis 2021 13 185–203. Xu Y, Chu Y, Yang W, Chu K, Li S, Guo L. BML-111 inhibit H2O2-induced pyroptosis and osteogenic dysfunction of human periodontal ligament fibroblasts by activating the Nrf2/HO-1 pathway. BMC Oral Health 2024 24. Li J, Wang T, Liu P, Yang F, Wang X, Zheng W, et al. Hesperetin ameliorates hepatic oxidative stress and inflammation via the PI3K/AKT-Nrf2-ARE pathway in oleic acid-induced HepG2 cells and a rat model of high-fat diet-induced NAFLD. Food & Function 2021 12 3898–918. Zhang Y, Li J, Wang Z, Chen J, Zhao M, Guo C, et al. Preclinical evidence construction for epigallocatechin-3-gallate against non-alcoholic fatty liver disease: a meta-analysis and machine learning study. Phytomedicine 2025 156651–1. Paternostro R, Trauner M. Current treatment of non‐alcoholic fatty liver disease. Journal of Internal Medicine 2022 292 190–204. Du T, Gao J, Li P, Wang Y, Qi Q, Liu X, et al. Pyroptosis, metabolism, and tumor immune microenvironment. Clinical and Translational Medicine 2021 11. Li L-R, Chen L, Sun Z-J. Igniting hope: Harnessing NLRP3 inflammasome-GSDMD-mediated pyroptosis for cancer immunotherapy. Life Sciences 2024 354 122951–1. Luo R, Hu Y, Wang L, Ke Z, Wang W, Wang P, et al. Penthorum chinense Pursh extract ameliorates hepatic steatosis by suppressing pyroptosis via the NLRP3/Caspase‐1/GSDMD pathway. Food Science & Nutrition 2024 12 5176–87. Mehmood S, Maqsood M, Nazia Mahtab, Muhammad Issa Khan, Sahar A, Sania Zaib, et al. Epigallocatechin gallate: Phytochemistry, bioavailability, utilization challenges, and strategies 2022 46. Hiba Siblini, Ayman Al-Hendy, Segars J, González F, Taylor HS, Singh B, et al. Assessing the Hepatic Safety of Epigallocatechin Gallate (EGCG) in Reproductive-Aged Women. Nutrients 2023 15 320–0. Bao B, Yin X-P, Wen X-Q, Suo Y-J, Chen Z-Y, Li DL, et al. The protective effects of EGCG was associated with HO-1 active and microglia pyroptosis inhibition in experimental intracerebral hemorrhage. Neurochemistry International 2023 170 105603–3. Xiao Y, Yang C, Si N, Chu T, Yu J, Yuan X, et al. Epigallocatechin-3-gallate Inhibits LPS/AβO-induced Neuroinflammation in BV2 Cells through Regulating the ROS/TXNIP/NLRP3 Pathway. Journal of Neuroimmune Pharmacology 2024 19. Zhang J, Wang S, Zhang T, Zi M, Wang S, Zhang Q. Green tea epigallocatechin gallate attenuate metabolic dysfunction-associated steatotic liver disease by regulation of pyroptosis. Lipids in Health and Disease 2025 24. Gaul S, Leszczynska A, Alegre F, Kaufmann B, Johnson CD, Adams LA, et al. Hepatocyte pyroptosis and release of inflammasome particles induce stellate cell activation and liver fibrosis. Journal of Hepatology 2021 74 156–67. Pouwels S, Sakran N, Graham Y, Leal A, Pintar T, Yang W, et al. Non-alcoholic fatty liver disease (NAFLD): a review of pathophysiology, clinical management and effects of weight loss. BMC Endocrine Disorders 2022 22. Mandala A, Janssen RC, Palle S, Short KR, Friedman JE. Pediatric Non-Alcoholic Fatty Liver Disease: Nutritional Origins and Potential Molecular Mechanisms. Nutrients 2020 12 E3166. Revathy Sahadevan, Singh S, Anupama Binoy, Sushabhan Sadhukhan. Chemico-biological aspects of(−)-epigallocatechin-3-gallate (EGCG) to improve its stability, bioavailability and membrane permeability: Current status and future prospects. Critical Reviews in Food Science and Nutrition 2022 1–30. Liu Z, Wang M, Wang X, Bu Q, Wang Q, Su W, et al. XBP1 deficiency promotes hepatocyte pyroptosis by impairing mitophagy to activate mtDNA-cGAS-STING signaling in macrophages during acute liver injury. Redox Biology 2022 52 102305. Additional Declarations No competing interests reported. Supplementary Files WBrawdata20251223225355.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 27 Jan, 2026 Reviewers agreed at journal 16 Jan, 2026 Reviewers invited by journal 14 Jan, 2026 Editor assigned by journal 14 Jan, 2026 Editor invited by journal 29 Dec, 2025 Submission checks completed at journal 26 Dec, 2025 First submitted to journal 26 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8314367","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":575638920,"identity":"868c96a3-4819-42e5-8f57-e49e0c09bd27","order_by":0,"name":"Dan-Ting Mao","email":"","orcid":"","institution":"Affiliated Hospital of North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Dan-Ting","middleName":"","lastName":"Mao","suffix":""},{"id":575638922,"identity":"87895677-7016-4a6f-90b6-2a23f9d84e1c","order_by":1,"name":"Kun-Li Yang","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Kun-Li","middleName":"","lastName":"Yang","suffix":""},{"id":575638924,"identity":"7438a090-ee4a-4af4-a2b0-f025ae91edc0","order_by":2,"name":"Jiao-Jiao Peng","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Jiao-Jiao","middleName":"","lastName":"Peng","suffix":""},{"id":575638925,"identity":"e3e587f8-f737-401d-b1d8-ec968cc697e6","order_by":3,"name":"Pu Yu","email":"","orcid":"","institution":"North SIchuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Pu","middleName":"","lastName":"Yu","suffix":""},{"id":575638926,"identity":"8e578d1f-9270-4ee2-8af3-a377c5823336","order_by":4,"name":"Xu Jia","email":"","orcid":"","institution":"Affiliated Hospital of North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Jia","suffix":""},{"id":575638927,"identity":"83d56a69-0ba0-4eee-8c40-4aefb6e9f4b9","order_by":5,"name":"Yan-Lin Zhu","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Yan-Lin","middleName":"","lastName":"Zhu","suffix":""},{"id":575638928,"identity":"e9eff73d-58e5-4173-8408-a60a9ddea4e4","order_by":6,"name":"Jiang-Yu Ke","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Jiang-Yu","middleName":"","lastName":"Ke","suffix":""},{"id":575638930,"identity":"82907a89-14f3-4b1b-8367-39e84d13c71c","order_by":7,"name":"En-Jie Yang","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"En-Jie","middleName":"","lastName":"Yang","suffix":""},{"id":575638932,"identity":"224d28c8-7db4-49d5-95e1-7661dc26ff8a","order_by":8,"name":"Hai-Tao Lan","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Hai-Tao","middleName":"","lastName":"Lan","suffix":""},{"id":575638934,"identity":"9ce518ad-5411-48ca-9582-eb07f1accf17","order_by":9,"name":"Lu Liu","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Liu","suffix":""},{"id":575638937,"identity":"6c7c614f-f817-4711-bcf1-570bec058239","order_by":10,"name":"Li Jiang","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Jiang","suffix":""},{"id":575638938,"identity":"699605cb-c9b8-49ba-8642-23f3ef6de1c3","order_by":11,"name":"Zi-Ren Luo","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zi-Ren","middleName":"","lastName":"Luo","suffix":""},{"id":575638941,"identity":"ec001ff7-a8b7-455a-8a0f-99384f01aba9","order_by":12,"name":"Jing-Ran Chen Lin","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Jing-Ran","middleName":"Chen","lastName":"Lin","suffix":""},{"id":575638942,"identity":"9fa5d19e-15bd-4a92-a830-b96f0d47d810","order_by":13,"name":"Hong Liu","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Liu","suffix":""},{"id":575638943,"identity":"21f0166d-421c-46d8-bfb1-86e113c92708","order_by":14,"name":"Yi Shang","email":"","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Shang","suffix":""},{"id":575638944,"identity":"28138a38-da3e-42ae-8ab9-ea0914c96224","order_by":15,"name":"Qian Zheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7klEQVRIiWNgGAWjYDACCRjJzHz8wwcDGzsStLC3pTHOKEhLJlYLEPCcMWPm+XCIsYGQDvnZzccefimzkDeXSDB7bGNwgJmB/fDRDfi0MM45lm4sc07CcOeMhHTjHIM7fAw8aWk38Glhlsgxk5Zsk2DccCPhgHSOwTNmBgkeM7xa2CTyv4G02G+4kdggbWFwmLGBkBYeiRw2yY9tEokbzhxmk2YgRouERJqZNMM5ieQNx9uYDXsM0pLZCPlFfkbyM8kfZXW2Gw7zf3zw44+NHT/74WN4tYAAMw8bsu8IKQcBxh9EKRsFo2AUjIIRCwAvJkhGZGXblgAAAABJRU5ErkJggg==","orcid":"","institution":"North Sichuan Medical College","correspondingAuthor":true,"prefix":"","firstName":"Qian","middleName":"","lastName":"Zheng","suffix":""}],"badges":[],"createdAt":"2025-12-09 07:23:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8314367/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8314367/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100625742,"identity":"8048cf35-404c-43ef-966f-27f00ab137c0","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"jpg","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17313235,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/fc74756908aebe35058f7a56.jpg"},{"id":100625712,"identity":"84bdd457-5ab5-49ab-88e9-01716a4f5afb","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":665836,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/d29ea1afb55249e3e2ef0662.docx"},{"id":100625758,"identity":"58e61d0d-1541-4744-831b-6163b07f652e","added_by":"auto","created_at":"2026-01-19 19:27:32","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":551650,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1CCK8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/07418403b440b784d53113fd.jpg"},{"id":100625714,"identity":"b100f273-ebd4-40b4-89ee-e254a8d69645","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2109875,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/41aad0b840f867051d39e279.jpg"},{"id":100796297,"identity":"6b585c67-4d47-42ae-8b54-91ca1a2415ef","added_by":"auto","created_at":"2026-01-21 13:42:30","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11890,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/5a1f2ae1a0398d15260af23d.docx"},{"id":100625709,"identity":"56fa4e66-b280-494f-8b68-80524d266459","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":561946,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/c5ae814df9b517bfa53359d8.jpg"},{"id":100625741,"identity":"7b3bb363-310e-40d2-874f-7f3ffb6de5e4","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11757,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/f4cafac6f5c0336b45a33a2e.docx"},{"id":100804058,"identity":"4e47697b-2963-40fa-8663-3e1b0f026f2d","added_by":"auto","created_at":"2026-01-21 14:35:39","extension":"docx","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11812,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.docx","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/75e636f8737e09a9e478d923.docx"},{"id":100625717,"identity":"3c87d8f8-c25d-4615-985a-2c9194081506","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"jpg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1476532,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/1bfd4fb35660c11aa28803d3.jpg"},{"id":100625715,"identity":"0bc9fe5d-cb56-4179-8b19-280887c2109f","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"jpg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1072115,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/d46955f26ddac6869bf4c192.jpg"},{"id":100796152,"identity":"e131927e-ae8a-4208-9d48-18b9a1a9fb3d","added_by":"auto","created_at":"2026-01-21 13:41:00","extension":"json","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15053,"visible":true,"origin":"","legend":"","description":"","filename":"55cfee79819b439f8b26f34962cdd1a7.json","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/0b151718d2bd5f809085d879.json"},{"id":100625736,"identity":"aceb6266-9efb-4f8c-8076-ea74f3ab7e6d","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":455596,"visible":true,"origin":"","legend":"","description":"","filename":"WBrawdata20251223225355.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/a8bf5eefc17fff0bd4faff65.pdf"},{"id":100625762,"identity":"6946b7c6-9021-4a15-a216-0e298ef551ca","added_by":"auto","created_at":"2026-01-19 19:27:32","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102039,"visible":true,"origin":"","legend":"","description":"","filename":"55cfee79819b439f8b26f34962cdd1a71enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/a6c6bb6489d585b83441ad56.xml"},{"id":100804051,"identity":"4963bda3-9405-4c05-9b22-38e414554094","added_by":"auto","created_at":"2026-01-21 14:35:31","extension":"jpg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17313235,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/06dc5ad508cbc97eec5ef1e4.jpg"},{"id":100796266,"identity":"f2d1d1af-af66-477c-acc6-e1b3661ce60e","added_by":"auto","created_at":"2026-01-21 13:42:21","extension":"jpg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":551650,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1CCK8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/cbe452e1e6567f6b9dbe6982.jpg"},{"id":100625720,"identity":"b05c3a6c-b3fc-445b-ad5e-50ac3a4d9f36","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"jpg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2109875,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/513d471f4405e7bf97d038ed.jpg"},{"id":100625731,"identity":"e68067d1-b701-4197-a57f-1f1fd7199de7","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"jpg","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":561946,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/98d243b27c829426dc9774d2.jpg"},{"id":100625754,"identity":"6fdb7a90-93a0-43d7-8680-1052fce508dd","added_by":"auto","created_at":"2026-01-19 19:27:32","extension":"jpg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1476532,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/a4de7d1f97eab2c913b446bf.jpg"},{"id":100796136,"identity":"571da13c-770b-4b43-826b-84e1800d5f05","added_by":"auto","created_at":"2026-01-21 13:40:51","extension":"jpg","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1072115,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/c8763e36444e48dcbd06a792.jpg"},{"id":100625734,"identity":"5509f859-db68-483b-9ef7-5af601899d62","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"jpeg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59426,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/fcd319ae389bca9684b4e545.jpeg"},{"id":101880446,"identity":"e94cd435-1409-4711-8dff-6b749bdb402a","added_by":"auto","created_at":"2026-02-04 15:02:02","extension":"jpeg","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":150461,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/b33b51c062f597c846035fa5.jpeg"},{"id":100625732,"identity":"9a68b038-01ba-4697-8685-033bb104a522","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"jpeg","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":72638,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/e3aae64d2d5d13e461edb731.jpeg"},{"id":100625764,"identity":"5d810561-4e25-44ad-96a3-ae50040195f2","added_by":"auto","created_at":"2026-01-19 19:27:33","extension":"jpeg","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":237112,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/d021ee884e4ead4bebe78711.jpeg"},{"id":100804019,"identity":"7260e414-7071-47b9-8f9e-8b0d7cd74c4e","added_by":"auto","created_at":"2026-01-21 14:34:56","extension":"jpeg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":114707,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/fb0c14596650cb9a4d15943f.jpeg"},{"id":100625738,"identity":"ce45f167-5014-45f6-a47e-db74678b5331","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"jpeg","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":91775,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/891d73a2d0ac4ccfa6cce3eb.jpeg"},{"id":100949297,"identity":"a0529a03-b889-44cf-8479-b8c98111add6","added_by":"auto","created_at":"2026-01-23 06:58:53","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4853517,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/d080177b1ddd5ad0ad955aa6.png"},{"id":100625751,"identity":"ce89fc79-e14b-4b42-ac0f-c2776dec2cc3","added_by":"auto","created_at":"2026-01-19 19:27:32","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99733,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1CCK8.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/626583de216cb8f1bffbedf1.png"},{"id":100625747,"identity":"70b68f85-d74d-459a-b3ee-d976adce1813","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1997535,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/876f51276e3d479170625816.png"},{"id":100625757,"identity":"0b3bcff0-60d6-4059-b876-f98c28fcdc04","added_by":"auto","created_at":"2026-01-19 19:27:32","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":161295,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/3a696e8f32fe6cfbd6c03213.png"},{"id":100796120,"identity":"0ea983d1-2f97-4922-8423-f6a9ebd0befb","added_by":"auto","created_at":"2026-01-21 13:40:34","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":167536,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/423134fd303faac50fd0818a.png"},{"id":100796349,"identity":"2bc7678c-aa15-4497-810a-0d5115f43ae5","added_by":"auto","created_at":"2026-01-21 13:42:44","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":178769,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/eb7818ab88d1fff6c83dc3a1.png"},{"id":100796415,"identity":"53cfc4f9-7e10-4ec7-a4ca-66513e4787ca","added_by":"auto","created_at":"2026-01-21 13:43:04","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20471,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/2841d5fd6ab86dfe96536119.png"},{"id":100796428,"identity":"7ab4242e-3c85-4337-9e0a-3c5ff76903a1","added_by":"auto","created_at":"2026-01-21 13:43:08","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":158291,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/a0cc6214697d0383c8c5c071.png"},{"id":100857716,"identity":"6cc8a8a9-1f97-4c8e-94d9-59004af290b3","added_by":"auto","created_at":"2026-01-22 07:21:03","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":31096,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/be50da8d6c1904129538cc36.png"},{"id":100625763,"identity":"2da031f2-20b3-4e4f-b80e-4c93927ec1f5","added_by":"auto","created_at":"2026-01-19 19:27:33","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":247072,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/889d142525cd39622cf062cd.png"},{"id":100796102,"identity":"18dc8348-cf5e-4768-8af6-0b2bb6a8cdc6","added_by":"auto","created_at":"2026-01-21 13:40:24","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57740,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/63b32e5115c2b7283cefc08e.png"},{"id":100796154,"identity":"cf727c8d-f567-4725-9466-f3b7a67e533a","added_by":"auto","created_at":"2026-01-21 13:41:02","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37881,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/3cb776bbfd7a537310d0beea.png"},{"id":100625749,"identity":"7fa7a987-6f2e-4ab6-a85d-a68f838189ea","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"xml","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99996,"visible":true,"origin":"","legend":"","description":"","filename":"55cfee79819b439f8b26f34962cdd1a71structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/539a797072ed40bea9ebeb6c.xml"},{"id":100625760,"identity":"5c1d08b4-2e51-433b-9416-7619af690c36","added_by":"auto","created_at":"2026-01-19 19:27:32","extension":"html","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":112043,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/3c5392b33bff3e5b3dfa9cea.html"},{"id":100796294,"identity":"f56456bc-5487-4bcb-95f0-e1b0264cd864","added_by":"auto","created_at":"2026-01-21 13:42:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":551650,"visible":true,"origin":"","legend":"\u003cp\u003eThe proliferation activity of the HepG2 cells .A The effect of different concentrations of EGCG on the proliferation activity of the HepG2 cells.B The proliferation activity of the HepG2 cells under different action times by High-fat emulsion.C The effect of EGCG onthe proliferation activity of the HepG2 cells under High-fat emulsion.(n=3)Data are shown as the mean ± SD.\u003cem\u003e*p\u003c/em\u003e<0.05; \u003cem\u003e**p\u003c/em\u003e<0.01\u003c/p\u003e","description":"","filename":"Figure1CCK8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/fe51fcb14d31c45bf06b6c25.jpg"},{"id":100804098,"identity":"7224271a-c494-433b-b1d3-3fd226b354f5","added_by":"auto","created_at":"2026-01-21 14:37:03","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2109875,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of EGCG on Figh- fat emμlsion inducing HepG2 cellμlar lipid droplet and lipoprotein eneartion.(A-B)Oil Red O staining results.(C–F) Levels of T-CHO, TC, LDL and HDL in HepG2 cell.(n=3)Data are shown as the mean ± SD.\u003cem\u003e*p\u003c/em\u003e<0.05; \u003cem\u003e**p\u003c/em\u003e<0.01\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/3b9fef667a60a4b22220c3b7.jpg"},{"id":100625752,"identity":"cb9934d5-f90a-4179-9983-d7dd6a03f3d6","added_by":"auto","created_at":"2026-01-19 19:27:32","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":561946,"visible":true,"origin":"","legend":"\u003cp\u003e(A–C) Western blot analysis of proptosis-related gene IL-1β and Cleaved- IL-1β expression in HepG2 cells. (D) qRT-PCR analysis of inflammatory factors IL-1β expression in HepG2 cells.(E)ELISA analysis of IL-18 in HepG2 cells.(n=3)Data are shown as the mean ± SD.\u003cem\u003e*p\u003c/em\u003e<0.05; \u003cem\u003e**p\u003c/em\u003e<0.01.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/02a11a2001df1b92dbf3e2ba.jpg"},{"id":100625733,"identity":"98f235a7-4f90-4e2d-ac3f-6b0328b8187d","added_by":"auto","created_at":"2026-01-19 19:27:31","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":17313235,"visible":true,"origin":"","legend":"\u003cp\u003e(A)The effect of EGCG on the ultrastructure of HepG2 cells under scanning electron microscopy.The left image is magnified 10000 times, and the right image is magnified 20000 . Yellow arrows indicate the formation of cell membrane pores and bubble formationtimes.(n=3)(B)The effect of EGCG on the ultrastructure of HepG2 cells under transmission electron microscopy The left image is magnified 8000 times, and the right image is magnified 20000 times, The yellow arrow represents mitochondria, and the green arrow represents the nucleus.(n=3)\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/ad316916ede014418a24f768.jpg"},{"id":100803982,"identity":"235ff7a3-e636-42df-827c-769c830675aa","added_by":"auto","created_at":"2026-01-21 14:33:29","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1476532,"visible":true,"origin":"","legend":"\u003cp\u003eEGCG attenuated Hight-fat emulsion-induced pyroptosis in HepG2 cell.(A) Flow cytometry analysis of FAM-YVAD-FMK in HepG2 cell. (B) The level of LDH in HepG2 cell.(C) The immunofluorescence analysis of GSDMD in HepG2 cell.(n=3)Data are shown as the mean ± SD.\u003cem\u003e*p\u003c/em\u003e<0.05;\u003cem\u003e**p\u003c/em\u003e<0.01.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/821f6b4b0e44fbf2bd5543c9.jpg"},{"id":100796354,"identity":"041b4725-22cd-4182-9543-b58a18836d4b","added_by":"auto","created_at":"2026-01-21 13:42:45","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1072115,"visible":true,"origin":"","legend":"\u003cp\u003eEGCG ameliorated Hight-fat emulsion-induced pyroptosis in HepG2 cell.(A–C) qRT-PCR analysis of proptosis-related gene NLRP3, GSDMD and Caspase-1 expression in HepG2 cells. (D–H) Western blot analysis of liver proptosis-related protein NLRP3, GSDMD-N and Cleaved-Caspase-1 expression in HepG2 cells.(n=3)Data are shown as the mean ± SD.\u003cem\u003e*p\u003c/em\u003e<0.05; \u003cem\u003e**p\u003c/em\u003e<0.01.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/3597305f31af1344f6f8e5d4.jpg"},{"id":101882170,"identity":"c6325d69-f066-42f5-b1bc-fa437da0f0ef","added_by":"auto","created_at":"2026-02-04 15:21:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":24067428,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/fcfca00a-efba-4900-8d27-37e59f390ab5.pdf"},{"id":100625711,"identity":"3b04b544-8bb0-41a7-ad32-cd2c09cac9eb","added_by":"auto","created_at":"2026-01-19 19:27:30","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":455596,"visible":true,"origin":"","legend":"","description":"","filename":"WBrawdata20251223225355.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8314367/v1/42e4ae122cb1f946b1b0b246.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Epigallocatechin Gallate Attenuates High-Fat Emulsion–Induced Pyroptosis in HepG2 Cells by Inhibiting the NLRP3–Caspase-1–GSDMD Pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNon-alcoholic fatty liver disease (NAFLD) is one of the most prevalent chronic liver disorders worldwide\u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]\u003c/sup\u003e. In recent years, with improvements in living standards and changes in dietary patterns, its incidence has continued to rise, and the proportion of affected young individuals has increased markedly\u003csup\u003e[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. The etiology of NAFLD remains incompletely understood, but its pathogenesis is thought to be closely associated with lipid metabolism disorders, insulin resistance, chronic inflammation, and various forms of programmed cell death\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Currently, the management of NAFLD primarily relies on lifestyle interventions such as dietary restriction and regular physical activity, in addition to pharmacological agents including insulin sensitizers and lipid-lowering drugs\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003c/sup\u003e. However, these approaches often yield limited efficacy and may be accompanied by adverse effects such as weight gain, osteoporosis, and hepatotoxicity\u003csup\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Therefore, there is an urgent need to develop novel therapeutic strategies with clearly defined mechanisms, proven efficacy, and favorable safety profiles for the prevention and treatment of NAFLD.\u003c/p\u003e \u003cp\u003eIn recent years, natural compounds have attracted increasing attention in the prevention and treatment of metabolic and chronic inflammatory diseases owing to their wide availability, chemical diversity, favorable safety profiles, and ability to modulate multiple pathological pathways simultaneously\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Epigallocatechin gallate (EGCG), the most abundant catechin-derived polyphenol in green tea, possesses high bioavailability and a broad spectrum of biological activities\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Accumulating evidence has demonstrated that EGCG exerts antioxidant, anti-inflammatory, antifibrotic, lipid metabolism\u0026ndash;regulating, and immunomodulatory effects, and confers protective benefits in cardiovascular diseases, diabetes, cancer, and neurodegenerative disorders\u003csup\u003e[\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Several studies have also investigated its potential in NAFLD, showing that EGCG can alleviate hepatic lipid metabolic disturbances by scavenging reactive oxygen species, enhancing mitochondrial respiration, and thereby reducing oxidative stress\u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]\u003c/sup\u003e. In addition, EGCG has been reported to modulate the composition and metabolic activity of gut microbiota, improve gut\u0026ndash;liver axis function, and further regulate hepatic lipid homeostasis by influencing bile acid synthesis and transport\u003csup\u003e[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Collectively, these findings highlight the considerable therapeutic potential of EGCG in NAFLD.\u003c/p\u003e \u003cp\u003eIn our preliminary work, analysis of publicly available databases combined with network pharmacology suggested that EGCG may also modulate the process of pyroptosis\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. Pyroptosis is an inflammation-dependent form of programmed cell death triggered by inflammasome activation, characterized by pore formation in the plasma membrane, disruption of osmotic balance, release of intracellular contents, and abundant secretion of proinflammatory cytokines such as interleukin IL-1β and IL-18\u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Previous studies have shown that a high-fat diet can activate the NLRP3 inflammasome in hepatocytes and Kupffer cells, thereby promoting lipid deposition and inflammatory responses\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e; moreover, in a murine model of non-alcoholic steatohepatitis (NASH), genetic deletion of caspase-1 significantly alleviated hepatic steatosis and inflammation\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Importantly, accumulating evidence indicates that the progression of NAFLD is accompanied by a marked increase in hepatocyte pyroptosis, which is positively correlated with dysregulated lipid metabolism\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. However, whether EGCG can attenuate NAFLD-associated pathological injury by suppressing NLRP3/caspase-1/GSDMD-mediated pyroptosis remains unknown.\u003c/p\u003e \u003cp\u003eIn summary, this study aims to establish an in vitro NAFLD cell model by treating HepG2 cells with 1% medical fat emulsion, and to systematically evaluate the effects of EGCG on cell viability, lipid accumulation, inflammatory responses, and pyroptosis. Using CCK-8 assays, flow cytometry, biochemical measurements, immunofluorescence, and molecular biology techniques, we seek to determine whether EGCG can attenuate pathological injury in the NAFLD cell model by inhibiting the canonical NLRP3/caspase-1/GSDMD pyroptosis pathway. This work will not only provide new insights into the potential molecular mechanisms of EGCG in the prevention and treatment of NAFLD but also offer a theoretical basis and experimental evidence for the development of safe and effective natural-product-based therapeutic strategies.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eCell culture\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human hepatocellular carcinoma (HCC) cell line HepG2 (CL-0103) was purchased from Wuhan Pricella Biotechnology Co., Ltd. (Wuhan, China). Cells were cultured in high-glucose Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM; C11995500BT, Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco). Cultures were maintained at 37 \u0026deg;C in a humidified atmosphere containing 5% CO2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell treatment\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWhen the cell density in 6-cm culture dishes reached approximately 70%, HepG2 cells were seeded into 96-well plates at a density of 5 \u0026times; 10\u0026sup3; cells/well in 100 \u0026mu;L of complete medium. After cell attachment, 10 \u0026mu;L of EGCG(Shanghai Macklin Biochemical Technology Co., Ltd.E885861)\u0026nbsp;at different concentrations (10, 20, 40, 80, 160, and 320 \u0026mu;M) was added to the designated wells, followed by incubation for 24 h. Subsequently, medical fat emulsion (20%) was diluted with complete medium to a final concentration of 1% and applied to the cells for 36 h. Cells were assigned to the following experimental groups: normal control (NC), model group (MD; 1% fat emulsion only), and EGCG treatment groups with low (E1), medium (E2), and high (E3) doses. At the end of the treatments, cells were collected for subsequent assays.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell viability assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell viability was assessed using a Cell Counting Kit-8 (CCK-8; MF128-02, Mei5 Biotechnology Co., Ltd., Beijing, China). HepG2 cells were treated with EGCG at various concentrations (10, 20, 40, 80, 160, and 320 \u0026mu;M) for 24 h. Subsequently, 10 \u0026mu;L of CCK-8 solution was added to each well, and the cells were incubated at 37 \u0026deg;C for 30 min. Absorbance was measured at 450 nm using a microplate reader (SpectraMax, Molecular Devices, USA). Cell viability was calculated using the following formula: [A (dosing) - A (blank)]/[A (0 dosing) - A (blank)] \u0026times; 100%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOil Red O staining\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOil Red O staining was performed to assess intracellular lipid accumulation. HepG2 cells were washed three times with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde for 30 min at room temperature, and then stained with Oil Red O working solution (Oil Red O stock solution diluted with its matching diluent at a ratio of 3:2) for 20 min in the dark at 4 \u0026deg;C. The cells were subsequently washed with 60% isopropanol to remove excess dye, followed by two washes with PBS. For quantitative analysis, stained lipid droplets were eluted with 200 \u0026mu;L of isopropanol per well (three replicate wells per group), and the optical density (OD) was measured at 490 nm using a microplate reader.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of triglycerides, total cholesterol, low-density lipoprotein, and high-density lipoprotein\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIntracellular lipid profiles were determined by commercially available assay kits (Nanjing Jiancheng Bioengineering Research Institute, Nanjing, China). Total cholesterol (TC) levels were measured using the cholesterol oxidase\u0026ndash;p-aminophenazone (COD-PAP) method (Cat. No. A111-1-1), and triglycerides (TG) were quantified using the glycerol phosphate oxidase\u0026ndash;p-aminophenazone (GPO-PAP) method (Cat. No. A110-1-1). High-density lipoprotein cholesterol (HDL-C; Cat. No. A112-1-1) and low-density lipoprotein cholesterol (LDL-C; Cat. No. A113-1-1) were measured according to the manufacturer\u0026rsquo;s protocols. All measurements were performed on HepG2 cell lysates, and absorbance was read with a microplate reader as specified in the kit instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInterleukin-18 (IL-18), a key pro-inflammatory cytokine, was quantified using a commercial ELISA kit (Jiangsu Enzyme Immunoassay Industry Co., Ltd., Jiangsu, China) according to the manufacturer\u0026rsquo;s instructions. Absorbance was measured at the wavelength specified in the kit protocol using a microplate reader, and concentrations were calculated from a standard curve.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLactate dehydrogenase (LDH) release assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLactate dehydrogenase (LDH) release was measured to evaluate the effect of EGCG on NAFLD-induced pyroptosis in HepG2 cells. LDH levels in the culture supernatant were determined using an LDH assay kit (Beyotime Biotechnology, Shanghai, China) following the manufacturer\u0026rsquo;s instructions. Absorbance was recorded at 490 nm, and LDH release was expressed as a percentage of total cellular LDH, calculated according to the kit formula.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetection of pyroptotic cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing drug treatment, cells were harvested and resuspended in PBS. FAM-YVAD-FMK (a fluorescently labeled caspase-1 inhibitor peptide; final volume 5 \u0026micro;l; Beyotime Biotechnology, Shanghai, China) was added to the cell suspension and incubated at 37 \u0026deg;C in a humidified atmosphere containing 5% CO₂ for 1 h in the dark. Cells were then centrifuged at 1000 rpm for 5 min, washed twice with 1 ml washing buffer, and resuspended in 500 \u0026micro;l washing buffer. Propidium iodide (PI) was subsequently added according to the manufacturer\u0026rsquo;s protocol. The samples were analyzed by flow cytometry (within 1 h after staining) to detect FAM-YVAD-FMK and PI signals, and the percentage of pyroptotic cells was quantified\u003csup\u003e[19,20]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransmission electron microscopy (TEM) observation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were collected and fixed in 3% glutaraldehyde at room temperature, followed by post-fixation in 1% osmium tetroxide. The samples were dehydrated sequentially in graded acetone for 2 h, embedded in Epon812 resin, and polymerized. Ultrathin sections were prepared using an ultramicrotome, stained with 4% uranyl acetate and 0.5% lead citrate, and examined under a transmission electron microscope (JEM-1400FLASH; JEOL Ltd., Tokyo, Japan) to assess mitochondrial morphology in HepG2 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMicroscopy and scanning electron microscopy (SEM) observation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate cisplatin-induced morphological changes in HepG2 cells, scanning electron microscopy (JSM-IT700HR; JEOL Ltd., Tokyo, Japan) was used to visualize pore formation associated with pyroptosis. Following drug treatment, cells were washed with PBS, fixed in 3% glutaraldehyde at 4 \u0026deg;C for 1 h, and post-fixed in 1% osmium tetroxide for 1 h. Samples were rinsed three times with distilled water, dehydrated through a graded ethanol series (30%, 50%, 70%, 80%, 90%, 95%, and 100%), and dried. The specimens were then mounted and examined under a scanning electron microscope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real-time polymerase chain reaction (qRT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted, and 1 \u0026micro;g of RNA was reverse transcribed into cDNA using a commercially available reverse transcription kit, following the manufacturer\u0026rsquo;s instructions. One microliter of cDNA was used as the template for quantitative real-time PCR (qRT-PCR) in a 10 \u0026micro;L reaction system. GAPDH served as the internal reference gene, and relative mRNA expression levels were calculated using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method. Primer sequences are listed in Table 1, the qPCR reaction system is shown in Table 2, and the qPCR cycling program is presented in Table 3.\u003c/p\u003e\n\u003cp\u003eTable 1. Primer sequence\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" align=\"\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14.6127%;\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 43.662%;\"\u003e\n \u003cp\u003eUpstream Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.7254%;\"\u003e\n \u003cp\u003eDownstream Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14.6127%;\"\u003e\n \u003cp\u003eNLRP3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 43.662%;\"\u003e\n \u003cp\u003eAGGGATGAGAGTGTTGTGTGAAACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.7254%;\"\u003e\n \u003cp\u003eGCTTCTGGTTGCTGCTGAGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14.6127%;\"\u003e\n \u003cp\u003eGSDMD\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 43.662%;\"\u003e\n \u003cp\u003eGCCTCCACAACTTCCTGACAGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.7254%;\"\u003e\n \u003cp\u003eGGTCTCCACCTCTGCCCGTAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14.6127%;\"\u003e\n \u003cp\u003eCaspase-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 43.662%;\"\u003e\n \u003cp\u003eTCCTCAGGCTCAGAAGGGAATGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.7254%;\"\u003e\n \u003cp\u003eGTGCGGCTTGACTTGTCCATTATTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14.6127%;\"\u003e\n \u003cp\u003eIL-1\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 43.662%;\"\u003e\n \u003cp\u003eGGACAGGATATGGAGCAACAAGTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.7254%;\"\u003e\n \u003cp\u003eTCATCTTTCAACACGCAGGACAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 14.6127%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 43.662%;\"\u003e\n \u003cp\u003eGGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 41.7254%;\"\u003e\n \u003cp\u003eGGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eTable 2. Real time fluorescence quantitative PCR reaction system(10\u0026mu;l)\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eReagent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eDose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eFinal Concentration\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eTB Green(2\u0026times;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e5.0\u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1\u0026times;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eForward Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e0.4\u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e10uM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eReverse Primer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e0.4\u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e10uM\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003ecDNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e1.0\u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eddH2O\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e3.2\u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003eTotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e10.0\u0026mu;l\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 33.3333%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eTable 3.Real time fluorescence quantitative PCR reaction system\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eNumber of cycles\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.1426%;\"\u003e\n \u003cp\u003eStep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eTemperature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eDuration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eDetection or not\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.1426%;\"\u003e\n \u003cp\u003ePre denaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e95℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e30sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.1426%;\"\u003e\n \u003cp\u003eDenaturation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e95℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e5sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.1426%;\"\u003e\n \u003cp\u003eAnneal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e60℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e30sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eNo\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 20.1426%;\"\u003e\n \u003cp\u003eExtension\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e72℃\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003e10sec\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 19.9643%;\"\u003e\n \u003cp\u003eYes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal protein from HepG2 cells was extracted using a commercial Protein Extraction Kit (BSC29S1; Bioer Technology, Hangzhou, China), following the manufacturer\u0026rsquo;s protocol. Equal amounts of protein were separated by SDS\u0026ndash;PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes. After transfer, the membranes were blocked with 5% non-fat milk in Tris-buffered saline with 0.1% Tween-20 (TBST) for 1 h at room temperature, and subsequently incubated overnight at 4 \u0026deg;C with the following primary antibodies: \u0026beta;-actin (Proteintech, 66009-1-Ig), NLRP3 (Abcam, ab263899), caspase-1 (Cell Signaling Technology, 4199S), and GSDMD (Cell Signaling Technology, 69469S). The membranes were then washed three times with TBST (10 min each) and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (Hangzhou Hua\u0026rsquo;an Biotechnology, HA1031) for 1 h at room temperature. Protein bands were visualized using the Tanon imaging system and quantified with the accompanying analysis software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence of GSDMD\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing treatment with EGCG for 24 h, HepG2 cells were fixed with 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.5% Triton X-100 for 20 min, and blocked with blocking buffer for 30 min. The cells were then incubated overnight at 4 \u0026deg;C with a primary antibody against gasdermin D (CST, 69469S; 1:800), followed by incubation with an IF488-conjugated secondary antibody (Hangzhou Hua\u0026rsquo;an Biotechnology Co., Ltd., HA1121; 1:500) for 1 h at room temperature. Nuclei were counterstained with 4\u0026prime;,6-diamidino-2-phenylindole (DAPI), and fluorescence images were captured using an immunofluorescence microscope (Nikon, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistics and Data Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses were performed using SPSS version 26.0 (IBM Corp., Armonk, NY, USA) and GraphPad Prism version 9.0 (GraphPad Software, San Diego, CA, USA). Data are presented as the mean \u0026plusmn; standard deviation (SD). Comparisons between two groups were conducted using an independent-samples \u003cem\u003et\u003c/em\u003e-test, while comparisons among multiple groups were analyzed using one-way analysis of variance (ANOVA) followed by Tukey post hoc tests. A \u003cem\u003ep\u003c/em\u003e-value of \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e1 EGCG enhances HepG2 cell viability and alleviates fat emulsion-induced cytotoxicity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the effects of EGCG on hepatocyte viability, we first examined its influence on HepG2 cells across a concentration gradient. As shown in Figure 1A, EGCG significantly increased cell viability at concentrations ranging from 10 to 80\u0026mu;M, with the most pronounced enhancement observed at 40\u0026mu;M (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01). However, higher concentrations (160 \u0026mu;M and above) resulted in a marked decrease in cell viability (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01), suggesting a biphasic, dose-dependent effect of EGCG on cell proliferation. We then determined the optimal exposure time for high-fat emulsion-induced cytotoxicity in HepG2 cells. Treatment with\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e1% high-fat emulsion for 12 hours did not significantly affect cell viability, whereas prolonged exposure for 36 hours led to an approximately 50% reduction in viability compared to untreated controls (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, Figure 1B), establishing 36 hours as the appropriate time point for subsequent modeling. Next, we assessed the protective effects of EGCG on high-fat emulsion-treated HepG2 cells. As expected, high-fat emulsion significantly suppressed cell viability (MD group, \u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01), whereas EGCG treatment partially reversed this suppression in a dose-dependent manner. The most robust rescue effect was observed at 40 \u0026mu;M (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, Figure 1C). These findings demonstrate that EGCG enhances HepG2 cell viability within a safe concentration range and significantly alleviates high-fat emulsion-induced cellular damage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2 EGCG suppresses lipid accumulation and lipoprotein dysregulation induced by high-fat emulsion in HepG2 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo assess the effects of EGCG on lipid accumulation and lipoprotein production under high-fat emulsion stimulation, Oil Red O staining was performed. As shown in Figure 2A, a large number of red-stained lipid droplets of varying sizes were observed throughout the cytoplasm in MD group, indicating significant intracellular lipid deposition. In contrast, EGCG treatment markedly reduced lipid droplet formation in a dose-dependent manner. Quantitative analysis further revealed that exposure to fat emulsion significantly increased the levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein (LDL), and high-density lipoprotein (HDL) in HepG2 cells (Figure 2B\u0026ndash;F, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). EGCG administration effectively reduced the elevated TC, TG, and LDL levels, and notably reversed the abnormal increase in HDL toward baseline levels observed in the control group. These findings suggest that EGCG attenuates high-fat emulsion-induced steatosis by suppressing intracellular lipid accumulation and correcting lipoprotein imbalances.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3 EGCG attenuates high-fat emulsion induced inflammatory cytokine expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eqPCR analysis revealed that exposure to high-fat emulsion markedly increased IL-1\u0026beta; and IL-18 transcripts in HepG2 cells. EGCG treatment reduced the mRNA levels of both cytokines in a dose-dependent manner, with the most pronounced suppression observed at 40\u0026mu;M (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 versus MD,Figure 3D). Consistent with these findings, western blot demonstrated a substantial increase in total and cleaved IL-1\u0026beta; protein in the MD, and ELISA confirmed elevated IL-18 secretion. EGCG effectively reversed these changes: at 40\u0026mu;M, the abundance of IL-1\u0026beta; and IL-18 returned to near-baseline values (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 Figure 3A-C;Figure 3E), whereas a moderate reduction was evident at 20\u0026mu;M and a minimal effect at 10\u0026mu;M. Collectively, these data indicate that EGCG exerts a potent anti-inflammatory effect against high-fat emulsion-induced injury.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4 EGCG ameliorates high-fat emulsion induced ultrastructural damage in HepG2 cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eScanning electron microscopy revealed that 36h exposure to high-fat emulsion caused extensive ultrastructural lesions characteristic of pyroptosis: abundant membrane pores of heterogeneous diameter, pronounced membrane blebbing and overt cellular swelling (Figure4A). EGCG markedly mitigated these defects in a concentration-dependent manner. At 10\u0026mu;M the number of pores and blebs was partially reduced; 20\u0026mu;M further decreased membrane protrusions; and 40\u0026mu;M almost completely restored a smooth, continuous plasma membrane with a regular cellular outline and no detectable swelling. Transmission electron microscopy further corroborated these findings (Figure 4B). HepG2 cells exposed to high-fat emulsion displayed prominent pyroptotic ultrastructural alterations, including swollen mitochondria with disrupted cristae, cytoplasmic vacuolization, and nuclear chromatin condensation. Treatment with EGCG alleviated these injuries in a dose-dependent manner: 10\u0026mu;M partially preserved mitochondrial morphology and reduced vacuole formation; 20\u0026mu;M further restored mitochondrial integrity and decreased cytoplasmic vacuoles; while 40\u0026mu;M nearly normalized subcellular architecture, showing intact mitochondria, continuous nuclear membranes, and markedly diminished pyroptotic features.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e5 EGCG attenuates high-fat emulsion induced pyroptosis via suppression of the NLRP3/caspase1/GADMD axis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFlow-cytometric analysis of active caspase-1/PI dual-positive cells revealed a pronounced increase in pyroptosis after 36 h exposure to 1 % fat emulsion (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; Fig. 5A). EGCG mitigated this effect in a concentration-dependent fashion, reducing the pyroptotic fraction to 17.9 %, 12.9% and 10.30% at 10, 20 and 40 \u0026micro;M, respectively (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01 vs. MD). Consistent with the cytometric findings, extracellular LDH activity was markedly elevated in the MD group and progressively lowered by EGCG, with maximal suppression at 40 \u0026micro;M (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01; Fig. 5B). Immunofluorescence corroborated these observations: robust membrane translocation of GSDMD was evident after fat-emulsion treatment, whereas 40 \u0026micro;M EGCG almost completely abolished the GSDMD signal (Fig. 5C).\u003c/p\u003e\n\u003cp\u003eAt the transcriptional level, high-fat emulsion up-regulated mRNA expression of NLRP3, GSDMD (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). EGCG dose-dependently suppressed the induction of all three genes and restored their expression to near-baseline values at 40 \u0026micro;M (Fig. 6A\u0026ndash;C). These changes were mirrored at the protein level: the MD group showed marked accumulation of NLRP3, GSDMD-N, pro-caspase-1 and cleaved caspase-1, whereas EGCG sharply attenuated each of these increases, again with greatest efficacy at 40 \u0026micro;M (Fig. 6D, 6E\u0026ndash;H).\u003c/p\u003e\n\u003cp\u003eCollectively, the data demonstrate that EGCG confers potent protection against fat-emulsion\u0026ndash;induced pyroptosis in HepG2 cells, an effect closely associated with inhibition of the canonical NLRP3/caspase-1/GSDMD signaling pathway.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, we successfully established an in vitro NAFLD model in HepG2 cells by treatment with 1% medical high-fat emulsion, which induced marked lipid accumulation and activation of the canonical pyroptotic pathway\u003csup\u003e[21]\u003c/sup\u003e. Our data demonstrated that stimulation with EGCG markedly alleviated lipid deposition, suppressed pyroptosis, and downregulated the expression of the NLRP3/Caspase-1/GSDMD signaling axis. These findings suggest that EGCG may exert protective effects against the progression of NAFLD, at least in part, by inhibiting inflammasome-mediated pyroptosis\u003csup\u003e[22]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eNAFLD is pathologically characterized by hepatic steatosis and may progress to non-alcoholic steatohepatitis (NASH), a process closely associated with chronic hepatic inflammation\u003csup\u003e[23]\u003c/sup\u003e. Increasing evidence indicates that pyroptosis plays a critical role in the initiation and maintenance of this inflammatory microenvironment\u003csup\u003e[24]\u003c/sup\u003e. Upon pyroptotic activation, the NLRP3 inflammasome promotes the cleavage of pro-caspase-1 into its active form, which in turn facilitates the maturation and secretion of IL-18 and IL-1\u0026beta;, and drives GSDMD-mediated membrane pore formation\u003csup\u003e[25]\u003c/sup\u003e. These events synergistically lead to hepatocellular swelling, membrane rupture, and the release of inflammatory mediators, thereby amplifying both local and systemic inflammation. In our \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003emodel, high-fat emulsion exposure significantly induced lipid accumulation and steatosis in HepG2 cells, accompanied by robust upregulation of NLRP3, Caspase-1, and GSDMD at both mRNA and protein levels, as well as increased secretion of IL-1\u0026beta; and IL-18. These findings are consistent with previous \u003cem\u003ein vivo\u003c/em\u003e studies in NAFLD models reporting elevated GSDMD expression in liver tissues, further supporting the notion that activation of the NLRP3/Caspase-1/GSDMD axis contributes to hepatic lipid accumulation and inflammation\u003csup\u003e[26]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eEGCG, the most abundant catechin in green tea, possesses potent antioxidant, anti-inflammatory, and metabolic regulatory activities\u003csup\u003e[27]\u003c/sup\u003e. Previous studies have reported its hepatoprotective effects in diverse liver injury models, including alcoholic liver disease, immune-mediated liver injury, and metabolic syndrome-related hepatic damage\u003csup\u003e[28]\u003c/sup\u003e. Our findings extend these observations by showing that EGCG suppresses lipid accumulation and attenuates pyroptosis in hepatocytes under lipotoxic stress. Mechanistically, EGCG treatment reduced NLRP3, Caspase-1, and GSDMD expression, lowered LDH release, and diminished IL-1\u0026beta; and IL-18 secretion, suggesting inhibition of the canonical pyroptotic cascade\u003csup\u003e[29]\u003c/sup\u003e. While the direct molecular targets remain to be elucidated, EGCG has been shown to modulate upstream regulators such as ROS production, NF-\u0026kappa;B signaling, and AMP-activated protein kinase (AMPK), all of which may converge on NLRP3 inflammasome activation\u003csup\u003e[30]\u003c/sup\u003e. Further studies involving specific inhibitors or gene silencing are warranted to confirm these mechanistic links.\u003c/p\u003e\n\u003cp\u003eIn this study, we for the first time, employed a medical high-fat emulsion\u0026ndash;induced \u003cem\u003ein vitro\u003c/em\u003e NAFLD model. Although high-fat emulsion has been predominantly applied \u003cem\u003ein vivo\u003c/em\u003e, we found that diluting a 20% fat emulsion to 1% was sufficient to induce steatosis and pyroptosis in HepG2 cells. Notably, EGCG treatment ameliorated both the morphological and biochemical alterations associated with pyroptosis induced by the 1% high-fat emulsion\u003csup\u003e[31]\u003c/sup\u003e. This was evidenced by a reduction in membrane pore formation observed under scanning electron microscopy and decreased membrane localization of GSDMD as detected by immunofluorescence. These findings are in line with previous reports showing that suppression of hepatocyte pyroptosis not only alleviates inflammatory injury but also reduces lipid accumulation, highlighting the bidirectional interplay between metabolic stress and inflammatory cell death\u003csup\u003e[32]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eSeveral limitations should be acknowledged in the present study. First, the experiments were conducted exclusively in HepG2 cells, which may not fully recapitulate the complex cellular and metabolic interactions in the liver \u003cem\u003ein vivo\u003c/em\u003e. Second, while the medical high-fat emulsion\u0026ndash;based model is reproducible, it may not completely mimic the long-term dietary and metabolic milieu of NAFLD\u003csup\u003e[33]\u003c/sup\u003e. Third, the precise upstream signaling events by which EGCG suppresses NLRP3 activation remain to be elucidated. Future studies should employ NAFLD animal models to validate our findings and utilize molecular interventions\u0026mdash;such as siRNA-mediated knockdown or CRISPR/Cas9 genome editing\u0026mdash;to clarify the causal role of NLRP3/Caspase-1/GSDMD inhibition in the hepatoprotective effects of EGCG\u003csup\u003e[34]\u003c/sup\u003e. Furthermore, investigating the pharmacokinetics and bioavailability of EGCG will be essential for facilitating clinical translation\u003csup\u003e[35]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn summary, our study demonstrates that EGCG alleviates lipid accumulation and suppresses pyroptosis in an in vitro NAFLD model, at least in part by inhibiting the canonical NLRP3\u0026ndash;Caspase-1\u0026ndash;GSDMD pathway\u003csup\u003e[36]\u003c/sup\u003e. These findings provide mechanistic insight into the hepatoprotective actions of EGCG and suggest its potential as a therapeutic candidate for preventing NAFLD progression.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e Z.Q and S.Y was involved in the study concepts. Z.Q, M.D.Tand Y.K.L were involved in the study design. J.X, Z.Y.L, K.J.Y, Y. E.J, L.H.T, L.L, G. J.W, L.Z.R, L.H, were involved in the experiments.M.D.T and Y.K.L was involved in the original manuscript. M.D.T was involved in the data analysis.All authors contributed to the article and approved the submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e This current research was supported by the Sichuan Provincial Administration of Traditional Chinese Medicine (2023MS563) and Scientific Research and Development Fund project of North Sichuan Medical College(CBY24-QNA14);Strategic Cooperation Project of Nanchong City(22SXQT0129);Affiliated Hospital of North Sichuan Medical College Project(2024OPTZK012);Medical Imaging Key Laborary of Province(MIKL202402);Sichuan Hospital Association Youth Pharmacist Research Special Fund(YP2202424);National Undergraduate Innovation and Entrepreneurship Project(202210634181);Sichuan Undergraduate Innovation and Entrepreneurship Project(202410634081)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u0026nbsp; The authors declare no competing interests.\u003cbr\u003e\u0026nbsp;\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u0026nbsp;Younossi ZM, Koenig AB, Abdelatif D, Fazel Y, Henry L , Wymer M,et al. Global Epidemiology of Nonalcoholic Fatty Liver disease-Meta-analytic Assessment of prevalence, incidence, and Outcomes. Hepatology 2016\u0026nbsp;\u003cstrong\u003e64\u003c/strong\u003e 73\u0026ndash;84.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Duseja A , Chalasani N. Epidemiology and risk factors of nonalcoholic fatty liver disease (NAFLD). Hepatology International 2013\u0026nbsp;\u003cstrong\u003e7\u003c/strong\u003e 755\u0026ndash;64.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Teng M, Cheng Han Ng, Huang DQ, En Chan K, Jun D ,Wen Kwang Lim,et al. Global incidence and prevalence of nonalcoholic fatty liver disease. Clinical and Molecular Hepatology 2022\u0026nbsp;\u003cstrong\u003e29\u003c/strong\u003e S32\u0026ndash;42.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Sanyal AJ. Past, present and future perspectives in nonalcoholic fatty liver disease. Nature Reviews Gastroenterology \u0026amp; Hepatology 2019\u0026nbsp;\u003cstrong\u003e16\u003c/strong\u003e 377\u0026ndash;86.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp; Maurice J , Manousou P. Non-alcoholic fatty liver disease. Clinical Medicine 2018\u0026nbsp;\u003cstrong\u003e18\u003c/strong\u003e 245\u0026ndash;50.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Yu L, Hong W, Lu S, Li Y, Guan Y, Weng X, et al. The NLRP3 Inflammasome in Non-Alcoholic Fatty Liver Disease and Steatohepatitis: Therapeutic Targets and Treatment. Frontiers in Pharmacology 2022 13.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Colak Y, Hasan B, Banu Erkalma, Tandon K, Zervos X, Menzo EL, et al. Pathogenetic mechanisms of nonalcoholic fatty liver disease and inhibition of the inflammasome as a new therapeutic target. Clinics and Research in Hepatology and Gastroenterology 2021\u0026nbsp;\u003cstrong\u003e45\u003c/strong\u003e 101710\u0026ndash;0.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Capasso L, Masi LD, Sirignano C, Maresca V, Basile A, Nebbioso A, et al. Epigallocatechin Gallate (EGCG): Pharmacological Properties, Biological Activities and Therapeutic Potential. Molecules 2025\u0026nbsp;\u003cstrong\u003e30\u003c/strong\u003e 654\u0026ndash;4.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Gui L, Wang F, Hu X, Liu X, Yang H, Cai Z, et al. Epigallocatechin Gallate Protects Diabetes Mellitus Rats Complicated with Cardiomyopathy through TGF-\u0026beta;1/JNK Signaling Pathway. Current Pharmaceutical Design 2022\u0026nbsp;\u003cstrong\u003e28\u003c/strong\u003e 2758\u0026ndash;70.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Karimi-Shahri M, Alalikhan A, hashemian P, Hashemzadeh A, Javid DrH. The applications of epigallocatechin gallate (EGCG)-nanogold conjugate in cancer therapy. Nanotechnology 2022.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Sergi CM. Epigallocatechin gallate for Parkinson\u0026rsquo;s disease. Clinical and Experimental Pharmacology \u0026amp; Physiology 2022\u003cstrong\u003e\u0026nbsp;49\u0026nbsp;\u003c/strong\u003e1029\u0026ndash;41.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Yang M, Yan R, Sha R, Wang X, Zhou S, Li B, et al. Epigallocatechin gallate alleviates Non-alcoholic fatty liver disease through the inhibition of the expression and activity of Dipeptide kinase 4. Clinical Nutrition 2024 43 1769\u0026ndash;80.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp; Zuo G, Chen M, Zuo Y, Liu F, Yang Y, Li J, et al. Tea Polyphenol Epigallocatechin Gallate Protects Against Nonalcoholic Fatty Liver Disease and Associated Endotoxemia in Rats via Modulating Gut Microbiota Dysbiosis and Alleviating Intestinal Barrier Dysfunction and Related Inflammation. Journal of Agricultural and Food Chemistry 2024.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Mao D, Guo J, Yang K, Yang F, Peng J, Jia X, et al. Mechanism of epigallocatechin gallate in treating non-alcoholic fatty liver disease: Insights from network pharmacology and experimental validation. Biochemical and Biophysical Research Communications 2024\u0026nbsp;\u003cstrong\u003e734\u003c/strong\u003e 150424.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Rao Z, Zhu Y, Yang P, Chen Z, Xia Y, Qiao C, et al. Pyroptosis in inflammatory diseases and cancer. Theranostics 2022\u0026nbsp;\u003cstrong\u003e12\u0026nbsp;\u003c/strong\u003e4310\u0026ndash;29.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Thornton P, Reader V, Digby Z, Smolak P, Lindsay N, Harrison D, et al. Reversal of High Fat Diet-Induced Obesity, Systemic Inflammation, and Astrogliosis by the NLRP3 Inflammasome Inhibitors NT-0249 and NT-0796. The Journal of Pharmacology and Experimental Therapeutics 2024\u0026nbsp;\u003cstrong\u003e388\u003c/strong\u003e 813\u0026ndash;26.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Feng Y, Li W, Wang Z, Zhang R, Li Y, Zang L, et al. The p-STAT3/ANXA2 axis promotes caspase-1-mediated hepatocyte pyroptosis in non-alcoholic steatohepatitis. Journal of Translational Medicine 2022 20.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Koh EH, Yoon JE, Ko MS, Jaechan Leem, Yun J-Y, Hong CH, et al. Sphingomyelin synthase 1 mediates hepatocyte pyroptosis to trigger non-alcoholic steatohepatitis. Gut 2020\u0026nbsp;\u003cstrong\u003e70\u003c/strong\u003e 1954\u0026ndash;64.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Manohar SM, Shah P, Nair A. Flow cytometry: principles, Applications and Recent Advances. Bioanalysis 2021\u0026nbsp;\u003cstrong\u003e13\u003c/strong\u003e 185\u0026ndash;203.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Xu Y, Chu Y, Yang W, Chu K, Li S, Guo L. BML-111 inhibit H2O2-induced pyroptosis and osteogenic dysfunction of human periodontal ligament fibroblasts by activating the Nrf2/HO-1 pathway. BMC Oral Health 2024 24.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Li J, Wang T, Liu P, Yang F, Wang X, Zheng W, et al. Hesperetin ameliorates hepatic oxidative stress and inflammation via the PI3K/AKT-Nrf2-ARE pathway in oleic acid-induced HepG2 cells and a rat model of high-fat diet-induced NAFLD. Food \u0026amp; Function 2021\u0026nbsp;\u003cstrong\u003e12\u003c/strong\u003e 3898\u0026ndash;918.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Zhang Y, Li J, Wang Z, Chen J, Zhao M, Guo C, et al. Preclinical evidence construction for epigallocatechin-3-gallate against non-alcoholic fatty liver disease: a meta-analysis and machine learning study. Phytomedicine 2025 156651\u0026ndash;1. \u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Paternostro R, Trauner M. Current treatment of non‐alcoholic fatty liver disease. Journal of Internal Medicine 2022\u0026nbsp;\u003cstrong\u003e292\u003c/strong\u003e 190\u0026ndash;204.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Du T, Gao J, Li P, Wang Y, Qi Q, Liu X, et al. Pyroptosis, metabolism, and tumor immune microenvironment. Clinical and Translational Medicine 2021 11.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Li L-R, Chen L, Sun Z-J. Igniting hope: Harnessing NLRP3 inflammasome-GSDMD-mediated pyroptosis for cancer immunotherapy. Life Sciences 2024\u0026nbsp;\u003cstrong\u003e354\u0026nbsp;\u003c/strong\u003e122951\u0026ndash;1.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Luo R, Hu Y, Wang L, Ke Z, Wang W, Wang P, et al. Penthorum chinense Pursh extract ameliorates hepatic steatosis by suppressing pyroptosis via the NLRP3/Caspase‐1/GSDMD pathway. Food Science \u0026amp; Nutrition 2024\u0026nbsp;\u003cstrong\u003e12\u0026nbsp;\u003c/strong\u003e5176\u0026ndash;87.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Mehmood S, Maqsood M, Nazia Mahtab, Muhammad Issa Khan, Sahar A, Sania Zaib, et al. Epigallocatechin gallate: Phytochemistry, bioavailability, utilization challenges, and strategies 2022 46.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Hiba Siblini, Ayman Al-Hendy, Segars J, Gonz\u0026aacute;lez F, Taylor HS, Singh B, et al. Assessing the Hepatic Safety of Epigallocatechin Gallate (EGCG) in Reproductive-Aged Women. Nutrients 2023\u0026nbsp;\u003cstrong\u003e15\u003c/strong\u003e 320\u0026ndash;0.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Bao B, Yin X-P, Wen X-Q, Suo Y-J, Chen Z-Y, Li DL, et al. The protective effects of EGCG was associated with HO-1 active and microglia pyroptosis inhibition in experimental intracerebral hemorrhage. Neurochemistry International 2023\u0026nbsp;\u003cstrong\u003e170\u0026nbsp;\u003c/strong\u003e105603\u0026ndash;3.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Xiao Y, Yang C, Si N, Chu T, Yu J, Yuan X, et al. Epigallocatechin-3-gallate Inhibits LPS/A\u0026beta;O-induced Neuroinflammation in BV2 Cells through Regulating the ROS/TXNIP/NLRP3 Pathway. Journal of Neuroimmune Pharmacology 2024 19.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Zhang J, Wang S, Zhang T, Zi M, Wang S, Zhang Q. Green tea epigallocatechin gallate attenuate metabolic dysfunction-associated steatotic liver disease by regulation of pyroptosis. Lipids in Health and Disease 2025 24.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Gaul S, Leszczynska A, Alegre F, Kaufmann B, Johnson CD, Adams LA, et al. Hepatocyte pyroptosis and release of inflammasome particles induce stellate cell activation and liver fibrosis. Journal of Hepatology 2021\u0026nbsp;\u003cstrong\u003e74\u003c/strong\u003e 156\u0026ndash;67.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Pouwels S, Sakran N, Graham Y, Leal A, Pintar T, Yang W, et al. Non-alcoholic fatty liver disease (NAFLD): a review of pathophysiology, clinical management and effects of weight loss. BMC Endocrine Disorders 2022 22.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Mandala A, Janssen RC, Palle S, Short KR, Friedman JE. Pediatric Non-Alcoholic Fatty Liver Disease: Nutritional Origins and Potential Molecular Mechanisms. Nutrients 2020\u0026nbsp;\u003cstrong\u003e12\u003c/strong\u003e E3166.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Revathy Sahadevan, Singh S, Anupama Binoy, Sushabhan Sadhukhan. Chemico-biological aspects of(\u0026minus;)-epigallocatechin-3-gallate (EGCG) to improve its stability, bioavailability and membrane permeability: Current status and future prospects. Critical Reviews in Food Science and Nutrition 2022 1\u0026ndash;30.\u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Liu Z, Wang M, Wang X, Bu Q, Wang Q, Su W, et al. XBP1 deficiency promotes hepatocyte pyroptosis by impairing mitophagy to activate mtDNA-cGAS-STING signaling in macrophages during acute liver injury. Redox Biology 2022\u0026nbsp;\u003cstrong\u003e52\u003c/strong\u003e 102305.\u0026nbsp;\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Epigallocatechin gallate, NAFLD, pyroptosis, GSDMD","lastPublishedDoi":"10.21203/rs.3.rs-8314367/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8314367/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eTo investigate the role of the pyroptosis pathway in high-fat emulsion\u0026ndash;induced injury of HepG2 cells and to evaluate the protective effect of epigallocatechin gallate (EGCG).\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eAn \u003cem\u003ein vitro\u003c/em\u003e NAFLD model was established by exposing HepG2 cells to a high-fat emulsion, followed by treatment with varying concentrations of EGCG. Anti-NAFLD effects were assessed by evaluating cell viability, lipid accumulation, lipoprotein levels, inflammatory cytokines, and LDH release. The underlying mechanism was explored using flow cytometry, transmission electron microscopy, scanning electron microscopy, RT-PCR, Western blotting, and immunofluorescence.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eEGCG treatment markedly improved cell viability, reduced lipid accumulation, normalized lipoprotein profiles, and decreased inflammatory cytokine levels and LDH release. EGCG also ameliorated morphological and biochemical features of high-fat emulsion\u0026ndash;induced pyroptosis, lowering the proportion of pyroptotic cells. Furthermore, EGCG significantly downregulated the mRNA and protein expression of NLRP3, Caspase-1, and GSDMD, reduced fluorescence intensity, and diminished GSDMD localization to the plasma membrane.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eHigh-fat emulsion induces HepG2 cell pyroptosis via the NLRP3\u0026ndash;Caspase-1\u0026ndash;GSDMD pathway. EGCG attenuates lipid deposition and pyroptosis in this model, potentially through inhibition of the classical NLRP3\u0026ndash;Caspase-1\u0026ndash;GSDMD signaling axis.\u003c/p\u003e","manuscriptTitle":"Epigallocatechin Gallate Attenuates High-Fat Emulsion–Induced Pyroptosis in HepG2 Cells by Inhibiting the NLRP3–Caspase-1–GSDMD Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-19 19:27:25","doi":"10.21203/rs.3.rs-8314367/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-01-27T20:49:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"318012809758861862891560711550832848774","date":"2026-01-16T13:15:28+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-14T13:07:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-14T12:57:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-12-29T18:54:38+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-27T02:46:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-12-27T02:40:52+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cc915f24-96c9-4313-abd8-ef7d6dfac851","owner":[],"postedDate":"January 19th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":61251597,"name":"Biological sciences/Biochemistry"},{"id":61251598,"name":"Biological sciences/Cell biology"},{"id":61251599,"name":"Health sciences/Diseases"},{"id":61251600,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-01-19T19:27:25+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-19 19:27:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8314367","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8314367","identity":"rs-8314367","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00