CXCR4 regulates macrophage M1 polarization by altering glycolysis to promote prostate fibrosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article CXCR4 regulates macrophage M1 polarization by altering glycolysis to promote prostate fibrosis Yi zhang, Chen Zhang, Rui Feng, Tong Meng, Wei Peng, Jian Song, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4592373/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Sep, 2024 Read the published version in Cell Communication and Signaling → Version 1 posted 12 You are reading this latest preprint version Abstract Background CXCR4 (C-X-C receptor 4) is widely considered to be a highly conserved G protein-coupled receptor, widely involved in the pathophysiological processes in the human body, including fibrosis. However, its role in regulating macrophage-related inflammation in the fibrotic process of prostatitis has not been confirmed. Here, we aim to describe the role of CXCR4 in modulating macrophage M1 polarization through glycolysis in the development of prostatitis fibrosis. Methods Use inducible experimental chronic prostatitis as a model of prostatic fibrosis. Reduce CXCR4 expression in immortalized bone marrow-derived macrophages using lentivirus. In the fibrotic mouse model, use adenovirus carrying CXCR4 agonists to detect the silencing of CXCR4 and assess the in vivo effects. Results In this study, we demonstrated that reducing CXCR4 expression during LPS treatment of macrophages can lead to M1 polarization. Silencing CXCR4 can inhibit glycolytic metabolism, enhance mitochondrial function, and promote macrophage transition from M1 to M2. Additionally, in vivo functional experiments using AAV carrying CXCR4 showed that blocking CXCR4 in EAP can alleviate inflammation and experimental prostate fibrosis development. Mechanistically, CXCR4, a chemokine receptor, when silenced, weakens the PI3K/AKT/mTOR pathway as its downstream signal, reducing c-MYC expression. PFKFB3, a key enzyme involved in glucose metabolism, is a target gene of c-MYC, thus impacting macrophage polarization and glycolytic metabolism processes. macrophage M1 glycolysis Chronic prostatitis fibrosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Chronic prostatitis is one of the most common diseases in adult males, with approximately 15% of men experiencing symptoms of prostatitis at some point in their lives[1]. The main symptoms during the course of the disease, apart from pain and lower urinary tract symptoms such as frequency, urgency, interruption of urination, and waiting to urinate, also seriously affect the quality of life of men. In the past, it was often thought to be secondary to inflammation of the prostate, increased volume, and the resulting increase in bladder outlet resistance or urethral sphincter contraction to explain. However, clinically, patients with prostatitis may experience LUTS even when their prostate volume is normal or slightly enlarged [2].Prostate tissue specimens from patients with LUTS commonly show inflammatory infiltrates, including T cells, B cells, macrophages, and so on [3].Research has shown that prostatitis is related to prostate volume, and patients with chronic inflammation cell infiltration have a larger prostate volume compared to those without evidence of inflammation[4].The severity of LUTS is also positively correlated with the degree of inflammation. [5]In epidemiological research, there is an association between chronic prostatitis and the subsequent occurrence of LUTS [6, 7].Fibrosis occurs downstream of inflammation in terms of the mechanism [8],Chronic inflammation can cause damage to tissue cells, triggering abnormal healing responses, ultimately leading to fibrosis[9, 10].Prostate fibrosis is characterized by the accumulation of myofibroblasts, collagen deposition, extracellular matrix (ECM) remodeling, and increased tissue hardness [3, 8, 11].Prostate fibrosis occurs under the stimulation of inflammation, leading to organ stiffness, disappearance of normal tissue structure, and thus adversely affecting lower urinary tract function, resulting in changes in voiding symptoms. In young men, only a small number of immune cells infiltrate the prostate gland. When inflammation occurs, a large number of immune cells, mainly including T cells and macrophages, will infiltrate [12].Macrophages recruited in particular in prostatitis have been identified as key regulatory factors in prostatitis. In clinical practice, phospholipid vesicles are often used as an indicator to some extent to assess the severity of chronic prostatitis. Due to the decrease of phospholipid vesicles and the phenomenon of clustering during the inflammatory process, it indicates that the macrophages in the area of inflammation engulf a large amount of lipids. Research has also pointed out that macrophages infiltrated in nerve tissues, especially in the nerve ganglia near the prostate, may be one of the causes of autoimmune prostatitis pain. [13]Macrophages have been widely studied for their impact on fibrosis in various diseases. [14, 15],renal[16],liver[17],lung[18] etc . In fact, fibroblasts and macrophages are present in all organs, usually closely connected to each other and may regulate each other as a feedback loop [19]However, research on macrophages in prostate fibrosis has not been extensively studied. CXCR4 is a chemokine receptor that plays a regulatory role in many diseases and is essential during embryonic development. CXCR4 knockout mice exhibit embryonic lethality, with defects in vascular development, hematopoiesis, and heart formation. [20]. The CXCL12/CXCR4 pathway promotes the involvement of inflammatory cells in the occurrence and development of inflammatory reactions. At the same time, CXCL12/CXCR4 promotes the recruitment of key effector cells such as myofibroblasts and macrophages to the site of tissue damage [9].The role of CXCR4 in inflammation has been widely studied over the past thirty years. However, CXCR4 is widely considered to be a pro-fibrotic protein, but previous research has mainly focused on its pro-fibrotic function in mesenchymal cells such as myofibroblasts, rather than its pro-fibrotic function in inflammatory cells such as macrophages [21, 22].PFKFB3 plays an important regulatory role in the energy metabolism of glycolysis, and fructose-2,6-bisphosphate is the most potent allosteric activator of phosphofructokinase-1, which can function within physiological concentrations. Its driven glycolysis plays a crucial role in endothelial cells and myeloid cells [23, 24]. Here, we aim to describe the role and mechanism of macrophage CXCR4 in prostatic fibrosis. We found that CXCR4 drives macrophage glycolytic metabolism by affecting PFKFB3 transcriptional regulation. Furthermore, we observed that in vivo inhibition of CXCR4 expression reduces inflammation and macrophage M1 polarization infiltration in a mouse model of chronic prostatitis. Finally, we discovered that CXCR4-silenced macrophages can affect fibroblast fibrosis, revealing the relationship between M1 macrophages and prostatic fibrosis. Therefore, we have uncovered the central role of CXCR4 in macrophage metabolism and in maintaining fibrosis in chronic prostatitis. Materials and Methods 2.1. Cell lines, treatment and knockout Cultivate the immortalized bone marrow-derived macrophage cell line iBMDM, embryonic fibroblast cell line 3T3, and HEK293T cells in high glucose DMEM medium supplemented with 10% fetal bovine serum (FBS) (Cat# BC-SE-FBS07, Biochannel) and 1% penicillin-streptomycin (Cat# C0222, beyotime). Induce macrophage polarization with LPS (100ng/ml) (Cat# HY-D1056, MCE) for 24 hours. To knock down CXCR4 in macrophages, transfect iBMDM cells with a lentiviral vector. After transfection for 24 hours, select anti-puromycin macrophages using 5 μg/mL puromycin. Incubate at 37°C with 5% CO2. The passage number of all cell lines used for experimental research is less than twenty. 2.2 Patient samples All clinical prostatic samples came from the First Affiliated Hospital of Anhui Medical University (Anhui, China, Approval No: PJ2024-04-30), with 26 paraffin-embedded prostate tissue slices. Analysis of all specimens by patients was obtained with informed consent. All human studies were approved by the Medical Ethics Committee of Anhui Medical University. 2.3 Construction of a mouse model of autoimmune prostatitis (EAP) and evaluation of pelvic pain symptoms For the construction of experimental autoimmune prostatitis (EAP), NOD male mice were obtained from the Nanjing Biomedical Research Institute at Nanjing University. All in vivo experimental protocols were authorized by the Animal Center of Anhui Medical University (Approval No: LLSC20211051). Prostate tissues from SD rats were ground to obtain prostate antigens, which were then emulsified in equal amounts of complete Freund's adjuvant to prepare the immunizing reagent. Subsequently, on day 0 and day 28, 300 μg of the immunizing reagent was injected subcutaneously at various sites such as the base of the tail and hind paws of male NOD mice. The mouse modeling was divided into two phases. In the first phase, the EAP mice were divided into two groups, with one group receiving intraperitoneal injections of AMD3100 (5mg/kg/d, soluble in PBS) (Cat# GC14745, glpbio) and the control group receiving an equal amount of PBS via intraperitoneal injection for 14 consecutive days. After sacrificing these two groups of mice, the prostate tissues were collected for transcriptome sequencing and untargeted metabolome sequencing. In the second phase, EAP mice with reduced CXCR4 expression using adenovirus-associated vectors were constructed. Mice injected with Sh NC-AAV via the tail vein served as the control group. All mice injected with adenovirus-associated vectors were first injected with 100 μl of virus via the tail vein, followed by two subcutaneous immunizations for the construction of EAP model two weeks later. After 14 days of model construction, the reaction frequency of various fibers in the pelvic stimulation of mice in each group was tested before euthanasia. A positive pain response was considered if one of the following three reactions occurred: (a) severe abdominal contractions, (b) immediate scratching or licking of the area stimulated by the fibers, or (c) jumping. 2.4 Hematoxylin-Eosin (HE) Staining Dehydrate the paraffin section, stain with hematoxylin for 3-5 minutes, rinse with water, treat with differentiation solution, rinse again, incubate, rinse with tap water. Then, stain with eosin after sectioning. Dehydrate the slides in 95% ethanol for 1 minute, treat with eosin solution for 15 seconds, and cover with neutral resin. Classify the severity of inflammation into 4 levels: 0 = no inflammation, 1 = mild inflammation with evident mononuclear cell infiltration around blood vessels, 2 = moderate mononuclear cell infiltration around blood vessels, 3 = vessels significantly curved, bleeding, and rich mononuclear cell infiltration. 2.5 Immunohistochemistry Assay First, deparaffinize the paraffin-embedded tissue sections with water, perform antigen retrieval with antigen retrieval solution, wash three times, soak in a 3% hydrogen peroxide solution, and then incubate in the dark at room temperature for 25 minutes to block endogenous peroxidase. Subsequently, block with 3% BSA serum, wash, treat with primary antibody at a certain ratio overnight at 4°C, wash three times, and then incubate with the corresponding secondary antibody (HRP labeled) at room temperature for 60 minutes. Afterwards, wash the sections, slightly dry, treat with freshly prepared DAB chromogenic solution, and rinse under running water to stop the chromogenic reaction. Finally, counterstain with hematoxylin, stain the cell nuclei, dehydrate, seal, and observe under a microscope. All primary antibodies are listed in Table S1. 2.6 Immunofluorescence First, remove the paraffin from the wax sections in water, then repair the antigen with EDTA buffer (pH 6.00), wash three times, block the antigen, and then incubate overnight with the primary antibody prepared at a certain ratio at 4°C. Next, use the appropriate secondary antibody and let it incubate at room temperature in the dark for 2 hours. For nuclear staining, use DAPI and let it incubate at room temperature in the dark for 10 minutes. Finally, seal the sections with an anti-fluorescence quenching reagent, and evaluate and image under a fluorescence microscope. All primary antibody information is listed in Table S1. 2.7 Masson staining The Masson staining kit was purchased from Servicebio (Cat# G1006). After dewaxing paraffin sections to water, immerse the sections in Masson A solution overnight, rinse with tap water. Then immerse the sections in a mixture of Masson B solution and Masson C solution at a 1:1 ratio for 1 minute, rinse with tap water, differentiate in differentiation solution for several seconds, rinse with tap water. Immerse the sections in Masson D solution for 6 minutes, followed by immersion in Masson E solution for 1 minute. Without rinsing, remove excess liquid and directly immerse in Masson F solution for 20 seconds. Rinse the sections with 1% acetic acid for differentiation, dehydrate with ethanol, and mount with a coverslip. 2.8 Sirius Red staining The Sirius Red staining solution was purchased from Servicebio (Cat# G1018). Dewax the paraffin sections with water, stain with Sirius Red staining solution: stain the sections in Sirius Red staining solution for 8 minutes, dehydrate in absolute ethanol; mount coverslips after dehydration. 2.9 RNA Isolation and RT-qPCR According to the reagent kit instructions, use ESscience RNA-quick purification technology to separate RNA from total prostate tissue (Cat# RN002plus; YiShan Biotech) and macrophages (Cat# ES-RN001; YiShan Biotech). Then, measure the purity and concentration of RNA using a NanoDrop 2000 spectrophotometer. Reverse transcription is performed using the PrimeScript™ RT kit, and qPCR reactions are prepared using SYBR Green Mix, with a final volume of 20µL. All primers are synthesized by General Biology. The primer sequences used are listed in Table S2. To elucidate the relative gene expression levels, the 2^−ΔΔCT method is employed, with β-actin as the internal reference for data normalization. 2.8 Western Blotting Use RIPA lysis buffer (Beyotime) to separate total cellular proteins, enhanced with a mixture of PMSF, complete phosphatase and protease inhibitors. The extracted proteins were separated by 12.5% SDS-PAGE gel electrophoresis, transferred to NC membrane (Bio-Rad, Hercules), blocked in 5% non-fat milk at room temperature for 1 hour, incubated with primary antibody overnight at 4℃, washed, and then incubated with secondary antibody for 2 hours. β-actin was used as an internal reference for normalizing total proteins. Each reaction was repeated three times. 2.9 Co-culture First, polarize the macrophages transfected with Sh NC and Sh CXCR4 by inducing with LPS (100ng/ml) for 24 hours. The next day, discard the supernatant and gently tap the cells to detach them, then wash the cells three times with PBS. Plate the 3T3 cells in the bottom layer of a six-well co-culture plate (Cat# 3412, Corning), and place the macrophages in the co-culture chamber. Continue to culture for 24 hours, then collect the 3T3 cells for the corresponding experimental tests. 2.10 RNA-seq According to the kit instructions, TRIzol reagent was used to extract total RNA. The quantity and purity of RNA were assessed using a NanoDrop 2000 spectrophotometer, and the integrity was evaluated using the Agilent 2100 Bioanalyzer. The construction of the transcriptome library was performed using the VAHTS Universal V5 RNA-seq Library Prep Kit. The library was sequenced on the Illumina Novaseq 6000 platform. For differential gene expression analysis, the DESeq2 package was used, and genes with a q-value 1 were defined as differentially expressed genes (DEGs). 2.11 Non- Targeted Metabolomics Place the prostate tissue sample (20 mg) in a 1.5 mL EP tube, add 2 small steel beads and methanol-water solution (400 μL, V: V = 4:1, containing 4 μg/mL l-2-chlorophenylalanine). After cooling at -40°C for 2 minutes, grind the material evenly, perform ultrasound extraction in an ice bath, and let it sit at -40°C for 2 hours. Centrifuge the sample for 10 minutes, collect 150 ul of the supernatant, filter it through a 0.22 μm organic phase syringe filter, transfer it to an LC injection vial, and analyze it by a liquid chromatography-tandem mass spectrometry system composed of ACQUITY UPLC I-Class plus and QE high-resolution mass spectrometer. The data is processed using Progenesis QI V2.3 software. VIP > 1.0 and p-value < 0.05 are used as the criteria for identifying differential metabolites. 2.12 Dual-luciferase reporter assay To verify the c-MYC transcriptional regulation of Pfkfb3, Clone the Pfkfb3 promoter into the pGL3 vector to construct the reporter gene vector, clone the transcription factor into the pCDNA3.1 expression vector to construct the target gene expression vector. Transfect the experimental group with the reporter gene, target gene expression vector, TK vector, and the control group with the reporter gene, empty vector, TK vector into HEK293T cells. After incubation, lyse the cells and detect using a spectrophotometer. Measure firefly luciferase and Renilla signals. Use Renilla luciferase activity as an endogenous control. 2.13 ChIP assay The ChIP assay was carried out per the kit’s guide. For immunoprecipitation, an anti-c-MYC antibody (Cat# 18583; 1:100, CST) was used. Additionally, purified DNA was analyzed by qPCR. Primer sequences: WT1 (F: GCCATTCTGTCAGCACTTGG, R: CAGACCTTGTTGCCACTGAG), WT2 (F: GGAGAGAGGGAGGAAGGAGA, R: CCCAGACACAACAGAAGAGG), and WT3 (F: CAAAGGCATTCACCCCAAGA, R: CTGCCCTGGAACTCACTTT).The results of chromatin immunoprecipitation were analyzed using q-PCR and agarose gel electrophoresis 2.14 Seahorse XF assays Macrophages were seeded in XFe96 plates at a density of 1.2×10^4 cells/well. After incubating at room temperature for 1 hour on a clean bench until the cells adhered to the wall, they were stimulated overnight with LPS (100ng/ml). At the same time, probe plates with sterile water and calibration solution were placed in a 37°C non-CO2 incubator overnight. The next day, the sterile water in the probe plate was discarded, and 200ul of calibration solution was added and placed in a 37°C non-CO2 cell culture incubator for 60 minutes. Mitochondrial stress test solutions (1mM pyruvate, 2mM glutamine, and 10mM glucose) and glycolysis stress test solution (2mM glutamine) were prepared separately. The cells were washed with the test solutions as required. Then the cell culture plates were placed in a 37°C non-CO2 cell culture incubator for 60 minutes. According to the instructions, the drug concentrations in the mitochondrial stress test were Oligomycin (1.5 μM), Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) (2 μM), and Rotenone/antimycin A (0.5 μM), added to the respective ports of the utility plate for the standard MitoStress test. The drug concentrations in the glycolysis stress test were Glucose (10mM), Oligomycin (1.0 μM), and 2-DG (50mM). First, run the probe plate on the Seahorse XF Pro Analyzer (Agilent, Lexington, MA) for calibration. After completion, replace the hydration plate with the cell culture plate, and run the real-time Seahorse XFe96 analyzer using the Wave software to analyze the data. 2.15 Lactate assay, NO assay and ATP assay According to the manufacturer's instructions, all detection of lysed cells will be normalized using BCA detection. Lactate assay kit (Cat# KTB1100, abbkine), NO assay kit (Cat# S0023, beyotime), and ATP assay kit (Cat# S0026B, beyotime). 2.16 2-NBDG, ROS, MitoSOX Red and Mito-Tracker Deep Red According to the manufacturer's instructions, first treat the macrophages accordingly for 24 hours, then wash them once with PBS. Add the diluted liquid prepared according to the instructions into the culture plate, and incubate it in the dark at 37°C for the specified time. After that, gently transfer the cells into a flow tube, wash them twice with PBS, and use a flow cytometer for detection. Calculate the average fluorescence intensity for statistical analysis. 2-NBDG (Cat# GC10289, glpbio) should be incubated in the dark for 45 minutes, while ROS (Cat# S0033S, beyotime), MitoSOX Red (Cat# GC68230, glpbio), and Mito-Tracker Deep Red (Cat# C1035, beyotime) should all be incubated in the dark for thirty minutes. 2.17 Flow Cytometry Analysis As previously reported, mouse spleens were separated and single-cell suspensions were prepared[25-27]. After the macrophages were treated, they were cleaned once with PBS, gently blown down to the flow tube, cleaned three times with PBS, and then disposed of with PBS. 100ul PBS was added, and 2ul Cd11b-APC(Cat# 101212, Biolegend), F4/80-FITC(Cat# 123108, Biolegend), and Cd86-PE (Cat# 105008,Biolegend) were added to each flow tube respectively. 2.18 Annexin V-FITC/PI Apoptosis assay Apoptosis detection experiment (Cat# E-CK-A211, elabscience) was conducted according to the instructions. Cells were placed into a flow tube, centrifuged at 300 ×g for 5 min, and the supernatant was discarded. The cells were washed once with PBS, centrifuged, and the supernatant was discarded. 100 μL of diluted 1 × Annexin V Binding Buffer was added to resuspend the cells. Then, 2.5 μL of Annexin V-FITC Reagent and 2.5 μL of PI Reagent were added to the cell suspension, and the mixture was incubated at room temperature in the dark for 20 min. Subsequently, 400 μL of diluted 1 × Annexin V Binding Buffer was added before flow cytometry analysis. 2.19 Mitochondrial Permeability Transition Pore Assay According to the manufacturer's instructions (Cat# KTA4002, abbkine), three types of detection solutions should be prepared: Calcein AM staining solution and Ionomycin control solution are only used for preliminary experiments to verify the staining conditions. The Fluorescence quenching solution working fluid is used in the formal experiment to measure the detection solution of MPTP. Follow the experimental procedures as required, and calculate the average fluorescence intensity using a flow cytometer for statistical analysis. 2.20 Statistical Analysis R-4.2.3 software, SPSS 26.0 software, image J software and GraphPad Prism 8.0 software were used for statistics. Data were expressed as the mean value ± SD. Student t test and Wilcoxon rank sum test were used for statistical analysis. A p value < 0.05 was considered statistically significant. Results Silencing CXCR4 alleviates M1 polarization of macrophages and reduces their inflammatory capacity First, we verified the expression of CXCR4 in lentivirus-silenced macrophages using PCR and WB (Figure 1 A and B). For M1 marker genes, we found that the decreased expression of CXCR4 led to a reduction in IL1β, IL6, TNF-α, and iNOS expression, while increasing ARG1 expression (Figure 1 C). This was further confirmed by WB experiments (Figure 1 D). Since the pro-inflammatory capacity of M1-polarized macrophages mainly depends on the flux of glucose to lactate, the production of reactive oxygen species, and nitric oxide[28].So we tested the impact of CXCR4 on ROS (Figure 1 E) and NO production (Figure 1 F) in macrophages. Consistent with the above, whether macrophages were induced to M1 polarization by LPS or not, both the content of NO in the cell culture medium and inside the cells was decreased. However, ROS levels were abnormally elevated, which seems to contradict the trend of M1 metabolic reprogramming, as for many years, reactive oxygen species have been viewed as destructive molecules and byproducts of cell stress. However, recent literature research indicates the importance of ROS as important endogenous signaling molecules[28-30].The main sources of ROS are NADPH oxidase (NOX) and mitochondria[31].The main source of ROS in macrophages is REDOX reaction resulting from electron transfer by mitochondrial complex[32].Therefore, next, we would like to elaborate the effects of CXCR4 on mitochondria and metabolic processes of macrophages. Inhibiting CXCR4 does not decrease macrophage mitochondrial function, but enhances mitochondrial metabolism We used MitoSOX reagent to observe the distribution of mitochondrial ROS, which was consistent with the previous findings that the reduction of CXCR4 led to an increase in mitochondrial ROS (Figure 2A). We hypothesized whether this was due to an increase in mitochondrial function and metabolism, or due to mitochondrial dysfunction (respiratory chain dysfunction, inner membrane damage, changes in membrane permeability) leading to increased ROS. The Mito-Tracker Red CMXRos probe can specifically detect bioactive mitochondria and monitor mitochondrial membrane potential. Experimental data showed that CXCR4 did not decrease mitochondrial membrane potential and, under LPS-induced conditions, to some extent, protected mitochondrial function (Figure 2B). The concentration of intracellular calcium ions affects mitochondrial function, including the transport of tricarboxylic acid cycle proteins, membrane permeability, and apoptosis. Experimental data showed that although calcium ion levels increased (Figure 2C), there was also a decrease in the opening of mitochondrial permeability transition pores (Figure 2D). Typically, a decrease in ATP levels indicates impaired or decreased mitochondrial function. In apoptosis, a decrease in ATP levels usually occurs simultaneously with a decrease in mitochondrial membrane potential. In this experiment, CXCR4 did not reduce intracellular ATP content (Figure 2E). Based on this, we explored the apoptotic state of cells, and CXCR4 was found to alleviate LPS-induced apoptosis (Figure 2F and G). Finally, using the Seahorse XF96 extracellular flux analyzer, we measured the OCR (oxygen consumption rate, representing OXPHOS) levels of macrophages. Under LPS-induced polarization conditions, CXCR4 still played a protective role in mitochondrial function (Figure 2H). ATP production, mitochondrial basal metabolism, and maximum metabolism levels also increased with the silencing of CXCR4 (Figure 2I). Importantly, the significant reduction of CXCR4 enhanced the OCR of maximum and basal respiration weakened by LPS, indicating a protective role of CXCR4 in mitochondria. As for the changes in intracellular calcium ion concentrations, we speculate that CXCR4 itself affects the activation of calcium ion channels or the intracellular calcium ion homeostasis. Inhibit CXCR4 and reduce macrophage glycolytic metabolism During the polarization process of M1 macrophages, glycolysis metabolism plays a dominant role[33, 34]. Decreasing CXCR4 can enhance the mitochondrial metabolism of macrophages. Based on this, we speculate that CXCR4 can alter macrophage polarization status through glycolysis metabolism. Cellular lactate levels (Figure 3A) and glucose uptake experiments (Figure 3B) indicated that inhibition of CXCR4 was associated with a suppression of glycolytic flux in macrophages. Consistent with expectations, Seahorse glycolytic stress tests revealed that LPS stimulation for 24 hours shifted macrophages towards anaerobic glycolysis, and inhibition of CXCR4 led to a decrease in ECAR in the presence of glucose (Figure 3C). Similarly, conversely, silencing CXCR4 reduced baseline glycolysis and significantly impaired the ability of glycolysis to increase after mitochondrial inhibition (Figure 3D). Figure 3E shows the changes in several key enzymes of glycolysis after reducing CXCR4 expression, with only Pfkfb3 being downregulated. We validated the changes of Pfkfb3 at the protein level (Figure 3F). Immunofluorescence staining showed that the expression of Pfkfb3 in macrophages, whether polarized or not, was influenced by CXCR4 (Figure 3G). Figure 3H shows the main enzymes involved in the glycolysis process and regulatory enzymes. Phosphofructokinase-1 is the most important enzyme in regulating glycolytic rate, and its most potent allosteric activator is fructose-2,6-bisphosphate, which is formed by catalyzing fructose-6-phosphate-C2 phosphorylation by phosphofructokinase-2 [35]. We used the glycolytic inhibitor 2-deoxy-D-glucose (2-DG) to block glucose supply and found that in macrophages with inhibited CXCR4 expression, the expression of IL-1β, IL-6, TNF-α, and iNOS decreased while arginase-1 increased (Figure3 I). These results indicate that CXCR4 can alter macrophage polarization by affecting glycolytic metabolism processes. CXCR4 affects c-Myc transcription regulation through the PI3K/AKT/mTOR pathway AKT pathway and c-Myc are major transcription factors deeply involved in glycolytic metabolism [36-38],We want to explore whether CXCR4 downstream affects the expression of AKT and c-Myc. Immunofluorescence staining shows that CXCR4 reduction in macrophages leads to decreased AKT pathway activation (Figure4 A). Figure4 B indicates changes in the activation of the PI3K/AKT/mTOR pathway and c-myc protein expression. CXCR4 expression affects mRNA c-Myc expression (Figure4 C). c-Myc is distributed less in the cytoplasm and nucleus of macrophages with silenced CXCR4 (Figure4 D). We used a c-Myc inhibitor (10058-F4) and found that Pfkfb3 expression is reduced (Figure4 E and F). Firstly, through ChIP experiments, we verified the predicted binding sites 1 and 2, where c-Myc as a transcription factor can bind to the promoter region of Pfkfb3, as shown by q-PCR (Figure4 H) and gel electrophoresis (Figure4 G). Subsequently, we designed plasmids targeting three sites for dual-luciferase experiments to demonstrate that c-Myc can regulate the expression of Pfkfb3 (Figure5 I). All these results confirm that CXCR4 induction of Pfkfb3 is crucial for M1 polarization, glycolysis, and inflammation. M1 cells expressing CXCR4+ are highly expressed in prostatitis tissues We collected human surgical specimens of prostate hyperplasia and divided them into inflammatory group and non-inflammatory group based on whether there was a large amount of inflammatory cell infiltration in the pathology. Immunofluorescence co-staining of CD68 and iNOS indicated that prostate inflammation had more M1 cell infiltration (Figure 5 A). Immunofluorescence localization of CD68 with CXCR4 and PFKFB3 showed that the expression of CXCR4 and PFKFB3 in prostate macrophages with inflammation was higher (Figure 5 B and C). Therefore, we reasonably speculated that CXCR4-driven M1 macrophages in prostate inflammation may influence the pathological process to a certain extent. In order to explore possible mechanisms, we constructed a mouse model of experimental autoimmune prostatitis (EAP) and continuously intraperitoneally injected AMD3100 (CXCR4 inhibitor) at a dose of 5mg/kg/day for two weeks, while the control group received an equal amount of PBS intraperitoneally. After sacrificing the mice, we took half of the prostate tissue from each group for RNA-seq and untargeted metabolomics sequencing. Figure 5 D displayed the distribution of genes involved in glycolytic metabolism with |LogFc|>1 and p<0.05 as the criteria through a volcano plot, indicating that most key genes involved in glycolysis were upregulated or unchanged, while Pfkfb3 was downregulated. The heatmap showed the expression levels of key glycolytic metabolism enzymes in each group (Figure 5 E). GO enrichment analysis revealed differences in terms of myofibril and calcium ion pathways (Figure 5 F). In the GSEA analysis, the collagen binding pathway was significantly inhibited after the use of AMD3100 (Figure 5 G). The sequencing results of the transcriptome indicated that CXCR4 might affect the process of prostate fibrosis. As for untargeted metabolomics, we focused on changes in carbohydrate metabolism products. We first showed the differences in related metabolites (Figure 5 H). Then, in the order of glycolytic metabolism process, we sequentially displayed the levels of products through a heatmap. We could clearly see that, including fructose-6-phosphate, the increase in glycolytic products in inflammation could not be changed by the use of AMD3100 (Figure 5 I). The change occurred in the process from fructose-6-phosphate to fructose-1,6-diphosphate, a step catalyzed by the key enzyme Pfk-1. The expression of Pfkm was increased in the transcriptome (Figure 5 E), but the expression of Pfkfb3 was decreased. Pfkfb3 catalyzes fructose-2,6-diphosphate, the most important regulator of Pfk-1, deeply affecting the flux of sugar metabolism[35]. The ratio of Fructose 6-phosphate to Fructose 1,6-bisphosphate is used to demonstrate the activity of the Pfk-1 enzyme. It is evident that Pfk-1 activity significantly decreases after the use of AMD3100 (Figure 5 J). As expected, KEGG analysis of the final metabolism pathway shows differences in glycolysis metabolism pathway after the use of AMD3100 (Figure 5 K). Inhibiting CXCR4 expression alleviates the severity of chronic prostatitis in mice and reduces macrophage infiltration We first constructed an adenovirus-related virus knockdown CXCR4 mouse model, and then constructed an EAP model. HE staining and immunohistochemical staining of CD45 showed that mouse inflammation decreased with the decrease of CXCR4, as well as a reduction in the infiltration of inflammatory cells in the stroma (Figure 6 A). The inflammatory scores from the HE staining (Figure 6 B) and the mouse pelvic pain test (Figure 6 C) also indicated relief of inflammation. Figure 6 D illustrates the decrease in CXCR4. The mRNA levels of inflammatory factors including IL-1β, IL-6, and TNF-α in prostate tissue decreased with the inhibition of CXCR4 (Figure 6 E). Immunofluorescence staining demonstrated the impact of CXCR4 on macrophage infiltration in prostatitis (Figure 6 F). The proportion of M1 cells in mice with prostatitis detected by flow cytometry in vivo , we found that the proportion of M1 cells increased when inflammation occurred and decreased with the reduction of CXCR4(Figure 6 G). The results of IHC showed that Pfkfb3 decreases in prostatitis with the decrease of CXCR4 (Figure 6 H), which was also validated by WB experiments (Figure 6 I). Reducing CXCR4 can inhibit chronic prostatitis fibrosis Figure 7A shows that the degree of prostate fibrosis in EAP+shCXCR4 mice is significantly lower than in EAP+shNC mice, as demonstrated by Masson, Sirius Red, and α-smooth muscle actin (α-SMA) staining. On the day of sacrificing the mice, we measured the body weight and prostate weight, and calculated the prostate fibrosis index as prostate weight/body weight ratio. The fibrosis index of the prostate in the EAP+shCXCR4 mouse group decreased compared to the control group (Figure 7B). Immunofluorescence staining showed a decrease in collagen I (Figure 7C) in the prostate tissue of EAP+shCXCR4 mice. Furthermore, the mRNA expression of α-SMA, Col1a1, and Timp1 in the prostate tissue of EAP+shCXCR4 mice was significantly lower than in the control group (Figure 7D). Western blot analysis further showed that CXCR4 deficiency reduced the expression of type I collagen, α-SMA, and Timp1 in fibrotic prostate tissue compared to the control group (Figure 7E). To clarify the impact of macrophages on fibroblasts, we conducted a co-culture experiment following the process shown in Figure 7F. Macrophages were polarized by LPS induction in vitro , and then the polarized macrophages were used to activate fibroblasts. PCR results showed that M1 macrophages with reduced CXCR4 had decreased levels of three fibrosis markers (α-SMA, Col1a1, and Timp1) compared to M1 macrophages in the control Sh NC group (Figure 7G). Immunofluorescence staining showed a significant reduction in the distribution of α-smooth muscle actin, a major substance in fibrosis, in the knockdown CXCR4 group (Figure 7H). Western blot analysis further indicated that CXCR4 deficiency weakened the activation of macrophages into fibroblasts and reduced the expression of type I collagen, α-SMA, and Timp1 (Figure 7I). Our study results suggest that the lack of CXCR4 can reduce fibroblast activation and alleviate prostatic fibrosis in mice CXCR4 deficiency alleviates M1 polarization and PI3K/AKT/mTOR pathway activation in fibrotic prostate As mentioned above, the lack of CXCR4 can alleviate liver inflammation, and CXCR4 may promote M1 polarization. We first immunofluorescence quantified M1, and the results showed that the iNOS+F4/80+ macrophages observed in EAP+Sh CXCR4 mice were fewer than those in EAP+Sh NC mice (Figure 8 A). In addition, in EAP mice with reduced CXCR4, the expression of inducible nitric oxide synthase (iNOS) mRNA was downregulated, while Arg1 was upregulated in the fibrotic prostate (Figure 8 B). WB analysis showed that in fibrotic prostates lacking CXCR4, the expression of iNOS and Arg1 was reduced compared to the control prostates (Figure 8 C). There are numerous literature studies indicating that the PI3K/AKT/mTOR pathway in macrophages mediates the progression of many inflammatory diseases[39-41],and WB analysis in fibrotic prostates also showed significant inhibition of the AKT pathway by inhibiting CXCR4(Figure 8 D). Finally, our immunofluorescence staining localization showed a decrease in the expression of Pfkfb3 in macrophages in fibrotic prostatitis (Figure 8 E). These results indicate that CXCR4 through the PI3K/AKT/mTOR pathway is a distinct regulatory pathway for macrophage-mediated chronic prostatitis. Discussion Chronic prostatitis is a complex multifactorial disease characterized by infiltration of various immune cells [12]. Derived from the bone marrow and infiltrating tissues, macrophages are a branch of mononuclear phagocytes that play a crucial role in maintaining the balance of tissue inflammation and immune attacks. When stimulated by tissue damage, macrophages are activated and polarized, secreting a large amount of pro-inflammatory and pro-fibrotic cytokines, and producing ECM components and other harmful molecules [19, 42, 43]. In this study, we identified CXCR4 as a pro-polarization molecule for macrophages, which affects macrophages' impact on the fibrotic pathological process by regulating glucose metabolism. Furthermore, we elucidated the transcriptional activation of Pfkfb3 by c-MYC, thereby influencing the infiltration and polarization status of macrophages in the prostate. Our findings suggest for the first time that CXCR4 can alter macrophage metabolism processes and that macrophages are one of the main sources promoting prostate fibrosis in chronic prostatitis. CXCR4 was originally isolated and purified from a human blood mononuclear cell gene library using gene probes, and it is highly expressed in mononuclear cells [44]. The research on CXCR4 related to macrophages has previously included studies on how CXCR4 affects the autophagy process in coronary heart disease [45], Liver damage affects macrophage apoptosis through CXCR4 [46] and macrophages in gastric cancer rely on CXCR4 to promote tumor metastasis[47] etc . Research on macrophages in chronic prostatitis has yielded clear results. [26, 48].In this study, we first clarified the influence of CXCR4 on the polarization state of macrophages. In the process of reducing the expression of CXCR4, we found that inflammatory factors, the proportion of M1 cells and the content of NO were decreased, but ROS was slightly increased. ROS mainly comes from mitochondria, and the rise of ROS is generally considered to be the destruction of mitochondrial function and electron leakage [49]. Based on this, we speculate that it is not the destruction of mitochondria, but the enhancement of oxidative phosphorylation that leads to the increase in ROS. The transition of macrophages from M1 to M2 status is characterized by a shift from glycolysis to oxidative phosphorylation[50]. This study provides compelling evidence that silencing CXCR4 does not impair mitochondrial function. Our data clearly show that while mitochondrial ROS levels increase, mitochondrial function remains intact. Glucose uptake experiments, lactate measurements, and Seahorse energy metabolism assays demonstrate that downregulation of CXCR4 is associated with inhibition of glycolysis and enhancement of mitochondrial function, which indirectly confirms that CXCR4 influences the polarization of macrophages towards the M1 state. As a key regulatory factor of glycolysis [51],The rate of glycolysis flux is determined by three key enzymes regulated under various conditions. Among them, the most crucial one is phosphofructokinase-1 (PFK-1), and its most important and potent allosteric regulator is fructose-2,6-bisphosphate, which negates the inhibitory effects of ATP and citrate[35]. In macrophages, the typical types are LPS-induced M1 macrophages and IL-4 and IL-13-induced M2 macrophages. Metabolic changes similar to the Warburg effect occur in the context of inflammation induction. Recent studies on c-MYC have identified it as a key factor in tumor metabolism immunity and a major regulator of metabolic reprogramming, stimulating glycolysis, nucleotide metabolism, and glutamine metabolism[37, 52].Although some studies have indicated that silencing CXCR4 in T-cell acute lymphoblastic leukemia can inhibit the expression of myc [53]. However, we first demonstrated the transcriptional regulation of Pfkfb3 by MYC in macrophages. But in the process of knocking down CXCR4, only Pfkfb3 among the key enzymes of glucose metabolism decreased. As the gene identified as the first in macrophages, the exact reason behind this difference is not yet clear, but it suggests that Pfkfb3 plays a critical role in metabolism during macrophage M1 polarization. Fibrosis issues associated with chronic prostatitis have gradually been noticed. [2, 4, 6, 7] .It is worth noting that there is a certain association between the infiltration of inflammatory cells (such as macrophages) and prostatic fibrosis. However, it remains to be verified whether the effects produced by activated macrophages are necessary for the occurrence and development of prostatic fibrosis. Based on this, the experimental data demonstrate that reducing CXCR4 expression in EAP mice significantly reduces the degree of inflammation infiltration and fibrosis. Co-culture studies in vitro also confirmed that silencing CXCR4 in macrophages reduces their role in promoting proliferation and activation of stromal fibroblasts. These results clearly indicate the important role of CXCR4 in promoting macrophages in prostatic fibrosis. In conclusion, we show here that CXCR4, by affecting glucose metabolism, mediates macrophage polarization. Blocking the expression of CXCR4 can inhibit the activation of fibroblasts, improve the fibrotic lesions of chronic prostatitis. Although this experiment still has limitations and further research is needed, we have demonstrated the important role of metabolic reprogramming of macrophage polarization in the state of fibroblasts. These studies also provide new perspectives on the close relationship between chronic prostatitis and prostatic fibrosis, as well as new targets for clinical treatment. Declarations Conflicts of interest disclosure None. Availability of Data and Materials None. Funding support The National Natural Science Foundation of China 82170787, 82300872, and 82370776. Author contribution LZ, XC and CJ: conception and design this study; ZY, FR and ZC: collection and assembly of data; PW, SJ, XWL, MWM, ZY, FR and ZC: data Analysis and interpretation; ZY: manuscript writing. Final Approval of Manuscript: All the authors. Acknowledgments We sincerely thank the team of Academician Shao Feng for the gift of iBMDM cells. We wish to thank the Center for Scientific Research of the First Affiliated Hospital of Anhui Medical University for valuable help in seahorse experiments. Thanks for Dr. Dandan Zang's guidance and assistance with the seahorse experiment. References Krieger JN, Riley DE, Cheah PY, Liong ML, Yuen KH: Epidemiology of prostatitis: new evidence for a world-wide problem . World J Urol 2003, 21 (2):70-74. Blaivas JG: Obstructive uropathy in the male . Urol Clin North Am 1996, 23 (3):373-384. Rodriguez-Nieves JA, Macoska JA: Prostatic fibrosis, lower urinary tract symptoms, and BPH . Nat Rev Urol 2013, 10 (9):546-550. Robert G, Descazeaud A, Nicolaiew N, Terry S, Sirab N, Vacherot F, Maille P, Allory Y, de la Taille A: Inflammation in benign prostatic hyperplasia: a 282 patients' immunohistochemical analysis . Prostate 2009, 69 (16):1774-1780. Huang XH, Qin B, Liang YW, Wu QG, Li CZ, Wei GS, Ji HC, Liang YB, Chen HQ, Guan T: [LUTS in BPH patients with histological prostatitis before and after transurethral resection of the prostate] . Zhonghua Nan Ke Xue 2013, 19 (1):35-39. St Sauver JL, Jacobson DJ, McGree ME, Girman CJ, Lieber MM, Jacobsen SJ: Longitudinal association between prostatitis and development of benign prostatic hyperplasia . Urology 2008, 71 (3):475-479; discussion 479. Krieger JN, Lee SW, Jeon J, Cheah PY, Liong ML, Riley DE: Epidemiology of prostatitis . Int J Antimicrob Agents 2008, 31 Suppl 1 (Suppl 1):S85-90. Bushman WA, Jerde TJ: The role of prostate inflammation and fibrosis in lower urinary tract symptoms . Am J Physiol Renal Physiol 2016, 311 (4):F817-F821. Wynn TA: Cellular and molecular mechanisms of fibrosis . J Pathol 2008, 214 (2):199-210. Hinz B: Formation and function of the myofibroblast during tissue repair . J Invest Dermatol 2007, 127 (3):526-537. Pohlers D, Brenmoehl J, Loffler I, Muller CK, Leipner C, Schultze-Mosgau S, Stallmach A, Kinne RW, Wolf G: TGF-beta and fibrosis in different organs - molecular pathway imprints . Biochim Biophys Acta 2009, 1792 (8):746-756. Theyer G, Kramer G, Assmann I, Sherwood E, Preinfalk W, Marberger M, Zechner O, Steiner GE: Phenotypic characterization of infiltrating leukocytes in benign prostatic hyperplasia . Lab Invest 1992, 66 (1):96-107. Zhang ZY, Zug C, Schluesener HJ: Sphingosine 1-phosphate receptor modulator FTY720 suppresses rat experimental autoimmune prostatitis . Scand J Immunol 2011, 73 (6):546-553. Weidenbusch M, Anders HJ: Tissue microenvironments define and get reinforced by macrophage phenotypes in homeostasis or during inflammation, repair and fibrosis . J Innate Immun 2012, 4 (5-6):463-477. Perciani CT, MacParland SA: Lifting the veil on macrophage diversity in tissue regeneration and fibrosis . Sci Immunol 2019, 4 (40). Cao Q, Wang Y, Harris DC: Macrophage heterogeneity, phenotypes, and roles in renal fibrosis . Kidney Int Suppl (2011) 2014, 4 (1):16-19. Tacke F, Zimmermann HW: Macrophage heterogeneity in liver injury and fibrosis . J Hepatol 2014, 60 (5):1090-1096. Bruscia EM, Bonfield TL: Cystic Fibrosis Lung Immunity: The Role of the Macrophage . J Innate Immun 2016, 8 (6):550-563. Buechler MB, Fu W, Turley SJ: Fibroblast-macrophage reciprocal interactions in health, fibrosis, and cancer . Immunity 2021, 54 (5):903-915. Lu L, Li J, Jiang X, Bai R: CXCR4/CXCL12 axis: "old" pathway as "novel" target for anti-inflammatory drug discovery . Med Res Rev 2024, 44 (3):1189-1220. Gharaee-Kermani M, Kasina S, Moore BB, Thomas D, Mehra R, Macoska JA: CXC-type chemokines promote myofibroblast phenoconversion and prostatic fibrosis . PLoS One 2012, 7 (11):e49278. Rodriguez-Nieves JA, Patalano SC, Almanza D, Gharaee-Kermani M, Macoska JA: CXCL12/CXCR4 Axis Activation Mediates Prostate Myofibroblast Phenoconversion through Non-Canonical EGFR/MEK/ERK Signaling . PLoS One 2016, 11 (7):e0159490. Van Schaftingen E, Lederer B, Bartrons R, Hers HG: A kinetic study of pyrophosphate: fructose-6-phosphate phosphotransferase from potato tubers. Application to a microassay of fructose 2,6-bisphosphate . Eur J Biochem 1982, 129 (1):191-195. De Bock K, Georgiadou M, Schoors S, Kuchnio A, Wong BW, Cantelmo AR, Quaegebeur A, Ghesquiere B, Cauwenberghs S, Eelen G et al : Role of PFKFB3-driven glycolysis in vessel sprouting . Cell 2013, 154 (3):651-663. Motrich RD, Breser ML, Sanchez LR, Godoy GJ, Prinz I, Rivero VE: IL-17 is not essential for inflammation and chronic pelvic pain development in an experimental model of chronic prostatitis/chronic pelvic pain syndrome . Pain 2016, 157 (3):585-597. Hua X, Ge S, Zhang M, Mo F, Zhang L, Zhang J, Yang C, Tai S, Chen X, Zhang L et al : Pathogenic Roles of CXCL10 in Experimental Autoimmune Prostatitis by Modulating Macrophage Chemotaxis and Cytokine Secretion . Front Immunol 2021, 12 :706027. Chen J, Meng J, Li X, Li X, Liu Y, Jin C, Zhang L, Hao Z, Chen X, Zhang M et al : HA/CD44 Regulates the T Helper 1 Cells Differentiation by Activating Annexin A1/Akt/mTOR Signaling to Drive the Pathogenesis of EAP . Front Immunol 2022, 13 :875412. Li M, Yang Y, Xiong L, Jiang P, Wang J, Li C: Metabolism, metabolites, and macrophages in cancer . J Hematol Oncol 2023, 16 (1):80. Sies H, Jones DP: Reactive oxygen species (ROS) as pleiotropic physiological signalling agents . Nat Rev Mol Cell Biol 2020, 21 (7):363-383. Schieber M, Chandel NS: ROS function in redox signaling and oxidative stress . Curr Biol 2014, 24 (10):R453-462. Holmstrom KM, Finkel T: Cellular mechanisms and physiological consequences of redox-dependent signalling . Nat Rev Mol Cell Biol 2014, 15 (6):411-421. Tran N, Mills EL: Redox regulation of macrophages . Redox Biol 2024, 72 :103123. Mouton AJ, Li X, Hall ME, Hall JE: Obesity, Hypertension, and Cardiac Dysfunction: Novel Roles of Immunometabolism in Macrophage Activation and Inflammation . Circ Res 2020, 126 (6):789-806. Saha S, Shalova IN, Biswas SK: Metabolic regulation of macrophage phenotype and function . Immunol Rev 2017, 280 (1):102-111. Van Schaftingen E, Jett MF, Hue L, Hers HG: Control of liver 6-phosphofructokinase by fructose 2,6-bisphosphate and other effectors . Proc Natl Acad Sci U S A 1981, 78 (6):3483-3486. Ni X, Lu CP, Xu GQ, Ma JJ: Transcriptional regulation and post-translational modifications in the glycolytic pathway for targeted cancer therapy . Acta Pharmacol Sin 2024. Venkatraman S, Balasubramanian B, Thuwajit C, Meller J, Tohtong R, Chutipongtanate S: Targeting MYC at the intersection between cancer metabolism and oncoimmunology . Front Immunol 2024, 15 :1324045. D'Souza LC, Shekher A, Challagundla KB, Sharma A, Gupta SC: Reprogramming of glycolysis by chemical carcinogens during tumor development . Semin Cancer Biol 2022, 87 :127-136. Linton MF, Moslehi JJ, Babaev VR: Akt Signaling in Macrophage Polarization, Survival, and Atherosclerosis . Int J Mol Sci 2019, 20 (11). Covarrubias AJ, Aksoylar HI, Horng T: Control of macrophage metabolism and activation by mTOR and Akt signaling . Semin Immunol 2015, 27 (4):286-296. Vergadi E, Ieronymaki E, Lyroni K, Vaporidi K, Tsatsanis C: Akt Signaling Pathway in Macrophage Activation and M1/M2 Polarization . J Immunol 2017, 198 (3):1006-1014. Yang H, Cheng H, Dai R, Shang L, Zhang X, Wen H: Macrophage polarization in tissue fibrosis . PeerJ 2023, 11 :e16092. Wen JH, Li DY, Liang S, Yang C, Tang JX, Liu HF: Macrophage autophagy in macrophage polarization, chronic inflammation and organ fibrosis . Front Immunol 2022, 13 :946832. Loetscher M, Geiser T, O'Reilly T, Zwahlen R, Baggiolini M, Moser B: Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes . J Biol Chem 1994, 269 (1):232-237. Li F, Peng J, Lu Y, Zhou M, Liang J, Le C, Ding J, Wang J, Dai J, Wan C et al : Blockade of CXCR4 promotes macrophage autophagy through the PI3K/AKT/mTOR pathway to alleviate coronary heart disease . Int J Cardiol 2023, 392 :131303. Ma Q, Zhang N, You Y, Zhu J, Yu Z, Chen H, Xie X, Yu H: CXCR4 blockade in macrophage promotes angiogenesis in ischemic hindlimb by modulating autophagy . J Mol Cell Cardiol 2022, 169 :57-70. Tang C, Lei X, Xiong L, Hu Z, Tang B: HMGA1B/2 transcriptionally activated-POU1F1 facilitates gastric carcinoma metastasis via CXCL12/CXCR4 axis-mediated macrophage polarization . Cell Death Dis 2021, 12 (5):422. Hua X, Zhang J, Ge S, Liu H, Du H, Niu Q, Chen X, Yang C, Zhang L, Liang C: CXCR3 antagonist AMG487 ameliorates experimental autoimmune prostatitis by diminishing Th1 cell differentiation and inhibiting macrophage M1 phenotypic activation . Prostate 2022, 82 (13):1223-1236. Okoye CN, Koren SA, Wojtovich AP: Mitochondrial complex I ROS production and redox signaling in hypoxia . Redox Biol 2023, 67 :102926. Dussold C, Zilinger K, Turunen J, Heimberger AB, Miska J: Modulation of macrophage metabolism as an emerging immunotherapy strategy for cancer . J Clin Invest 2024, 134 (2). Shi L, Pan H, Liu Z, Xie J, Han W: Roles of PFKFB3 in cancer . Signal Transduct Target Ther 2017, 2 :17044. Purhonen J, Klefstrom J, Kallijarvi J: MYC-an emerging player in mitochondrial diseases . Front Cell Dev Biol 2023, 11 :1257651. Ma W, Wan Y, Zhang J, Yao J, Wang Y, Lu J, Liu H, Huang X, Zhang X, Zhou H et al : Growth arrest-specific protein 2 (GAS2) interacts with CXCR4 to promote T-cell leukemogenesis partially via c-MYC . Mol Oncol 2022, 16 (20):3720-3734. Additional Declarations No competing interests reported. Supplementary Files TableS1.xlsx TableS2.xlsx Cite Share Download PDF Status: Published Journal Publication published 26 Sep, 2024 Read the published version in Cell Communication and Signaling → Version 1 posted Editorial decision: Revision requested 12 Jul, 2024 Reviews received at journal 11 Jul, 2024 Reviews received at journal 07 Jul, 2024 Reviewers agreed at journal 01 Jul, 2024 Reviewers agreed at journal 30 Jun, 2024 Reviews received at journal 24 Jun, 2024 Reviewers agreed at journal 22 Jun, 2024 Reviewers agreed at journal 20 Jun, 2024 Reviewers invited by journal 19 Jun, 2024 Editor assigned by journal 18 Jun, 2024 Submission checks completed at journal 18 Jun, 2024 First submitted to journal 17 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4592373","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":322251689,"identity":"68e8b7fd-cede-481b-9196-0dd13d1382bc","order_by":0,"name":"Yi zhang","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"zhang","suffix":""},{"id":322251690,"identity":"d39f267a-4b2f-4aec-960e-ccddd1bade96","order_by":1,"name":"Chen Zhang","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Zhang","suffix":""},{"id":322251692,"identity":"d4123867-cf2b-4af3-bfe5-84c016cdefdb","order_by":2,"name":"Rui Feng","email":"","orcid":"","institution":"Shanghai University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Feng","suffix":""},{"id":322251694,"identity":"e10dab78-cb5c-4833-8b2e-c0d65e0f5099","order_by":3,"name":"Tong Meng","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tong","middleName":"","lastName":"Meng","suffix":""},{"id":322251696,"identity":"a920819b-2710-48e2-82be-6f8607340677","order_by":4,"name":"Wei Peng","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Peng","suffix":""},{"id":322251698,"identity":"c9d7826b-8d27-4a73-8f6a-b7ebabaaa6c9","order_by":5,"name":"Jian Song","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Song","suffix":""},{"id":322251699,"identity":"06e91d12-f5ae-4525-a38b-6ee5a23f26c4","order_by":6,"name":"Wenming Ma","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenming","middleName":"","lastName":"Ma","suffix":""},{"id":322251705,"identity":"a0891c67-080a-4b40-951a-a2d69848bf85","order_by":7,"name":"Wenlong Xu","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenlong","middleName":"","lastName":"Xu","suffix":""},{"id":322251706,"identity":"3f70bd4b-a852-4b76-a6ff-63d187854c89","order_by":8,"name":"Xianguo Chen","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xianguo","middleName":"","lastName":"Chen","suffix":""},{"id":322251708,"identity":"d1c345d7-7265-463b-b4bd-541a946f001d","order_by":9,"name":"Jing Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA40lEQVRIiWNgGAWjYHACAwbGBgYGxmYg84OBjR1pWhhnFKQlE68FBJh5PhyCsXED/hnJGxh+7rDJY27nPfzaxuAAMwP74aMb8GmRuJFWwNh7Jq2YsZkvzTrH4A4fA09a2g281tzIMWBmbDuc2NjMY2acY/CMmUGCxwyvFnmIlv8QLRYGhxkbCGkxgGg5ANJi/JiBGC2GZ54B/dKWDLaFsccgLZmNkF/kjoNCrM0ucWP/GeMPP/7Y2PGzHz6G3/sCCew/wNY1MLBJgBhseJWDAP8BCC0PjMkPBFWPglEwCkbBiAQAEhdLMZAF5LsAAAAASUVORK5CYII=","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jing","middleName":"","lastName":"Chen","suffix":""},{"id":322251710,"identity":"e97849a5-233a-4bcc-b4a0-1ae24d9b2910","order_by":10,"name":"Chaozhao Liang","email":"","orcid":"","institution":"the First Affiliated Hospital of Anhui Medical University, Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Chaozhao","middleName":"","lastName":"Liang","suffix":""}],"badges":[],"createdAt":"2024-06-17 07:14:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4592373/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4592373/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12964-024-01828-y","type":"published","date":"2024-09-26T15:57:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":59684904,"identity":"4bc3473d-c20b-4062-8264-e9ecd7afe44f","added_by":"auto","created_at":"2024-07-04 20:03:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1714804,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSilencing CXCR4 alleviates M1 polarization of macrophages and reduces their inflammatory capacity. \u003c/strong\u003eThe efficiency of knocking down CXCR4 in macrophages was detected by PCR(A) and WB(B). Divide macrophages into ShNC, Sh CXCR4, Sh NC+LPS, and Sh CXCR4+LPS four groups. The mRNA expression levels of IL-1β,IL-6, TNF-α, iNOS and Arg1 in CXCR4-knockdown macrophages were analyzed by PCR(C) and in protein expression levels of iNOS and Arg1 (D). (E) The ROS levels in macrophages were detected by flow cytometry. (F) Detect the content of NO in the supernatant and intracellular of four sets of macrophage culture medium. respectively. ns, Not Significant. ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/5af6407d1976055a3cf38f83.jpg"},{"id":59684905,"identity":"e3d80023-6f3b-4efa-a36f-8bf0e144b232","added_by":"auto","created_at":"2024-07-04 20:03:30","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2992863,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibiting CXCR4 does not decrease macrophage mitochondrial function, but enhances mitochondrial metabolism. \u003c/strong\u003eThe experimental groups of macrophages are ShNC, Sh CXCR4, Sh NC+LPS, and Sh CXCR4+LPS. A-D were used for flow cytometry to detect mitosox (A), mito-tracker red (B), Fluo-4AM (C), and Mptp (D). (E) ATP content in macrophages was measured using BCA for normalization. Apoptosis rate of macrophages was detected by flow cytometry, (F) corresponding data analysis was performed based on the apoptosis data, (G) flow cytometry graphs of cells. (H) Mitochondrial metabolic function of ibmdm was determined by real-time recording mitochondrial pressure (OAR) after continuous injection of oligomycin (O), FCCP, and Rot/AA. (I) Data from (H) was used to calculate basal respiratory capacity, ATP production, and maximum respiratory capacity of mitochondria. ns, Not Significant. ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/3bd05787cc5bbf614ddafebf.jpg"},{"id":59684773,"identity":"4050d2e7-e26b-44f9-a018-6cd728f5f56b","added_by":"auto","created_at":"2024-07-04 19:55:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4795353,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibit CXCR4 and reduce macrophage glycolytic metabolism. \u003c/strong\u003eMacrophages are divided into four groups: Sh NC, ShCXCR4, Sh NC+LPS, and Sh CXCR4+LPS.(A) Measurement of lactate production in iBMDM in response to LPS and CXCR4.(B) Flow cytometry analysis to assess cellular glucose uptake capacity.(C) Following sequential injections of glucose (Glc), oligomycin (O), and 2DG, changes in glycolytic stress in iBMDM are determined by real-time recording of extracellular acidification rate (ECAR).(D) Data analysis from (C) to determine the ECAR rate and maximum glycolytic capacity of macrophages. (E) q-PCR analysis to detect changes in mRNA levels of key glycolytic enzymes in macrophages. (F) Western blot analysis to determine the expression of Pfkfb3 in macrophages after knocking down CXCR4. (G) Immunofluorescence staining to observe the localization and changes in the levels of Pfkfb3 in macrophages. (H)a simple flow chart of glycolytic metabolism. (I) Transfect iBMDMs with Sh NC and Sh CXCR4, treat with LPS (100 ng/mL) for 4 hours. Wash the cells three times, pre-treat with 2.5 mM 2-DG for 1 hour, then treat with or without LPS (100 ng/mL) for another 4 hours. Determine the mRNA levels of IL-1β, IL-6, TNF-α, iNOS, and Arg1.ns, Not Significant. ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/6f0006976adbeb77a2769f12.jpg"},{"id":59684906,"identity":"37b5ad7e-19c7-4b3b-87c9-d1f8da5da9b9","added_by":"auto","created_at":"2024-07-04 20:03:30","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":740593,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCXCR4 affects c-Myc transcription regulation through the PI3K/AKT/mTOR pathway. \u003c/strong\u003e(A) Immunofluorescence staining showed changes in AKT in four groups of macrophages. (B) WB analysis of changes in the PI3K/AKT/mTOR pathway and phosphorylation, as well as c-Myc in macrophages. (C) PCR analysis of mRNA c-Myc changes after knocking down CXCR4. (D) Immunofluorescence staining analysis of changes in the localization and content of c-Myc. PCR (E) and WB (F) analysis of Pfkfb3 changes after using c-Myc (10058-F4). To verify the transcriptional regulation of c-Myc on Pfkfb3. (G) ChIP-qPCR detection of the binding status of c-Myc to three sites on the Pfkfb3 promoter. (H) Agarose gel electrophoresis results of PCR products further elucidated the transcriptional binding of c-Myc to Pfkfb3. (I) Plasmid transfection in 293T cells, dual-luciferase assay to clarify the interaction of the transcription factor c-Myc with the target gene Pfkfb3. ns, Not Significant. ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/47dee719348179924c92a173.jpg"},{"id":59684775,"identity":"c229fc36-bc9d-4870-8107-e82586783b75","added_by":"auto","created_at":"2024-07-04 19:55:30","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7033808,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eM1 cells expressing CXCR4+ are highly expressed in prostatitis tissues. \u003c/strong\u003eWe divided the collected human prostate tissues into inflammatory group and non-inflammatory group, and conducted immunofluorescence co-localization of CD68/INOS(A), CD68/CXCR4(B), and CD68/Pfkfb3(C). We established EAP mice and injected AMD3100 (5mg/kg/d) into the abdominal cavity, with the control group receiving an equal amount of PBS injection. After sacrificing the mice, we took half of the prostate for RNA-seq and non-targeted metabolic sequencing. (D) The volcano plot shows gene changes involved in glycolytic metabolism in RNA-seq. (E) The heatmap displays the mRNA levels of key glycolytic enzymes in each sample. (F) GO enrichment analysis of differentially expressed genes pathways. (G) GSEA enrichment analysis of different pathways. (H) The volcano plot shows differential metabolites in the non-targeted metabolic group. (I) The heatmap displays the levels of products in glycolysis process in each sample. (J) Analysis of PFK-1 enzyme activity after AMD3100 use. (K) KEGG enrichment analysis of differential pathways of metabolic products. ns, Not Significant. *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/b4d83e87c7420440b9019c08.jpg"},{"id":59684907,"identity":"f347f5f7-4744-4eb9-a572-1a482dd0d51f","added_by":"auto","created_at":"2024-07-04 20:03:30","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":10048021,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInhibiting CXCR4 expression alleviates the severity of chronic prostatitis in mice and reduces macrophage infiltration. \u003c/strong\u003eFirst inject adenovirus into the tail vein of the mice to construct the EAP mouse model, divided into four groups: control, EAP, EAP+Sh NC, and EAP+Sh CXCR4. (A) Show the inflammation status of the four groups of mice through HE staining and immunohistochemistry of CD45. (B) Quantify the degree of inflammation in mice through HE inflammatory scoring. (C) Pelvic pain stimulation experiment, indicating that inhibiting CXCR4 can alleviate pelvic pain symptoms in EAP mice. (D) WB analysis of the content of CXCR4 protein in mouse prostate. (E) PCR analysis of the expression of IL-1β, IL-6, and TNF-α mRNA in mouse prostate tissue. (F) Immunofluorescence staining analysis of macrophage infiltration in the prostate. (G) Flow cytometry results of splenic macrophages from each group of mice. (H) Immunohistochemistry staining of Pfkfb3 expression and distribution in the prostate. (I) WB analysis of the expression of Pfkfb3 in mouse prostate. ns, Not Significant. ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/5f6c0f1380d6bb8d6283e64b.jpg"},{"id":59684776,"identity":"f0c50e9b-0777-4d27-a6ee-a69ebf846216","added_by":"auto","created_at":"2024-07-04 19:55:30","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":13381609,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReducing CXCR4 can inhibit chronic prostatitis fibrosis. \u003c/strong\u003eThe mouse prostate fibrosis is divided into four groups: control, EAP, EAP+Sh NC, and EAP+Sh CXCR4. (A) Masson staining, Sirius Redstaining, and immunohistochemistry α-SMA staining were performed to clarify the situation of prostate fibrosis. (B) The ratio of mouse prostate weight/body weight was used to assess prostate fibrosis. (C) Immunofluorescence staining analyzed the changes of collagen 1 in the prostate. (D) PCR analysis of changes in α-SMA, Col1a1, and Timp1 mRNA in fibrotic mouse prostate. (E) WB analysis of changes in α-SMA, collagen 1, and Timp1 in fibrotic mouse prostate. (F) Schematic diagram of the co-culture process of macrophages and fibroblasts to clarify the effect of knocking down CXCR4 on M1 macrophage activation of fibroblasts. (G) Changes in α-SMA, Col1a1, and Timp1 mRNA in fibroblasts. (H) Immunofluorescence staining analyzed the changes of α-SMA in fibroblasts. (I) WB analysis of changes in α-SMA, Collagen 1, and Timp1 in fibroblasts. ns, Not Significant. ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/f7aad4b20d5ab87ab2b7b743.jpg"},{"id":59684778,"identity":"805d2179-7a90-4ca0-8acb-33625423ef44","added_by":"auto","created_at":"2024-07-04 19:55:30","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2576026,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCXCR4 deficiency alleviates M1 polarization and PI3K/AKT/mTOR pathway activation in fibrotic prostate. \u003c/strong\u003eThe mouse prostate fibrosis is divided into four groups: control, EAP, EAP+Sh NC, and EAP+Sh CXCR4. (A) Immunofluorescence co-staining analysis of the co-expression of F4/80/iNOS in prostate tissue. PCR (B) and WB (C) were used to detect the mRNA expression of iNOS and Arg1 in prostate tissue. (D) WB was employed to detect the phosphorylation activation of the PI3K/AKT/mTOR pathway and changes in the c-Myc protein level in prostate tissue. (E) Immunofluorescence staining analysis of the co-localization of F4/80/Pfkfb3 in prostate tissue. (F) Schematic diagram illustrating how CXCR4 influences c-Myc transcriptional regulation of Pfkfb3, leading to metabolic changes in macrophages and affecting the process of prostate fibrosis. ns, Not Significant. ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/8feb9958630b2b768f963bf7.jpg"},{"id":65627552,"identity":"446c4e9a-91cb-4929-a9ef-5cbbe994bdaf","added_by":"auto","created_at":"2024-09-30 16:16:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":45132800,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/b44571ba-aa6b-465b-a6ae-d69f036222f0.pdf"},{"id":59684769,"identity":"5594afcc-00e0-4828-8fc1-be7c80259851","added_by":"auto","created_at":"2024-07-04 19:55:30","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":9717,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/7810bfb2b975edd36a2b837a.xlsx"},{"id":59684771,"identity":"767ea36c-cb17-4d77-b37c-6146885a6fcd","added_by":"auto","created_at":"2024-07-04 19:55:30","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":11823,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4592373/v1/44ed19835906c9049a63c2d7.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"CXCR4 regulates macrophage M1 polarization by altering glycolysis to promote prostate fibrosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eChronic prostatitis is one of the most common diseases in adult males, with approximately 15% of men experiencing symptoms of prostatitis at some point in their lives[1]. The main symptoms during the course of the disease, apart from pain and lower urinary tract symptoms such as frequency, urgency, interruption of urination, and waiting to urinate, also seriously affect the quality of life of men. In the past, it was often thought to be secondary to inflammation of the prostate, increased volume, and the resulting increase in bladder outlet resistance or urethral sphincter contraction to explain. However, clinically, patients with prostatitis may experience LUTS even when their prostate volume is normal or slightly enlarged\u0026nbsp;[2].Prostate tissue specimens from patients with LUTS commonly show inflammatory infiltrates, including T cells, B cells, macrophages, and so on\u0026nbsp;[3].Research has shown that prostatitis is related to prostate volume, and patients with chronic inflammation cell infiltration have a larger prostate volume compared to those without evidence of inflammation[4].The severity of LUTS is also positively correlated with the degree of inflammation.\u0026nbsp;[5]In epidemiological research, there is an association between chronic prostatitis and the subsequent occurrence of LUTS\u0026nbsp;[6, 7].Fibrosis occurs downstream of inflammation in terms of the mechanism\u0026nbsp;[8],Chronic inflammation can cause damage to tissue cells, triggering abnormal healing responses, ultimately leading to fibrosis[9, 10].Prostate fibrosis is characterized by the accumulation of myofibroblasts, collagen deposition, extracellular matrix (ECM) remodeling, and increased tissue hardness\u0026nbsp;[3, 8, 11].Prostate fibrosis occurs under the stimulation of inflammation, leading to organ stiffness, disappearance of normal tissue structure, and thus adversely affecting lower urinary tract function, resulting in changes in voiding symptoms.\u003c/p\u003e\n\u003cp\u003eIn young men, only a small number of immune cells infiltrate the prostate gland. When inflammation occurs, a large number of immune cells, mainly including T cells and macrophages, will infiltrate\u0026nbsp;[12].Macrophages recruited in particular in prostatitis have been identified as key regulatory factors in prostatitis. In clinical practice, phospholipid vesicles are often used as an indicator to some extent to assess the severity of chronic prostatitis. Due to the decrease of phospholipid vesicles and the phenomenon of clustering during the inflammatory process, it indicates that the macrophages in\u0026nbsp;the area of inflammation engulf a large amount of lipids. Research has also pointed out that macrophages infiltrated in nerve tissues, especially in the nerve ganglia near the prostate, may be one of the causes of autoimmune prostatitis pain.\u0026nbsp;[13]Macrophages have been widely studied for their impact on fibrosis in various diseases.\u0026nbsp;[14, 15],renal[16],liver[17],lung[18]\u0026nbsp;\u003cem\u003eetc\u003c/em\u003e. In fact, fibroblasts and macrophages are present in all organs, usually closely connected to each other and may regulate each other as a feedback loop\u0026nbsp;[19]However, research on macrophages in prostate fibrosis has not been extensively studied.\u003c/p\u003e\n\u003cp\u003eCXCR4 is a chemokine receptor that plays a regulatory role in many diseases and is essential during embryonic development. CXCR4 knockout mice exhibit embryonic lethality, with defects in vascular development, hematopoiesis, and heart formation.\u0026nbsp;[20].\u0026nbsp;The CXCL12/CXCR4 pathway promotes the involvement of inflammatory cells in the occurrence and development of inflammatory reactions. At the same time, CXCL12/CXCR4 promotes the recruitment of key effector cells such as myofibroblasts and macrophages to the site of tissue damage\u0026nbsp;[9].The role of CXCR4 in inflammation has been widely studied over the past thirty years. However, CXCR4 is widely considered to be a pro-fibrotic protein, but previous research has mainly focused on its pro-fibrotic function in mesenchymal cells such as myofibroblasts, rather than its pro-fibrotic function in inflammatory cells such as macrophages\u0026nbsp;[21, 22].PFKFB3 plays an important regulatory role in the energy metabolism of glycolysis, and fructose-2,6-bisphosphate is the most potent allosteric activator of phosphofructokinase-1, which can function within physiological concentrations. Its driven glycolysis plays a crucial role in endothelial cells and myeloid cells\u0026nbsp;[23, 24].\u003c/p\u003e\n\u003cp\u003eHere, we aim to describe the role and mechanism of macrophage CXCR4 in prostatic fibrosis. We found that CXCR4 drives macrophage glycolytic metabolism by affecting PFKFB3 transcriptional regulation. Furthermore, we observed that in vivo inhibition of CXCR4 expression reduces inflammation and macrophage M1 polarization infiltration in a mouse model of chronic prostatitis. Finally, we discovered that CXCR4-silenced macrophages can affect fibroblast fibrosis, revealing the relationship between M1 macrophages and prostatic fibrosis. Therefore, we have uncovered the central role of CXCR4 in macrophage metabolism and in maintaining fibrosis in chronic prostatitis.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e2.1. Cell lines, treatment and knockout\u003c/p\u003e\n\u003cp\u003eCultivate the immortalized bone marrow-derived macrophage cell line iBMDM, embryonic fibroblast cell line 3T3, and HEK293T cells in high glucose DMEM medium supplemented with 10% fetal bovine serum (FBS) (Cat# BC-SE-FBS07, Biochannel) and 1% penicillin-streptomycin (Cat# C0222, beyotime). Induce macrophage polarization with LPS (100ng/ml) (Cat# HY-D1056, MCE) for 24 hours. To knock down CXCR4 in macrophages, transfect iBMDM cells with a lentiviral vector. After transfection for 24 hours, select anti-puromycin macrophages using 5 μg/mL puromycin. Incubate at 37°C with 5% CO2. The passage number of all cell lines used for experimental research is less than twenty.\u003c/p\u003e\n\u003cp\u003e2.2 Patient samples\u003c/p\u003e\n\u003cp\u003eAll clinical prostatic samples came from the First Affiliated Hospital of Anhui Medical University (Anhui, China,\u0026nbsp;Approval No: PJ2024-04-30), with 26 paraffin-embedded prostate tissue slices. Analysis of all specimens by patients was obtained with informed consent. All human studies were approved by the Medical Ethics Committee of Anhui Medical University.\u003c/p\u003e\n\u003cp\u003e2.3 Construction of a mouse model of autoimmune prostatitis (EAP) and evaluation of pelvic pain symptoms\u003c/p\u003e\n\u003cp\u003eFor the construction of experimental autoimmune prostatitis (EAP), NOD male mice were obtained from the Nanjing Biomedical Research Institute at Nanjing University. All in vivo experimental protocols were authorized by the Animal Center of Anhui Medical University (Approval No: LLSC20211051). Prostate tissues from SD rats were ground to obtain prostate antigens, which were then emulsified in equal amounts of complete Freund's adjuvant to prepare the immunizing reagent. Subsequently, on day 0 and day 28, 300 μg of the immunizing reagent was injected subcutaneously at various sites such as the base of the tail and hind paws of male NOD mice. The mouse modeling was divided into two phases. In the first phase, the EAP mice were divided into two groups, with one group receiving intraperitoneal injections of AMD3100 (5mg/kg/d, soluble in PBS) (Cat# GC14745, glpbio) and the control group receiving an equal amount of PBS via intraperitoneal injection for 14 consecutive days. After sacrificing these two groups of mice, the prostate tissues were collected for transcriptome sequencing and untargeted metabolome sequencing. In the second phase, EAP mice with reduced CXCR4 expression using adenovirus-associated vectors were constructed. Mice injected with Sh NC-AAV via the tail vein served as the control group. All mice injected with adenovirus-associated vectors were first injected with 100 μl of virus via the tail vein, followed by two subcutaneous immunizations for the construction of EAP model two weeks later. After 14 days of model construction, the reaction frequency of various fibers in the pelvic stimulation of mice in each group was tested before euthanasia. A positive pain response was considered if one of the following three reactions occurred: (a) severe abdominal contractions, (b) immediate scratching or licking of the area stimulated by the fibers, or (c) jumping.\u003c/p\u003e\n\u003cp\u003e2.4\u0026nbsp;Hematoxylin-Eosin (HE) Staining\u003c/p\u003e\n\u003cp\u003eDehydrate the paraffin section, stain with hematoxylin for 3-5 minutes, rinse with water, treat with differentiation solution, rinse again, incubate, rinse with tap water. Then, stain with eosin after sectioning. Dehydrate the slides in 95% ethanol for 1 minute, treat with eosin solution for 15 seconds, and cover with neutral resin. Classify the severity of inflammation into 4 levels: 0 = no inflammation, 1 = mild inflammation with evident mononuclear cell infiltration around blood vessels, 2 = moderate mononuclear cell infiltration around blood vessels, 3 = vessels significantly curved, bleeding, and rich mononuclear cell infiltration.\u003c/p\u003e\n\u003cp\u003e2.5\u0026nbsp;Immunohistochemistry Assay\u003c/p\u003e\n\u003cp\u003eFirst, deparaffinize the paraffin-embedded tissue sections with water, perform antigen retrieval with antigen retrieval solution, wash three times, soak in a 3% hydrogen peroxide solution, and then incubate in the dark at room temperature for 25 minutes to block endogenous peroxidase. Subsequently, block with 3% BSA serum, wash, treat with primary antibody at a certain ratio overnight at 4°C, wash three times, and then incubate with the corresponding secondary antibody (HRP labeled) at room temperature for 60 minutes. Afterwards, wash the sections, slightly dry, treat with freshly prepared DAB chromogenic solution, and rinse under running water to stop the chromogenic reaction. Finally, counterstain with hematoxylin, stain the cell nuclei, dehydrate, seal, and observe under a microscope. All primary antibodies are listed in Table S1.\u003c/p\u003e\n\u003cp\u003e2.6 Immunofluorescence\u003c/p\u003e\n\u003cp\u003eFirst, remove the paraffin from the wax sections in water, then repair the antigen with EDTA buffer (pH 6.00), wash three times, block the antigen, and then incubate overnight with the primary antibody prepared at a certain ratio at 4°C. Next, use the appropriate secondary antibody and let it incubate at room temperature in the dark for 2 hours. For nuclear staining, use DAPI and let it incubate at room temperature in the dark for 10 minutes. Finally, seal the sections with an anti-fluorescence quenching reagent, and evaluate and image under a fluorescence microscope. All primary antibody information is listed in Table S1.\u003c/p\u003e\n\u003cp\u003e2.7 Masson staining\u003c/p\u003e\n\u003cp\u003eThe Masson staining kit was purchased from Servicebio (Cat# G1006). After dewaxing paraffin sections to water, immerse the sections in Masson A solution overnight, rinse with tap water. Then immerse the sections in a mixture of Masson B solution and Masson C solution at a 1:1 ratio for 1 minute, rinse with tap water, differentiate in differentiation solution for several seconds, rinse with tap water. Immerse the sections in Masson D solution for 6 minutes, followed by immersion in Masson E solution for 1 minute. Without rinsing, remove excess liquid and directly immerse in Masson F solution for 20 seconds. Rinse the sections with 1% acetic acid for differentiation, dehydrate with ethanol, and mount with a coverslip.\u003c/p\u003e\n\u003cp\u003e2.8 Sirius Red staining\u003c/p\u003e\n\u003cp\u003eThe Sirius Red staining solution was purchased from Servicebio (Cat# G1018). Dewax the paraffin sections with water, stain with Sirius Red staining solution: stain the sections in Sirius Red staining solution for 8 minutes, dehydrate in absolute ethanol; mount coverslips after dehydration.\u003c/p\u003e\n\u003cp\u003e2.9 RNA Isolation and RT-qPCR\u003c/p\u003e\n\u003cp\u003eAccording to the reagent kit instructions, use ESscience RNA-quick purification technology to separate RNA from total prostate tissue (Cat# RN002plus; YiShan Biotech) and macrophages (Cat# ES-RN001; YiShan Biotech). Then, measure the purity and concentration of RNA using a NanoDrop 2000 spectrophotometer. Reverse transcription is performed using the PrimeScript™ RT kit, and qPCR reactions are prepared using SYBR Green Mix, with a final volume of 20µL. All primers are synthesized by General Biology. The primer sequences used are listed in Table S2. To elucidate the relative gene expression levels, the 2^−ΔΔCT method is employed, with β-actin as the internal reference for data normalization.\u003c/p\u003e\n\u003cp\u003e2.8 Western Blotting\u003c/p\u003e\n\u003cp\u003eUse RIPA lysis buffer (Beyotime) to separate total cellular proteins, enhanced with a mixture of PMSF, complete phosphatase and protease inhibitors. The extracted proteins were separated by 12.5% SDS-PAGE gel electrophoresis, transferred to NC membrane (Bio-Rad, Hercules), blocked in 5% non-fat milk at room temperature for 1 hour, incubated with primary antibody overnight at 4℃, washed, and then incubated with secondary antibody for 2 hours. β-actin was used as an internal reference for normalizing total proteins. Each reaction was repeated three times.\u003c/p\u003e\n\u003cp\u003e2.9 Co-culture\u003c/p\u003e\n\u003cp\u003eFirst, polarize the macrophages transfected with Sh NC and Sh CXCR4 by inducing with LPS (100ng/ml) for 24 hours. The next day, discard the supernatant and gently tap the cells to detach them, then wash the cells three times with PBS. Plate the 3T3 cells in the bottom layer of a six-well co-culture plate (Cat# 3412, Corning), and place the macrophages in the co-culture chamber. Continue to culture for 24 hours, then collect the 3T3 cells for the corresponding experimental tests.\u003c/p\u003e\n\u003cp\u003e2.10 RNA-seq\u003c/p\u003e\n\u003cp\u003eAccording to the kit instructions, TRIzol reagent was used to extract total RNA. The quantity and purity of RNA were assessed using a NanoDrop 2000 spectrophotometer, and the integrity was evaluated using the Agilent 2100 Bioanalyzer. The construction of the transcriptome library was performed using the VAHTS Universal V5 RNA-seq Library Prep Kit. The library was sequenced on the Illumina Novaseq 6000 platform. For differential gene expression analysis, the DESeq2 package was used, and genes with a q-value \u0026lt; 0.05 and |logfc| \u0026gt; 1 were defined as differentially expressed genes (DEGs).\u003c/p\u003e\n\u003cp\u003e2.11 Non- Targeted Metabolomics\u003c/p\u003e\n\u003cp\u003ePlace the prostate tissue sample (20 mg) in a 1.5 mL EP tube, add 2 small steel beads and methanol-water solution (400 μL, V: V = 4:1, containing 4 μg/mL l-2-chlorophenylalanine). After cooling at -40°C for 2 minutes, grind the material evenly, perform ultrasound extraction in an ice bath, and let it sit at -40°C for 2 hours. Centrifuge the sample for 10 minutes, collect 150 ul of the supernatant, filter it through a 0.22 μm organic phase syringe filter, transfer it to an LC injection vial, and analyze it by a liquid chromatography-tandem mass spectrometry system composed of ACQUITY UPLC I-Class plus and QE high-resolution mass spectrometer. The data is processed using Progenesis QI V2.3 software. VIP \u0026gt; 1.0 and p-value \u0026lt; 0.05 are used as the criteria for identifying differential metabolites.\u003c/p\u003e\n\u003cp\u003e2.12\u0026nbsp;Dual-luciferase reporter assay\u003c/p\u003e\n\u003cp\u003eTo verify the\u0026nbsp;c-MYC\u0026nbsp;transcriptional regulation of\u0026nbsp;Pfkfb3,\u0026nbsp;Clone the Pfkfb3 promoter into the pGL3 vector to construct the reporter gene vector, clone the transcription factor into the pCDNA3.1 expression vector to construct the target gene expression vector. Transfect the experimental group with the reporter gene, target gene expression vector, TK vector, and the control group with the reporter gene, empty vector, TK vector into HEK293T cells. After incubation, lyse the cells and detect using a spectrophotometer. Measure firefly luciferase and Renilla signals. Use Renilla luciferase activity as an endogenous control.\u003c/p\u003e\n\u003cp\u003e2.13\u0026nbsp;ChIP assay\u003c/p\u003e\n\u003cp\u003eThe ChIP assay was carried out per the kit’s guide. For immunoprecipitation, an anti-c-MYC\u0026nbsp;antibody (Cat# 18583; 1:100, CST)\u0026nbsp;was used. Additionally, purified DNA was analyzed by qPCR. Primer sequences: WT1 (F: GCCATTCTGTCAGCACTTGG, R: CAGACCTTGTTGCCACTGAG), WT2 (F: GGAGAGAGGGAGGAAGGAGA, R:\u0026nbsp;CCCAGACACAACAGAAGAGG), and WT3 (F: CAAAGGCATTCACCCCAAGA, R: CTGCCCTGGAACTCACTTT).The results of chromatin immunoprecipitation were analyzed using q-PCR and agarose gel electrophoresis\u003c/p\u003e\n\u003cp\u003e2.14 Seahorse XF assays\u003c/p\u003e\n\u003cp\u003eMacrophages were seeded in XFe96 plates at a density of 1.2×10^4 cells/well. After incubating at room temperature for 1 hour on a clean bench until the cells adhered to the wall, they were stimulated overnight with LPS (100ng/ml). At the same time, probe plates with sterile water and calibration solution were placed in a 37°C non-CO2 incubator overnight. The next day, the sterile water in the probe plate was discarded, and 200ul of calibration solution was added and placed in a 37°C non-CO2 cell culture incubator for 60 minutes. Mitochondrial stress test solutions (1mM pyruvate, 2mM glutamine, and 10mM glucose) and glycolysis stress test solution (2mM glutamine) were prepared separately. The cells were washed with the test solutions as required. Then the cell culture plates were placed in a 37°C non-CO2 cell culture incubator for 60 minutes. According to the instructions, the drug concentrations in the mitochondrial stress test were Oligomycin (1.5 μM), Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP) (2 μM), and Rotenone/antimycin A (0.5 μM), added to the respective ports of the utility plate for the standard MitoStress test. The drug concentrations in the glycolysis stress test were Glucose (10mM), Oligomycin (1.0 μM), and 2-DG (50mM). First, run the probe plate on the Seahorse XF Pro Analyzer (Agilent, Lexington, MA) for calibration. After completion, replace the hydration plate with the cell culture plate, and run the real-time Seahorse XFe96 analyzer using the Wave software to analyze the data.\u003c/p\u003e\n\u003cp\u003e2.15 Lactate assay, NO assay and ATP assay\u003c/p\u003e\n\u003cp\u003eAccording to the manufacturer's instructions, all detection of lysed cells will be normalized using BCA detection. Lactate assay kit (Cat# KTB1100, abbkine), NO assay kit (Cat# S0023, beyotime), and ATP assay kit (Cat# S0026B, beyotime).\u003c/p\u003e\n\u003cp\u003e2.16 2-NBDG, ROS, MitoSOX Red and Mito-Tracker Deep Red\u003c/p\u003e\n\u003cp\u003eAccording to the manufacturer's instructions, first treat the macrophages accordingly for 24 hours, then wash them once with PBS. Add the diluted liquid prepared according to the instructions into the culture plate, and incubate it in the dark at 37°C for the specified time. After that, gently transfer the cells into a flow tube, wash them twice with PBS, and use a flow cytometer for detection. Calculate the average fluorescence intensity for statistical analysis. 2-NBDG (Cat# GC10289, glpbio) should be incubated in the dark for 45 minutes, while ROS (Cat# S0033S, beyotime), MitoSOX Red (Cat# GC68230, glpbio), and Mito-Tracker Deep Red (Cat# C1035, beyotime) should all be incubated in the dark for thirty minutes.\u003c/p\u003e\n\u003cp\u003e2.17 Flow Cytometry Analysis\u003c/p\u003e\n\u003cp\u003eAs previously reported, mouse spleens were separated and single-cell suspensions were prepared[25-27]. After the macrophages were treated, they were cleaned once with PBS, gently blown down to the flow tube, cleaned three times with PBS, and then disposed of with PBS. 100ul PBS was added, and 2ul Cd11b-APC(Cat# 101212, Biolegend), F4/80-FITC(Cat# 123108, Biolegend), and Cd86-PE (Cat# 105008,Biolegend) were added to each flow tube respectively.\u003c/p\u003e\n\u003cp\u003e2.18 Annexin V-FITC/PI Apoptosis assay\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eApoptosis detection experiment (Cat# E-CK-A211, elabscience) was conducted according to the instructions. Cells were placed into a flow tube, centrifuged at 300 ×g for 5 min, and the supernatant was discarded. The cells were washed once with PBS, centrifuged, and the supernatant was discarded. 100 μL of diluted 1 × Annexin V Binding Buffer was added to resuspend the cells. Then, 2.5 μL of Annexin V-FITC Reagent and 2.5 μL of PI Reagent were added to the cell suspension, and the mixture was incubated at room temperature in the dark for 20 min. Subsequently, 400 μL of diluted 1 × Annexin V Binding Buffer was added before flow cytometry analysis.\u003c/p\u003e\n\u003cp\u003e2.19 Mitochondrial Permeability Transition Pore Assay\u003c/p\u003e\n\u003cp\u003eAccording to the manufacturer's instructions (Cat# KTA4002, abbkine), three types of detection solutions should be prepared: Calcein AM staining solution and Ionomycin control solution are only used for preliminary experiments to verify the staining conditions. The Fluorescence quenching solution working fluid is used in the formal experiment to measure the detection solution of MPTP. Follow the experimental procedures as required, and calculate the average fluorescence intensity using a flow cytometer for statistical analysis.\u003c/p\u003e\n\u003cp\u003e2.20 Statistical Analysis\u003c/p\u003e\n\u003cp\u003eR-4.2.3 software, SPSS 26.0 software, image J software and GraphPad Prism 8.0 software were used for statistics. Data were expressed as the mean value ± SD. Student t test and Wilcoxon rank sum test were used for statistical analysis. A p value \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eSilencing CXCR4 alleviates M1 polarization of macrophages and reduces their inflammatory capacity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFirst, we verified the expression of CXCR4 in lentivirus-silenced macrophages using PCR and WB (Figure 1 A and B). For M1 marker genes, we found that the decreased expression of CXCR4 led to a reduction in IL1\u0026beta;, IL6, TNF-\u0026alpha;, and iNOS expression, while increasing ARG1 expression (Figure 1 C). This was further confirmed by WB experiments (Figure 1 D). Since the pro-inflammatory capacity of M1-polarized macrophages mainly depends on the flux of glucose to lactate, the production of reactive oxygen species, and nitric oxide[28].So we tested the impact of CXCR4 on ROS (Figure 1 E) and NO production (Figure 1 F) in macrophages. Consistent with the above, whether macrophages were induced to M1 polarization by LPS or not, both the content of NO in the cell culture medium and inside the cells was decreased. However, ROS levels were abnormally elevated, which seems to contradict the trend of M1 metabolic reprogramming, as for many years, reactive oxygen species have been viewed as destructive molecules and byproducts of cell stress. However, recent literature research indicates the importance of ROS as important endogenous signaling molecules[28-30].The main sources of ROS are NADPH oxidase (NOX) and mitochondria[31].The main source of ROS in macrophages is REDOX reaction resulting from electron transfer by mitochondrial complex[32].Therefore, next, we would like to elaborate the effects of CXCR4 on mitochondria and metabolic processes of macrophages.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibiting CXCR4 does not decrease macrophage mitochondrial function, but enhances mitochondrial metabolism\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe used MitoSOX reagent to observe the distribution of mitochondrial ROS, which was consistent with the previous findings that the reduction of CXCR4 led to an increase in mitochondrial ROS (Figure 2A). We hypothesized whether this was due to an increase in mitochondrial function and metabolism, or due to mitochondrial dysfunction (respiratory chain dysfunction, inner membrane damage, changes in membrane permeability) leading to increased ROS. The Mito-Tracker Red CMXRos probe can specifically detect bioactive mitochondria and monitor mitochondrial membrane potential. Experimental data showed that CXCR4 did not decrease mitochondrial membrane potential and, under LPS-induced conditions, to some extent, protected mitochondrial function (Figure 2B). The concentration of intracellular calcium ions affects mitochondrial function, including the transport of tricarboxylic acid cycle proteins, membrane permeability, and apoptosis. Experimental data showed that although calcium ion levels increased (Figure 2C), there was also a decrease in the opening of mitochondrial permeability transition pores (Figure 2D). Typically, a decrease in ATP levels indicates impaired or decreased mitochondrial function. In apoptosis, a decrease in ATP levels usually occurs simultaneously with a decrease in mitochondrial membrane potential. In this experiment, CXCR4 did not reduce intracellular ATP content (Figure 2E). Based on this, we explored the apoptotic state of cells, and CXCR4 was found to alleviate LPS-induced apoptosis (Figure 2F and G). Finally, using the Seahorse XF96 extracellular flux analyzer, we measured the OCR (oxygen consumption rate, representing OXPHOS) levels of macrophages. Under LPS-induced polarization conditions, CXCR4 still played a protective role in mitochondrial function (Figure 2H). ATP production, mitochondrial basal metabolism, and maximum metabolism levels also increased with the silencing of CXCR4 (Figure 2I). Importantly, the significant reduction of CXCR4 enhanced the OCR of maximum and basal respiration weakened by LPS, indicating a protective role of CXCR4 in mitochondria. As for the changes in intracellular calcium ion concentrations, we speculate that CXCR4 itself affects the activation of calcium ion channels or the intracellular calcium ion homeostasis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibit CXCR4 and reduce macrophage glycolytic metabolism\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the polarization process of M1 macrophages, glycolysis metabolism plays a dominant role[33, 34]. Decreasing CXCR4 can enhance the mitochondrial metabolism of macrophages. Based on this, we speculate that CXCR4 can alter macrophage polarization status through glycolysis metabolism. Cellular lactate levels (Figure 3A) and glucose uptake experiments (Figure 3B) indicated that inhibition of CXCR4 was associated with a suppression of glycolytic flux in macrophages. Consistent with expectations, Seahorse glycolytic stress tests revealed that LPS stimulation for 24 hours shifted macrophages towards anaerobic glycolysis, and inhibition of CXCR4 led to a decrease in ECAR in the presence of glucose (Figure 3C). Similarly, conversely, silencing CXCR4 reduced baseline glycolysis and significantly impaired the ability of glycolysis to increase after mitochondrial inhibition (Figure 3D). Figure 3E shows the changes in several key enzymes of glycolysis after reducing CXCR4 expression, with only Pfkfb3 being downregulated. We validated the changes of Pfkfb3 at the protein level (Figure 3F). Immunofluorescence staining showed that the expression of Pfkfb3 in macrophages, whether polarized or not, was influenced by CXCR4 (Figure 3G). Figure 3H shows the main enzymes involved in the glycolysis process and regulatory enzymes. Phosphofructokinase-1 is the most important enzyme in regulating glycolytic rate, and its most potent allosteric activator is fructose-2,6-bisphosphate, which is formed by catalyzing fructose-6-phosphate-C2 phosphorylation by phosphofructokinase-2\u0026nbsp;[35].\u0026nbsp;We used the glycolytic inhibitor 2-deoxy-D-glucose (2-DG) to block glucose supply and found that in macrophages with inhibited CXCR4 expression, the expression of IL-1\u0026beta;, IL-6, TNF-\u0026alpha;, and iNOS decreased while arginase-1 increased (Figure3 I). These results indicate that CXCR4 can alter macrophage polarization by affecting glycolytic metabolism processes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCXCR4 affects c-Myc transcription regulation through the PI3K/AKT/mTOR pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAKT pathway and c-Myc are major transcription factors deeply involved in glycolytic metabolism\u0026nbsp;[36-38],We want to explore whether CXCR4 downstream affects the expression of AKT and c-Myc. Immunofluorescence staining shows that CXCR4 reduction in macrophages leads to decreased AKT pathway activation (Figure4 A). Figure4 B indicates changes in the activation of the PI3K/AKT/mTOR pathway and c-myc protein expression. CXCR4 expression affects mRNA c-Myc expression (Figure4 C). \u0026nbsp;c-Myc is distributed less in the cytoplasm and nucleus of macrophages with silenced CXCR4 (Figure4 D). We used a c-Myc inhibitor (10058-F4) and found that Pfkfb3 expression is reduced (Figure4 E and F). Firstly, through ChIP experiments, we verified the predicted binding sites 1 and 2, where c-Myc as a transcription factor can bind to the promoter region of Pfkfb3, as shown by q-PCR (Figure4 H) and gel electrophoresis (Figure4 G). Subsequently, we designed plasmids targeting three sites for dual-luciferase experiments to demonstrate that c-Myc can regulate the expression of Pfkfb3 (Figure5 I). All these results confirm that CXCR4 induction of Pfkfb3 is crucial for M1 polarization, glycolysis, and inflammation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eM1 cells expressing CXCR4+ are highly expressed in prostatitis tissues\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe collected human surgical specimens of prostate hyperplasia and divided them into inflammatory group and non-inflammatory group based on whether there was a large amount of inflammatory cell infiltration in the pathology. Immunofluorescence co-staining of CD68 and iNOS indicated that prostate inflammation had more M1 cell infiltration (Figure 5 A). Immunofluorescence localization of CD68 with CXCR4 and PFKFB3 showed that the expression of CXCR4 and PFKFB3 in prostate macrophages with inflammation was higher (Figure 5 B and C). Therefore, we reasonably speculated that CXCR4-driven M1 macrophages in prostate inflammation may influence the pathological process to a certain extent. In order to explore possible mechanisms, we constructed a mouse model of experimental autoimmune prostatitis (EAP) and continuously intraperitoneally injected AMD3100 (CXCR4 inhibitor) at a dose of 5mg/kg/day for two weeks, while the control group received an equal amount of PBS intraperitoneally. After sacrificing the mice, we took half of the prostate tissue from each group for RNA-seq and untargeted metabolomics sequencing. Figure 5 D displayed the distribution of genes involved in glycolytic metabolism with |LogFc|>1 and p\u0026lt;0.05 as the criteria through a volcano plot, indicating that most key genes involved in glycolysis were upregulated or unchanged, while Pfkfb3 was downregulated. The heatmap showed the expression levels of key glycolytic metabolism enzymes in each group (Figure 5 E). GO enrichment analysis revealed differences in terms of myofibril and calcium ion pathways (Figure 5 F). In the GSEA analysis, the collagen binding pathway was significantly inhibited after the use of AMD3100 (Figure 5 G). The sequencing results of the transcriptome indicated that CXCR4 might affect the process of prostate fibrosis. As for untargeted metabolomics, we focused on changes in carbohydrate metabolism products. We first showed the differences in related metabolites (Figure 5 H). Then, in the order of glycolytic metabolism process, we sequentially displayed the levels of products through a heatmap. We could clearly see that, including fructose-6-phosphate, the increase in glycolytic products in inflammation could not be changed by the use of AMD3100 (Figure 5 I). The change occurred in the process from fructose-6-phosphate to fructose-1,6-diphosphate, a step catalyzed by the key enzyme Pfk-1. The expression of Pfkm was increased in the transcriptome (Figure 5 E), but the expression of Pfkfb3 was decreased. Pfkfb3 catalyzes fructose-2,6-diphosphate, the most important regulator of Pfk-1, deeply affecting the flux of sugar metabolism[35].\u0026nbsp;The ratio of Fructose 6-phosphate to Fructose 1,6-bisphosphate is used to demonstrate the activity of the Pfk-1 enzyme. It is evident that Pfk-1 activity significantly decreases after the use of AMD3100 (Figure 5 J). As expected, KEGG analysis of the final metabolism pathway shows differences in glycolysis metabolism pathway after the use of AMD3100 (Figure 5 K).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibiting CXCR4 expression alleviates the severity of chronic prostatitis in mice and reduces macrophage infiltration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe first constructed an adenovirus-related virus knockdown CXCR4 mouse model, and then constructed an EAP model. HE staining and immunohistochemical staining of CD45 showed that mouse inflammation decreased with the decrease of CXCR4, as well as a reduction in the infiltration of inflammatory cells in the stroma (Figure 6 A). The inflammatory scores from the HE staining (Figure 6 B) and the mouse pelvic pain test (Figure 6 C) also indicated relief of inflammation. Figure 6 D illustrates the decrease in CXCR4. The mRNA levels of inflammatory factors including IL-1\u0026beta;, IL-6, and TNF-\u0026alpha; in prostate tissue decreased with the inhibition of CXCR4 (Figure 6 E). Immunofluorescence staining demonstrated the impact of CXCR4 on macrophage infiltration in prostatitis (Figure 6 F). The proportion of M1 cells in mice with prostatitis detected by flow cytometry in \u003cem\u003evivo\u003c/em\u003e, we found that the proportion of M1 cells increased when inflammation occurred and decreased with the reduction of CXCR4(Figure 6 G). The results of IHC showed that Pfkfb3 decreases in prostatitis with the decrease of CXCR4 (Figure 6 H), which was also validated by WB experiments (Figure 6 I).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReducing CXCR4 can inhibit chronic prostatitis fibrosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFigure 7A shows that the degree of prostate fibrosis in EAP+shCXCR4 mice is significantly lower than in EAP+shNC mice, as demonstrated by Masson, Sirius Red, and \u0026alpha;-smooth muscle actin (\u0026alpha;-SMA) staining. On the day of sacrificing the mice, we measured the body weight and prostate weight, and calculated the prostate fibrosis index as prostate weight/body weight ratio. The fibrosis index of the prostate in the EAP+shCXCR4 mouse group decreased compared to the control group (Figure 7B). Immunofluorescence staining showed a decrease in collagen I (Figure 7C) in the prostate tissue of EAP+shCXCR4 mice. Furthermore, the mRNA expression of \u0026alpha;-SMA, Col1a1, and Timp1 in the prostate tissue of EAP+shCXCR4 mice was significantly lower than in the control group (Figure 7D). Western blot analysis further showed that CXCR4 deficiency reduced the expression of type I collagen, \u0026alpha;-SMA, and Timp1 in fibrotic prostate tissue compared to the control group (Figure 7E). To clarify the impact of macrophages on fibroblasts, we conducted a co-culture experiment following the process shown in Figure 7F. Macrophages were polarized by LPS induction in \u003cem\u003evitro\u003c/em\u003e, and then the polarized macrophages were used to activate fibroblasts. PCR results showed that M1 macrophages with reduced CXCR4 had decreased levels of three fibrosis markers (\u0026alpha;-SMA, Col1a1, and Timp1) compared to M1 macrophages in the control Sh NC group (Figure 7G). Immunofluorescence staining showed a significant reduction in the distribution of \u0026alpha;-smooth muscle actin, a major substance in fibrosis, in the knockdown CXCR4 group (Figure 7H). Western blot analysis further indicated that CXCR4 deficiency weakened the activation of macrophages into fibroblasts and reduced the expression of type I collagen, \u0026alpha;-SMA, and Timp1 (Figure 7I). Our study results suggest that the lack of CXCR4 can reduce fibroblast activation and alleviate prostatic fibrosis in mice\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCXCR4 deficiency alleviates M1 polarization and PI3K/AKT/mTOR pathway activation in fibrotic prostate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs mentioned above, the lack of CXCR4 can alleviate liver inflammation, and CXCR4 may promote M1 polarization. We first immunofluorescence quantified M1, and the results showed that the iNOS+F4/80+ macrophages observed in EAP+Sh CXCR4 mice were fewer than those in EAP+Sh NC mice (Figure 8 A). In addition, in EAP mice with reduced CXCR4, the expression of inducible nitric oxide synthase (iNOS) mRNA was downregulated, while Arg1 was upregulated in the fibrotic prostate (Figure 8 B). WB analysis showed that in fibrotic prostates lacking CXCR4, the expression of iNOS and Arg1 was reduced compared to the control prostates (Figure 8 C). There are numerous literature studies indicating that the PI3K/AKT/mTOR pathway in macrophages mediates the progression of many inflammatory diseases[39-41],and WB analysis in fibrotic prostates also showed significant inhibition of the AKT pathway by inhibiting CXCR4(Figure 8 D). Finally, our immunofluorescence staining localization showed a decrease in the expression of Pfkfb3 in macrophages in fibrotic prostatitis (Figure 8 E). These results indicate that CXCR4 through the PI3K/AKT/mTOR pathway is a distinct regulatory pathway for macrophage-mediated chronic prostatitis.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eChronic prostatitis is a complex multifactorial disease characterized by infiltration of various immune cells\u0026nbsp;[12].\u0026nbsp;Derived from the bone marrow and infiltrating tissues, macrophages are a branch of mononuclear phagocytes that play a crucial role in maintaining the balance of tissue inflammation and immune attacks. When stimulated by tissue damage, macrophages are activated and polarized, secreting a large amount of pro-inflammatory and pro-fibrotic cytokines, and producing ECM components and other harmful molecules\u0026nbsp;[19, 42, 43].\u0026nbsp;In this study, we identified CXCR4 as a pro-polarization molecule for macrophages, which affects macrophages\u0026apos; impact on the fibrotic pathological process by regulating glucose metabolism. Furthermore, we elucidated the transcriptional activation of Pfkfb3 by c-MYC, thereby influencing the infiltration and polarization status of macrophages in the prostate. Our findings suggest for the first time that CXCR4 can alter macrophage metabolism processes and that macrophages are one of the main sources promoting prostate fibrosis in chronic prostatitis. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCXCR4 was originally isolated and purified from a human blood mononuclear cell gene library using gene probes, and it is highly expressed in mononuclear cells\u0026nbsp;[44].\u0026nbsp;The research on CXCR4 related to macrophages has previously included studies on how CXCR4 affects the autophagy process in coronary heart disease\u0026nbsp;[45],\u0026nbsp;Liver damage affects macrophage apoptosis through CXCR4\u0026nbsp;[46]\u0026nbsp;and macrophages in gastric cancer rely on CXCR4 to promote tumor metastasis[47]\u003cem\u003eetc\u003c/em\u003e.\u0026nbsp;Research on macrophages in chronic prostatitis has yielded clear results.\u0026nbsp;[26, 48].In this study, we first clarified the influence of CXCR4 on the polarization state of macrophages. In the process of reducing the expression of CXCR4, we found that inflammatory factors, the proportion of M1 cells and the content of NO were decreased, but ROS was slightly increased. ROS mainly comes from mitochondria, and the rise of ROS is generally considered to be the destruction of mitochondrial function and electron leakage\u0026nbsp;[49].\u0026nbsp;Based on this, we speculate that it is not the destruction of mitochondria, but the enhancement of oxidative phosphorylation that leads to the increase in ROS. The transition of macrophages from M1 to M2 status is characterized by a shift from glycolysis to oxidative phosphorylation[50].\u0026nbsp;This study provides compelling evidence that silencing CXCR4 does not impair mitochondrial function. Our data clearly show that while mitochondrial ROS levels increase, mitochondrial function remains intact. Glucose uptake experiments, lactate measurements, and Seahorse energy metabolism assays demonstrate that downregulation of CXCR4 is associated with inhibition of glycolysis and enhancement of mitochondrial function, which indirectly confirms that CXCR4 influences the polarization of macrophages towards the M1 state.\u003c/p\u003e\n\u003cp\u003eAs a key regulatory factor of glycolysis\u0026nbsp;[51],The rate of glycolysis flux is determined by three key enzymes regulated under various conditions. Among them, the most crucial one is phosphofructokinase-1 (PFK-1), and its most important and potent allosteric regulator is fructose-2,6-bisphosphate, which negates the inhibitory effects of ATP and citrate[35].\u0026nbsp;In macrophages, the typical types are LPS-induced M1 macrophages and IL-4 and IL-13-induced M2 macrophages. Metabolic changes similar to the Warburg effect occur in the context of inflammation induction. Recent studies on c-MYC have identified it as a key factor in tumor metabolism immunity and a major regulator of metabolic reprogramming, stimulating glycolysis, nucleotide metabolism, and glutamine metabolism[37, 52].Although some studies have indicated that silencing CXCR4 in T-cell acute lymphoblastic leukemia can inhibit the expression of myc\u0026nbsp;[53].\u0026nbsp;However, we first demonstrated the transcriptional regulation of Pfkfb3 by MYC in macrophages. But in the process of knocking down CXCR4, only Pfkfb3 among the key enzymes of glucose metabolism decreased. As the gene identified as the first in macrophages, the exact reason behind this difference is not yet clear, but it suggests that Pfkfb3 plays a critical role in metabolism during macrophage M1 polarization. Fibrosis issues associated with chronic prostatitis have gradually been noticed.\u0026nbsp;[2, 4, 6, 7]\u0026nbsp;.It is worth noting that there is a certain association between the infiltration of inflammatory cells (such as macrophages) and prostatic fibrosis. However, it remains to be verified whether the effects produced by activated macrophages are necessary for the occurrence and development of prostatic fibrosis. Based on this, the experimental data demonstrate that reducing CXCR4 expression in EAP mice significantly reduces the degree of inflammation infiltration and fibrosis. Co-culture studies in vitro also confirmed that silencing CXCR4 in macrophages reduces their role in promoting proliferation and activation of stromal fibroblasts. These results clearly indicate the important role of CXCR4 in promoting macrophages in prostatic fibrosis.\u003c/p\u003e\n\u003cp\u003eIn conclusion, we show here that CXCR4, by affecting glucose metabolism, mediates macrophage polarization. Blocking the expression of CXCR4 can inhibit the activation of fibroblasts, improve the fibrotic lesions of chronic prostatitis. Although this experiment still has limitations and further research is needed, we have demonstrated the important role of metabolic reprogramming of macrophage polarization in the state of fibroblasts. These studies also provide new perspectives on the close relationship between chronic prostatitis and prostatic fibrosis, as well as new targets for clinical treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflicts of interest disclosure \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding support\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe National Natural Science Foundation of China 82170787, 82300872, and 82370776.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLZ, XC and CJ: conception and design this study; ZY, FR and ZC: collection and assembly of data; PW, SJ, XWL, MWM, ZY, FR and ZC: data Analysis and interpretation; ZY: manuscript writing. Final Approval of Manuscript: All the authors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe sincerely thank the team of Academician Shao Feng for the gift of iBMDM cells. We wish to thank the Center for Scientific Research of the First Affiliated Hospital of Anhui Medical University for valuable help in seahorse experiments. Thanks for Dr. Dandan Zang\u0026apos;s guidance and assistance with the seahorse experiment.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKrieger JN, Riley DE, Cheah PY, Liong ML, Yuen KH: \u003cstrong\u003eEpidemiology of prostatitis: new evidence for a world-wide problem\u003c/strong\u003e. \u003cem\u003eWorld J Urol \u003c/em\u003e2003, \u003cstrong\u003e21\u003c/strong\u003e(2):70-74.\u003c/li\u003e\n\u003cli\u003eBlaivas JG: \u003cstrong\u003eObstructive uropathy in the male\u003c/strong\u003e. \u003cem\u003eUrol Clin North Am \u003c/em\u003e1996, \u003cstrong\u003e23\u003c/strong\u003e(3):373-384.\u003c/li\u003e\n\u003cli\u003eRodriguez-Nieves JA, Macoska JA: \u003cstrong\u003eProstatic fibrosis, lower urinary tract symptoms, and BPH\u003c/strong\u003e. \u003cem\u003eNat Rev Urol \u003c/em\u003e2013, \u003cstrong\u003e10\u003c/strong\u003e(9):546-550.\u003c/li\u003e\n\u003cli\u003eRobert G, Descazeaud A, Nicolaiew N, Terry S, Sirab N, Vacherot F, Maille P, Allory Y, de la Taille A: \u003cstrong\u003eInflammation in benign prostatic hyperplasia: a 282 patients\u0026apos; immunohistochemical analysis\u003c/strong\u003e. \u003cem\u003eProstate \u003c/em\u003e2009, \u003cstrong\u003e69\u003c/strong\u003e(16):1774-1780.\u003c/li\u003e\n\u003cli\u003eHuang XH, Qin B, Liang YW, Wu QG, Li CZ, Wei GS, Ji HC, Liang YB, Chen HQ, Guan T: \u003cstrong\u003e[LUTS in BPH patients with histological prostatitis before and after transurethral resection of the prostate]\u003c/strong\u003e. \u003cem\u003eZhonghua Nan Ke Xue \u003c/em\u003e2013, \u003cstrong\u003e19\u003c/strong\u003e(1):35-39.\u003c/li\u003e\n\u003cli\u003eSt Sauver JL, Jacobson DJ, McGree ME, Girman CJ, Lieber MM, Jacobsen SJ: \u003cstrong\u003eLongitudinal association between prostatitis and development of benign prostatic hyperplasia\u003c/strong\u003e. \u003cem\u003eUrology \u003c/em\u003e2008, \u003cstrong\u003e71\u003c/strong\u003e(3):475-479; discussion 479.\u003c/li\u003e\n\u003cli\u003eKrieger JN, Lee SW, Jeon J, Cheah PY, Liong ML, Riley DE: \u003cstrong\u003eEpidemiology of prostatitis\u003c/strong\u003e. \u003cem\u003eInt J Antimicrob Agents \u003c/em\u003e2008, \u003cstrong\u003e31 Suppl 1\u003c/strong\u003e(Suppl 1):S85-90.\u003c/li\u003e\n\u003cli\u003eBushman WA, Jerde TJ: \u003cstrong\u003eThe role of prostate inflammation and fibrosis in lower urinary tract symptoms\u003c/strong\u003e. \u003cem\u003eAm J Physiol Renal Physiol \u003c/em\u003e2016, \u003cstrong\u003e311\u003c/strong\u003e(4):F817-F821.\u003c/li\u003e\n\u003cli\u003eWynn TA: \u003cstrong\u003eCellular and molecular mechanisms of fibrosis\u003c/strong\u003e. \u003cem\u003eJ Pathol \u003c/em\u003e2008, \u003cstrong\u003e214\u003c/strong\u003e(2):199-210.\u003c/li\u003e\n\u003cli\u003eHinz B: \u003cstrong\u003eFormation and function of the myofibroblast during tissue repair\u003c/strong\u003e. \u003cem\u003eJ Invest Dermatol \u003c/em\u003e2007, \u003cstrong\u003e127\u003c/strong\u003e(3):526-537.\u003c/li\u003e\n\u003cli\u003ePohlers D, Brenmoehl J, Loffler I, Muller CK, Leipner C, Schultze-Mosgau S, Stallmach A, Kinne RW, Wolf G: \u003cstrong\u003eTGF-beta and fibrosis in different organs - molecular pathway imprints\u003c/strong\u003e. \u003cem\u003eBiochim Biophys Acta \u003c/em\u003e2009, \u003cstrong\u003e1792\u003c/strong\u003e(8):746-756.\u003c/li\u003e\n\u003cli\u003eTheyer G, Kramer G, Assmann I, Sherwood E, Preinfalk W, Marberger M, Zechner O, Steiner GE: \u003cstrong\u003ePhenotypic characterization of infiltrating leukocytes in benign prostatic hyperplasia\u003c/strong\u003e. \u003cem\u003eLab Invest \u003c/em\u003e1992, \u003cstrong\u003e66\u003c/strong\u003e(1):96-107.\u003c/li\u003e\n\u003cli\u003eZhang ZY, Zug C, Schluesener HJ: \u003cstrong\u003eSphingosine 1-phosphate receptor modulator FTY720 suppresses rat experimental autoimmune prostatitis\u003c/strong\u003e. \u003cem\u003eScand J Immunol \u003c/em\u003e2011, \u003cstrong\u003e73\u003c/strong\u003e(6):546-553.\u003c/li\u003e\n\u003cli\u003eWeidenbusch M, Anders HJ: \u003cstrong\u003eTissue microenvironments define and get reinforced by macrophage phenotypes in homeostasis or during inflammation, repair and fibrosis\u003c/strong\u003e. \u003cem\u003eJ Innate Immun \u003c/em\u003e2012, \u003cstrong\u003e4\u003c/strong\u003e(5-6):463-477.\u003c/li\u003e\n\u003cli\u003ePerciani CT, MacParland SA: \u003cstrong\u003eLifting the veil on macrophage diversity in tissue regeneration and fibrosis\u003c/strong\u003e. \u003cem\u003eSci Immunol \u003c/em\u003e2019, \u003cstrong\u003e4\u003c/strong\u003e(40).\u003c/li\u003e\n\u003cli\u003eCao Q, Wang Y, Harris DC: \u003cstrong\u003eMacrophage heterogeneity, phenotypes, and roles in renal fibrosis\u003c/strong\u003e. \u003cem\u003eKidney Int Suppl (2011) \u003c/em\u003e2014, \u003cstrong\u003e4\u003c/strong\u003e(1):16-19.\u003c/li\u003e\n\u003cli\u003eTacke F, Zimmermann HW: \u003cstrong\u003eMacrophage heterogeneity in liver injury and fibrosis\u003c/strong\u003e. \u003cem\u003eJ Hepatol \u003c/em\u003e2014, \u003cstrong\u003e60\u003c/strong\u003e(5):1090-1096.\u003c/li\u003e\n\u003cli\u003eBruscia EM, Bonfield TL: \u003cstrong\u003eCystic Fibrosis Lung Immunity: The Role of the Macrophage\u003c/strong\u003e. \u003cem\u003eJ Innate Immun \u003c/em\u003e2016, \u003cstrong\u003e8\u003c/strong\u003e(6):550-563.\u003c/li\u003e\n\u003cli\u003eBuechler MB, Fu W, Turley SJ: \u003cstrong\u003eFibroblast-macrophage reciprocal interactions in health, fibrosis, and cancer\u003c/strong\u003e. \u003cem\u003eImmunity \u003c/em\u003e2021, \u003cstrong\u003e54\u003c/strong\u003e(5):903-915.\u003c/li\u003e\n\u003cli\u003eLu L, Li J, Jiang X, Bai R: \u003cstrong\u003eCXCR4/CXCL12 axis: \u0026quot;old\u0026quot; pathway as \u0026quot;novel\u0026quot; target for anti-inflammatory drug discovery\u003c/strong\u003e. \u003cem\u003eMed Res Rev \u003c/em\u003e2024, \u003cstrong\u003e44\u003c/strong\u003e(3):1189-1220.\u003c/li\u003e\n\u003cli\u003eGharaee-Kermani M, Kasina S, Moore BB, Thomas D, Mehra R, Macoska JA: \u003cstrong\u003eCXC-type chemokines promote myofibroblast phenoconversion and prostatic fibrosis\u003c/strong\u003e. \u003cem\u003ePLoS One \u003c/em\u003e2012, \u003cstrong\u003e7\u003c/strong\u003e(11):e49278.\u003c/li\u003e\n\u003cli\u003eRodriguez-Nieves JA, Patalano SC, Almanza D, Gharaee-Kermani M, Macoska JA: \u003cstrong\u003eCXCL12/CXCR4 Axis Activation Mediates Prostate Myofibroblast Phenoconversion through Non-Canonical EGFR/MEK/ERK Signaling\u003c/strong\u003e. \u003cem\u003ePLoS One \u003c/em\u003e2016, \u003cstrong\u003e11\u003c/strong\u003e(7):e0159490.\u003c/li\u003e\n\u003cli\u003eVan Schaftingen E, Lederer B, Bartrons R, Hers HG: \u003cstrong\u003eA kinetic study of pyrophosphate: fructose-6-phosphate phosphotransferase from potato tubers. Application to a microassay of fructose 2,6-bisphosphate\u003c/strong\u003e. \u003cem\u003eEur J Biochem \u003c/em\u003e1982, \u003cstrong\u003e129\u003c/strong\u003e(1):191-195.\u003c/li\u003e\n\u003cli\u003eDe Bock K, Georgiadou M, Schoors S, Kuchnio A, Wong BW, Cantelmo AR, Quaegebeur A, Ghesquiere B, Cauwenberghs S, Eelen G\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eRole of PFKFB3-driven glycolysis in vessel sprouting\u003c/strong\u003e. \u003cem\u003eCell \u003c/em\u003e2013, \u003cstrong\u003e154\u003c/strong\u003e(3):651-663.\u003c/li\u003e\n\u003cli\u003eMotrich RD, Breser ML, Sanchez LR, Godoy GJ, Prinz I, Rivero VE: \u003cstrong\u003eIL-17 is not essential for inflammation and chronic pelvic pain development in an experimental model of chronic prostatitis/chronic pelvic pain syndrome\u003c/strong\u003e. \u003cem\u003ePain \u003c/em\u003e2016, \u003cstrong\u003e157\u003c/strong\u003e(3):585-597.\u003c/li\u003e\n\u003cli\u003eHua X, Ge S, Zhang M, Mo F, Zhang L, Zhang J, Yang C, Tai S, Chen X, Zhang L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003ePathogenic Roles of CXCL10 in Experimental Autoimmune Prostatitis by Modulating Macrophage Chemotaxis and Cytokine Secretion\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e:706027.\u003c/li\u003e\n\u003cli\u003eChen J, Meng J, Li X, Li X, Liu Y, Jin C, Zhang L, Hao Z, Chen X, Zhang M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eHA/CD44 Regulates the T Helper 1 Cells Differentiation by Activating Annexin A1/Akt/mTOR Signaling to Drive the Pathogenesis of EAP\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e:875412.\u003c/li\u003e\n\u003cli\u003eLi M, Yang Y, Xiong L, Jiang P, Wang J, Li C: \u003cstrong\u003eMetabolism, metabolites, and macrophages in cancer\u003c/strong\u003e. \u003cem\u003eJ Hematol Oncol \u003c/em\u003e2023, \u003cstrong\u003e16\u003c/strong\u003e(1):80.\u003c/li\u003e\n\u003cli\u003eSies H, Jones DP: \u003cstrong\u003eReactive oxygen species (ROS) as pleiotropic physiological signalling agents\u003c/strong\u003e. \u003cem\u003eNat Rev Mol Cell Biol \u003c/em\u003e2020, \u003cstrong\u003e21\u003c/strong\u003e(7):363-383.\u003c/li\u003e\n\u003cli\u003eSchieber M, Chandel NS: \u003cstrong\u003eROS function in redox signaling and oxidative stress\u003c/strong\u003e. \u003cem\u003eCurr Biol \u003c/em\u003e2014, \u003cstrong\u003e24\u003c/strong\u003e(10):R453-462.\u003c/li\u003e\n\u003cli\u003eHolmstrom KM, Finkel T: \u003cstrong\u003eCellular mechanisms and physiological consequences of redox-dependent signalling\u003c/strong\u003e. \u003cem\u003eNat Rev Mol Cell Biol \u003c/em\u003e2014, \u003cstrong\u003e15\u003c/strong\u003e(6):411-421.\u003c/li\u003e\n\u003cli\u003eTran N, Mills EL: \u003cstrong\u003eRedox regulation of macrophages\u003c/strong\u003e. \u003cem\u003eRedox Biol \u003c/em\u003e2024, \u003cstrong\u003e72\u003c/strong\u003e:103123.\u003c/li\u003e\n\u003cli\u003eMouton AJ, Li X, Hall ME, Hall JE: \u003cstrong\u003eObesity, Hypertension, and Cardiac Dysfunction: Novel Roles of Immunometabolism in Macrophage Activation and Inflammation\u003c/strong\u003e. \u003cem\u003eCirc Res \u003c/em\u003e2020, \u003cstrong\u003e126\u003c/strong\u003e(6):789-806.\u003c/li\u003e\n\u003cli\u003eSaha S, Shalova IN, Biswas SK: \u003cstrong\u003eMetabolic regulation of macrophage phenotype and function\u003c/strong\u003e. \u003cem\u003eImmunol Rev \u003c/em\u003e2017, \u003cstrong\u003e280\u003c/strong\u003e(1):102-111.\u003c/li\u003e\n\u003cli\u003eVan Schaftingen E, Jett MF, Hue L, Hers HG: \u003cstrong\u003eControl of liver 6-phosphofructokinase by fructose 2,6-bisphosphate and other effectors\u003c/strong\u003e. \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e1981, \u003cstrong\u003e78\u003c/strong\u003e(6):3483-3486.\u003c/li\u003e\n\u003cli\u003eNi X, Lu CP, Xu GQ, Ma JJ: \u003cstrong\u003eTranscriptional regulation and post-translational modifications in the glycolytic pathway for targeted cancer therapy\u003c/strong\u003e. \u003cem\u003eActa Pharmacol Sin \u003c/em\u003e2024.\u003c/li\u003e\n\u003cli\u003eVenkatraman S, Balasubramanian B, Thuwajit C, Meller J, Tohtong R, Chutipongtanate S: \u003cstrong\u003eTargeting MYC at the intersection between cancer metabolism and oncoimmunology\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2024, \u003cstrong\u003e15\u003c/strong\u003e:1324045.\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Souza LC, Shekher A, Challagundla KB, Sharma A, Gupta SC: \u003cstrong\u003eReprogramming of glycolysis by chemical carcinogens during tumor development\u003c/strong\u003e. \u003cem\u003eSemin Cancer Biol \u003c/em\u003e2022, \u003cstrong\u003e87\u003c/strong\u003e:127-136.\u003c/li\u003e\n\u003cli\u003eLinton MF, Moslehi JJ, Babaev VR: \u003cstrong\u003eAkt Signaling in Macrophage Polarization, Survival, and Atherosclerosis\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2019, \u003cstrong\u003e20\u003c/strong\u003e(11).\u003c/li\u003e\n\u003cli\u003eCovarrubias AJ, Aksoylar HI, Horng T: \u003cstrong\u003eControl of macrophage metabolism and activation by mTOR and Akt signaling\u003c/strong\u003e. \u003cem\u003eSemin Immunol \u003c/em\u003e2015, \u003cstrong\u003e27\u003c/strong\u003e(4):286-296.\u003c/li\u003e\n\u003cli\u003eVergadi E, Ieronymaki E, Lyroni K, Vaporidi K, Tsatsanis C: \u003cstrong\u003eAkt Signaling Pathway in Macrophage Activation and M1/M2 Polarization\u003c/strong\u003e. \u003cem\u003eJ Immunol \u003c/em\u003e2017, \u003cstrong\u003e198\u003c/strong\u003e(3):1006-1014.\u003c/li\u003e\n\u003cli\u003eYang H, Cheng H, Dai R, Shang L, Zhang X, Wen H: \u003cstrong\u003eMacrophage polarization in tissue fibrosis\u003c/strong\u003e. \u003cem\u003ePeerJ \u003c/em\u003e2023, \u003cstrong\u003e11\u003c/strong\u003e:e16092.\u003c/li\u003e\n\u003cli\u003eWen JH, Li DY, Liang S, Yang C, Tang JX, Liu HF: \u003cstrong\u003eMacrophage autophagy in macrophage polarization, chronic inflammation and organ fibrosis\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e:946832.\u003c/li\u003e\n\u003cli\u003eLoetscher M, Geiser T, O\u0026apos;Reilly T, Zwahlen R, Baggiolini M, Moser B: \u003cstrong\u003eCloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes\u003c/strong\u003e. \u003cem\u003eJ Biol Chem \u003c/em\u003e1994, \u003cstrong\u003e269\u003c/strong\u003e(1):232-237.\u003c/li\u003e\n\u003cli\u003eLi F, Peng J, Lu Y, Zhou M, Liang J, Le C, Ding J, Wang J, Dai J, Wan C\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eBlockade of CXCR4 promotes macrophage autophagy through the PI3K/AKT/mTOR pathway to alleviate coronary heart disease\u003c/strong\u003e. \u003cem\u003eInt J Cardiol \u003c/em\u003e2023, \u003cstrong\u003e392\u003c/strong\u003e:131303.\u003c/li\u003e\n\u003cli\u003eMa Q, Zhang N, You Y, Zhu J, Yu Z, Chen H, Xie X, Yu H: \u003cstrong\u003eCXCR4 blockade in macrophage promotes angiogenesis in ischemic hindlimb by modulating autophagy\u003c/strong\u003e. \u003cem\u003eJ Mol Cell Cardiol \u003c/em\u003e2022, \u003cstrong\u003e169\u003c/strong\u003e:57-70.\u003c/li\u003e\n\u003cli\u003eTang C, Lei X, Xiong L, Hu Z, Tang B: \u003cstrong\u003eHMGA1B/2 transcriptionally activated-POU1F1 facilitates gastric carcinoma metastasis via CXCL12/CXCR4 axis-mediated macrophage polarization\u003c/strong\u003e. \u003cem\u003eCell Death Dis \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e(5):422.\u003c/li\u003e\n\u003cli\u003eHua X, Zhang J, Ge S, Liu H, Du H, Niu Q, Chen X, Yang C, Zhang L, Liang C: \u003cstrong\u003eCXCR3 antagonist AMG487 ameliorates experimental autoimmune prostatitis by diminishing Th1 cell differentiation and inhibiting macrophage M1 phenotypic activation\u003c/strong\u003e. \u003cem\u003eProstate \u003c/em\u003e2022, \u003cstrong\u003e82\u003c/strong\u003e(13):1223-1236.\u003c/li\u003e\n\u003cli\u003eOkoye CN, Koren SA, Wojtovich AP: \u003cstrong\u003eMitochondrial complex I ROS production and redox signaling in hypoxia\u003c/strong\u003e. \u003cem\u003eRedox Biol \u003c/em\u003e2023, \u003cstrong\u003e67\u003c/strong\u003e:102926.\u003c/li\u003e\n\u003cli\u003eDussold C, Zilinger K, Turunen J, Heimberger AB, Miska J: \u003cstrong\u003eModulation of macrophage metabolism as an emerging immunotherapy strategy for cancer\u003c/strong\u003e. \u003cem\u003eJ Clin Invest \u003c/em\u003e2024, \u003cstrong\u003e134\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eShi L, Pan H, Liu Z, Xie J, Han W: \u003cstrong\u003eRoles of PFKFB3 in cancer\u003c/strong\u003e. \u003cem\u003eSignal Transduct Target Ther \u003c/em\u003e2017, \u003cstrong\u003e2\u003c/strong\u003e:17044.\u003c/li\u003e\n\u003cli\u003ePurhonen J, Klefstrom J, Kallijarvi J: \u003cstrong\u003eMYC-an emerging player in mitochondrial diseases\u003c/strong\u003e. \u003cem\u003eFront Cell Dev Biol \u003c/em\u003e2023, \u003cstrong\u003e11\u003c/strong\u003e:1257651.\u003c/li\u003e\n\u003cli\u003eMa W, Wan Y, Zhang J, Yao J, Wang Y, Lu J, Liu H, Huang X, Zhang X, Zhou H\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eGrowth arrest-specific protein 2 (GAS2) interacts with CXCR4 to promote T-cell leukemogenesis partially via c-MYC\u003c/strong\u003e. \u003cem\u003eMol Oncol \u003c/em\u003e2022, \u003cstrong\u003e16\u003c/strong\u003e(20):3720-3734.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-communication-and-signaling","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccas","sideBox":"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)","snPcode":"12964","submissionUrl":"https://submission.nature.com/new-submission/12964/3","title":"Cell Communication and Signaling","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"macrophage, M1, glycolysis, Chronic prostatitis, fibrosis","lastPublishedDoi":"10.21203/rs.3.rs-4592373/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4592373/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCXCR4 (C-X-C receptor 4) is widely considered to be a highly conserved G protein-coupled receptor, widely involved in the pathophysiological processes in the human body, including fibrosis. However, its role in regulating macrophage-related inflammation in the fibrotic process of prostatitis has not been confirmed. Here, we aim to describe the role of CXCR4 in modulating macrophage M1 polarization through glycolysis in the development of prostatitis fibrosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUse inducible experimental chronic prostatitis as a model of prostatic fibrosis. Reduce CXCR4 expression in immortalized bone marrow-derived macrophages using lentivirus. In the fibrotic mouse model, use adenovirus carrying CXCR4 agonists to detect the silencing of CXCR4 and assess the in vivo effects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn this study, we demonstrated that reducing CXCR4 expression during LPS treatment of macrophages can lead to M1 polarization. Silencing CXCR4 can inhibit glycolytic metabolism, enhance mitochondrial function, and promote macrophage transition from M1 to M2. Additionally, in vivo functional experiments using AAV carrying CXCR4 showed that blocking CXCR4 in EAP can alleviate inflammation and experimental prostate fibrosis development. Mechanistically, CXCR4, a chemokine receptor, when silenced, weakens the PI3K/AKT/mTOR pathway as its downstream signal, reducing c-MYC expression. PFKFB3, a key enzyme involved in glucose metabolism, is a target gene of c-MYC, thus impacting macrophage polarization and glycolytic metabolism processes.\u003c/p\u003e","manuscriptTitle":"CXCR4 regulates macrophage M1 polarization by altering glycolysis to promote prostate fibrosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-04 19:55:25","doi":"10.21203/rs.3.rs-4592373/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-12T12:48:41+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-11T09:28:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-07T08:38:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"197037552533464574338356233788785309025","date":"2024-07-01T05:01:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"220500909472202698492240705827783442941","date":"2024-06-30T10:49:32+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-24T05:54:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"107237054185469086139777844336569866498","date":"2024-06-22T22:21:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"150617822393765353541559636718588741215","date":"2024-06-20T18:57:15+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-19T14:11:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-18T13:52:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-18T11:33:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Communication and Signaling","date":"2024-06-17T07:12:13+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-communication-and-signaling","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ccas","sideBox":"Learn more about [Cell Communication and Signaling](http://biosignaling.biomedcentral.com/)","snPcode":"12964","submissionUrl":"https://submission.nature.com/new-submission/12964/3","title":"Cell Communication and Signaling","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1b37f8c8-4b54-4224-8745-312347c15722","owner":[],"postedDate":"July 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-30T16:07:49+00:00","versionOfRecord":{"articleIdentity":"rs-4592373","link":"https://doi.org/10.1186/s12964-024-01828-y","journal":{"identity":"cell-communication-and-signaling","isVorOnly":false,"title":"Cell Communication and Signaling"},"publishedOn":"2024-09-26 15:57:03","publishedOnDateReadable":"September 26th, 2024"},"versionCreatedAt":"2024-07-04 19:55:25","video":"","vorDoi":"10.1186/s12964-024-01828-y","vorDoiUrl":"https://doi.org/10.1186/s12964-024-01828-y","workflowStages":[]},"version":"v1","identity":"rs-4592373","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4592373","identity":"rs-4592373","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.