Presence of non-regulated Elsinoë species on citrus fruits and their impact on regulatory plant health diagnostics

Presence of non-regulated Elsinoë species on citrus fruits and their impact on regulatory plant health diagnostics | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Presence of non-regulated Elsinoë species on citrus fruits and their impact on regulatory plant health diagnostics Bart van de Vossenberg, Valerie A. van Ingen-Buijs, Ashleigh J. Elliott, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6631223/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Dec, 2025 Read the published version in European Journal of Plant Pathology → Version 1 posted 5 You are reading this latest preprint version Abstract Citrus fruits such as oranges, lemons, limes, grapefruits, and tangerines are economically significant crops worldwide. The EU is a net importer of citrus fruits to meet consumer demand, with the Netherlands functioning as a key distribution hub. Citrus fruit imports may pose a risk to EU production, particularly through the introduction of regulated plant pathogens. Considering that only the three regulated Elsinoë species were known to occur on citrus fruits, the diagnosis of the regulated Elsinoë species in the Netherlands was based on a genus-level real-time PCR detection combined with symptom analysis, host plant species, and origin of the fruits. Import samples originating from countries where none of the regulated species are known to occur, as well as samples exhibiting late Elsinoë spp. Cq values, raised questions regarding the presumed host specificity of Elsinoë species. Metabarcoding was performed in an attempt to determine presence of the (regulated) Elsinoë species in symptomatic citrus samples from Asia, Africa, Europe and South America, representing nine countries and five hosts. Surprisingly, the ITS1 barcode revealed the presence of non-regulated Elsinoë species on symptomatic fruits. In some consignments presence of several different species was observed. Symptoms typically associated with E. fawcettii and E. australis were observed on fruits in which only non-regulated Elsinoë spp. were detected. This further underlines the limitations to distinguish the regulated Elsinoë species from other organisms based on symptomology. The occurrence of non-regulated Elsinoë species on citrus fruit prevents accurate diagnosis of regulated pests following a positive genus-level test. Culturing and identification of the non-regulated species on citrus fruits is needed. Additionally, broader validation of alternative diagnostic tests is required to demonstrate their ability to distinguish regulated pathogens from non-regulated Elsinoë species on citrus fruits. metabarcoding citrus ITS1 High Throughput Sequencing Figures Figure 1 Figure 2 Figure 3 Introduction Citrus fruits, including oranges, lemons, limes, grapefruits, and tangerines, are economically valuable crops globally and within Europe. In 2023–2024, Europe produced approximately 10.5 million metric tons of citrus fruits, with Mediterranean countries leading this production. Spain and Italy are the foremost producers, followed by Greece, Portugal, and Cyprus. The European Union (EU) is a net importer of citrus fruits, with imports exceeding exports in order to meet consumer demand (Guerrero, 2024 ). The Netherlands serves as a central hub for the import of citrus fruits into the EU. In 2023, the Netherlands ranked fourth in world import for citrus fruits (fresh or dried) with 6.8% of all imports. South Africa, Egypt and Brazil represent the top three countries exporting citrus fruits to the Netherlands ( https://www.trademap.org , accessed 26 March 2025). Citrus fruit imports pose risks for EU citrus production, notably the introduction of regulated pathogens such as the bacterium Xanthomonas citri subsp. c itri or the fungi Phyllosticta citricarpa , Elsinoë fawcettii , E. australis and E. citricola (EU, 2016 , EFSA, 2017 , Pham et al., 2025 ). For instance, over 50% of imported citrus consignments originate from countries where at least one of the regulated Elsinoë species is present (S-table 1). To prevent the introduction and potential establishment of regulated pathogens in European orchards, border controls are conducted and diagnostic tests are carried out on symptomatic fruits that may indicate the presence of regulated plant pests. The regulated Elsinoë species cause scab on citrus, with E. fawcettii producing thick, warty, irregular lesions, while E. australis causes larger, flatter, and smoother lesions with less irregularity. Imported fruits with scab lesions are sampled for further testing as symptomatology alone cannot provide a reliable diagnosis. Other pests, such as X. citri subsp. c itri and Diaporthe citri , as well as mite and abiotic damage (e.g. rub scratches caused by wind) are known to produce similar symptoms (EPPO/OEPP, 2025b , EPPO/OEPP, 2025a ). In the Netherlands, molecular testing was performed with an Elsinoë spp. genus-specific real-time PCR (Elliott et al., 2023 ), which targets 18S ribosomal DNA (rDNA) and internal transcribed spacer 1 (ITS1) sequences. Since only the three regulated Elsinoë species were known to infect citrus fruits (Elliott et al., 2023 , Fan et al., 2017 ), a positive genus-level detection, in conjunction with an analysis of symptomatology, host plant species, and fruit origin, was used for the detection of regulated Elsinoë species on citrus. However, during routine testing, samples from Spain, where none of the regulated Elsinoë species are known to occur, and samples with late Elsinoë spp. real-time PCR Cq values were observed. These cases were regarded critical and required test confirmation (EPPO/OEPP, 2024 ). Since Elsinoë spp. are challenging to isolate from citrus fruits and exhibit slow growth (reference), confirming the presence of suspected pests through sequencing of cultured fungal strains was regarded unfeasible. Therefore we aimed to verify the presence of regulated Elsinoë species in symptomatic plant material testing positive for Elsinoë spp. with a metabarcoding approach targeting the species-specific elongation factor 1 alpha ( EF1α ) and the rDNA locus that offer less resolution. Using the EF1α barcode proved to be too challenging on account of non-specific amplification and inconclusive results were obtained. With the ITS1 barcode however, presence of Elsinoë species other than the regulated ones was observed. The occurrence of non-regulated Elsinoë species on citrus fruits complicates the diagnosis of regulated Elsinoë species. It necessitates the isolation and identification of the non-regulated species, as well as extended validation of diagnostic assays, given that test exclusivity must account not only for other citrus pathogens but also for closely related non-regulated Elsinoë species. Material and methods Sample selection DNAs extracted from symptomatic citrus samples taken at routine phytosanitary inspections between September 2022 and July 2024 were considered for metabarcoding. Initially, samples with average Cq values ranging from 23.8 to 38.5 and two negatives for the Elliott assay were selected (n = 26), but later on samples with Cq ≤ 27.5 (n = 27) were selected to maximize the success of obtaining reliable Elsinoë spp. consensus sequences. In total, 53 DNA extracts were included from 40 consignments representing five hosts ( Citrus hystrix , Citrus limon , Citrus maxima , Citrus sinensis , Citrus x latifolia ) and nine exporting countries (Brazil, Colombia, Indonesia, Peru, South Africa, Spain, Thailand, Vietnam, Zimbabwe). An overview of selected samples and relevant associated data is listed in S-table 2. DNA extraction and Elsinoë spp. detection Up to 100 mg of symptomatic citrus fruit was added to an Eppendorf tube containing 300 µl of extraction buffer (0.02 M PBS + 0.05% Tween + 2% PVP + 0.2% BSA) and a single 3.2-mm stainless steel bead. Material was homogenized with a MM301 mixer mill (Retsch, Haan, Germany) for 80 s on 30 beats/s. The homogenized material (75 µl) was processed using the QuickPick Plant DNA kit (Bio-Nobile, Pargas, Finland) on a KingFisher Flex 96 (Thermo Fisher Scientific, Waltham, MA, United States) following the manufacturer's instructions. To detect Elsinoë spp. DNA in the nucleic acid extracts, real-time PCR reactions described by Elliott et al. ( 2023 ) were performed using the iTaq Supermix (Bio-Rad, Hercules, CA, United States), 0.3 µM of each primer (Table 1 ), 0.1 µM of each probe (Table 1 ), and 2 µl of template DNA. Molecular grade water (MGW) was added to reach a final volume of 25 µl. Triplex real-time PCR reactions ( Elsinoë A, Elsinoë B (Elliott et al., 2023 ), and the 18S rDNA internal control (Ioos et al., 2009 )) were performed in a CFX Opus 96 (Bio-Rad) using the following thermocycler conditions: 2 min 95°C, 40x (15 s 95°C, 1 min 60°C). Samples producing Cq values < 40 and exponential amplification curves were regarded positive. During each thermocycler run, a negative amplification control (MGW) and two positive amplification controls (10 ng/µl and 0.1 ng/µl of E. fawcettii (CBS 233.64) DNA) were included. Table 1 Oligonucleotides used in this study. Test Target Name Sequence 5’ – 3’ Author Elliott et al. real-time PCR Elsinoë spp. Els A_fw CTGCGGAAGGATCATTAACGA Elliott et al. 2023 Els A_rv CGCCGAAGCAACGTGATT Elliott et al. 2023 Els B_fw CCGAAAGGAGCCCGAACT Elliott et al. 2023 Els B_rv CCGCCGAAGCAACAGATT Elliott et al. 2023 Elsinoe_pr [FAM]-CCCACCCTTTGCTG-[BHQ1] Elliott et al. 2023 18S internal control 18S uni-F GCAAGGCTGAAACTTAAAGGAA Ioos et al. 2009 18S uni-R CCACCACCCATAGAATCAAGA Ioos et al. 2009 18S uni-P [VIC]-ACGGAAGGGCACCACCAGGAGT-[BHQ1] Ioos et al. 2009 metabarcoding PCR ITS barcode ITS5 GGAAGTAAAAGTCGTAACAAGG White et al. 1990 ITS4 TCCTCCGCTTATTGATATGC White et al. 1990 Ribosomal DNA amplification and sequencing Total DNA extracted from samples selected for metabarcoding were subjected to conventional PCR amplification of the rDNA barcode (partial 18S, ITS1, 5.8S, ITS2 and partial 28S) with primers ITS4 and ITS5 (White et al., 1990 ), Table 1 ). Reaction mixes were based on the MyFi Mix (Bioline, United Kingdom) containing 0.2 µM of each primer, 2 µl of template DNA and MGW to reach a final volume of 25 µl. Reactions were performed in a C1000 (Bio-Rad) using the following thermocycler conditions: 5 min 95°C, 40x (30 s 94°C, 30 s 52°C, 1 min 40 s 72°C), 10 min 72°C. PCR products were visualized in a 1.5% agarose gel-electrophoresis (RESULT LE General Purpose (BIOzymTC, the Netherlands)) and SYBR-safe (Life Technologies, CA, USA) staining. Reactions producing visible PCR products of approximately 500 to 1000 bp were used for Illumina short-read sequencing. The Illumina DNA Prep Tagmentation kit (Illumina, CA, USA) was used according to the manufacturer’s specifications to generate Illumina-ready libraries. Illumina Unique Dual Indexes were used for indexing. A total of five amplification cycles were performed during the library generation step. Library yields were quality assessed by fluorescence on a Qubit 4.0 fluorometer (Thermo Fisher Scientific, MA, USA ), and correct insert sizes were verified using D1000 ScreenTape on a TapeStation 4200 system (Agilent Technologies, CA, USA). Amplicon libraries were equimolarly pooled over four individual sequencing runs. Paired-end requencing reads were generated using 300-cycle P1 cartridge and flow cell combinations on a NextSeq 2000 system (Illumina, CA, USA). Datasets yielded at least 200 megabases (Mb) per sample. The Illumina metabarcoding sequence data were submitted to NCBI Sequence Read Archive under project accession PRJNA1244768 (BioSample SAMN477679 through SAMN47730731). Bio-informatic analysis To identify Elsinoë ITS1 sequences from the metabarcoding datasets, reads were analysed with a custom pipeline in CLC genomics workbench v24.01 (Qiagen, Germany). Reads were quality trimmed (quality limit = 0.05; max ambiguities = 2; auto adapter trimming = on; trim 3’homopolymers = all) and stringently mapped (length fraction = 0.9; similarity fraction = 0.995) to unique ITS1 sequences from a phylogenetic study by Fan et al. ( 2017 ) (S-file 1, S-table 3). Consensus sequences were extracted from the read mappings with removal of low coverage regions (≤ 10x coverage). These sequences were analysed using BLAST (megablast; E-value = 0.001; minimum percentage identity = 90%; low complexity filter enabled) against a locally installed copy of the NCBI nucleotide collection (nr/nt). BLAST results were visualized using Krona (Ondov et al., 2011 ). Custom BLAST and Krona CLC external applications are available from https://github.com/NPPO-NL/CLC-External-Applications (accessed 26-3-2025). Mappings with ≥ 99.5% sequence length coverage and ≥ 10x average read coverage (ARC) were visually inspected to assess mapping quality prior to including consensus sequences in the clustering analysis. Clustering Consensus sequences were MAFFT v7.49 (Katoh & Standley, 2013 ) aligned with ITS1 sequences from Fan et al. ( 2017 ) in Geneious Prime v2024.1.2 (Biomatters, New Zealand). Clustering was performed with FastTree v2.1.11 (Price et al., 2010 ) with optimization for the Gamma20 likelihood, and branch support was calculated with the Shimodaira-Hasegawa-like method. Haplotype networks were constructed with PopART (Leigh & Bryant, 2015 ) using the Integer Neighbour-Joining method (reticulation tolerance = 0.5). Results Reference set Of the 120 rDNA barcode sequences included in Fan et al. ( 2017 ), 77 ITS1 sequences were unique in the overall dataset, which are referred to as molecular operational taxonomical units (MOTU). Five species ( Elsinoë arachidis, Elsinoë bidentis, Elsinoë mimosa, Elsinoë perseae, Elsinoë phaseoli ) were represented with more than one MOTU, and six MOTUs represent more than one species (e.g. MOTU_1: Elsinoë fawcettii, Elsinoë citricola ; MOTU_3: Elsinoë australis, Elsinoë genipae-americanae, Elsinoë punicae ) (S-table 3). ITS1 sequences ranged from 203 to 259 bp (mean = 246.2, st.dev = 9.6) and displayed similar resolution compared to the full ITS barcode (S-Fig. 1). Mapping to MOTUs All of the 53 selected DNA extracts resulted in amplification of the ITS barcode and Illumina sequencing yielded 212 to 1,371 Mb of sequence data. Read mappings were obtained for 7 out of 77 MOTUs, with average read coverage values ranging from 11× to 48,022×. The median ARC across these mappings was 162×, with an interquartile range of 54× to 820×, indicating considerable variation in sequencing depth. Among the 26 initial samples, which had Cq values between 23.8 and 38.5 and two samples in which no Elsinoë DNA was detected, reliable consensus sequences (≥ 99.5% reference length coverage at ≥ 10× ARC) were obtained for 10 samples. In contrast, within the subset of 27 samples with a Cq ≤ 27.5, 24 samples produced reliable consensus sequences, demonstrating a higher success rate in samples with lower Cq values (S-Fig. 2). Among the 34 samples that produced mappings to one or more full-length MOTUs, 26 mapped to a single MOTU, five mapped to two MOTUs, two mapped to three MOTUs, and one mapped to four MOTUs. In total, this resulted in 46 mappings covering the full-length MOTU sequence, all of which were visually inspected and used to create a reliable consensus sequence. Cluster analysis Alignment of 46 consensus sequences obtained from MOTU mappings and the 120 ITS1 sequences included in Fan et al. ( 2017 ) resulted in a 306 nt (including gaps) alignment. Metabarcoding ITS1 sequences clustered in one of five clades including one or more MOTUs and represented multiple Elsinoë species. Clades were defined as follows: Clade 1 (MOTU_01 and MOTU_32) representing Elsinoë citricola , Elsinoë fagarae and Elsinoë fawcettii ; Clade 2 (MOTU_10, MOTU_34, and MOTU_54) with Elsinoë centrolobii , Elsinoë fici , Elsinoë jasmini and Elsinoë randii ; Clade 3 (MOTU_11) with Elsinoë embeliae and Elsinoë pongamiae ; Clade 4 (MOTU_04) with Elsinoë anacardia and Elsinoë semecarpi ; and Clade 5 (MOTU_03) with Elsinoë australis , Elsinoë genipae-americanae , and Elsinoë punicae (Fig. 1 ). Of the 34 samples with full-length MOTU mappings and consensus sequences, 29 generated consensus sequences clustering in one of the five clades. For instance, the two Spanish samples resulted in sequences clustering in clade 4, containing E. anacardii and E. semecarpi . Five samples produced consensus sequences that clustered in two distinct clades (S-table 2). These consisted of Citrus × latifolia consignments from Colombia and Brazil. The two Brazilian samples produced sequences from clades 2 and 5. Of the three Colombian samples, two produced sequences in clades 1 and 3 and one in clades 2 and 3. No samples generated sequences that clustered in three or more clades. Among the 46 consensus sequences, eleven clustered in clades containing regulated species ( clade 1: n = 7; clade 5: n = 4), representing ten consignments. The remaining 35 sequences grouped into clades containing non-regulated Elsinoë species: clade 2 (n = 17), clade 3 (n = 13) and clade 4 (n = 5). Sequences clustering in clade 1, which includes the regulated species E. citricola and E. fawcettii , were obtained from consignments of C. × latifolia and C. hystrix (Fig. 2 A) originating from Colombia and Indonesia (Fig. 2 B). In contrast, sequences clustering in clade 5, which contains the regulated species E. australis , were retrieved from consignments of C. × latifolia originating from Brazil and Peru (Fig. 2 , S-table 2). Symptom–clade correlation Symptoms observed on citrus fruits from import consignments were classified into three categories, namely: 1. Typical E. fawcettii , 2. Typical E. australis , and 3. Atypical, following EPPO (EPPO/OEPP, 2025a , EPPO/OEPP, 2025b ). Images of symptomatic citrus fruits with positive Elsinoë real-time PCR results and resulting in consensus sequences in one of the five clusters are shown in Fig. 3 . Samples associated with clade 1 (which includes E. citricola and E. fawcettii ) exhibited symptoms characteristic of E. fawcettii . One sample also displayed symptoms typically linked to E. australis . Sequences belonging to clades 2 and 3 were associated with symptoms typical either to E. fawcettii or E. australis in separate fruits, or a combination of both in a single fruit. Samples corresponding to clade 4 showed atypical symptoms. Interestingly, samples in clade 5 (which includes E. australis ) displayed symptoms typically associated with E. fawcettii . Discussion In the Netherlands, genus-level molecular detection in combination with symptom analysis, host plant and species were used to diagnose the regulated Elsinoë species on citrus. With only the three regulated Elsinoë species known to occur on citrus and a stringent host specificity concept for Elsinoë species (Fan et al., 2017 ), this was deemed adequate. Genus-level detection was conducted using a real-time PCR assay targeting 18S rDNA and ITS1 sequences described by Elliott et al. ( 2023 ). Import samples from Spain, where none of the regulated species are known to occur, and/or with late Elsinoë spp. Cq values were considered critical cases requiring test confirmation, which we aimed to achieve with ITS1 metabarcoding. The Spanish samples did not produce sequences clustering in clades containing the regulated Elsinoë species. To our surprise, the use of ITS1 metabarcoding revealed a broader diversity of Elsinoë species than previously recognized in citrus fruit imports, indicating that genus-level detection alone is insufficient for phytosanitary decision-making. Metabarcoding of the ITS1 sequence does not provide species-level resolution and is therefore unsuitable for verifying regulated Elsinoë species. However, it can be used to confirm the presence of non-regulated Elsinoë species. For sequences clustering in clade 1, which includes the regulated species E. citricola and E. fawcettii , only mappings to MOTU_01 were obtained, representing these two species. Additionally, cluster analysis identified E. fagarae (MOTU_32) within this clade, as its ITS1 sequence is similar to that of E. fawcettii and E. citricola . Therefore, the ITS1 sequences clustering in clade 1 likely originate from either E. fawcettii or E. citricola . For sequences in clade 5, which includes the regulated species E. australis , mappings were obtained to MOTU_03. This MOTU represents E. australis, E. genipae-americanae , and E. punicae , all of which share identical ITS1 sequences. Consequently, these sequences originated from the regulated species or from another species represented by the MOTU. E. punicae is a fungal pathogen responsible for scab disease in pomegranates ( Punica granatum , Lythraceae) and has been reported in Argentina, Brazil, Italy, China, India, Iran, and South Africa. Experimental studies suggest that E. punicae is incapable of infecting citrus (Carstens et al., 2018 ). Similarly, E. genipae-americanae causes scab on the genip tree ( Genipa americana , Rubiaceae), which is native to tropical forests in the Americas (Fan et al., 2017 ). There is currently no available data on the ability of E. genipae-americanae to occur on citrus. One of the metabarcoding sequences clustering in clade 5 (32902471-2) exhibited a single polymorphism (184 T > C, similarity = 99.6%) compared to MOTU_03. This variation may represent intraspecific variation within one of the species in this clade or could indicate the presence of another species not included in this analysis. Clade 2 includes imported samples from Brazil and Colombia. This cluster is characterized by sequences of Elsinoë centrolobii from Brazil on the deciduous tree Centrolobium robustum (Fabaceae); Elsinoë fici from Brazil on Ficus luschnathiana (Moraceae); Elsinoë jasmini from Brazil on Arabian jasmine ( Jasminum sambac ; Oleaceae); and Elsinoë randii from Brazil on pecan ( Carya illinoinensis , synonym Carya pecan ; Juglandaceae) (Fan et al., 2017 ). It should be noted that Fan et al. ( 2017 ) indicate that the Brazilian E. fici strain included in their study is treated as synonymous to the type species but that it is believed to likely represent a distinct species from the original description in Java, Indonesia. The geographical overlap between the majority of import sample clade 2 sequences and the public sequences from Fan et al. ( 2017 ) in this clade is noteworthy. Clade 3 contains samples originating from Brazil, Colombia, Thailand and Vietnam. Two sequences from Colombia (41962257-2, 41853966-2) differ a single polymorphism (Δ108, 99.6% similarity) relative to MOTU_11 and could represent intraspecific variation or a different species. This cluster is characterized by sequences of E. embeliae from India on false black pepper ( Embelia ribes ; Primulaceae) and E. pongamiae from India on Indian beech tree ( Pongamia pinnata ; Fabaceae). Clade 4 contains samples originating from Colombia, Spain, South-Africa and Zimbabwe. The two sequences from Spain (33314516-1, 33314516-2) differ two polymorphisms (115 G > A and 119 G > A, 99.2% similarity) relative to MOTU_04 and could represent intraspecific variation or a different species. This cluster is characterized by sequences of E . anacardia from India on species from different plant families (sugar apple, Annona squamosa , Annonaceae; rose, Rosa sp., Rosaceae; and cashew, Anacardium occidentale , Anacardiaceae) and E. semecarpi from India on Melanochyla caesia (Anacardiaceae). Fan et al. ( 2017 ) suggested that the fact the E . anacardia isolates analysed originate from distinct host families may indicate a potential error during the culturing and subsequent deposit of these cultures in collection. Alternatively, this species might have a broader host range than suspected. Compared to real-time PCR, metabarcoding exhibits lower sensitivity for the detection of Elsinoë species in symptomatic plant samples. Using real-time PCR, Elsinoë DNA was detected in 51 out of 53 DNA extracts obtained from symptomatic plant material. Among the 34 samples with Cq values below 30, complete Elsinoë ITS1 barcodes were obtained in 31 cases (91% success rate). Conversely, in the 19 samples with Cq values greater than 30, complete Elsinoë ITS1 barcodes were successfully obtained in only three cases (16% success rate). The reduced analytical sensitivity of metabarcoding in this context is believed to be attributed to the non-specific amplification of rDNA from multiple sources (Abdelfattah et al., 2018 ), which is reflected by the multiple amplicons obtained with the rDNA barcode primers (S-Fig. 3). These sources include the host plant and other related fungal genera such as Alternaria , Cladosporium , Colletotrichum , and Fusarium as detected with blast analysis of all obtained rDNA contigs (S-file 2). This competition for amplification likely limits the recovery of Elsinoë sequences. In instances where complete ITS1 barcodes were not recovered, Elsinoë reads mapped to the reference sequences in some cases. However, these mappings did not span the entire reference sequence and were therefore considered unreliable for clustering analysis. Given the potential presence of multiple Elsinoë species in symptomatic samples as observed in this study, and the reduced analytical sensitivity of the metabarcoding test, we cannot rule out the possibility that regulated species may be present in samples where no Elsinoë sequences from clades containing the regulated species were detected. Even though we were able to include only a limited number of samples in the symptom-clade association, our results suggest that symptoms regarded as typical E. fawcettii or E. australis are not exclusive to those species. We used three categories to characterize the observed symptoms following (EPPO/OEPP, 2025a , EPPO/OEPP, 2025b ). Typical symptoms caused by E. fawcettii (category 1) include raised, scabby, and often irregular lesions. These lesions tend to be thicker, warty, and fissured, especially in more advanced stages of infection. Their appearance may vary in shape and colour depending on the citrus host and the infection stage. In contrast, symptoms typically associated with E. australis (category 2) are generally larger, but flatter and smoother. These lesions are often less irregular and lack the strongly warty appearance characteristic of E. fawcettii . Category 3 symptoms are attributed to mechanical or abiotic damage, including injury from thrips or wind. These usually appear as larger, scarred, and often corky patches, but are not raised or protuberant. In the samples from clades 2 and 3 (where regulated Elsinoë species were absent) symptoms classified as category 1 and/or 2 were still observed. The average Cq value from real-time PCR for these samples was 26.2 (± 1.2). Although metabarcoding is less sensitive than real-time PCR, we would still expect to detect the regulated species if they were responsible for the observed symptoms. This expectation is based on the relatively low Cq values, which, if caused by regulated species, would likely indicate their presence in sufficient quantity to be detected by metabarcoding. However, only non-regulated Elsinoë species were identified in these samples. In addition to the three symptom categories, a fourth category was observed, often interpreted as wind damage including lesions that are smaller, sunken, and flaky. These samples were not included in the current study on account of their relatively high Cq values, suggesting positive detection with the metabarcoding test is not possible. Understanding the origin and ecological role of these non-regulated Elsinoë species is crucial for assessing their potential risk to citrus production. Although the genus was first described over a century ago (Raciborski, 1900 ), key aspects such as host range, biology, and epidemiology of Elsinoë spp. remain poorly understood (Pham et al., 2025 ). Local spread of Elsinoë spp. is typically attributed to rain splash, heavy dew or overhead irrigation (Brook, 1973 , Whiteside, 1988 , Pham et al., 2025 ). However, ascospores from E. veneta have been shown to travel up to 800 meters by wind, facilitating infection of nearby plants (Jones, 1924 , Pham et al., 2025 ). Similarly, non-regulated Elsinoë species growing on hosts adjacent to citrus orchards could be dispersed via irrigation or rainfall. Alternatively, windborne ascospores could potentially play a role in their life cycle and serve as a source of introduction into orchard environments. These species may exhibit an opportunistic commensal relationship with damaged citrus fruits, while potentially acting as more aggressive pathogens on other host species. Rather than being strictly host-specific, some Elsinoë species could behave as opportunistic pathogens. Further research is needed to determine whether non-regulated Elsinoë species are present on hosts near citrus orchards, whether they can act as opportunistic commensals, and whether dispersal occurs through wind or water. Validation of diagnostic tests is essential to determine if tests are fit for purpose for their intended use under a specific application scope (EPPO/OEPP, 2021 ). Given the discovery of non-regulated Elsinoë species on citrus fruits, additional testing is necessary to reassess the exclusivity (ability to distinguish target species from non-targets) of the current tests. For example, the single-copy MS204 real-time PCR test for E. australis and E. fawcettii was validated using only three non-target Elsinoë species ( E. centrolobi , E. eucalypticola , and E. veneta ). This limited scope was initially justified based on the assumption of high host specificity. However, the findings reported in this manuscript indicate that further investigation is required. Particular focus should be put on closely related Elsinoë species in clades 1 and 5, but also the known species in clades 2, 3 and 4, as well as the Elsinoë species that were detected with the metabarcoding test. To include relevant related non-regulated Elsinoë species on citrus, they need to be identified first. This cannot be done with the current metabarcoding test, and culturing, morphological examination and sequencing of the fungal strains isolated from symptomatic material is needed. Ideally, this should be done prior to treatment and shipment of fruits, with sampling conducted at orchard sites of production. Since non-regulated Elsinoë species have been detected in consignments originating from Africa, Asia, Europe, and South America, a coordinated and harmonized approach, involving local sampling and culturing prior to fruit treatment and shipment, would be most effective. Declarations Ethical approval This article did not contain any studies with human participants or animals performed by any of the authors. Conflict of interest The authors declare that they have no conflict of interest. Funding declaration The authors received no funding for this work. Author contributions Bart van de Vossenberg, Ashleigh Elliott and Sietse van der Linde contributed to the study conception and design. Material selection and preparation were performed by Valerie van Ingen-Buijs, Mandy Wildhagen and Aron van Duijnhoven, data production and collection was performed by Tijs van den Bosch. Molecular analyses were performed by Bart van de Vossenberg and symptomatology assessments were performed by Valerie van Ingen-Buijs. The first draft of the manuscript was written by Bart van de Vossenberg, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors are grateful to Michael Visser, Bas Berbers and Lucas van der Gouw (NVWA, the Netherlands) for their bio-informatic support and maintaining the analysis environment. We would also like to thank Pedro-Pablo Parra Giraldo (EURL Fungi and Oomycetes, ANSES, France) for critically reviewing the manuscript prior to submission. References Abdelfattah, A., Malacrinò, A., Wisniewski, M., Cacciola, S. O., & Schena, L. (2018). Metabarcoding: A powerful tool to investigate microbial communities and shape future plant protection strategies. Biological Control , 120 , 1–10. Ahmed, Y., Hubert, J., Fourrier-Jeandel, C., Dewdney, M. M., Aguayo, J., & Ioos, R. (2019). A Set of Conventional and Multiplex Real-Time PCR Assays for Direct Detection of Elsinoë fawcettii , E. australis , and Pseudocercospora angolensis in Citrus Fruits. Plant Disease , 103 , 345–356. Brook, P. (1973). Epidemiology of grapevine anthracnose, caused by Elsinoe ampelina. New Zealand Journal of Agricultural Research , 16 , 333–342. Carstens, E., Langenhoven, S. D., Pierron, R., Laubscher, W., Serfontein, J. J., Bezuidenhout, C. M., et al. (2018). Elsinoë punicae causing scab of pomegranates in South Africa does not cause disease on citrus. Australasian Plant Pathology , 47 , 405–411. EFSA. (2017). Pest categorisation of Elsinoë fawcettii and E. australis . EFSA Journal , 15 , e05100. Elliott, A. J., van Raak, M. M. J. P., Barnes, A. V., Field, C. J., van Duijnhoven, Aron, A. L. A. M., Webb, K., & van de Vossenberg, B. T. L. H. (2023). Real-Time PCR Detection of Elsinoë spp. on Citrus PhytoFrontiers™ , 3 , 164–172. EPPO/OEPP. (2021). PM 7/98 (5) Specific requirements for laboratories preparing accreditation for a plant pest diagnostic activity. EPPO Bulletin , 51 , 468–498. EPPO/OEPP. (2024). PM 7/76 (6) Use of EPPO Diagnostic Standards. EPPO Bulletin , 54 , 312–316. EPPO/OEPP (2025a). Elsinoë australis , EPPO datasheets on pests recommended for regulation. EPPO global database . EPPO/OEPP (2025b). Elsinoë fawcettii , EPPO datasheets on pests recommended for regulation. EPPO global database . EU (2016). Regulation (EU) 2016/2031 of the European Parliament and of the Council of 26 October 2016 on protective measures against pests of plants. Official Journal of the European Union , pp. 4–104. Fan, X. L., Barreto, R. W., Groenewald, J. Z., Bezerra, J. D., Pereira, O. L., Cheewangkoon, R., et al. (2017). Phylogeny and taxonomy of the scab and spot anthracnose fungus Elsinoë (Myriangiales, Dothideomycetes). Studies In Mycology , 87 , 1–41. Guerrero, M. (2024). Citrus Annual. (Kuypers (p. 26). K., ed.). United States department of agriculture. Ioos, R., Fourrier, C., Iancu, G., & Gordon, T. R. (2009). Sensitive Detection of Fusarium circinatum in Pine Seed by Combining an Enrichment Procedure with a Real-Time Polymerase Chain Reaction Using Dual-Labeled Probe Chemistry. Phytopathology® , 99 , 582–590. Jones, L. K. (1924). Anthracnose of cane fruits and its control on black raspberries in Wisconsin . Agricultural Experiment Station of the University of Wisconsin. Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology And Evolution , 30 , 772–780. Leigh, J. W., & Bryant, D. (2015). popart: full-feature software for haplotype network construction. Methods in Ecology and Evolution , 6 , 1110–1116. Ondov, B. D., Bergman, N. H., & Phillippy, A. M. (2011). Interactive metagenomic visualization in a Web browser. Bmc Bioinformatics , 12 , 385. Pham, N. Q., Wingfield, B. D., Barnes, I., Gazis, R., & Wingfield, M. J. (2025). Elsinoe species: The rise of scab diseases. Plant Pathology , 74 , 39–58. Price, M. N., Dehal, P. S., & Arkin, A. P. (2010). FastTree 2 – Approximately Maximum-Likelihood Trees for Large Alignments. PLOS ONE , 5 , e9490. Raciborski, M. (1900). Parasitische Algen und Pilze Java's . Staatsdruckerei. White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications , 18 , 315–322. Whiteside, J. (1988). Factors contributing to the rare occurrence of scab on sweet orange in Florida. Ethics declarations. Supplementary Files SFig1.rDNAversusITS1.tif SFig2.nARCvsCqgrouped.tif SFig3.Amplicons.tif Sfile1UniqueMOTUITS1references.fasta Sfile2kronareportallrDNAhits.html renamed07c26.xlsx Cite Share Download PDF Status: Published Journal Publication published 18 Dec, 2025 Read the published version in European Journal of Plant Pathology → Version 1 posted Reviewers agreed at journal 21 May, 2025 Reviewers invited by journal 19 May, 2025 Editor invited by journal 16 May, 2025 Editor assigned by journal 15 May, 2025 First submitted to journal 12 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6631223","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":458477075,"identity":"fc689f66-19b7-4569-ba25-61ae9f8c8cc5","order_by":0,"name":"Bart van de Vossenberg","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABKUlEQVRIiWNgGAWjYBACAxDxgOEAmCMBFWQDEXJQjgWmFmYGhgRsWoyhHAnitSQ24NBizsB/AKjlDoPB8bMHb3xss7GXb+899uDjntr07RI5hh8Yd2BosWwA2/KMweBMXrLlzLa0xA1nzqUbznh2PHfnjBxjCcYzmA47ANZymEGyIcdMmufM4QQDCRDjwLHcDWfObpBgbMOjpf+NmfSfM4ft5eeDGAeOpRucObv5Bz4t/CDDGSoOMzbc4AEyDtQkGBzv3YbNFstmZoMDCQaHefgl3hhb9lSA/JJjbthz4IDhhuP93ywSMbWYszc+fPCh4rAcG3+O4Y0fBqAQO2P24MeBOnmDw2zJoDBE1wKKlgPA2OFBFz8MoRIwNOAGdSSoHQWjYBSMgmEOAEw8bcNJTEzSAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-1205-6119","institution":"Netherlands Institute for Vectors, Invasive plants and Plant health","correspondingAuthor":true,"prefix":"","firstName":"Bart","middleName":"van","lastName":"de Vossenberg","suffix":""},{"id":458477079,"identity":"2021b590-eb5d-4f56-8adb-c9b97fc2aabc","order_by":1,"name":"Valerie A. van Ingen-Buijs","email":"","orcid":"","institution":"Netherlands Institute for Vectors, Invasive plants and Plant health","correspondingAuthor":false,"prefix":"","firstName":"Valerie","middleName":"A. van","lastName":"Ingen-Buijs","suffix":""},{"id":458477080,"identity":"573fb8eb-b65e-4655-8929-ea3fae7d09c6","order_by":2,"name":"Ashleigh J. Elliott","email":"","orcid":"","institution":"Fera Science Limited","correspondingAuthor":false,"prefix":"","firstName":"Ashleigh","middleName":"J.","lastName":"Elliott","suffix":""},{"id":458477081,"identity":"4606da03-6b6d-4e20-a3f5-7d5ca4188568","order_by":3,"name":"Tijs J.M. van den Bosch","email":"","orcid":"","institution":"Netherlands Institute for Vectors, Invasive plants and Plant health","correspondingAuthor":false,"prefix":"","firstName":"Tijs","middleName":"J.M. van den","lastName":"Bosch","suffix":""},{"id":458477082,"identity":"95f91d65-2694-48f0-b2ba-5ed0f2a376e0","order_by":4,"name":"Mandy M.D.A. Wildhagen","email":"","orcid":"","institution":"Netherlands Institute for Vectors, Invasive plants and Plant health","correspondingAuthor":false,"prefix":"","firstName":"Mandy","middleName":"M.D.A.","lastName":"Wildh","suffix":"M.D"},{"id":458477083,"identity":"14e0800e-1881-4503-862b-784dbd08908e","order_by":5,"name":"Aron A. L. A. M. van Duijnhoven","email":"","orcid":"","institution":"Netherlands Institute for Vectors, Invasive plants and Plant health","correspondingAuthor":false,"prefix":"","firstName":"Aron","middleName":"A. L. A. M. van","lastName":"Duijnhoven","suffix":""},{"id":458477084,"identity":"c5ba31bf-cc13-4b0e-a563-5644c2577b74","order_by":6,"name":"Sietse van der Linde","email":"","orcid":"","institution":"Netherlands Institute for Vectors, Invasive plants and Plant health","correspondingAuthor":false,"prefix":"","firstName":"Sietse","middleName":"van der","lastName":"Linde","suffix":""}],"badges":[],"createdAt":"2025-05-09 20:15:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6631223/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6631223/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10658-025-03168-0","type":"published","date":"2025-12-18T15:58:28+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":83223807,"identity":"121c1a5c-485f-4d01-a9ed-b58516554cff","added_by":"auto","created_at":"2025-05-21 10:54:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":31790227,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFastTree containing \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElsinoë\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e spp. sequences obtained from symptomatic citrus fruit consignments\u003c/strong\u003e. A 306 nt (including gaps) ITS1 alignment of 46 sequences from import consignments and sequences from Fan \u003cem\u003eet al.\u003c/em\u003e (2017) were used to construct an approximately-maximum-likelihood cladogram. Support values displayed on internal nodes are based on the Shimodaira-Hasegawa method. Selected clusters are highlighted to indicate clusters with sequences obtained from symptomatic fruits from import consignments. Representative ITS1 MOTU sequences in clades 1 to 5 are indicated. Sequences from EU regulated \u003cem\u003eElsinoë\u003c/em\u003especies, generated by Fan \u003cem\u003eet al.\u003c/em\u003e (2017), are represented in clade 1 (\u003cem\u003eE. citricola\u003c/em\u003e, \u003cem\u003eE. fawcettii\u003c/em\u003e) and clade 5 (\u003cem\u003eE. australis\u003c/em\u003e).\u003c/p\u003e","description":"","filename":"Fig1.FastTree166ITS1v2.png","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/86655a7e972b4dd11608df24.png"},{"id":83223812,"identity":"9c58dfeb-37fd-4521-b8e0-be1095d2140a","added_by":"auto","created_at":"2025-05-21 10:54:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":19645373,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInteger Neighbour-Joining network containing 46 \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eElsinoë\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e spp. ITS1 sequences obtained from symptomatic citrus fruit consignments\u003c/strong\u003e. Circle sizes are proportional to haplotype frequencies, and circles are coloured based on host (\u003cstrong\u003eA\u003c/strong\u003e) or consignment origin (\u003cstrong\u003eB\u003c/strong\u003e). Black nodes represent hypothetical ancestors and marks on the branches indicate the number of mutations.\u003c/p\u003e","description":"","filename":"Fig2.IntNJnethostandorigin.png","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/3d706cb886592725e9716543.png"},{"id":83223955,"identity":"c237a429-2543-4d0b-8756-bf2f4e16db8e","added_by":"auto","created_at":"2025-05-21 11:02:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":44528141,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eObserved symptoms in imported citrus fruit samples in the context of the ITS1 FastTree-defined clusters. \u003c/strong\u003ePer clade, representing samples were selected and for each sample the observed symptom group is indicated (typical \u003cem\u003eE. fawcettii\u003c/em\u003e = ❶, typical \u003cem\u003eE. australis\u003c/em\u003e = ❷, a-typical = ❸). When more than one typical symptom was observed, these are indicated with large (❶) and small (❷) dotted lines. Sample identifiers are listed left to right. Clade 1 contains 41212843-2: \u003cem\u003eCitrus x latifolia\u003c/em\u003e with ❶❷, 65617677-4: \u003cem\u003eCitrus hystrix\u003c/em\u003e with❶ and 64868335-2: \u003cem\u003eCitrus x latifolia\u003c/em\u003ewith ❶. Clade 2 contains 40045326-1: \u003cem\u003eCitrus x latifolia\u003c/em\u003e with ❷, 41855558-3: \u003cem\u003eCitrus x latifolia\u003c/em\u003ewith ❶ and 41224385-1: \u003cem\u003eCitrus x latifolia\u003c/em\u003ewith ❶. Clade 3 contains 33139842-1: \u003cem\u003eCitrus x latifolia\u003c/em\u003e with ❶❷, 40725428-2: \u003cem\u003eCitrus x latifolia\u003c/em\u003ewith symptoms close to ❷ and 40725428-3: \u003cem\u003eCitrus x latifolia\u003c/em\u003e with ❶❷. Clade 4 contains 33314516-2 (\u003cem\u003eCitrus sinensis\u003c/em\u003e), 33314516-1 (\u003cem\u003eCitrus sinensis\u003c/em\u003e) and 41780576-2 (\u003cem\u003eCitrus limon\u003c/em\u003e), which all display ❸. Clade 5 contains 42459223-1 and 66042190, both \u003cem\u003eCitrus x latifolia\u003c/em\u003e displaying ❶.\u003c/p\u003e","description":"","filename":"Fig3.Symptoms.png","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/88cd099c83d4f45e5388ddc3.png"},{"id":98814374,"identity":"3a633acc-736d-4c26-a345-ea95b8744c95","added_by":"auto","created_at":"2025-12-22 16:12:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":89919349,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/7e80489b-648e-4cc3-aa95-cc3047d5e38d.pdf"},{"id":83223956,"identity":"525b7050-9006-4d14-8ab5-ed7e56713010","added_by":"auto","created_at":"2025-05-21 11:02:10","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":3800960,"visible":true,"origin":"","legend":"","description":"","filename":"SFig1.rDNAversusITS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/23805b3315cd16f1ae4c52ef.tif"},{"id":83223952,"identity":"f816016c-d125-440e-9ead-d1f1e6210b29","added_by":"auto","created_at":"2025-05-21 11:02:10","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":1271756,"visible":true,"origin":"","legend":"","description":"","filename":"SFig2.nARCvsCqgrouped.tif","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/da899c73312e1304bcec2cdc.tif"},{"id":83223816,"identity":"17d61d0e-0246-411c-bd1f-aea2bfc2e490","added_by":"auto","created_at":"2025-05-21 10:54:11","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":17272728,"visible":true,"origin":"","legend":"","description":"","filename":"SFig3.Amplicons.tif","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/17112c5c6c27a907c150ab6c.tif"},{"id":83223803,"identity":"0940b3b7-4a38-428e-b920-6a04479da008","added_by":"auto","created_at":"2025-05-21 10:54:10","extension":"fasta","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":22860,"visible":true,"origin":"","legend":"","description":"","filename":"Sfile1UniqueMOTUITS1references.fasta","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/306365b70d8799dfcf7dbe98.fasta"},{"id":83224531,"identity":"7476a5a2-5f3c-4f6e-a3d3-82eec406e3aa","added_by":"auto","created_at":"2025-05-21 11:10:10","extension":"html","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":430680,"visible":true,"origin":"","legend":"","description":"","filename":"Sfile2kronareportallrDNAhits.html","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/04b39078ee353ff4036e8802.html"},{"id":83223815,"identity":"5e65428f-d877-4301-a5e5-898afd8322bd","added_by":"auto","created_at":"2025-05-21 10:54:11","extension":"xlsx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":41964,"visible":true,"origin":"","legend":"","description":"","filename":"renamed07c26.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6631223/v1/ea15725881fdf853d046d78a.xlsx"}],"financialInterests":"","formattedTitle":"Presence of non-regulated Elsinoë species on citrus fruits and their impact on regulatory plant health diagnostics","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCitrus fruits, including oranges, lemons, limes, grapefruits, and tangerines, are economically valuable crops globally and within Europe. In 2023\u0026ndash;2024, Europe produced approximately 10.5\u0026nbsp;million metric tons of citrus fruits, with Mediterranean countries leading this production. Spain and Italy are the foremost producers, followed by Greece, Portugal, and Cyprus. The European Union (EU) is a net importer of citrus fruits, with imports exceeding exports in order to meet consumer demand (Guerrero, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The Netherlands serves as a central hub for the import of citrus fruits into the EU. In 2023, the Netherlands ranked fourth in world import for citrus fruits (fresh or dried) with 6.8% of all imports. South Africa, Egypt and Brazil represent the top three countries exporting citrus fruits to the Netherlands (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.trademap.org\u003c/span\u003e\u003cspan address=\"https://www.trademap.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, accessed 26 March 2025).\u003c/p\u003e \u003cp\u003eCitrus fruit imports pose risks for EU citrus production, notably the introduction of regulated pathogens such as the bacterium \u003cem\u003eXanthomonas citri\u003c/em\u003e subsp. c\u003cem\u003eitri\u003c/em\u003e or the fungi \u003cem\u003ePhyllosticta citricarpa\u003c/em\u003e, \u003cem\u003eElsino\u0026euml; fawcettii\u003c/em\u003e, \u003cem\u003eE. australis\u003c/em\u003e and \u003cem\u003eE. citricola\u003c/em\u003e (EU, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, EFSA, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Pham et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). For instance, over 50% of imported citrus consignments originate from countries where at least one of the regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species is present (S-table 1). To prevent the introduction and potential establishment of regulated pathogens in European orchards, border controls are conducted and diagnostic tests are carried out on symptomatic fruits that may indicate the presence of regulated plant pests.\u003c/p\u003e \u003cp\u003eThe regulated Elsino\u0026euml; species cause scab on citrus, with \u003cem\u003eE. fawcettii\u003c/em\u003e producing thick, warty, irregular lesions, while \u003cem\u003eE. australis\u003c/em\u003e causes larger, flatter, and smoother lesions with less irregularity. Imported fruits with scab lesions are sampled for further testing as symptomatology alone cannot provide a reliable diagnosis. Other pests, such as \u003cem\u003eX. citri\u003c/em\u003e subsp. c\u003cem\u003eitri\u003c/em\u003e and \u003cem\u003eDiaporthe citri\u003c/em\u003e, as well as mite and abiotic damage (e.g. rub scratches caused by wind) are known to produce similar symptoms (EPPO/OEPP, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e, EPPO/OEPP, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e). In the Netherlands, molecular testing was performed with an \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. genus-specific real-time PCR (Elliott et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), which targets 18S ribosomal DNA (rDNA) and internal transcribed spacer 1 (ITS1) sequences. Since only the three regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species were known to infect citrus fruits (Elliott et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Fan et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), a positive genus-level detection, in conjunction with an analysis of symptomatology, host plant species, and fruit origin, was used for the detection of regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on citrus. However, during routine testing, samples from Spain, where none of the regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species are known to occur, and samples with late \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. real-time PCR Cq values were observed. These cases were regarded critical and required test confirmation (EPPO/OEPP, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Since \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. are challenging to isolate from citrus fruits and exhibit slow growth (reference), confirming the presence of suspected pests through sequencing of cultured fungal strains was regarded unfeasible. Therefore we aimed to verify the presence of regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species in symptomatic plant material testing positive for \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. with a metabarcoding approach targeting the species-specific \u003cem\u003eelongation factor 1 alpha\u003c/em\u003e (\u003cem\u003eEF1α\u003c/em\u003e) and the rDNA locus that offer less resolution. Using the EF1α barcode proved to be too challenging on account of non-specific amplification and inconclusive results were obtained. With the ITS1 barcode however, presence of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species other than the regulated ones was observed.\u003c/p\u003e \u003cp\u003eThe occurrence of non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on citrus fruits complicates the diagnosis of regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species. It necessitates the isolation and identification of the non-regulated species, as well as extended validation of diagnostic assays, given that test exclusivity must account not only for other citrus pathogens but also for closely related non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e \u003cb\u003eSample selection\u003c/b\u003e DNAs extracted from symptomatic citrus samples taken at routine phytosanitary inspections between September 2022 and July 2024 were considered for metabarcoding. Initially, samples with average Cq values ranging from 23.8 to 38.5 and two negatives for the Elliott assay were selected (n\u0026thinsp;=\u0026thinsp;26), but later on samples with Cq\u0026thinsp;\u0026le;\u0026thinsp;27.5 (n\u0026thinsp;=\u0026thinsp;27) were selected to maximize the success of obtaining reliable \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. consensus sequences. In total, 53 DNA extracts were included from 40 consignments representing five hosts (\u003cem\u003eCitrus hystrix\u003c/em\u003e, \u003cem\u003eCitrus limon\u003c/em\u003e, \u003cem\u003eCitrus maxima\u003c/em\u003e, \u003cem\u003eCitrus sinensis\u003c/em\u003e, \u003cem\u003eCitrus x latifolia\u003c/em\u003e) and nine exporting countries (Brazil, Colombia, Indonesia, Peru, South Africa, Spain, Thailand, Vietnam, Zimbabwe). An overview of selected samples and relevant associated data is listed in S-table 2.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDNA extraction and\u003c/b\u003e \u003cb\u003eElsino\u0026euml;\u003c/b\u003e \u003cb\u003espp. detection\u003c/b\u003e Up to 100 mg of symptomatic citrus fruit was added to an Eppendorf tube containing 300 \u0026micro;l of extraction buffer (0.02 M PBS\u0026thinsp;+\u0026thinsp;0.05% Tween\u0026thinsp;+\u0026thinsp;2% PVP\u0026thinsp;+\u0026thinsp;0.2% BSA) and a single 3.2-mm stainless steel bead. Material was homogenized with a MM301 mixer mill (Retsch, Haan, Germany) for 80 s on 30 beats/s. The homogenized material (75 \u0026micro;l) was processed using the QuickPick Plant DNA kit (Bio-Nobile, Pargas, Finland) on a KingFisher Flex 96 (Thermo Fisher Scientific, Waltham, MA, United States) following the manufacturer's instructions. To detect \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. DNA in the nucleic acid extracts, real-time PCR reactions described by Elliott et al. (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) were performed using the iTaq Supermix (Bio-Rad, Hercules, CA, United States), 0.3 \u0026micro;M of each primer (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), 0.1 \u0026micro;M of each probe (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and 2 \u0026micro;l of template DNA. Molecular grade water (MGW) was added to reach a final volume of 25 \u0026micro;l. Triplex real-time PCR reactions (\u003cem\u003eElsino\u0026euml;\u003c/em\u003e A, \u003cem\u003eElsino\u0026euml;\u003c/em\u003e B (Elliott et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), and the 18S rDNA internal control (Ioos et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e)) were performed in a CFX Opus 96 (Bio-Rad) using the following thermocycler conditions: 2 min 95\u0026deg;C, 40x (15 s 95\u0026deg;C, 1 min 60\u0026deg;C). Samples producing Cq values\u0026thinsp;\u0026lt;\u0026thinsp;40 and exponential amplification curves were regarded positive. During each thermocycler run, a negative amplification control (MGW) and two positive amplification controls (10 ng/\u0026micro;l and 0.1 ng/\u0026micro;l of \u003cem\u003eE. fawcettii\u003c/em\u003e (CBS 233.64) DNA) were included.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOligonucleotides used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTest\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence 5\u0026rsquo; \u0026ndash; 3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAuthor\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eElliott \u003cem\u003eet al.\u003c/em\u003e real-time PCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEls A_fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGCGGAAGGATCATTAACGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eElliott et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEls A_rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGCCGAAGCAACGTGATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eElliott et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEls B_fw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCGAAAGGAGCCCGAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eElliott et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEls B_rv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCGCCGAAGCAACAGATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eElliott et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eElsinoe_pr\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[FAM]-CCCACCCTTTGCTG-[BHQ1]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eElliott et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18S internal control\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18S uni-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCAAGGCTGAAACTTAAAGGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIoos et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18S uni-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCACCACCCATAGAATCAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIoos et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18S uni-P\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[VIC]-ACGGAAGGGCACCACCAGGAGT-[BHQ1]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIoos et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2009\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emetabarcoding PCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eITS barcode\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eITS5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGAAGTAAAAGTCGTAACAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWhite et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1990\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eITS4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCCTCCGCTTATTGATATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eWhite et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1990\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRibosomal DNA amplification and sequencing\u003c/b\u003e Total DNA extracted from samples selected for metabarcoding were subjected to conventional PCR amplification of the rDNA barcode (partial 18S, ITS1, 5.8S, ITS2 and partial 28S) with primers ITS4 and ITS5 (White et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1990\u003c/span\u003e), Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Reaction mixes were based on the MyFi Mix (Bioline, United Kingdom) containing 0.2 \u0026micro;M of each primer, 2 \u0026micro;l of template DNA and MGW to reach a final volume of 25 \u0026micro;l. Reactions were performed in a C1000 (Bio-Rad) using the following thermocycler conditions: 5 min 95\u0026deg;C, 40x (30 s 94\u0026deg;C, 30 s 52\u0026deg;C, 1 min 40 s 72\u0026deg;C), 10 min 72\u0026deg;C. PCR products were visualized in a 1.5% agarose gel-electrophoresis (RESULT LE General Purpose (BIOzymTC, the Netherlands)) and SYBR-safe (Life Technologies, CA, USA) staining. Reactions producing visible PCR products of approximately 500 to 1000 bp were used for Illumina short-read sequencing. The Illumina DNA Prep Tagmentation kit (Illumina, CA, USA) was used according to the manufacturer\u0026rsquo;s specifications to generate Illumina-ready libraries. Illumina Unique Dual Indexes were used for indexing. A total of five amplification cycles were performed during the library generation step. Library yields were quality assessed by fluorescence on a Qubit 4.0 fluorometer (Thermo Fisher Scientific, MA, USA ), and correct insert sizes were verified using D1000 ScreenTape on a TapeStation 4200 system (Agilent Technologies, CA, USA). Amplicon libraries were equimolarly pooled over four individual sequencing runs. Paired-end requencing reads were generated using 300-cycle P1 cartridge and flow cell combinations on a NextSeq 2000 system (Illumina, CA, USA). Datasets yielded at least 200 megabases (Mb) per sample. The Illumina metabarcoding sequence data were submitted to NCBI Sequence Read Archive under project accession PRJNA1244768 (BioSample SAMN477679 through SAMN47730731).\u003c/p\u003e \u003cp\u003e \u003cb\u003eBio-informatic analysis\u003c/b\u003e To identify \u003cem\u003eElsino\u0026euml;\u003c/em\u003e ITS1 sequences from the metabarcoding datasets, reads were analysed with a custom pipeline in CLC genomics workbench v24.01 (Qiagen, Germany). Reads were quality trimmed (quality limit\u0026thinsp;=\u0026thinsp;0.05; max ambiguities\u0026thinsp;=\u0026thinsp;2; auto adapter trimming\u0026thinsp;=\u0026thinsp;on; trim 3\u0026rsquo;homopolymers\u0026thinsp;=\u0026thinsp;all) and stringently mapped (length fraction\u0026thinsp;=\u0026thinsp;0.9; similarity fraction\u0026thinsp;=\u0026thinsp;0.995) to unique ITS1 sequences from a phylogenetic study by Fan et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) (S-file 1, S-table 3). Consensus sequences were extracted from the read mappings with removal of low coverage regions (\u0026le;\u0026thinsp;10x coverage). These sequences were analysed using BLAST (megablast; E-value\u0026thinsp;=\u0026thinsp;0.001; minimum percentage identity\u0026thinsp;=\u0026thinsp;90%; low complexity filter enabled) against a locally installed copy of the NCBI nucleotide collection (nr/nt). BLAST results were visualized using Krona (Ondov et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Custom BLAST and Krona CLC external applications are available from \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/NPPO-NL/CLC-External-Applications\u003c/span\u003e\u003cspan address=\"https://github.com/NPPO-NL/CLC-External-Applications\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (accessed 26-3-2025). Mappings with \u0026ge;\u0026thinsp;99.5% sequence length coverage and \u0026ge;\u0026thinsp;10x average read coverage (ARC) were visually inspected to assess mapping quality prior to including consensus sequences in the clustering analysis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eClustering\u003c/b\u003e Consensus sequences were MAFFT v7.49 (Katoh \u0026amp; Standley, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) aligned with ITS1 sequences from Fan et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) in Geneious Prime v2024.1.2 (Biomatters, New Zealand). Clustering was performed with FastTree v2.1.11 (Price et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) with optimization for the Gamma20 likelihood, and branch support was calculated with the Shimodaira-Hasegawa-like method. Haplotype networks were constructed with PopART (Leigh \u0026amp; Bryant, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) using the Integer Neighbour-Joining method (reticulation tolerance\u0026thinsp;=\u0026thinsp;0.5).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eReference set\u003c/b\u003e Of the 120 rDNA barcode sequences included in Fan et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), 77 ITS1 sequences were unique in the overall dataset, which are referred to as molecular operational taxonomical units (MOTU). Five species (\u003cem\u003eElsino\u0026euml; arachidis, Elsino\u0026euml; bidentis, Elsino\u0026euml; mimosa, Elsino\u0026euml; perseae, Elsino\u0026euml; phaseoli\u003c/em\u003e) were represented with more than one MOTU, and six MOTUs represent more than one species (e.g. MOTU_1: \u003cem\u003eElsino\u0026euml; fawcettii, Elsino\u0026euml; citricola\u003c/em\u003e; MOTU_3: \u003cem\u003eElsino\u0026euml; australis, Elsino\u0026euml; genipae-americanae, Elsino\u0026euml; punicae\u003c/em\u003e) (S-table 3). ITS1 sequences ranged from 203 to 259 bp (mean\u0026thinsp;=\u0026thinsp;246.2, st.dev\u0026thinsp;=\u0026thinsp;9.6) and displayed similar resolution compared to the full ITS barcode (S-Fig.\u0026nbsp;1).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMapping to MOTUs\u003c/b\u003e All of the 53 selected DNA extracts resulted in amplification of the ITS barcode and Illumina sequencing yielded 212 to 1,371 Mb of sequence data. Read mappings were obtained for 7 out of 77 MOTUs, with average read coverage values ranging from 11\u0026times; to 48,022\u0026times;. The median ARC across these mappings was 162\u0026times;, with an interquartile range of 54\u0026times; to 820\u0026times;, indicating considerable variation in sequencing depth. Among the 26 initial samples, which had Cq values between 23.8 and 38.5 and two samples in which no \u003cem\u003eElsino\u0026euml;\u003c/em\u003e DNA was detected, reliable consensus sequences (\u0026ge;\u0026thinsp;99.5% reference length coverage at \u0026ge;\u0026thinsp;10\u0026times; ARC) were obtained for 10 samples. In contrast, within the subset of 27 samples with a Cq\u0026thinsp;\u0026le;\u0026thinsp;27.5, 24 samples produced reliable consensus sequences, demonstrating a higher success rate in samples with lower Cq values (S-Fig.\u0026nbsp;2). Among the 34 samples that produced mappings to one or more full-length MOTUs, 26 mapped to a single MOTU, five mapped to two MOTUs, two mapped to three MOTUs, and one mapped to four MOTUs. In total, this resulted in 46 mappings covering the full-length MOTU sequence, all of which were visually inspected and used to create a reliable consensus sequence.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCluster analysis\u003c/b\u003e Alignment of 46 consensus sequences obtained from MOTU mappings and the 120 ITS1 sequences included in Fan et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) resulted in a 306 nt (including gaps) alignment. Metabarcoding ITS1 sequences clustered in one of five clades including one or more MOTUs and represented multiple \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species. Clades were defined as follows: Clade 1 (MOTU_01 and MOTU_32) representing \u003cem\u003eElsino\u0026euml; citricola\u003c/em\u003e, \u003cem\u003eElsino\u0026euml; fagarae\u003c/em\u003e and \u003cem\u003eElsino\u0026euml; fawcettii\u003c/em\u003e; Clade 2 (MOTU_10, MOTU_34, and MOTU_54) with \u003cem\u003eElsino\u0026euml; centrolobii\u003c/em\u003e, \u003cem\u003eElsino\u0026euml; fici\u003c/em\u003e, \u003cem\u003eElsino\u0026euml; jasmini\u003c/em\u003e and \u003cem\u003eElsino\u0026euml; randii\u003c/em\u003e; Clade 3 (MOTU_11) with \u003cem\u003eElsino\u0026euml; embeliae\u003c/em\u003e and \u003cem\u003eElsino\u0026euml; pongamiae\u003c/em\u003e; Clade 4 (MOTU_04) with \u003cem\u003eElsino\u0026euml; anacardia\u003c/em\u003e and \u003cem\u003eElsino\u0026euml; semecarpi\u003c/em\u003e; and Clade 5 (MOTU_03) with \u003cem\u003eElsino\u0026euml; australis\u003c/em\u003e, \u003cem\u003eElsino\u0026euml; genipae-americanae\u003c/em\u003e, and \u003cem\u003eElsino\u0026euml; punicae\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOf the 34 samples with full-length MOTU mappings and consensus sequences, 29 generated consensus sequences clustering in one of the five clades. For instance, the two Spanish samples resulted in sequences clustering in clade 4, containing \u003cem\u003eE. anacardii\u003c/em\u003e and \u003cem\u003eE. semecarpi\u003c/em\u003e. Five samples produced consensus sequences that clustered in two distinct clades (S-table 2). These consisted of \u003cem\u003eCitrus \u0026times; latifolia\u003c/em\u003e consignments from Colombia and Brazil. The two Brazilian samples produced sequences from clades 2 and 5. Of the three Colombian samples, two produced sequences in clades 1 and 3 and one in clades 2 and 3. No samples generated sequences that clustered in three or more clades. Among the 46 consensus sequences, eleven clustered in clades containing regulated species \u003cem\u003e(\u003c/em\u003eclade 1: n\u0026thinsp;=\u0026thinsp;7; clade 5: n\u0026thinsp;=\u0026thinsp;4), representing ten consignments. The remaining 35 sequences grouped into clades containing non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species: clade 2 (n\u0026thinsp;=\u0026thinsp;17), clade 3 (n\u0026thinsp;=\u0026thinsp;13) and clade 4 (n\u0026thinsp;=\u0026thinsp;5). Sequences clustering in clade 1, which includes the regulated species \u003cem\u003eE. citricola\u003c/em\u003e and \u003cem\u003eE. fawcettii\u003c/em\u003e, were obtained from consignments of \u003cem\u003eC. \u0026times; latifolia\u003c/em\u003e and \u003cem\u003eC. hystrix\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) originating from Colombia and Indonesia (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). In contrast, sequences clustering in clade 5, which contains the regulated species \u003cem\u003eE. australis\u003c/em\u003e, were retrieved from consignments of \u003cem\u003eC. \u0026times; latifolia\u003c/em\u003e originating from Brazil and Peru (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, S-table 2).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSymptom\u0026ndash;clade correlation\u003c/b\u003e Symptoms observed on citrus fruits from import consignments were classified into three categories, namely: 1. Typical \u003cem\u003eE. fawcettii\u003c/em\u003e, 2. Typical \u003cem\u003eE. australis\u003c/em\u003e, and 3. Atypical, following EPPO (EPPO/OEPP, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e, EPPO/OEPP, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e). Images of symptomatic citrus fruits with positive \u003cem\u003eElsino\u0026euml;\u003c/em\u003e real-time PCR results and resulting in consensus sequences in one of the five clusters are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. Samples associated with clade 1 (which includes \u003cem\u003eE. citricola\u003c/em\u003e and \u003cem\u003eE. fawcettii\u003c/em\u003e) exhibited symptoms characteristic of \u003cem\u003eE. fawcettii\u003c/em\u003e. One sample also displayed symptoms typically linked to \u003cem\u003eE. australis\u003c/em\u003e. Sequences belonging to clades 2 and 3 were associated with symptoms typical either to \u003cem\u003eE. fawcettii\u003c/em\u003e or \u003cem\u003eE. australis\u003c/em\u003e in separate fruits, or a combination of both in a single fruit. Samples corresponding to clade 4 showed atypical symptoms. Interestingly, samples in clade 5 (which includes \u003cem\u003eE. australis\u003c/em\u003e) displayed symptoms typically associated with \u003cem\u003eE. fawcettii\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the Netherlands, genus-level molecular detection in combination with symptom analysis, host plant and species were used to diagnose the regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on citrus. With only the three regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species known to occur on citrus and a stringent host specificity concept for \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species (Fan et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), this was deemed adequate. Genus-level detection was conducted using a real-time PCR assay targeting 18S rDNA and ITS1 sequences described by Elliott et al. (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Import samples from Spain, where none of the regulated species are known to occur, and/or with late \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. Cq values were considered critical cases requiring test confirmation, which we aimed to achieve with ITS1 metabarcoding. The Spanish samples did not produce sequences clustering in clades containing the regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species. To our surprise, the use of ITS1 metabarcoding revealed a broader diversity of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species than previously recognized in citrus fruit imports, indicating that genus-level detection alone is insufficient for phytosanitary decision-making.\u003c/p\u003e \u003cp\u003eMetabarcoding of the ITS1 sequence does not provide species-level resolution and is therefore unsuitable for verifying regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species. However, it can be used to confirm the presence of non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species. For sequences clustering in clade 1, which includes the regulated species \u003cem\u003eE. citricola\u003c/em\u003e and \u003cem\u003eE. fawcettii\u003c/em\u003e, only mappings to MOTU_01 were obtained, representing these two species. Additionally, cluster analysis identified \u003cem\u003eE. fagarae\u003c/em\u003e (MOTU_32) within this clade, as its ITS1 sequence is similar to that of \u003cem\u003eE. fawcettii\u003c/em\u003e and \u003cem\u003eE. citricola\u003c/em\u003e. Therefore, the ITS1 sequences clustering in clade 1 likely originate from either \u003cem\u003eE. fawcettii\u003c/em\u003e or \u003cem\u003eE. citricola\u003c/em\u003e. For sequences in clade 5, which includes the regulated species \u003cem\u003eE. australis\u003c/em\u003e, mappings were obtained to MOTU_03. This MOTU represents \u003cem\u003eE. australis, E. genipae-americanae\u003c/em\u003e, and \u003cem\u003eE. punicae\u003c/em\u003e, all of which share identical ITS1 sequences. Consequently, these sequences originated from the regulated species or from another species represented by the MOTU. \u003cem\u003eE. punicae\u003c/em\u003e is a fungal pathogen responsible for scab disease in pomegranates (\u003cem\u003ePunica granatum\u003c/em\u003e, Lythraceae) and has been reported in Argentina, Brazil, Italy, China, India, Iran, and South Africa. Experimental studies suggest that \u003cem\u003eE. punicae\u003c/em\u003e is incapable of infecting citrus (Carstens et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Similarly, \u003cem\u003eE. genipae-americanae\u003c/em\u003e causes scab on the genip tree (\u003cem\u003eGenipa americana\u003c/em\u003e, Rubiaceae), which is native to tropical forests in the Americas (Fan et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). There is currently no available data on the ability of \u003cem\u003eE. genipae-americanae\u003c/em\u003e to occur on citrus. One of the metabarcoding sequences clustering in clade 5 (32902471-2) exhibited a single polymorphism (184 T\u0026thinsp;\u0026gt;\u0026thinsp;C, similarity\u0026thinsp;=\u0026thinsp;99.6%) compared to MOTU_03. This variation may represent intraspecific variation within one of the species in this clade or could indicate the presence of another species not included in this analysis. Clade 2 includes imported samples from Brazil and Colombia. This cluster is characterized by sequences of \u003cem\u003eElsino\u0026euml; centrolobii\u003c/em\u003e from Brazil on the deciduous tree \u003cem\u003eCentrolobium robustum\u003c/em\u003e (Fabaceae); \u003cem\u003eElsino\u0026euml; fici\u003c/em\u003e from Brazil on \u003cem\u003eFicus luschnathiana\u003c/em\u003e (Moraceae); \u003cem\u003eElsino\u0026euml; jasmini\u003c/em\u003e from Brazil on Arabian jasmine (\u003cem\u003eJasminum sambac\u003c/em\u003e; Oleaceae); and \u003cem\u003eElsino\u0026euml; randii\u003c/em\u003e from Brazil on pecan (\u003cem\u003eCarya illinoinensis\u003c/em\u003e, synonym \u003cem\u003eCarya pecan\u003c/em\u003e; Juglandaceae) (Fan et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). It should be noted that Fan et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) indicate that the Brazilian \u003cem\u003eE. fici\u003c/em\u003e strain included in their study is treated as synonymous to the type species but that it is believed to likely represent a distinct species from the original description in Java, Indonesia. The geographical overlap between the majority of import sample clade 2 sequences and the public sequences from Fan et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) in this clade is noteworthy. Clade 3 contains samples originating from Brazil, Colombia, Thailand and Vietnam. Two sequences from Colombia (41962257-2, 41853966-2) differ a single polymorphism (Δ108, 99.6% similarity) relative to MOTU_11 and could represent intraspecific variation or a different species. This cluster is characterized by sequences of \u003cem\u003eE. embeliae\u003c/em\u003e from India on false black pepper (\u003cem\u003eEmbelia ribes\u003c/em\u003e; Primulaceae) and \u003cem\u003eE. pongamiae\u003c/em\u003e from India on Indian beech tree (\u003cem\u003ePongamia pinnata\u003c/em\u003e; Fabaceae). Clade 4 contains samples originating from Colombia, Spain, South-Africa and Zimbabwe. The two sequences from Spain (33314516-1, 33314516-2) differ two polymorphisms (115 G\u0026thinsp;\u0026gt;\u0026thinsp;A and 119 G\u0026thinsp;\u0026gt;\u0026thinsp;A, 99.2% similarity) relative to MOTU_04 and could represent intraspecific variation or a different species. This cluster is characterized by sequences of \u003cem\u003eE\u003c/em\u003e. \u003cem\u003eanacardia\u003c/em\u003e from India on species from different plant families (sugar apple, \u003cem\u003eAnnona squamosa\u003c/em\u003e, Annonaceae; rose, \u003cem\u003eRosa\u003c/em\u003e sp., Rosaceae; and cashew, \u003cem\u003eAnacardium occidentale\u003c/em\u003e, Anacardiaceae) and \u003cem\u003eE. semecarpi\u003c/em\u003e from India on \u003cem\u003eMelanochyla caesia\u003c/em\u003e (Anacardiaceae). Fan et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) suggested that the fact the \u003cem\u003eE\u003c/em\u003e. \u003cem\u003eanacardia\u003c/em\u003e isolates analysed originate from distinct host families may indicate a potential error during the culturing and subsequent deposit of these cultures in collection. Alternatively, this species might have a broader host range than suspected.\u003c/p\u003e \u003cp\u003eCompared to real-time PCR, metabarcoding exhibits lower sensitivity for the detection of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species in symptomatic plant samples. Using real-time PCR, \u003cem\u003eElsino\u0026euml;\u003c/em\u003e DNA was detected in 51 out of 53 DNA extracts obtained from symptomatic plant material. Among the 34 samples with Cq values below 30, complete \u003cem\u003eElsino\u0026euml;\u003c/em\u003e ITS1 barcodes were obtained in 31 cases (91% success rate). Conversely, in the 19 samples with Cq values greater than 30, complete \u003cem\u003eElsino\u0026euml;\u003c/em\u003e ITS1 barcodes were successfully obtained in only three cases (16% success rate). The reduced analytical sensitivity of metabarcoding in this context is believed to be attributed to the non-specific amplification of rDNA from multiple sources (Abdelfattah et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), which is reflected by the multiple amplicons obtained with the rDNA barcode primers (S-Fig.\u0026nbsp;3). These sources include the host plant and other related fungal genera such as \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e, \u003cem\u003eColletotrichum\u003c/em\u003e, and \u003cem\u003eFusarium\u003c/em\u003e as detected with blast analysis of all obtained rDNA contigs (S-file 2). This competition for amplification likely limits the recovery of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e sequences. In instances where complete ITS1 barcodes were not recovered, \u003cem\u003eElsino\u0026euml;\u003c/em\u003e reads mapped to the reference sequences in some cases. However, these mappings did not span the entire reference sequence and were therefore considered unreliable for clustering analysis. Given the potential presence of multiple \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species in symptomatic samples as observed in this study, and the reduced analytical sensitivity of the metabarcoding test, we cannot rule out the possibility that regulated species may be present in samples where no \u003cem\u003eElsino\u0026euml;\u003c/em\u003e sequences from clades containing the regulated species were detected.\u003c/p\u003e \u003cp\u003eEven though we were able to include only a limited number of samples in the symptom-clade association, our results suggest that symptoms regarded as typical \u003cem\u003eE. fawcettii\u003c/em\u003e or \u003cem\u003eE. australis\u003c/em\u003e are not exclusive to those species. We used three categories to characterize the observed symptoms following (EPPO/OEPP, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2025a\u003c/span\u003e, EPPO/OEPP, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2025b\u003c/span\u003e). Typical symptoms caused by \u003cem\u003eE. fawcettii\u003c/em\u003e (category 1) include raised, scabby, and often irregular lesions. These lesions tend to be thicker, warty, and fissured, especially in more advanced stages of infection. Their appearance may vary in shape and colour depending on the citrus host and the infection stage. In contrast, symptoms typically associated with \u003cem\u003eE. australis\u003c/em\u003e (category 2) are generally larger, but flatter and smoother. These lesions are often less irregular and lack the strongly warty appearance characteristic of \u003cem\u003eE. fawcettii\u003c/em\u003e. Category 3 symptoms are attributed to mechanical or abiotic damage, including injury from thrips or wind. These usually appear as larger, scarred, and often corky patches, but are not raised or protuberant. In the samples from clades 2 and 3 (where regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species were absent) symptoms classified as category 1 and/or 2 were still observed. The average Cq value from real-time PCR for these samples was 26.2 (\u0026plusmn;\u0026thinsp;1.2). Although metabarcoding is less sensitive than real-time PCR, we would still expect to detect the regulated species if they were responsible for the observed symptoms. This expectation is based on the relatively low Cq values, which, if caused by regulated species, would likely indicate their presence in sufficient quantity to be detected by metabarcoding. However, only non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species were identified in these samples. In addition to the three symptom categories, a fourth category was observed, often interpreted as wind damage including lesions that are smaller, sunken, and flaky. These samples were not included in the current study on account of their relatively high Cq values, suggesting positive detection with the metabarcoding test is not possible.\u003c/p\u003e \u003cp\u003eUnderstanding the origin and ecological role of these non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species is crucial for assessing their potential risk to citrus production. Although the genus was first described over a century ago (Raciborski, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1900\u003c/span\u003e), key aspects such as host range, biology, and epidemiology of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. remain poorly understood (Pham et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Local spread of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. is typically attributed to rain splash, heavy dew or overhead irrigation (Brook, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e1973\u003c/span\u003e, Whiteside, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1988\u003c/span\u003e, Pham et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). However, ascospores from \u003cem\u003eE. veneta\u003c/em\u003e have been shown to travel up to 800 meters by wind, facilitating infection of nearby plants (Jones, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1924\u003c/span\u003e, Pham et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Similarly, non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species growing on hosts adjacent to citrus orchards could be dispersed via irrigation or rainfall. Alternatively, windborne ascospores could potentially play a role in their life cycle and serve as a source of introduction into orchard environments. These species may exhibit an opportunistic commensal relationship with damaged citrus fruits, while potentially acting as more aggressive pathogens on other host species. Rather than being strictly host-specific, some \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species could behave as opportunistic pathogens. Further research is needed to determine whether non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species are present on hosts near citrus orchards, whether they can act as opportunistic commensals, and whether dispersal occurs through wind or water.\u003c/p\u003e \u003cp\u003eValidation of diagnostic tests is essential to determine if tests are fit for purpose for their intended use under a specific application scope (EPPO/OEPP, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Given the discovery of non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on citrus fruits, additional testing is necessary to reassess the exclusivity (ability to distinguish target species from non-targets) of the current tests. For example, the single-copy \u003cem\u003eMS204\u003c/em\u003e real-time PCR test for \u003cem\u003eE. australis\u003c/em\u003e and \u003cem\u003eE. fawcettii\u003c/em\u003e was validated using only three non-target \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species (\u003cem\u003eE. centrolobi\u003c/em\u003e, \u003cem\u003eE. eucalypticola\u003c/em\u003e, and \u003cem\u003eE. veneta\u003c/em\u003e). This limited scope was initially justified based on the assumption of high host specificity. However, the findings reported in this manuscript indicate that further investigation is required. Particular focus should be put on closely related \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species in clades 1 and 5, but also the known species in clades 2, 3 and 4, as well as the \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species that were detected with the metabarcoding test. To include relevant related non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on citrus, they need to be identified first. This cannot be done with the current metabarcoding test, and culturing, morphological examination and sequencing of the fungal strains isolated from symptomatic material is needed. Ideally, this should be done prior to treatment and shipment of fruits, with sampling conducted at orchard sites of production. Since non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species have been detected in consignments originating from Africa, Asia, Europe, and South America, a coordinated and harmonized approach, involving local sampling and culturing prior to fruit treatment and shipment, would be most effective.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthical approval\u003c/h2\u003e \u003cp\u003eThis article did not contain any studies with human participants or animals performed by any of the authors.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConflict of interest\u003c/strong\u003e \u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003edeclaration\u003c/p\u003e \u003cp\u003eThe authors received no funding for this work.\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eBart van de Vossenberg, Ashleigh Elliott and Sietse van der Linde contributed to the study conception and design. Material selection and preparation were performed by Valerie van Ingen-Buijs, Mandy Wildhagen and Aron van Duijnhoven, data production and collection was performed by Tijs van den Bosch. Molecular analyses were performed by Bart van de Vossenberg and symptomatology assessments were performed by Valerie van Ingen-Buijs. The first draft of the manuscript was written by Bart van de Vossenberg, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThe authors are grateful to Michael Visser, Bas Berbers and Lucas van der Gouw (NVWA, the Netherlands) for their bio-informatic support and maintaining the analysis environment. We would also like to thank Pedro-Pablo Parra Giraldo (EURL Fungi and Oomycetes, ANSES, France) for critically reviewing the manuscript prior to submission.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbdelfattah, A., Malacrin\u0026ograve;, A., Wisniewski, M., Cacciola, S. O., \u0026amp; Schena, L. (2018). Metabarcoding: A powerful tool to investigate microbial communities and shape future plant protection strategies. \u003cem\u003eBiological Control\u003c/em\u003e, \u003cem\u003e120\u003c/em\u003e, 1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed, Y., Hubert, J., Fourrier-Jeandel, C., Dewdney, M. M., Aguayo, J., \u0026amp; Ioos, R. (2019). A Set of Conventional and Multiplex Real-Time PCR Assays for Direct Detection of \u003cem\u003eElsino\u0026euml; fawcettii\u003c/em\u003e, \u003cem\u003eE. australis\u003c/em\u003e, and \u003cem\u003ePseudocercospora angolensis\u003c/em\u003e in Citrus Fruits. \u003cem\u003ePlant Disease\u003c/em\u003e, \u003cem\u003e103\u003c/em\u003e, 345\u0026ndash;356.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrook, P. (1973). Epidemiology of grapevine anthracnose, caused by Elsinoe ampelina. \u003cem\u003eNew Zealand Journal of Agricultural Research\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e, 333\u0026ndash;342.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarstens, E., Langenhoven, S. D., Pierron, R., Laubscher, W., Serfontein, J. J., Bezuidenhout, C. M., et al. (2018). \u003cem\u003eElsino\u0026euml;\u003c/em\u003e punicae causing scab of pomegranates in South Africa does not cause disease on citrus. \u003cem\u003eAustralasian Plant Pathology\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e, 405\u0026ndash;411.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEFSA. (2017). Pest categorisation of \u003cem\u003eElsino\u0026euml; fawcettii\u003c/em\u003e and \u003cem\u003eE. australis\u003c/em\u003e. \u003cem\u003eEFSA Journal\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e, e05100.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElliott, A. J., van Raak, M. M. J. P., Barnes, A. V., Field, C. J., van Duijnhoven, Aron, A. L. A. M., Webb, K., \u0026amp; van de Vossenberg, B. T. L. H. (2023). Real-Time PCR Detection of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. \u003cem\u003eon Citrus PhytoFrontiers\u0026trade;\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e, 164\u0026ndash;172.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEPPO/OEPP. (2021). PM 7/98 (5) Specific requirements for laboratories preparing accreditation for a plant pest diagnostic activity. \u003cem\u003eEPPO Bulletin\u003c/em\u003e, \u003cem\u003e51\u003c/em\u003e, 468\u0026ndash;498.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEPPO/OEPP. (2024). PM 7/76 (6) Use of EPPO Diagnostic Standards. \u003cem\u003eEPPO Bulletin\u003c/em\u003e, \u003cem\u003e54\u003c/em\u003e, 312\u0026ndash;316.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEPPO/OEPP (2025a). \u003cem\u003eElsino\u0026euml; australis\u003c/em\u003e, EPPO datasheets on pests recommended for regulation. \u003cem\u003eEPPO global database\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEPPO/OEPP (2025b). \u003cem\u003eElsino\u0026euml; fawcettii\u003c/em\u003e, EPPO datasheets on pests recommended for regulation. \u003cem\u003eEPPO global database\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEU (2016). Regulation (EU) 2016/2031 of the European Parliament and of the Council of 26 October 2016 on protective measures against pests of plants. \u003cem\u003eOfficial Journal of the European Union\u003c/em\u003e, pp. 4\u0026ndash;104.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan, X. L., Barreto, R. W., Groenewald, J. Z., Bezerra, J. D., Pereira, O. L., Cheewangkoon, R., et al. (2017). Phylogeny and taxonomy of the scab and spot anthracnose fungus \u003cem\u003eElsino\u0026euml;\u003c/em\u003e (Myriangiales, Dothideomycetes). \u003cem\u003eStudies In Mycology\u003c/em\u003e, \u003cem\u003e87\u003c/em\u003e, 1\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuerrero, M. (2024). \u003cem\u003eCitrus Annual. (Kuypers\u003c/em\u003e (p. 26). K., ed.). United States department of agriculture.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIoos, R., Fourrier, C., Iancu, G., \u0026amp; Gordon, T. R. (2009). Sensitive Detection of Fusarium circinatum in Pine Seed by Combining an Enrichment Procedure with a Real-Time Polymerase Chain Reaction Using Dual-Labeled Probe Chemistry. \u003cem\u003ePhytopathology\u0026reg;\u003c/em\u003e, \u003cem\u003e99\u003c/em\u003e, 582\u0026ndash;590.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJones, L. K. (1924). \u003cem\u003eAnthracnose of cane fruits and its control on black raspberries in Wisconsin\u003c/em\u003e. Agricultural Experiment Station of the University of Wisconsin.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatoh, K., \u0026amp; Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. \u003cem\u003eMolecular Biology And Evolution\u003c/em\u003e, \u003cem\u003e30\u003c/em\u003e, 772\u0026ndash;780.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeigh, J. W., \u0026amp; Bryant, D. (2015). popart: full-feature software for haplotype network construction. \u003cem\u003eMethods in Ecology and Evolution\u003c/em\u003e, \u003cem\u003e6\u003c/em\u003e, 1110\u0026ndash;1116.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOndov, B. D., Bergman, N. H., \u0026amp; Phillippy, A. M. (2011). Interactive metagenomic visualization in a Web browser. \u003cem\u003eBmc Bioinformatics\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e, 385.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePham, N. Q., Wingfield, B. D., Barnes, I., Gazis, R., \u0026amp; Wingfield, M. J. (2025). Elsinoe species: The rise of scab diseases. \u003cem\u003ePlant Pathology\u003c/em\u003e, \u003cem\u003e74\u003c/em\u003e, 39\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrice, M. N., Dehal, P. S., \u0026amp; Arkin, A. P. (2010). FastTree 2 \u0026ndash; Approximately Maximum-Likelihood Trees for Large Alignments. \u003cem\u003ePLOS ONE\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e, e9490.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaciborski, M. (1900). \u003cem\u003eParasitische Algen und Pilze Java's\u003c/em\u003e. Staatsdruckerei.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite, T. J., Bruns, T., Lee, S., \u0026amp; Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. \u003cem\u003ePCR protocols: a guide to methods and applications\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e, 315\u0026ndash;322.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhiteside, J. (1988). Factors contributing to the rare occurrence of scab on sweet orange in Florida.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEthics declarations.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"metabarcoding, citrus, ITS1, High Throughput Sequencing","lastPublishedDoi":"10.21203/rs.3.rs-6631223/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6631223/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCitrus fruits such as oranges, lemons, limes, grapefruits, and tangerines are economically significant crops worldwide. The EU is a net importer of citrus fruits to meet consumer demand, with the Netherlands functioning as a key distribution hub. Citrus fruit imports may pose a risk to EU production, particularly through the introduction of regulated plant pathogens. Considering that only the three regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species were known to occur on citrus fruits, the diagnosis of the regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species in the Netherlands was based on a genus-level real-time PCR detection combined with symptom analysis, host plant species, and origin of the fruits. Import samples originating from countries where none of the regulated species are known to occur, as well as samples exhibiting late \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. Cq values, raised questions regarding the presumed host specificity of \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species. Metabarcoding was performed in an attempt to determine presence of the (regulated) \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species in symptomatic citrus samples from Asia, Africa, Europe and South America, representing nine countries and five hosts. Surprisingly, the ITS1 barcode revealed the presence of non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on symptomatic fruits. In some consignments presence of several different species was observed. Symptoms typically associated with \u003cem\u003eE. fawcettii\u003c/em\u003e and \u003cem\u003eE. australis\u003c/em\u003e were observed on fruits in which only non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e spp. were detected. This further underlines the limitations to distinguish the regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species from other organisms based on symptomology. The occurrence of non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on citrus fruit prevents accurate diagnosis of regulated pests following a positive genus-level test. Culturing and identification of the non-regulated species on citrus fruits is needed. Additionally, broader validation of alternative diagnostic tests is required to demonstrate their ability to distinguish regulated pathogens from non-regulated \u003cem\u003eElsino\u0026euml;\u003c/em\u003e species on citrus fruits.\u003c/p\u003e","manuscriptTitle":"Presence of non-regulated Elsinoë species on citrus fruits and their impact on regulatory plant health diagnostics","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-21 10:54:05","doi":"10.21203/rs.3.rs-6631223/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-05-21T16:32:37+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-19T06:30:30+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"European Journal of Plant Pathology","date":"2025-05-16T04:13:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-15T06:46:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Plant Pathology","date":"2025-05-13T02:49:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-plant-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejpp","sideBox":"Learn more about [European Journal of Plant Pathology](http://link.springer.com/journal/10658)","snPcode":"10658","submissionUrl":"https://www.editorialmanager.com/ejpp/default2.aspx","title":"European Journal of Plant Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"2f2ce1e7-db88-4dd5-99f3-a56cff263d89","owner":[],"postedDate":"May 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-22T16:06:21+00:00","versionOfRecord":{"articleIdentity":"rs-6631223","link":"https://doi.org/10.1007/s10658-025-03168-0","journal":{"identity":"european-journal-of-plant-pathology","isVorOnly":false,"title":"European Journal of Plant Pathology"},"publishedOn":"2025-12-18 15:58:28","publishedOnDateReadable":"December 18th, 2025"},"versionCreatedAt":"2025-05-21 10:54:05","video":"","vorDoi":"10.1007/s10658-025-03168-0","vorDoiUrl":"https://doi.org/10.1007/s10658-025-03168-0","workflowStages":[]},"version":"v1","identity":"rs-6631223","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6631223","identity":"rs-6631223","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}