Development of a quadruple PCR-based gene microarray for detection of vaccine and wild-type classical swine fever virus, African swine fever virus and atypical porcine pestivirus.

preprint OA: closed
Full text JSON View at publisher

Abstract

Background: Classical swine fever (CSF), African swine fever (ASF) and atypical porcine pestivirus (APPV) are acute, virulent and contagious viral diseases currently hampering pig industry in China, which result in mummification or stillbirths in piglets and mortality in pigs. Diagnostic assay for the differentiation of infection and vaccination of CSFV in addition to the detection of ASFV and APPV are urgently required for better prevention, control and elimination of these viral diseases in China. Methods: : A quadruple PCR-based gene microarray assay was developed in this study to simultaneously detect wild type and vaccine CSFV strains, ASFV and APPV according to their conserved regions. 42 laboratory confirmed samples including positive samples of other 10 swine viral diseases were tested using this assay to confirm its high specificity. Results: : The limit of detections (LODs) of this assay for the wild type and vaccine CSFV were 6.98 and 6.92 copies/µL. LODs for ASFV and APPV were 2.56 ×10 and 1.80×10 copies/µL, respectively. When compared with standard RT-PCR or qPCR for CSFV (GB/T 26875-2018), ASFV (MARR issue No.172) or APPV(CN108611442A)using 219 clinical samples, the coincidence was 100%. The results showed that this assay with high sensitivity can specifically distinguish ASFV, APPV and CSFV including CSFV infection and immunization. Conclusion: This assay provides a practical, simple, economical and reliable test for the rapid detection and accurate diagnosis of the three viruses, and may have good prospects for application in epidemiological investigation, prevention and control and elimination of these three diseases.
Full text 125,820 characters · extracted from preprint-html · click to expand
Development of a quadruple PCR-based gene microarray for detection of vaccine and wild-type classical swine fever virus, African swine fever virus and atypical porcine pestivirus. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of a quadruple PCR-based gene microarray for detection of vaccine and wild-type classical swine fever virus, African swine fever virus and atypical porcine pestivirus. Ying-ju Xia, Lu Xu, Jun-jie Zhao, Yuan-xi Li, Rui-zhi Wu, Xiang-peng Song, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2011818/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Background: Classical swine fever (CSF), African swine fever (ASF) and atypical porcine pestivirus (APPV) are acute, virulent and contagious viral diseases currently hampering pig industry in China, which result in mummification or stillbirths in piglets and mortality in pigs. Diagnostic assay for the differentiation of infection and vaccination of CSFV in addition to the detection of ASFV and APPV are urgently required for better prevention, control and elimination of these viral diseases in China. Methods: A quadruple PCR-based gene microarray assay was developed in this study to simultaneously detect wild type and vaccine CSFV strains, ASFV and APPV according to their conserved regions. 42 laboratory confirmed samples including positive samples of other 10 swine viral diseases were tested using this assay to confirm its high specificity. Results: The limit of detections (LODs) of this assay for the wild type and vaccine CSFV were 6.98 and 6.92 copies/µL. LODs for ASFV and APPV were 2.56 ×10 and 1.80×10 copies/µL, respectively. When compared with standard RT-PCR or qPCR for CSFV (GB/T 26875-2018), ASFV (MARR issue No.172) or APPV(CN108611442A)using 219 clinical samples, the coincidence was 100%. The results showed that this assay with high sensitivity can specifically distinguish ASFV, APPV and CSFV including CSFV infection and immunization. Conclusion: This assay provides a practical, simple, economical and reliable test for the rapid detection and accurate diagnosis of the three viruses, and may have good prospects for application in epidemiological investigation, prevention and control and elimination of these three diseases. Classical swine fever African swine fever atypical pestivirus polymerase chain reaction differential diagnosis gene chip Figures Figure 1 Figure 2 Figure 3 Introduction Classical swine fever (CSF) is an acute, febrile, highly contagious and lethal infectious disease caused by classical swine fever virus (CSFV) belonging to pestivirus, Flaviviridae family [ 1 ]. It is an OIE notified animal disease and defined as the highly pathogenic microorganism in China [ 2 ]. It naturally infects domestic pigs and wild boars only despite of age, gender, species and seasons [ 3 ]. African swine fever (ASF) is an acute, hemorrhagic, lethally disease caused by African swine fever virus (ASFV), which is also an OIE notified disease [ 4 ]. It is characterized as short onset, 100% lethal in most acute and acute cases [ 5 ]. Atypical Porcine pestivirus (APPV) also known as congenital tremor or “dancing piglet”, resulted in paroxysmal contracture in head, legs and other parts of body muscles in piglets, which consequently caused piglets lost ability to stand and suck milk, even to die [ 6 , 7 ]. It was first reported in 2017 in Guangdong Province in China, and subsequently reported in piglets in other places, which indicated its epidemic in China [ 8 ]. Currently, the above three diseases are epidemic in China [ 9 , 10 , 11 ], therefore a fast and differential diagnosis of these three diseases in clinical is important. In addition, prevention and control of CSF in China mainly relies on vaccination with C strain which contributes to CSF control globally [ 12 ]. However, chronic and atypical infection still occur, bringing challenges to CSF prevention and control [ 13 ]. Since we are lack of effective clinical test to differentiate diagnosis between wild type and vaccine CSFV. There is no effective vaccine or treatment available for ASFV and APPV. It is essential to develop an assay to simultaneously detect the above four viruses. Recently, gene microarray has been widely used in the medical field and has achieved outstanding results in the research of gene expression, pathogenesis, clinical diagnosis, drug development and biological detection [ 14 – 15 ]. In this study, a gene microarray assay was developed to distinguish these three pathogens including wild type and vaccine CSFV strains, respectively. Three pairs of primers and corresponding probes were designed based on the conserved region of CSFV, ASFV and APPV to establish a reliable and rapid gene microarray assay for the differential diagnosis of ASFV, APPV and CSFV, which will be useful for clinical diagnosis as well as epidemiological investigation of these diseases in large-scale pig farms. Materials And Methods Viruses and clinical samples Wild type CSFV strains, and vaccine strains (C strain and Thiversal strain) used in this study were isolated and storied by national reference laboratory for CSF at Institute of China Veterinary Drug Control (IVDC). Japanese encephalitis virus(JEV), bovine viral diarrhea virus(BVDV), porcine reproductive and respiratory syndrome virus(PRRSV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine circovirus 1(PCV1), porcine circovirus 2(PCV2), porcine parvovirus (PPV) and pseudorabies virus (PRV) were provided by China Animal Disease Control Center(CADC). ASFV positive samples were disinfected and provided by Harbin Veterinary Research Institute (HVRI) of Chinese Academy of Agricultural Sciences (CAAS).APPV clinical samples were kindly provided by Prof. Xu Zhiwen from Sichuan Agricultural University(SAU). Detailed information of these samples were shown in Table 1 . Table 1 Strain information Virus Sample Name Sample number Virus Sample Name Sample number Shimen 1 HBJZ1 22 BJYQ1 2 LNCY1 23 SX4 3 SCMY1 24 HeBHD2 4 CSFV HBXY4 25 HeBHH1 5 HBXY5 26 HeBBD1 6 ZYBJ1 27 TJNH1 7 HeBBD4 28 HeBJZ1 8 Thiveosal strain 29 HeBQHD1 9 Chinese strain 30 CSFV HeNZZ1 10 ASFV HuBES4 31 HBES2 11 APPV SCMY1 32 ZJHZ1 12 FMDV 33 HENZMD1 13 BVDV 34 HeNXC3 14 PCV-1 35 JSXZ1 15 PCV-2 36 GXFL1 16 Other PRV 37 HeBCB2 17 PPV 38 HENZMD2 18 PRRSV 39 HeNXC1 19 TGDV 40 HBHG1 20 PEDV 41 HBHM1 21 JEV 42 Primers and probes Based on the gene sequences of CSFV wild type (CSFV-W) and vaccine strains (CSFV-V) published in GenBank, as well as the reference strains of ASFV and APPV, five pairs of specific primers with a biotin tag and the corresponding gene microarray probes were designed. The 5'UTR is the most conserved region for CSFV, which was used for primer design as a universal detection target for CSFV. The NS5B gene in the vaccine strains has one-base different compared to CSFV-W, and the primer and probe were designed to only amplify CSFV-V based on an amplification refractory mutation system PCR principle (ARMS-PCR). The conserved B646L (encoding p72) gene and the conserved 5'UTR of porcine APPV were selected for primer and probe design of ASFV and APPV, respectively. Beta-globin gene (GenBank: AH001475.2) was selected for the primers and probe design for PCR internal controlDetailed information of primers and probes used in this study can be found in Table 2 and Table 3 . Table 2 Primers used in this study Name of Primers a Primer sequence(5’→3’) Target gene Product size (bp) CSFV-W-F GGAGGGACTAGCCRTAGTG 5’UTR 77 CSFV-W-R ACGTCGAACTACTGACGACTG-biotin CSFV-V-F CCTTCGGGGAGAAAGTAACGAT NS5B 97 CSFV-V-R CCTACCACAGTCACGGCT-biotin ASFV-F TATATTGGCCCAAGACTTGCT B646L 119 ASFV-R GCACCAAATGTGTTTCTTCGAT-biotin APPV-F CAGACGTCACCGAGTAGTACACC -biotin 5’UTR 134 APPV-R CCCAGGTCCACCACCGAT IC-F AAGTCTGCCGTTACTGCC-biotin Beta-globin 83 IC-R TAACCTTGATACCAACCTGC Biotin has been attached to the primers. Activated streptavidin (SA) and horseradish peroxidase (HRP) are covalently conjugated to the membrane of the microarray. When primers have specifically amplified the expected PCR product, the product can hybridize with probes on the microarray, and biotin can interact with SA-HRP. Subsequently incubated with TMB which can produce a deep blue color during the enzymatic degradation of hydrogen peroxide by HRP and determine the results. a : CSFV-W-P: probe for detection of wild type CSFV; CSFV-V-P: probe for detection of CSFV vaccine strains. Table 3 Probes used in this study Name of Probes a Probe sequence(5’→3’) Length of the probe (bp) CSFV-W-P CCCTGGGTGGTCTAAGTCCTGAGTACAG 29 CSFV-V-P ATGCAGGAGGAGATAACCTTGCAGCC 26 ASFV-P AACCCGATCCCGAACCCACT 20 APPV-P ATGCCCACGTCCACCCAAGCC 21 IC-P CCACCAACTTCATCCACGTTCACC 24 CSFV-W-P: probe for detection of wild type CSFV; CSFV-V-P: probe for detection of CSFV vaccine strains. Development of the quadruple PCR ASFV viral DNA, CSFV and APPV viral RNAs were extracted according to manufactory’s instruction (TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0, Cat:9766). A quadruple one-step RT-PCR was developed as following: PrimeScript one step Enzyme Mix 1µL, 2×Super Multiplex PCR Mix 12.5µL, five pair of primers 1µL each, RNA/DNA template 4µL each, IC plasmid 1µL, Sterilized double distilled water (ddH2O) up to 25µL. The annealing temperature (56 ℃、58 ℃、60 ℃、62 ℃、64℃), concentration of primers (final concentration 3.2 pmol/µL, 2.4 pmol/µL, 1.6 pmol/µL, 0.8pmol/µL) and extension period were optimized respectively to get an efficient and time-saving PCR assay. An internal control and an external control were also set up in this assay. Preparation for microarray 2%EDC (1-3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) and 1.21% NHS(w/v,CN-hydroxysuccinimide) were fully dissolved in ultrapure water for preparation of the activation solution. 76 mm×65 mm modified silica membranes were placed in an activation bath with the front side up and 15ml per membrane activation solution was poured evenly into the bath to completely immerse the membrane surface for 30 minutes. Subsequently, the membrane was washed for three times with ultrapure water and blown dry with nitrogen to ensure the membrane surface is dry and clean. The activated membranes were loaded onto the membrane rack to assemble a 48-well plate which were then loaded into the corresponding positions on the spotter. The probes were diluted to a final concentration of 6µM, and 4µL was added to each well. The parameter of the spotter was set to 100 drop and the probes were dispensed onto the 48-well assembly of modified silica membranes according to the pre-arranged dispensing sequence to assemble the gene chips. The diagram of chip spot pattern was shown on Fig. 1 . Specific probes were dispensed onto each well as demonstrated in the diagram. The outside four spots were negative and positive controls: Biotin is the control for monitoring the efficient hybridization on microarray. IC-P is control for monitoring the efficient PCR progress and also indicated the direction for results interpretation. APPV, ASFV, CSFV-W and CSFV-V were dispensed inside Design and composition of gene chip Preparation of Hybridization Buffer A, Elution Buffer B and Rinse Buffer C as follows. Hybridization Buffer A: mixed up 10 mL of 20×SSC and 1 mL of 10% SDS into purified water up to 100 mL. Elution Solution B: took 3 mL of 20× SSC and 1.2 mL of 10% SDS together with purified water to 120 mL and mixed thoroughly. Rinse Solution C: took 10 mL of 1 mol sodium citrate into purified water to 100 mL and mixed thoroughly. All three buffers were stored at room temperature for up to 6 months. Preheated the chip and Buffer B at 47℃. Mixed 10 µL of PCR product with 110 µL of Buffer A and added to the chip at 120 µL/well at 47°C 200 r/min for 5 minutes. Washed three times with pre-warmed Buffer B (100 µL/well). SA-HRP was diluted at the ratio of 1:2000 with Buffer A, and then added to the wells with 100 µL/well followed by 47°C 200 r/min incubation for 5 minutes. The chip was then washed twice with Buffer A (100 µL/well), and then twice with Buffer C (100 µL/well) at room temperature. 60 µL/well of TMB was added and incubated at dark for 1 min, and then washed twice with purified water (200µL/well) and blow dry gently with a compressed air canister for final results interpretation. Result interpretation The test is validated if the Biotin spot on the gene chip presented clearly dark blue and at least one of the two IC-P probe spots is colored. If CSFV-W spot is blue, it means the sample is CSFV-W nucleic acid positive. If CSFV-W and CSFV-V spots are both blue, it represents that the sample is CSFV-V nucleic acid positive. If ASFV or APPV spot has no color, it means the sample is ASFV or APPV negative. Otherwise, if blue color shows on the spot, the result is positive. Generation of positive control plasmid Five pairs of specific primers were designed to amplify the 5' UTR of CSFV-W Shimen strain, the NS5B gene fragment of CSFV-V C strain, the 5' UTR gene fragment of ASFV/HuBES4 strain and the 5' UTR gene fragment of APPV/SCMY1 strain. The PCR products of ASFV/HuBES4 was gel purified and cloned into pUC57 vector to construct a recombinant plasmid. The rest three PCR products were gel purified and cloned into pGEM-T vector, respectively. The recombinant plasmids were sequenced for confirmation, and the sequencing results were analyzed using DNAStar (version 7.1) and NCBI Nucleotide Blast. The correct recombinant plasmids were then used as standard materials and named as CSFV-W-p, CSFV-V-p, ASFV-p and APPV-p, respectively (Table 4 ). Table 4 PCR primers for generation of recombinant plasmids Name of Primers Sequence of primer(5’→3’) Product size(bp) Targen gene CSFV-W-F GAGGTTAGTTCATTCTCGTATACACGA 310 5’UTR CSFV-W-R TATCAGGTCGTACTCCCATCAC CSFV-V- F CCCTTCACAACCTTACCCGACTGATTG 295 NS5B CSFV-V- R CAGGCCTGAACCTGAGCTGGTGAAC ASFV-F AGTTATGGGAAACCCGACCC 257 p72 ASFV- R CCCTGAATCGGAGCATCCT APPV-F CGCGGATCCACAGCCTACTGATGATCAGTCGATG 336 5’UTR APPV-R CCGGCACTCTATCAAGCAGTAAGGTC Specificity test The developed quadruple PCR combined with gene chip assay were used to test the specificity of 42 clinical samples with different swine diseases shown in Table 1 , including 28 current circulating CSFV-W strains identified by our laboratory, two CSFV-V strains, ASFV and APPV samples and 10 other common swine viral disease samples. Sterilized double distilled water was used as negative control. The specificity of the gene chip was evaluated based on these results. Sensitivity test CSFV-W-p, CSFV-V-p, ASFV-p and APPV-p were diluted in a 10-fold gradient ((10 − 8 -10 − 1 ) for sensitivity test by performing CSFV-W-p, ASFV-p and APPV-p single PCR and gene chip assays, CSFV-(W + V)-p duplex assays and then quadruple assay, respectively. The limits of detection (LOD) of each virus in this assay was calculated using the Dalton copy number formula [copy number = plasmid concentration×6.02×10 23 /(660×plasmid length)]. The sensitivity of the established quadruple PCR combined with the gene chip assay was evaluated based on the LOD of the single or quadrupled diluted plasmids. Detection of clinical samples To evaluate the accuracy of the gene chip assay for differential diagnosis of field samples, 219 clinical samples (20 spleen, 20 kidney, 20 lymph nodes and 159 whole blood samples) from a pig farm in Haidian, Beijing (BJHD), Dianjiang, Chongqing (CQDJ), Wanyuan, Sichuan (SCWY) and Baoding, Hebei (HeBBD) and HVRI were tested using this assay, and the results were compared with the results conducted from national standards or published methods including CSFV RT-nPCR assay (GB/T 26875 − 2018), ASFV real-time qPCR assay (Ministry of Agriculture and Rural Affairs Announcement No. 172) and APPV traditional PCR assay (CN108611442A). Thus, to verify again the specificity and sensitivity of this assay. Results Optimization of quadruple RT-PCR Final optimized PCR composition and condition were as following: a master mix of 25µL reaction is composed of 1µL of Primscript RT Master Mix, 12.5µL of 2×Super Multiplex PCR Mix, 1µL of each primer (final concentration was 3.2 pmol/µL)1µL of IC plasmid, 1µL of template DNA, 3.5µL of ddH20. The parameters for quadruple RT-PCR starts with reverse transcription at37℃ for 15min followed by inactivation of reverse transcriptase at 85℃ for 10s; then with a denaturation step at 95℃ for 2min, followed by a 35 cycles of denaturation at 98℃ for 15s, annealing/extension at 60℃ for 20s. PCR products then store at 4℃ for later use. Construction of standard plasmid as positive amplification control The CSFV-W-p, CSFV-V-p, ASFV-p and APPV-p plasmids were constructed as positive control for PCR amplification using the specific primers CSFV-W-5'UTR-F/R, CSFV-V-NS5B-F/R, ASFV-p72- F/R and APPV-5'UTR-F/R. The PCR products were 310bp for CSFV-W, 295bp for CSFV-V target gene, 257bp for ASFV and 336bp for APPV as expected. The PCR products were then purified, ligated with plasmid, and transformed into DH5α for clone selection. Finally, the positive clones were confirmed by PCR and sequencing. Results showed that all the plasmids have the right insertion sequence as their template sequence indicated on NCBI GenBank. The concentration of these plasmids were determined by NanoDrop™ 1000 fluorospectrometer and the copy number of each plasmid was calculated by Dalton method, which were 3.04×10 10 copies/µL, 4.16×10 10 copies/µL, 3.81×10 10 copies/µL and 4.04×10 10 copies/µL respectively. Specificity analysis The results of the gene microarray assay on 42 validated samples showed that the Biotin and IC plasmid control were all in blue indicating that the assay was valid. 28 CSFV-W strains were have CSFV-W spot in blue but not CSFV-V spot indicating they were wild type CSFV. The two vaccine strains (Chinese strain and Thiveosal strain) showed blue at both CSFV-W and CSFV-V spot indicating they were vaccine strains. The ASFV/HuBES4 and APPV/SCMY1 strains showed blue at ASFV or APPV spot respectively, demonstrating its success in detecting ASFV and APPV. The other 10 swine viral diseases samples were all negative for CSFV-W, CSFV-V, ASFV and APPV with no color at the four spots, further confirming the high specificity of this assay (Fig. 2 ). 42 validated samples were tested using this gene microarray assay to determine the specificity of this assay. The results of each detection well were recorded as above. The name of the viruses detected was showed on top of each detection well. Sensitivity analysis Four positive plasmids CSFV-W-p, CSFV-(W + V)-p, ASFV-p and APPV-p were tested with series dilutions ranging from 10 8 copies/µL to 10 − 1 copies/µL. The LOD was 6.98 copies/µL for CSFV-W-p(Fig. 3 a), 6.92 copies/µL for CSFV-(W + V)-p(Fig. 3 b); 2.56×10 copies/µL for ASFV-p(Fig. 3 c); and 1.8×10 copies/µL for APPV-p(Fig. 3 d), respectively. The mixture of the four plasmids were also texted for the quadruple assay with 1 µL of each plasmid and the concentration was ranging from 10 8 copies/µL to 10 − 1 copies/µL. The LOD of the quadruplet test was illustrated as the minimum amount of plasmids used to ensure all the four target genes being detected. The results showed that the minimum detection limit of the quadruple assay was 2.9×10 copies/µL of each plasmid (Fig. 3 ). Four positive plasmids CSFV-W-p(a), CSFV-(W + V)-p(b), ASFV-p(c) and APPV-p(d) were tested separately and jointly (e) using plasmids specific for each antigen with serious dilutions ranging from 10 8 copies/µL to 10 − 1 copies/µL. C was the negative control. Detection of clinical samples 219 clinical samples collected by our laboratory in recent years were tested by this assay as well as standard methods for CSFV, ASFV and APPV for simultaneous comparison. The results showed that 54 samples were positive for CSFV-W, 41 were positive for CSFV-V, 9 were positive for ASFV, 10 were positive for APPV, and 106 were negative. CSFV RT-nPCR followed by sequencing showed 54 samples were wild type CSFV strains, 41 were CSFV vaccine strains. 9 samples were positive for ASFV qPCR method and 10 samples were positive for APPV conventional RT-PCR method. The rest 106 samples were negatives for the three methods. The results of the gene chip were 100% consistent with the other three standard detection methods, indicating that the established gene chip assay can rapidly and accurately identify CSFV-W, CSFV-V, ASFV and APPV in the field, and is practical for differential diagnosis, surveillance and elimination of CSFV, ASFV and APPV. Table 5 Results for clinical samples Sample type Positive samples/rate by gene chip Positive samples/rate by standard methods CSFV-W 54/24.7% 54/24.7% CSFV-V 40/18.3% 40/18.7% ASFV 9/4.1% 9/4.1% APPV 10/4.6% 10/4.6% Negative samples 106 106 In total 219 219 coincidence rate % 100% Discussion Before 2016, CSF in China was under controlled with the effort of the compulsory vaccination policy of C strain vaccine [ 16 , 17 ]. However, with the development of intensive farming, many large-scale pig farms have been built in China and the compulsory vaccination policy has been replaced by overall vaccination since July 2016, the epidemiology of CSFV in turn has changed significantly [ 18 ]. Chronic and atypical CSF become dominant in epidemic outbreaks, which characterized as sporadic, vulnerable in young age, persistent infection, complex onset and immune tolerance, which have brought new challenges to the prevention and control of CSF [ 19 , 20 ]. In particular, it is clinically difficult to distinguish between infection and vaccination, which brings new challenges to the prevention, control and elimination of CSFV in China. The outbreaks of ASF in 2018 in China has devastating impact on the country's pig industry [ 21 ]. With the rapid response of our government and a series of precise control policies, the outbreak has been effectively controlled and the pig industry has been recovering in an orderly way [ 22 ]. In 2021, however, new situations for ASF epidemic in China have emerged, which showed reduced mortality, atypical clinical signs, and some "natural variant strains" showed no hemadsorption (HAD) [ 23 ]. These natural variant ASFV strains caused subclinical symptoms, which were difficult to identify and detect at the early stage and can be easily confused with other diseases, leading to problems in differential diagnosis and prevention and control of ASFV [ 24 ]. APPV, commonly known as "piglet shivering disease" or "jumping disease", is a disease in which piglets’ exhibit paroxysmal muscle movements in the head, limbs and other parts of the body [ 25 ]. It can cause piglets difficulties in standing, blocked suckling and even death. It is estimated that the number of piglets weaned by APPV infected sows could reduce by 10%, and the mortality rate of newborn piglets affected by APPV could rise up to 30% due to malnutrition [ 26 ]. APPV is widespread in pig herds throughout China and the world, posing a serious threat to pig industry [ 27 ]. CSFV, ASFV and APPV have become three important contagious virulent infectious diseases in China, which show similar clinical signs and are difficult to distinguish from each other. It is, therefore, critical to develop a simple, rapid, specific and sensitive assay to differential diagnose these three diseases. The sensitivity of the gene chip assay developed in this study is 6.98 copies/µL and 69.2 copies/µL for CSFV-W and CSFV-V respectively, which is higher than some published CSFV RT-PCR assays, demonstrating the advantage of the gene chip assay in sensitivity. In the current study, after looking through the 5’UTR gene sequences of 30 CSFV field strains preserved in our laboratory and 10 published strains on NCBI and 4 vaccine strains, we found that the 5'UTR was highly conserved among them and many CSFV RT-PCR diagnostic methods also chose this region for primer design [ 28 , 29 ]. NS5B is an RNA polymerase involved in viral genome replication and is one of the popular target for CSFV genotyping. We found there was a base difference between the vaccine and wild strains in the NS5B region which was then used for MGB probe designed to specifically binding to the NS5B gene of CSFV vaccine strains. It is not only practical to C strain, which is widely used in China, but also applicable to the CSFV low-temperature mutagenesis vaccine (Thiveosal strain). The biological reaction between samples and the gene chip is critical for the success detection and subsequent analysis of the gene chip assay. The size of the gene probe and the length of PCR products on the microarray are also important factors affecting the hybridization signal of the microarray [ 30 ]. Therefore, the length of the probes designed in this experiment is less than 30 bp, and the length of the PCR products is less than 100 bp, thus ensuring a stable and clear signal response. To facilitate the interpretation of the microarray results, primers were labelled with biotin that has good affinity with streptavidin. After quadruple PCR amplification, the products were combined with the probe on the microarray and reacted with the HRP-labelled streptavidin. Conventional gene microarrays usually use aldehyde-based slides as support and take longer time for detection. This assay use "0 + X" nano-membranes (0 for zero background and X for various probes) supported by high-topping materials which significantly reduces the reaction time compared to conventional one, resulting in significant time and cost savings. The hybridization process is simple and time-consuming. The results are fully consistent with those of national standard assays. The assay also allows for the addition of other swine infectious diseases other than the three diseases we target in this study. Therefore, the gene chip assay has potential use in the diagnosis and surveillance for swine and other animal diseases. Conclusion In this study, a novel gene chip assay was developed for rapid clinical identification of CSFV wild type strains and vaccine strains, ASFV and APPV with high specificity and sensitivity. This assay provides a practical, simple, economical and reliable way for the rapid and accurate diagnosis of CSFV, ASFV and APPV, and also provides a platform and new thoughts for multiple animal diseases detection using gene chips. Abbreviations ARMS-PCR amplification refractory mutation system PCR principle ASFV African swine fever virus APPV atypical porcine pestivirus BVDV bovine viral diarrhea virus CSFV-W classical swine fever virus wild type CSFV-V classical swine fever virus vaccine strains HAD hemadsorption IVDC Institute of China Veterinary Drug Control JEV Japanese encephalitis virus MGB minor groove binder NCBI National Center for Biotechnology Information NS5B Nonstructural protein 5B PCV1 porcine circovirus 1 PCV2 porcine circovirus 2 PEDV porcine epidemic diarrhea virus PRRSV porcine reproductive and respiratory syndrome virus PRV pseudorabies virus RT-PCR reverse-transcription polymerase chain reaction TGEV transmissible gastroenteritis virus PPV porcine parvovirus 5’UTR five prime untranslated region. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials All data generated or analyzed during this study are included in this published article. Competing interests The authors declared no competing interests. Funding This work was supported by the National Natural Science Foundation of China (31872484, Zhang Qian-yi). Authors ¢ contributions Zhang QY and Xia YJ design of the study, Xu L and Li YX performed the experiments, Zhang QY and Xia YJ wrote the manuscript with input from the other authors. All authors read and approved the final manuscript. Acknowledgements Some samples were kindly provided by China Animal Disease Control Center (CADC), Harbin Veterinary Research Institute (HVRI) of Chinese Academy of Agricultural Sciences (CAAS) and Sichuan Agricultural University (SAU). References Wang Q, Tu C C. Swine fever. Beijing: China Agriculture Press. 2015. Zhu X F, Liu M J, Wu X J, Ma W T, Zhao X D. Phylogenetic analysis of classical swine fever virus isolates from China. Archives of Virology. 2021;166(8):2255–2261. doi: 10.1007/s00705-021-05084-0 . Moennig V, Floegel-Niesmann G, Greiser-Wilke I. Clinical signs and epidemiology of classical swine fever. A review of new knowledge. Veterinary Journal. 2003; 165: 11–20. doi: 10.1016/s1090-0233(02)00112-0 . Gaudreault N N, Madden D W, Wilson W C, Trujillo J D, Richt J A. African Swine Fever Virus: An Emerging DNA Arbovirus. Frontiers in Veterinary Science. 2020; 7:215. doi: 10.3389/fvets.2020.00215 . Wang F X, Zhang H, Hou L N, Yang C, Wen Y J. Advance of African swine fever virus in recent years. Research in Veterinary Science. 2021; 136:535–539. doi: 10.1016/j.rvsc.2021.04.004 . Gatto I R H, Sonálio K, de Oliveira L G. Atypical Porcine Pestivirus (APPV) as a New Species of Pestivirus in Pig Production. Frontiers in Veterinary Science. 2019; 6:35. doi: 10.3389/fvets.2019.00035 . Pan S N, Mou C X, Wu H G, Chen Z H. Phylogenetic and codon usage analysis of atypical porcine pestivirus (APPV). Virulence. 2020; 11(1):916–926. doi: 10.1080/21505594.2020.1790282 . Shen H Q, Liu X C, Zhang P F, Wang L, Liu Y L, Zhang L Y, Liang P S, Song C X. Identification and characterization of atypical porcine pestivirus genomes in newborn piglets with congenital tremor in China. Journal of Veterinary Science. 2018; 19(3):468–471. doi: 10.4142/jvs.2018.19.3.468 . Ji W, Guo Z, Ding N Z, He C Q. Studying classical swine fever virus: making the best of a bad virus. Virus Research. 2015; 197:35–47. doi: 10.1016/j.virusres.2014.12.006 . Pan S N, Mou C X, Chen Z H. An emerging novel virus: Atypical porcine pestivirus (APPV). Reviews in Medical Virology. 2019; 29(1): e2018. doi: 10.1002/rmv.2018 . Teklue T, Sun Y, Abid M, Luo Y, Qiu H J. Current status and evolving approaches to African swine fever vaccine development. Transboundary and Emerging Disease. 2020; 67(2):529–542. doi: 10.1111/tbed.13364 . Hu D F, Lv L, Gu J Y, Chen T Y, Xiao Y H, Liu S D. Genetic Diversity and Positive Selection Analysis of Classical Swine Fever Virus Envelope Protein Gene E2 in East China under C-Strain Vaccination. Frontiers in Microbiology. 2016; 7:85. doi: 10.3389/fmicb.2016.00085 . Luo Y, Ji S, Liu Y, Lei J L, Xia S L, Wang Y, Du M L, Shao L, Meng X Y, Zhou M, Sun Y, Qiu H J. Isolation and Characterization of a Moderately Virulent Classical Swine Fever Virus Emerging in China. Transboundary and Emerging Disease. 2017; 64(6):1848–1857. doi: 10.1111/tbed.12581 . Chang J C, Hilsenbeck S G, Fuqua S A W. Genomic approaches in the management and treatment of breast cancer. British journal of cancer. 2005; 92(4): 618. doi: 10.1038/sj.bjc.6602410 . Taroneher-Oldenburg G, Griner E M, Francis C A, Ward B B. Oligonucleotide microarray for the study of functional gene diversity in the nitrogen cycle in the environment. Applied and Environmental Microbiology. 2003; 69(2):1159–1171. doi: 10.1128/AEM.69.2.1159-1171.2003 . Ji W, Niu D D, Si H L, Ding N Z, He C Q. Vaccination influences the evolution of classical swine fever virus. Infect Genetice and Evolution. 2014; 25:69–77. doi: 10.1016/j.meegid.2014.04.008 . Fatima M, Luo Y Z, Zhang L, Wang P Y, Song H, Fu Y H, Li Y F, Sun Y, Bao Y J, Qiu H J. Genotyping and Molecular Characterization of Classical Swine Fever Virus Isolated in China during 2016–2018. Viruses. 2021; 13(4):664. doi: 10.3390/v13040664 . Han Y Y, Xie L B, Yuan M Q, Ma Y T, Sun H M, Sun Y, Li Y F, Qiu H J. Development of a marker vaccine candidate against classical swine fever based on the live attenuated vaccine C-strain. Veterinary Microbiology. 2020; 247:108741. doi: 10.1016/j.vetmic.2020.108741 . Wang L H, Madera R, Li Y Z, McVey D S, Drolet B S, Shi J S. Recent Advances in the Diagnosis of Classical Swine Fever and Future Perspectives. Pathogens. 2020; 9(8):658. doi: 10.3390/pathogens9080658 . Xing C N, Lu Z J, Jiang J F, Huang L Z, Xu J L, He D S, Wei Z L, Huang H J, Zhang H G, Murong C Y, Tu C C, Gong W J. Sub-subgenotype 2.1c isolates of classical swine fever virus are dominant in Guangdong province of China, 2018. Infect Genetice and Evolution. 2019; 68:212–217. doi: 10.1016/j.meegid.2018.12.029 . Wang F X, Zhang H, Hou L, Yang C, Wen Y J. Advance of African swine fever virus in recent years. Research in Veterinary Science. 2021; 136:535–539. DOI: 10.1016/j.rvsc.2021.04.004 . Liu L, Wang X W, Mao R Q, Zhou Y H, Yin J B, Sun Y F, Yin X P. Research progress on live attenuated vaccine against African swine fever virus. Microbial Pathogensis. 2021; 158:105024. doi: 10.1016/j.micpath.2021.105024 . Yang J N, Tang K C, Cao Z, Pfeiffer D U, Zhao K, Zhang Q P, Zeng D D. Demand-driven spreading patterns of African swine fever in China. Chaos. 2021; 31(6):061102. doi: 10.1063/5.0053601 . Tao D P, Sun D P, Liu Y M, Wei S, Yang Z F, An T Q, Shan F P, Chen Z L, Liu J L. One year of African swine fever outbreak in China. Acta Tropica. 2020; 211:105602. doi: 10.1016/j.actatropica.2020.105602 . Zhang H, Wen W, Hao G, Hu Y, Chen H, Qian P, Li X. Phylogenetic and genomic characterization of a novel atypical porcine pestivirus in China. Transboundary and Emerging Disease. 2018; 65(1): e202-e204. doi: 10.1111/tbed.12675 . Zhou K, Yue H, Tang C, Ruan W, Zhou Q, Zhang B. Prevalence and genome characteristics of atypical porcine pestivirus in southwest China. The Journal of General Virology. 2019; 100(1):84–88. doi: 10.1099/jgv.0.001188 . Shi K C, Xie S Y, Sun W Y, Liu H X, Yin Y W, Si H B, Qu S J, Lu W J. Evolution and genetic diversity of atypical porcine pestivirus (APPV) from piglets with congenital tremor in Guangxi Province, Southern China. Veterinary Medicine and Science. 2021; 7(3):714–723. doi: 10.1002/vms3.407 . Zhao J J, Cheng D C, Li N, Sun Y, Shi Z X, Zhu Q H, Tu C C, Tong G Z, Qiu H J. Evaluation of a multiplex real-time RT-PCR for quantitative and differential detection of wild-type viruses and C-strain vaccine of Classical swine fever virus. Veterinary Microbiology. 2008; 126(1–3):1–10. doi: 10.1016/j.vetmic.2007.04.046 . Wen G, Zhang T, Yang J, Luo Q P, Liao Y H, Hu Z B, Zhang R R, Wang H L, Ai D Y, Song N H, Shao H B. Evaluation of a real-time RT-PCR assay using minor groove binding probe for specific detection of Chinese wild-type classical swine fever virus. Journal of Virological Methods. 2011; 176(1–2):96–102. doi: 10.1016/j.jviromet.2011.06.014 . Martínez M A, Soto-Del Río Mde L, Gutiérrez R M, Chiu C Y, Greninger A L, Contreras J F, López S, Arias C F, Isa P. DNA microarray for detection of gastrointestinal viruses. Journal of Clinical Microbiology. 2015; 53(1):136–145. doi: 10.1128/JCM.01317-14 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 03 Oct, 2022 Reviews received at journal 02 Oct, 2022 Reviewers agreed at journal 19 Sep, 2022 Reviewers invited by journal 18 Sep, 2022 Editor assigned by journal 05 Sep, 2022 Submission checks completed at journal 04 Sep, 2022 First submitted to journal 29 Aug, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2011818","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":134057396,"identity":"592b9156-5974-4ea8-9b63-7e4faf88b502","order_by":0,"name":"Ying-ju Xia","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ying-ju","middleName":"","lastName":"Xia","suffix":""},{"id":134057397,"identity":"6a5c2629-51ea-44f9-b262-feff98376e0e","order_by":1,"name":"Lu Xu","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Xu","suffix":""},{"id":134057398,"identity":"0e728fb6-d8f2-4153-8ecc-d6c9f6b66d68","order_by":2,"name":"Jun-jie Zhao","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jun-jie","middleName":"","lastName":"Zhao","suffix":""},{"id":134057399,"identity":"a8a204ba-e8bb-4798-b7f4-82ad6a8ef374","order_by":3,"name":"Yuan-xi Li","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuan-xi","middleName":"","lastName":"Li","suffix":""},{"id":134057400,"identity":"e46db8e3-9ff3-48e6-93c0-bf3edecda5e8","order_by":4,"name":"Rui-zhi Wu","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rui-zhi","middleName":"","lastName":"Wu","suffix":""},{"id":134057401,"identity":"994ba5f1-fef4-414b-8fbd-88189f97f247","order_by":5,"name":"Xiang-peng Song","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiang-peng","middleName":"","lastName":"Song","suffix":""},{"id":134057402,"identity":"20f086cd-543f-4bd9-a729-56a0bc1756ed","order_by":6,"name":"Qi-zu Zhao","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qi-zu","middleName":"","lastName":"Zhao","suffix":""},{"id":134057403,"identity":"4942b0f5-5d7f-4dc4-9566-8268936eaa18","order_by":7,"name":"Ye-bing Liu","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ye-bing","middleName":"","lastName":"Liu","suffix":""},{"id":134057404,"identity":"2f732bc0-1dd8-43a0-a5e0-d56317af099b","order_by":8,"name":"Qin Wang","email":"","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qin","middleName":"","lastName":"Wang","suffix":""},{"id":134057405,"identity":"6654d8e6-c53c-4bf8-865a-15c8b10d4057","order_by":9,"name":"Qian-yi Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYDACCQjFw8Zw+MCBDxUkaJHhYzyWeHDGGRK02MgxnzE+zNtChA752c3PHn4pO8zDxnbmwwHeBgZ5frED+LUwzjlmbixzDqiF5+yGA5I7GAxnzk7Ar4VZIsFMWrINqEUCqMXwDEOCwW0CWtgk0r9BtMi/eXAgsY0ILTwSOWaSH0FaGM4wHDhIjBYJiZwyaYZz6UAtxwwONpyRIOwX+Rnp2yR/lFnbyzccfvz5T4WNPL80AS0gwMzD1gy3lbByEGD8wVZHnMpRMApGwSgYmQAA8bpGYr24VJIAAAAASUVORK5CYII=","orcid":"","institution":"China Institute of Veterinary Drug Control","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Qian-yi","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2022-08-30 03:14:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2011818/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2011818/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":26182094,"identity":"16536ed9-c29d-4103-883c-f3ec2411a412","added_by":"auto","created_at":"2022-09-07 15:04:40","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":15678,"visible":true,"origin":"","legend":"\u003cp\u003eThe diagram of chip spot pattern\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-2011818/v1/515d3bc8c0cdd00a0307c3e7.jpg"},{"id":26182095,"identity":"68c7c599-b4f5-4344-ac45-d6f38eeb0653","added_by":"auto","created_at":"2022-09-07 15:04:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2704036,"visible":true,"origin":"","legend":"\u003cp\u003eThe specificity test results of the gene microarray assay\u0026nbsp;\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2011818/v1/c62320ccb0d6fc63706601c8.png"},{"id":26182093,"identity":"dd1770fc-0347-48cc-82c9-92e1365b966c","added_by":"auto","created_at":"2022-09-07 15:04:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":569160,"visible":true,"origin":"","legend":"\u003cp\u003eThe sensitivity test results of the gene microarray assay\u0026nbsp;\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-2011818/v1/9798437922971e53738eefe1.png"},{"id":26182096,"identity":"99821b9e-9b88-481c-a237-7288294b416a","added_by":"auto","created_at":"2022-09-07 15:04:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1084028,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2011818/v1/58d17274-d0a5-4ed1-9c78-e913af374038.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Development of a quadruple PCR-based gene microarray for detection of vaccine and wild-type classical swine fever virus, African swine fever virus and atypical porcine pestivirus.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eClassical swine fever (CSF) is an acute, febrile, highly contagious and lethal infectious disease caused by classical swine fever virus (CSFV) belonging to pestivirus, Flaviviridae family [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is an OIE notified animal disease and defined as the highly pathogenic microorganism in China [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It naturally infects domestic pigs and wild boars only despite of age, gender, species and seasons [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. African swine fever (ASF) is an acute, hemorrhagic, lethally disease caused by African swine fever virus (ASFV), which is also an OIE notified disease [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It is characterized as short onset, 100% lethal in most acute and acute cases [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Atypical Porcine pestivirus (APPV) also known as congenital tremor or \u0026ldquo;dancing piglet\u0026rdquo;, resulted in paroxysmal contracture in head, legs and other parts of body muscles in piglets, which consequently caused piglets lost ability to stand and suck milk, even to die [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It was first reported in 2017 in Guangdong Province in China, and subsequently reported in piglets in other places, which indicated its epidemic in China [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Currently, the above three diseases are epidemic in China [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], therefore a fast and differential diagnosis of these three diseases in clinical is important.\u003c/p\u003e \u003cp\u003eIn addition, prevention and control of CSF in China mainly relies on vaccination with C strain which contributes to CSF control globally [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. However, chronic and atypical infection still occur, bringing challenges to CSF prevention and control [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Since we are lack of effective clinical test to differentiate diagnosis between wild type and vaccine CSFV. There is no effective vaccine or treatment available for ASFV and APPV. It is essential to develop an assay to simultaneously detect the above four viruses.\u003c/p\u003e \u003cp\u003eRecently, gene microarray has been widely used in the medical field and has achieved outstanding results in the research of gene expression, pathogenesis, clinical diagnosis, drug development and biological detection [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In this study, a gene microarray assay was developed to distinguish these three pathogens including wild type and vaccine CSFV strains, respectively. Three pairs of primers and corresponding probes were designed based on the conserved region of CSFV, ASFV and APPV to establish a reliable and rapid gene microarray assay for the differential diagnosis of ASFV, APPV and CSFV, which will be useful for clinical diagnosis as well as epidemiological investigation of these diseases in large-scale pig farms.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eViruses and clinical samples\u003c/h2\u003e\n\u003cp\u003eWild type CSFV strains, and vaccine strains (C strain and Thiversal strain) used in this study were isolated and storied by national reference laboratory for CSF at Institute of China Veterinary Drug Control (IVDC). Japanese encephalitis virus(JEV), bovine viral diarrhea virus(BVDV), porcine reproductive and respiratory syndrome virus(PRRSV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine circovirus 1(PCV1), porcine circovirus 2(PCV2), porcine parvovirus (PPV) and pseudorabies virus (PRV) were provided by China Animal Disease Control Center(CADC). ASFV positive samples were disinfected and provided by Harbin Veterinary Research Institute (HVRI) of Chinese Academy of Agricultural Sciences (CAAS).APPV clinical samples were kindly provided by Prof. Xu Zhiwen from Sichuan Agricultural University(SAU). Detailed information of these samples were shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"char\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eStrain information\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eVirus\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSample Name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSample number\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eVirus\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSample Name\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSample number\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eShimen\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHBJZ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e22\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBJYQ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLNCY1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e23\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSX4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSCMY1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e24\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeBHD2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHBXY4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e25\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeBHH1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHBXY5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e26\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeBBD1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eZYBJ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e27\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTJNH1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeBBD4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e28\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeBJZ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eThiveosal strain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e29\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeBQHD1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eChinese strain\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e30\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeNZZ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eASFV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHuBES4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e31\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHBES2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e11\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAPPV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eSCMY1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e32\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eZJHZ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e12\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFMDV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e33\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHENZMD1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e13\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBVDV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e34\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeNXC3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e14\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePCV-1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e35\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eJSXZ1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e15\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePCV-2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e36\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGXFL1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e16\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eOther\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePRV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e37\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeBCB2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e17\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePPV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e38\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHENZMD2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e18\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePRRSV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e39\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHeNXC1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e19\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTGDV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e40\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHBHG1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e20\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePEDV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e41\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eHBHM1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e21\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eJEV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e42\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003ePrimers and probes\u003c/h2\u003e\n\u003cp\u003eBased on the gene sequences of CSFV wild type (CSFV-W) and vaccine strains (CSFV-V) published in GenBank, as well as the reference strains of ASFV and APPV, five pairs of specific primers with a biotin tag and the corresponding gene microarray probes were designed. The 5'UTR is the most conserved region for CSFV, which was used for primer design as a universal detection target for CSFV. The NS5B gene in the vaccine strains has one-base different compared to CSFV-W, and the primer and probe were designed to only amplify CSFV-V based on an amplification refractory mutation system PCR principle (ARMS-PCR). The conserved B646L (encoding p72) gene and the conserved 5'UTR of porcine APPV were selected for primer and probe design of ASFV and APPV, respectively. Beta-globin gene (GenBank: AH001475.2) was selected for the primers and probe design for PCR internal controlDetailed information of primers and probes used in this study can be found in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"char\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimers used in this study\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eName of Primers\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003ePrimer sequence(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTarget gene\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eProduct size (bp)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-W-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGGAGGGACTAGCCRTAGTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;UTR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e77\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-W-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eACGTCGAACTACTGACGACTG-biotin\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-V-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTTCGGGGAGAAAGTAACGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eNS5B\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e97\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-V-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCTACCACAGTCACGGCT-biotin\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eASFV-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTATATTGGCCCAAGACTTGCT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eB646L\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e119\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eASFV-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGCACCAAATGTGTTTCTTCGAT-biotin\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAPPV-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCAGACGTCACCGAGTAGTACACC -biotin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;UTR\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e134\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAPPV-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCCAGGTCCACCACCGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eIC-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGTCTGCCGTTACTGCC-biotin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eBeta-globin\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e83\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eIC-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTAACCTTGATACCAACCTGC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\"\u003eBiotin has been attached to the primers. Activated streptavidin (SA) and horseradish peroxidase (HRP) are covalently conjugated to the membrane of the microarray. When primers have specifically amplified the expected PCR product, the product can hybridize with probes on the microarray, and biotin can interact with SA-HRP. Subsequently incubated with TMB which can produce a deep blue color during the enzymatic degradation of hydrogen peroxide by HRP and determine the results.\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"4\"\u003e\u003csup\u003ea\u003c/sup\u003e: CSFV-W-P: probe for detection of wild type CSFV; CSFV-V-P: probe for detection of CSFV vaccine strains.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"char\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eProbes used in this study\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eName of Probes\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eProbe sequence(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eLength of the probe (bp)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-W-P\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCCTGGGTGGTCTAAGTCCTGAGTACAG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e29\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-V-P\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATGCAGGAGGAGATAACCTTGCAGCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e26\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eASFV-P\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAACCCGATCCCGAACCCACT\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e20\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAPPV-P\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eATGCCCACGTCCACCCAAGCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e21\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eIC-P\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCACCAACTTCATCCACGTTCACC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e24\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"3\"\u003eCSFV-W-P: probe for detection of wild type CSFV; CSFV-V-P: probe for detection of CSFV vaccine strains.\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eDevelopment of the quadruple PCR\u003c/h2\u003e\n\u003cp\u003eASFV viral DNA, CSFV and APPV viral RNAs were extracted according to manufactory\u0026rsquo;s instruction (TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0, Cat:9766). A quadruple one-step RT-PCR was developed as following: PrimeScript one step Enzyme Mix 1\u0026micro;L, 2\u0026times;Super Multiplex PCR Mix 12.5\u0026micro;L, five pair of primers 1\u0026micro;L each, RNA/DNA template 4\u0026micro;L each, IC plasmid 1\u0026micro;L, Sterilized double distilled water (ddH2O) up to 25\u0026micro;L. The annealing temperature (56 ℃、58 ℃、60 ℃、62 ℃、64℃), concentration of primers (final concentration 3.2 pmol/\u0026micro;L, 2.4 pmol/\u0026micro;L, 1.6 pmol/\u0026micro;L, 0.8pmol/\u0026micro;L) and extension period were optimized respectively to get an efficient and time-saving PCR assay. An internal control and an external control were also set up in this assay.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003ePreparation for microarray\u003c/h2\u003e\n\u003cp\u003e2%EDC (1-3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) and 1.21% NHS(w/v,CN-hydroxysuccinimide) were fully dissolved in ultrapure water for preparation of the activation solution. 76 mm\u0026times;65 mm modified silica membranes were placed in an activation bath with the front side up and 15ml per membrane activation solution was poured evenly into the bath to completely immerse the membrane surface for 30 minutes. Subsequently, the membrane was washed for three times with ultrapure water and blown dry with nitrogen to ensure the membrane surface is dry and clean. The activated membranes were loaded onto the membrane rack to assemble a 48-well plate which were then loaded into the corresponding positions on the spotter. The probes were diluted to a final concentration of 6\u0026micro;M, and 4\u0026micro;L was added to each well. The parameter of the spotter was set to 100 drop and the probes were dispensed onto the 48-well assembly of modified silica membranes according to the pre-arranged dispensing sequence to assemble the gene chips. The diagram of chip spot pattern was shown on Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSpecific probes were dispensed onto each well as demonstrated in the diagram. The outside four spots were negative and positive controls: Biotin is the control for monitoring the efficient hybridization on microarray. IC-P is control for monitoring the efficient PCR progress and also indicated the direction for results interpretation. APPV, ASFV, CSFV-W and CSFV-V were dispensed inside\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n\u003ch2\u003eDesign and composition of gene chip\u003c/h2\u003e\n\u003cp\u003ePreparation of Hybridization Buffer A, Elution Buffer B and Rinse Buffer C as follows. Hybridization Buffer A: mixed up 10 mL of 20\u0026times;SSC and 1 mL of 10% SDS into purified water up to 100 mL. Elution Solution B: took 3 mL of 20\u0026times; SSC and 1.2 mL of 10% SDS together with purified water to 120 mL and mixed thoroughly. Rinse Solution C: took 10 mL of 1 mol sodium citrate into purified water to 100 mL and mixed thoroughly. All three buffers were stored at room temperature for up to 6 months.\u003c/p\u003e\n\u003cp\u003ePreheated the chip and Buffer B at 47℃. Mixed 10 \u0026micro;L of PCR product with 110 \u0026micro;L of Buffer A and added to the chip at 120 \u0026micro;L/well at 47\u0026deg;C 200 r/min for 5 minutes. Washed three times with pre-warmed Buffer B (100 \u0026micro;L/well). SA-HRP was diluted at the ratio of 1:2000 with Buffer A, and then added to the wells with 100 \u0026micro;L/well followed by 47\u0026deg;C 200 r/min incubation for 5 minutes. The chip was then washed twice with Buffer A (100 \u0026micro;L/well), and then twice with Buffer C (100 \u0026micro;L/well) at room temperature. 60 \u0026micro;L/well of TMB was added and incubated at dark for 1 min, and then washed twice with purified water (200\u0026micro;L/well) and blow dry gently with a compressed air canister for final results interpretation.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003eResult interpretation\u003c/h2\u003e\n\u003cp\u003eThe test is validated if the Biotin spot on the gene chip presented clearly dark blue and at least one of the two IC-P probe spots is colored. If CSFV-W spot is blue, it means the sample is CSFV-W nucleic acid positive. If CSFV-W and CSFV-V spots are both blue, it represents that the sample is CSFV-V nucleic acid positive. If ASFV or APPV spot has no color, it means the sample is ASFV or APPV negative. Otherwise, if blue color shows on the spot, the result is positive.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003eGeneration of positive control plasmid\u003c/h2\u003e\n\u003cp\u003eFive pairs of specific primers were designed to amplify the 5' UTR of CSFV-W Shimen strain, the NS5B gene fragment of CSFV-V C strain, the 5' UTR gene fragment of ASFV/HuBES4 strain and the 5' UTR gene fragment of APPV/SCMY1 strain. The PCR products of ASFV/HuBES4 was gel purified and cloned into pUC57 vector to construct a recombinant plasmid. The rest three PCR products were gel purified and cloned into pGEM-T vector, respectively. The recombinant plasmids were sequenced for confirmation, and the sequencing results were analyzed using DNAStar (version 7.1) and NCBI Nucleotide Blast. The correct recombinant plasmids were then used as standard materials and named as CSFV-W-p, CSFV-V-p, ASFV-p and APPV-p, respectively (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"char\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab4\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePCR primers for generation of recombinant plasmids\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eName of Primers\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eSequence of primer(5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eProduct size(bp)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTargen gene\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-W-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGAGGTTAGTTCATTCTCGTATACACGA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e310\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;UTR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-W-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTATCAGGTCGTACTCCCATCAC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-V- F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCCTTCACAACCTTACCCGACTGATTG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e295\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eNS5B\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCSFV-V- R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCAGGCCTGAACCTGAGCTGGTGAAC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eASFV-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAGTTATGGGAAACCCGACCC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e257\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003ep72\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eASFV- R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCCTGAATCGGAGCATCCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAPPV-F\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCGCGGATCCACAGCCTACTGATGATCAGTCGATG\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"char\" char=\".\"\u003e\n\u003cp\u003e336\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e5\u0026rsquo;UTR\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAPPV-R\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCCGGCACTCTATCAAGCAGTAAGGTC\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n\u003ch2\u003eSpecificity test\u003c/h2\u003e\n\u003cp\u003eThe developed quadruple PCR combined with gene chip assay were used to test the specificity of 42 clinical samples with different swine diseases shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, including 28 current circulating CSFV-W strains identified by our laboratory, two CSFV-V strains, ASFV and APPV samples and 10 other common swine viral disease samples. Sterilized double distilled water was used as negative control. The specificity of the gene chip was evaluated based on these results.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eSensitivity test\u003c/h2\u003e\n\u003cp\u003eCSFV-W-p, CSFV-V-p, ASFV-p and APPV-p were diluted in a 10-fold gradient ((10\u003csup\u003e\u0026minus;\u0026thinsp;8\u003c/sup\u003e-10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) for sensitivity test by performing CSFV-W-p, ASFV-p and APPV-p single PCR and gene chip assays, CSFV-(W\u0026thinsp;+\u0026thinsp;V)-p duplex assays and then quadruple assay, respectively. The limits of detection (LOD) of each virus in this assay was calculated using the Dalton copy number formula [copy number\u0026thinsp;=\u0026thinsp;plasmid concentration\u0026times;6.02\u0026times;10\u003csup\u003e23\u003c/sup\u003e/(660\u0026times;plasmid length)]. The sensitivity of the established quadruple PCR combined with the gene chip assay was evaluated based on the LOD of the single or quadrupled diluted plasmids.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003eDetection of clinical samples\u003c/h2\u003e\n\u003cp\u003eTo evaluate the accuracy of the gene chip assay for differential diagnosis of field samples, 219 clinical samples (20 spleen, 20 kidney, 20 lymph nodes and 159 whole blood samples) from a pig farm in Haidian, Beijing (BJHD), Dianjiang, Chongqing (CQDJ), Wanyuan, Sichuan (SCWY) and Baoding, Hebei (HeBBD) and HVRI were tested using this assay, and the results were compared with the results conducted from national standards or published methods including CSFV RT-nPCR assay (GB/T 26875\u0026thinsp;\u0026minus;\u0026thinsp;2018), ASFV real-time qPCR assay (Ministry of Agriculture and Rural Affairs Announcement No. 172) and APPV traditional PCR assay (CN108611442A). Thus, to verify again the specificity and sensitivity of this assay.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eOptimization of quadruple RT-PCR\u003c/h2\u003e\n\u003cp\u003eFinal optimized PCR composition and condition were as following: a master mix of 25\u0026micro;L reaction is composed of 1\u0026micro;L of Primscript RT Master Mix, 12.5\u0026micro;L of 2\u0026times;Super Multiplex PCR Mix, 1\u0026micro;L of each primer (final concentration was 3.2 pmol/\u0026micro;L)1\u0026micro;L of IC plasmid, 1\u0026micro;L of template DNA, 3.5\u0026micro;L of ddH20. The parameters for quadruple RT-PCR starts with reverse transcription at37℃ for 15min followed by inactivation of reverse transcriptase at 85℃ for 10s; then with a denaturation step at 95℃ for 2min, followed by a 35 cycles of denaturation at 98℃ for 15s, annealing/extension at 60℃ for 20s. PCR products then store at 4℃ for later use.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003eConstruction of standard plasmid as positive amplification control\u003c/h2\u003e\n\u003cp\u003eThe CSFV-W-p, CSFV-V-p, ASFV-p and APPV-p plasmids were constructed as positive control for PCR amplification using the specific primers CSFV-W-5'UTR-F/R, CSFV-V-NS5B-F/R, ASFV-p72- F/R and APPV-5'UTR-F/R. The PCR products were 310bp for CSFV-W, 295bp for CSFV-V target gene, 257bp for ASFV and 336bp for APPV as expected. The PCR products were then purified, ligated with plasmid, and transformed into DH5\u0026alpha; for clone selection. Finally, the positive clones were confirmed by PCR and sequencing. Results showed that all the plasmids have the right insertion sequence as their template sequence indicated on NCBI GenBank. The concentration of these plasmids were determined by NanoDrop\u0026trade; 1000 fluorospectrometer and the copy number of each plasmid was calculated by Dalton method, which were 3.04\u0026times;10\u003csup\u003e10\u003c/sup\u003ecopies/\u0026micro;L, 4.16\u0026times;10\u003csup\u003e10\u003c/sup\u003ecopies/\u0026micro;L, 3.81\u0026times;10\u003csup\u003e10\u003c/sup\u003ecopies/\u0026micro;L and 4.04\u0026times;10\u003csup\u003e10\u003c/sup\u003e copies/\u0026micro;L respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003eSpecificity analysis\u003c/h2\u003e\n\u003cp\u003eThe results of the gene microarray assay on 42 validated samples showed that the Biotin and IC plasmid control were all in blue indicating that the assay was valid. 28 CSFV-W strains were have CSFV-W spot in blue but not CSFV-V spot indicating they were wild type CSFV. The two vaccine strains (Chinese strain and Thiveosal strain) showed blue at both CSFV-W and CSFV-V spot indicating they were vaccine strains. The ASFV/HuBES4 and APPV/SCMY1 strains showed blue at ASFV or APPV spot respectively, demonstrating its success in detecting ASFV and APPV. The other 10 swine viral diseases samples were all negative for CSFV-W, CSFV-V, ASFV and APPV with no color at the four spots, further confirming the high specificity of this assay (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e42 validated samples were tested using this gene microarray assay to determine the specificity of this assay. The results of each detection well were recorded as above. The name of the viruses detected was showed on top of each detection well.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003eSensitivity analysis\u003c/h2\u003e\n\u003cp\u003eFour positive plasmids CSFV-W-p, CSFV-(W\u0026thinsp;+\u0026thinsp;V)-p, ASFV-p and APPV-p were tested with series dilutions ranging from 10\u003csup\u003e8\u003c/sup\u003e copies/\u0026micro;L to 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e copies/\u0026micro;L. The LOD was 6.98 copies/\u0026micro;L for CSFV-W-p(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea), 6.92 copies/\u0026micro;L for CSFV-(W\u0026thinsp;+\u0026thinsp;V)-p(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb); 2.56\u0026times;10 copies/\u0026micro;L for ASFV-p(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec); and 1.8\u0026times;10 copies/\u0026micro;L for APPV-p(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed), respectively. The mixture of the four plasmids were also texted for the quadruple assay with 1 \u0026micro;L of each plasmid and the concentration was ranging from 10\u003csup\u003e8\u003c/sup\u003e copies/\u0026micro;L to 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e copies/\u0026micro;L. The LOD of the quadruplet test was illustrated as the minimum amount of plasmids used to ensure all the four target genes being detected. The results showed that the minimum detection limit of the quadruple assay was 2.9\u0026times;10 copies/\u0026micro;L of each plasmid (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFour positive plasmids CSFV-W-p(a), CSFV-(W\u0026thinsp;+\u0026thinsp;V)-p(b), ASFV-p(c) and APPV-p(d) were tested separately and jointly (e) using plasmids specific for each antigen with serious dilutions ranging from 10\u003csup\u003e8\u003c/sup\u003e copies/\u0026micro;L to 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e copies/\u0026micro;L. C was the negative control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003eDetection of clinical samples\u003c/h2\u003e\n\u003cp\u003e219 clinical samples collected by our laboratory in recent years were tested by this assay as well as standard methods for CSFV, ASFV and APPV for simultaneous comparison. The results showed that 54 samples were positive for CSFV-W, 41 were positive for CSFV-V, 9 were positive for ASFV, 10 were positive for APPV, and 106 were negative. CSFV RT-nPCR followed by sequencing showed 54 samples were wild type CSFV strains, 41 were CSFV vaccine strains. 9 samples were positive for ASFV qPCR method and 10 samples were positive for APPV conventional RT-PCR method. The rest 106 samples were negatives for the three methods. The results of the gene chip were 100% consistent with the other three standard detection methods, indicating that the established gene chip assay can rapidly and accurately identify CSFV-W, CSFV-V, ASFV and APPV in the field, and is practical for differential diagnosis, surveillance and elimination of CSFV, ASFV and APPV.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab5\" style=\"width: 636px;\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eResults for clinical samples\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003eSample type\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"width: 218px;\" align=\"left\"\u003e\n\u003cp\u003ePositive samples/rate by gene chip\u003c/p\u003e\n\u003c/th\u003e\n\u003cth style=\"width: 271.797px;\" align=\"left\"\u003e\n\u003cp\u003ePositive samples/rate by standard methods\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003eCSFV-W\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 218px;\" align=\"left\"\u003e\n\u003cp\u003e54/24.7%\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 271.797px;\" align=\"left\"\u003e\n\u003cp\u003e54/24.7%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003eCSFV-V\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 218px;\" align=\"left\"\u003e\n\u003cp\u003e40/18.3%\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 271.797px;\" align=\"left\"\u003e\n\u003cp\u003e40/18.7%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003eASFV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 218px;\" align=\"left\"\u003e\n\u003cp\u003e9/4.1%\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 271.797px;\" align=\"left\"\u003e\n\u003cp\u003e9/4.1%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003eAPPV\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 218px;\" align=\"left\"\u003e\n\u003cp\u003e10/4.6%\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 271.797px;\" align=\"left\"\u003e\n\u003cp\u003e10/4.6%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003eNegative samples\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 218px;\" align=\"left\"\u003e\n\u003cp\u003e106\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 271.797px;\" align=\"left\"\u003e\n\u003cp\u003e106\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003eIn total\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 218px;\" align=\"left\"\u003e\n\u003cp\u003e219\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 271.797px;\" align=\"left\"\u003e\n\u003cp\u003e219\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 105px;\" align=\"left\"\u003e\n\u003cp\u003ecoincidence rate %\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 489.797px;\" colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003e100%\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eBefore 2016, CSF in China was under controlled with the effort of the compulsory vaccination policy of C strain vaccine [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, with the development of intensive farming, many large-scale pig farms have been built in China and the compulsory vaccination policy has been replaced by overall vaccination since July 2016, the epidemiology of CSFV in turn has changed significantly [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Chronic and atypical CSF become dominant in epidemic outbreaks, which characterized as sporadic, vulnerable in young age, persistent infection, complex onset and immune tolerance, which have brought new challenges to the prevention and control of CSF [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. In particular, it is clinically difficult to distinguish between infection and vaccination, which brings new challenges to the prevention, control and elimination of CSFV in China. The outbreaks of ASF in 2018 in China has devastating impact on the country's pig industry [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. With the rapid response of our government and a series of precise control policies, the outbreak has been effectively controlled and the pig industry has been recovering in an orderly way [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In 2021, however, new situations for ASF epidemic in China have emerged, which showed reduced mortality, atypical clinical signs, and some \"natural variant strains\" showed no hemadsorption (HAD) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. These natural variant ASFV strains caused subclinical symptoms, which were difficult to identify and detect at the early stage and can be easily confused with other diseases, leading to problems in differential diagnosis and prevention and control of ASFV [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. APPV, commonly known as \"piglet shivering disease\" or \"jumping disease\", is a disease in which piglets\u0026rsquo; exhibit paroxysmal muscle movements in the head, limbs and other parts of the body [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It can cause piglets difficulties in standing, blocked suckling and even death. It is estimated that the number of piglets weaned by APPV infected sows could reduce by 10%, and the mortality rate of newborn piglets affected by APPV could rise up to 30% due to malnutrition [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. APPV is widespread in pig herds throughout China and the world, posing a serious threat to pig industry [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. CSFV, ASFV and APPV have become three important contagious virulent infectious diseases in China, which show similar clinical signs and are difficult to distinguish from each other. It is, therefore, critical to develop a simple, rapid, specific and sensitive assay to differential diagnose these three diseases.\u003c/p\u003e \u003cp\u003eThe sensitivity of the gene chip assay developed in this study is 6.98 copies/\u0026micro;L and 69.2 copies/\u0026micro;L for CSFV-W and CSFV-V respectively, which is higher than some published CSFV RT-PCR assays, demonstrating the advantage of the gene chip assay in sensitivity. In the current study, after looking through the 5\u0026rsquo;UTR gene sequences of 30 CSFV field strains preserved in our laboratory and 10 published strains on NCBI and 4 vaccine strains, we found that the 5'UTR was highly conserved among them and many CSFV RT-PCR diagnostic methods also chose this region for primer design [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. NS5B is an RNA polymerase involved in viral genome replication and is one of the popular target for CSFV genotyping. We found there was a base difference between the vaccine and wild strains in the NS5B region which was then used for MGB probe designed to specifically binding to the NS5B gene of CSFV vaccine strains. It is not only practical to C strain, which is widely used in China, but also applicable to the CSFV low-temperature mutagenesis vaccine (Thiveosal strain).\u003c/p\u003e \u003cp\u003eThe biological reaction between samples and the gene chip is critical for the success detection and subsequent analysis of the gene chip assay. The size of the gene probe and the length of PCR products on the microarray are also important factors affecting the hybridization signal of the microarray [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Therefore, the length of the probes designed in this experiment is less than 30 bp, and the length of the PCR products is less than 100 bp, thus ensuring a stable and clear signal response. To facilitate the interpretation of the microarray results, primers were labelled with biotin that has good affinity with streptavidin. After quadruple PCR amplification, the products were combined with the probe on the microarray and reacted with the HRP-labelled streptavidin. Conventional gene microarrays usually use aldehyde-based slides as support and take longer time for detection. This assay use \"0\u0026thinsp;+\u0026thinsp;X\" nano-membranes (0 for zero background and X for various probes) supported by high-topping materials which significantly reduces the reaction time compared to conventional one, resulting in significant time and cost savings. The hybridization process is simple and time-consuming. The results are fully consistent with those of national standard assays. The assay also allows for the addition of other swine infectious diseases other than the three diseases we target in this study. Therefore, the gene chip assay has potential use in the diagnosis and surveillance for swine and other animal diseases.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, a novel gene chip assay was developed for rapid clinical identification of CSFV wild type strains and vaccine strains, ASFV and APPV with high specificity and sensitivity. This assay provides a practical, simple, economical and reliable way for the rapid and accurate diagnosis of CSFV, ASFV and APPV, and also provides a platform and new thoughts for multiple animal diseases detection using gene chips.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eARMS-PCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eamplification refractory mutation system PCR principle\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eASFV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAfrican swine fever virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eAPPV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eatypical porcine pestivirus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBVDV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ebovine viral diarrhea virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCSFV-W\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eclassical swine fever virus wild type\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCSFV-V\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eclassical swine fever virus vaccine strains\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHAD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehemadsorption\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eIVDC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInstitute of China Veterinary Drug Control\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eJEV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eJapanese encephalitis virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMGB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eminor groove binder\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNCBI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNational Center for Biotechnology Information\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNS5B\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNonstructural protein 5B\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePCV1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eporcine circovirus 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePCV2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eporcine circovirus 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePEDV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eporcine epidemic diarrhea virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePRRSV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eporcine reproductive and respiratory syndrome virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePRV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epseudorabies virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRT-PCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ereverse-transcription polymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTGEV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003etransmissible gastroenteritis virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePPV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eporcine parvovirus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e5\u0026rsquo;UTR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efive prime untranslated region.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declared no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (31872484, Zhang Qian-yi).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u003c/strong\u003e\u003cstrong\u003e\u0026cent;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhang QY and Xia YJ design of the study, Xu L and Li YX performed the experiments, Zhang QY and Xia YJ wrote the manuscript with input from the other authors. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSome samples were kindly provided by China Animal Disease Control Center (CADC), Harbin Veterinary Research Institute (HVRI) of Chinese Academy of Agricultural Sciences (CAAS) and Sichuan Agricultural University (SAU).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWang Q, Tu C C. Swine fever. Beijing: China Agriculture Press. 2015.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu X F, Liu M J, Wu X J, Ma W T, Zhao X D. Phylogenetic analysis of classical swine fever virus isolates from China. Archives of Virology. 2021;166(8):2255\u0026ndash;2261. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00705-021-05084-0\u003c/span\u003e\u003cspan address=\"10.1007/s00705-021-05084-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoennig V, Floegel-Niesmann G, Greiser-Wilke I. Clinical signs and epidemiology of classical swine fever. A review of new knowledge. Veterinary Journal. 2003; 165: 11\u0026ndash;20. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s1090-0233(02)00112-0\u003c/span\u003e\u003cspan address=\"10.1016/s1090-0233(02)00112-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaudreault N N, Madden D W, Wilson W C, Trujillo J D, Richt J A. African Swine Fever Virus: An Emerging DNA Arbovirus. Frontiers in Veterinary Science. 2020; 7:215. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fvets.2020.00215\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2020.00215\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang F X, Zhang H, Hou L N, Yang C, Wen Y J. Advance of African swine fever virus in recent years. Research in Veterinary Science. 2021; 136:535\u0026ndash;539. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.rvsc.2021.04.004\u003c/span\u003e\u003cspan address=\"10.1016/j.rvsc.2021.04.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGatto I R H, Son\u0026aacute;lio K, de Oliveira L G. Atypical Porcine Pestivirus (APPV) as a New Species of Pestivirus in Pig Production. Frontiers in Veterinary Science. 2019; 6:35. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fvets.2019.00035\u003c/span\u003e\u003cspan address=\"10.3389/fvets.2019.00035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan S N, Mou C X, Wu H G, Chen Z H. Phylogenetic and codon usage analysis of atypical porcine pestivirus (APPV). Virulence. 2020; 11(1):916\u0026ndash;926. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/21505594.2020.1790282\u003c/span\u003e\u003cspan address=\"10.1080/21505594.2020.1790282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen H Q, Liu X C, Zhang P F, Wang L, Liu Y L, Zhang L Y, Liang P S, Song C X. Identification and characterization of atypical porcine pestivirus genomes in newborn piglets with congenital tremor in China. Journal of Veterinary Science. 2018; 19(3):468\u0026ndash;471. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4142/jvs.2018.19.3.468\u003c/span\u003e\u003cspan address=\"10.4142/jvs.2018.19.3.468\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi W, Guo Z, Ding N Z, He C Q. Studying classical swine fever virus: making the best of a bad virus. Virus Research. 2015; 197:35\u0026ndash;47. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.virusres.2014.12.006\u003c/span\u003e\u003cspan address=\"10.1016/j.virusres.2014.12.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan S N, Mou C X, Chen Z H. An emerging novel virus: Atypical porcine pestivirus (APPV). Reviews in Medical Virology. 2019; 29(1): e2018. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/rmv.2018\u003c/span\u003e\u003cspan address=\"10.1002/rmv.2018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeklue T, Sun Y, Abid M, Luo Y, Qiu H J. Current status and evolving approaches to African swine fever vaccine development. Transboundary and Emerging Disease. 2020; 67(2):529\u0026ndash;542. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tbed.13364\u003c/span\u003e\u003cspan address=\"10.1111/tbed.13364\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu D F, Lv L, Gu J Y, Chen T Y, Xiao Y H, Liu S D. Genetic Diversity and Positive Selection Analysis of Classical Swine Fever Virus Envelope Protein Gene E2 in East China under C-Strain Vaccination. Frontiers in Microbiology. 2016; 7:85. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2016.00085\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2016.00085\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo Y, Ji S, Liu Y, Lei J L, Xia S L, Wang Y, Du M L, Shao L, Meng X Y, Zhou M, Sun Y, Qiu H J. Isolation and Characterization of a Moderately Virulent Classical Swine Fever Virus Emerging in China. Transboundary and Emerging Disease. 2017; 64(6):1848\u0026ndash;1857. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tbed.12581\u003c/span\u003e\u003cspan address=\"10.1111/tbed.12581\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang J C, Hilsenbeck S G, Fuqua S A W. Genomic approaches in the management and treatment of breast cancer. British journal of cancer. 2005; 92(4): 618. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/sj.bjc.6602410\u003c/span\u003e\u003cspan address=\"10.1038/sj.bjc.6602410\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaroneher-Oldenburg G, Griner E M, Francis C A, Ward B B. Oligonucleotide microarray for the study of functional gene diversity in the nitrogen cycle in the environment. Applied and Environmental Microbiology. 2003; 69(2):1159\u0026ndash;1171. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.69.2.1159-1171.2003\u003c/span\u003e\u003cspan address=\"10.1128/AEM.69.2.1159-1171.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi W, Niu D D, Si H L, Ding N Z, He C Q. Vaccination influences the evolution of classical swine fever virus. Infect Genetice and Evolution. 2014; 25:69\u0026ndash;77. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.meegid.2014.04.008\u003c/span\u003e\u003cspan address=\"10.1016/j.meegid.2014.04.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFatima M, Luo Y Z, Zhang L, Wang P Y, Song H, Fu Y H, Li Y F, Sun Y, Bao Y J, Qiu H J. Genotyping and Molecular Characterization of Classical Swine Fever Virus Isolated in China during 2016\u0026ndash;2018. Viruses. 2021; 13(4):664. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v13040664\u003c/span\u003e\u003cspan address=\"10.3390/v13040664\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Y Y, Xie L B, Yuan M Q, Ma Y T, Sun H M, Sun Y, Li Y F, Qiu H J. Development of a marker vaccine candidate against classical swine fever based on the live attenuated vaccine C-strain. Veterinary Microbiology. 2020; 247:108741. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetmic.2020.108741\u003c/span\u003e\u003cspan address=\"10.1016/j.vetmic.2020.108741\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L H, Madera R, Li Y Z, McVey D S, Drolet B S, Shi J S. Recent Advances in the Diagnosis of Classical Swine Fever and Future Perspectives. Pathogens. 2020; 9(8):658. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/pathogens9080658\u003c/span\u003e\u003cspan address=\"10.3390/pathogens9080658\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXing C N, Lu Z J, Jiang J F, Huang L Z, Xu J L, He D S, Wei Z L, Huang H J, Zhang H G, Murong C Y, Tu C C, Gong W J. Sub-subgenotype 2.1c isolates of classical swine fever virus are dominant in Guangdong province of China, 2018. Infect Genetice and Evolution. 2019; 68:212\u0026ndash;217. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.meegid.2018.12.029\u003c/span\u003e\u003cspan address=\"10.1016/j.meegid.2018.12.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang F X, Zhang H, Hou L, Yang C, Wen Y J. Advance of African swine fever virus in recent years. Research in Veterinary Science. 2021; 136:535\u0026ndash;539. DOI: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.rvsc.2021.04.004\u003c/span\u003e\u003cspan address=\"10.1016/j.rvsc.2021.04.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Wang X W, Mao R Q, Zhou Y H, Yin J B, Sun Y F, Yin X P. Research progress on live attenuated vaccine against African swine fever virus. Microbial Pathogensis. 2021; 158:105024. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.micpath.2021.105024\u003c/span\u003e\u003cspan address=\"10.1016/j.micpath.2021.105024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang J N, Tang K C, Cao Z, Pfeiffer D U, Zhao K, Zhang Q P, Zeng D D. Demand-driven spreading patterns of African swine fever in China. Chaos. 2021; 31(6):061102. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1063/5.0053601\u003c/span\u003e\u003cspan address=\"10.1063/5.0053601\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTao D P, Sun D P, Liu Y M, Wei S, Yang Z F, An T Q, Shan F P, Chen Z L, Liu J L. One year of African swine fever outbreak in China. Acta Tropica. 2020; 211:105602. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.actatropica.2020.105602\u003c/span\u003e\u003cspan address=\"10.1016/j.actatropica.2020.105602\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang H, Wen W, Hao G, Hu Y, Chen H, Qian P, Li X. Phylogenetic and genomic characterization of a novel atypical porcine pestivirus in China. Transboundary and Emerging Disease. 2018; 65(1): e202-e204. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tbed.12675\u003c/span\u003e\u003cspan address=\"10.1111/tbed.12675\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou K, Yue H, Tang C, Ruan W, Zhou Q, Zhang B. Prevalence and genome characteristics of atypical porcine pestivirus in southwest China. The Journal of General Virology. 2019; 100(1):84\u0026ndash;88. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/jgv.0.001188\u003c/span\u003e\u003cspan address=\"10.1099/jgv.0.001188\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi K C, Xie S Y, Sun W Y, Liu H X, Yin Y W, Si H B, Qu S J, Lu W J. Evolution and genetic diversity of atypical porcine pestivirus (APPV) from piglets with congenital tremor in Guangxi Province, Southern China. Veterinary Medicine and Science. 2021; 7(3):714\u0026ndash;723. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/vms3.407\u003c/span\u003e\u003cspan address=\"10.1002/vms3.407\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J J, Cheng D C, Li N, Sun Y, Shi Z X, Zhu Q H, Tu C C, Tong G Z, Qiu H J. Evaluation of a multiplex real-time RT-PCR for quantitative and differential detection of wild-type viruses and C-strain vaccine of Classical swine fever virus. Veterinary Microbiology. 2008; 126(1\u0026ndash;3):1\u0026ndash;10. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.vetmic.2007.04.046\u003c/span\u003e\u003cspan address=\"10.1016/j.vetmic.2007.04.046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen G, Zhang T, Yang J, Luo Q P, Liao Y H, Hu Z B, Zhang R R, Wang H L, Ai D Y, Song N H, Shao H B. Evaluation of a real-time RT-PCR assay using minor groove binding probe for specific detection of Chinese wild-type classical swine fever virus. Journal of Virological Methods. 2011; 176(1\u0026ndash;2):96\u0026ndash;102. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jviromet.2011.06.014\u003c/span\u003e\u003cspan address=\"10.1016/j.jviromet.2011.06.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez M A, Soto-Del R\u0026iacute;o Mde L, Guti\u0026eacute;rrez R M, Chiu C Y, Greninger A L, Contreras J F, L\u0026oacute;pez S, Arias C F, Isa P. DNA microarray for detection of gastrointestinal viruses. Journal of Clinical Microbiology. 2015; 53(1):136\u0026ndash;145. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/JCM.01317-14\u003c/span\u003e\u003cspan address=\"10.1128/JCM.01317-14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Classical swine fever, African swine fever, atypical pestivirus, polymerase chain reaction, differential diagnosis, gene chip ","lastPublishedDoi":"10.21203/rs.3.rs-2011818/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2011818/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eClassical swine fever (CSF), African swine fever (ASF) and atypical porcine pestivirus (APPV) are acute, virulent and contagious viral diseases currently hampering pig industry in China, which result in mummification or stillbirths in piglets and mortality in pigs. Diagnostic assay for the differentiation of infection and vaccination of CSFV in addition to the detection of ASFV and APPV are urgently required for better prevention, control and elimination of these viral diseases in China. \u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eA quadruple PCR-based gene microarray assay was developed in this study to simultaneously detect wild type and vaccine CSFV strains, ASFV and APPV according to their conserved regions. 42 laboratory confirmed samples including positive samples of other 10 swine viral diseases were tested using this assay to confirm its high specificity.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eThe limit of detections (LODs) of this assay for the wild type and vaccine CSFV were 6.98 and 6.92 copies/µL. LODs for ASFV and APPV were 2.56 ×10 and 1.80×10 copies/µL, respectively. When compared with standard RT-PCR or qPCR for CSFV (GB/T 26875-2018), ASFV (MARR issue No.172) or APPV(CN108611442A)using 219 clinical samples, the coincidence was 100%. The results showed that this assay with high sensitivity can specifically distinguish ASFV, APPV and CSFV including CSFV infection and immunization.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThis assay provides a practical, simple, economical and reliable test for the rapid detection and accurate diagnosis of the three viruses, and may have good prospects for application in epidemiological investigation, prevention and control and elimination of these three diseases.\u003c/p\u003e","manuscriptTitle":"Development of a quadruple PCR-based gene microarray for detection of vaccine and wild-type classical swine fever virus, African swine fever virus and atypical porcine pestivirus.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-09-07 15:04:38","doi":"10.21203/rs.3.rs-2011818/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-10-03T15:18:54+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-10-02T16:04:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"54552d34-27eb-4870-8274-e19ef376f0d1","date":"2022-09-19T12:10:59+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-09-19T03:09:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-09-05T14:20:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-09-04T23:18:30+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2022-08-30T03:02:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"25dc488c-81af-4277-86a3-90c4899ae681","owner":[],"postedDate":"September 7th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-11-24T16:14:25+00:00","versionOfRecord":[],"versionCreatedAt":"2022-09-07 15:04:38","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2011818","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2011818","identity":"rs-2011818","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00