Full text
103,828 characters
· extracted from
preprint-html
· click to expand
RNA polymerase II processing facilitates DNA repair and prevents DNA damage-induced neuronal and developmental failure | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results RNA polymerase II processing facilitates DNA repair and prevents DNA damage-induced neuronal and developmental failure View ORCID Profile Melanie van der Woude , Karen L. Thijssen , View ORCID Profile Mariangela Sabatella , View ORCID Profile Jurgen A. Marteijn , View ORCID Profile Wim Vermeulen , View ORCID Profile Hannes Lans doi: https://doi.org/10.1101/2025.03.21.644538 Melanie van der Woude 1 Department of Molecular Genetics, Erasmus MC Cancer Institute, Erasmus University Medical Center , 3015 GD, Rotterdam, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Melanie van der Woude Karen L. Thijssen 1 Department of Molecular Genetics, Erasmus MC Cancer Institute, Erasmus University Medical Center , 3015 GD, Rotterdam, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mariangela Sabatella 1 Department of Molecular Genetics, Erasmus MC Cancer Institute, Erasmus University Medical Center , 3015 GD, Rotterdam, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Mariangela Sabatella Jurgen A. Marteijn 2 Department of Molecular Genetics, Erasmus MC Cancer Institute, Oncode Institute, Erasmus University Medical Center , 3015 GD, Rotterdam, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jurgen A. Marteijn Wim Vermeulen 1 Department of Molecular Genetics, Erasmus MC Cancer Institute, Erasmus University Medical Center , 3015 GD, Rotterdam, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Wim Vermeulen Hannes Lans 1 Department of Molecular Genetics, Erasmus MC Cancer Institute, Erasmus University Medical Center , 3015 GD, Rotterdam, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Hannes Lans For correspondence: w.lans{at}erasmusmc.nl Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Hereditary transcription-coupled nucleotide excision repair (TC-NER) defects cause severe developmental and neurodegenerative features, as observed in Cockayne syndrome (CS), or mild cutaneous UV sensitivity, as observed in UV-sensitive syndrome. The mechanisms underlying the strikingly different clinical features of these syndromes are not fully understood. Using C. elegans , we demonstrate that TC-NER deficiency leads to DNA damage-induced motoneuronal and developmental failure, primarily caused by the lack of lesion removal due to persistent lesion-stalling of RNA polymerase II. If, in the absence of TC-NER, lesion-stalled RNA polymerase II is processed and removed, global genome NER acts as backup pathway to repair transcription-blocking lesions and prevents DNA damage-induced developmental failure. Our results furthermore show that processing of lesion-stalled RNA Polymerase II facilitates TC-NER and involves the activity of multiple E3 ubiquitin ligases. These findings reveal that persistently stalled RNA polymerase II, rather than TC-NER deficiency, is the major driver of severe disease features associated with TC-NER defects. Introduction Accurate transcription of DNA into mRNA by RNA polymerase II (Pol II) is a fundamental requirement for the proper functioning of cells. However, transcription is constantly challenged by DNA damage, which hinders the forward progression of Pol II along the DNA. DNA damage is unavoidable, as cells are continually exposed to environmental and metabolism-derived genotoxic agents, such as UV irradiation, endogenous reactive oxygen species, and aldehydes 1 – 3 . Different types of DNA damage interfere with transcription by physically blocking Pol II elongation, which may become even more harmful as local Pol II blockage can additionally lead to R-loop and DNA break formation, transcription-replication conflicts, global transcription shutdown, and loss of transcription fidelity 4 , 5 . This DNA damage-induced transcription stress significantly hampers cellular function, causing cell death and senescence, and is therefore considered to be a major driver of aging 6 , 7 . To secure transcriptional integrity, and thereby ensure a proper cellular response to stressors, cells eliminate DNA damage in genes via transcription-coupled DNA repair processes, most prominently via transcription-coupled nucleotide excision repair (TC-NER) 4 , 8 – 10 . Nucleotide excision repair (NER) is a major DNA repair pathway which repairs a wide variety of helix-distorting DNA lesions, including those induced by UV light 11 , 12 . DNA damage can be detected by the global genome NER (GG-NER) subpathway anywhere in the genome or by the TC-NER subpathway upon blockage of elongating Pol II. Detection of lesions by GG-NER relies on the XPC protein, which forms a heterotrimer with CETN2 and RAD23B 13 , 14 , and constantly probes the DNA searching for helix-distorting DNA lesions 15 , 16 . Upon stable binding of XPC to a DNA lesion, the core NER pathway is activated by the recruitment of the TFIIH complex 17 , 18 . In comparison, detection of lesions by TC-NER relies on activity of the CSB protein, which stably associates with elongating Pol II when it is blocked by a lesion 19 , 20 . CSB is an ATP-dependent translocase that tries to push Pol II forward over the lesion 21 . If unsuccessful, its stable association with Pol II leads to the recruitment of the E3 ubiquitin ligase complex CRL4 CSA , consisting of CSA, DDB1, DDA1, RBX1 and CUL4A 22 – 24 , and, with the help of the Pol II-associated ELOF1 protein 25 , 26 , to the recruitment of additional TC-NER factors UVSSA and its binding partner USP7 27 – 31 . During this process, the CRL4 CSA complex ubiquitylates both CSB 32 and Pol II 33 – 35 , the latter which also involves other E3 ubiquitin ligase complexes 36 , which may lead to their degradation. To promote TC-NER complex stability, the ubiquitin specific protease USP7 de-ubiquitylates CSB and thereby averts its degradation 27 , 37 . In addition, ubiquitylation of the RPB1 subunit of Pol II at residue K1268 facilitates the binding of UVSSA, which mediates the recruitment and association of the TFIIH complex to lesion-stalled Pol II 30 , 33 . GG-NER and TC-NER both merge into a common core NER mechanism, during which TFIIH, with the help of XPA, verifies the lesion 38 . Subsequently, the endonucleases ERCC1-XPF and XPG excise the damaged DNA segment spanning 22-30 base pairs 11 , 12 and the resulting gap is filled in by DNA synthesis mediated by replication factors, DNA polymerases and ligases. Once DNA damage is repaired, transcription can restart. Hereditary TC-NER deficiency manifests clinically as two strikingly divergent syndromes, i.e. Cockayne syndrome (CS) and UV-sensitive syndrome (UV S S). CS patients exhibit a range of developmental, progressive neurodegenerative and progeroid features, including early growth cessation, microcephaly, mental retardation with dysmyelination, retinal degeneration, sensorineural deafness, cachexia, photo-hypersensitivity, and a significantly reduced life expectancy 39 , 40 . In contrast, UV S S patients manifest merely mild cutaneous phenotypes, such as photo-hypersensitivity and freckling, without the severe developmental and neurological features seen in CS 31 , 41 , 42 . The genetic distinction between both syndromes is mostly found in the affected genes, as CSA and CSB mutations predominantly lead to CS 43 , while UVSSA mutations exclusively lead to UV S S 27 , 28 , 31 . Few cases are known in which also mutations in CSA or CSB cause UV S S 28 , 29 , 31 , 44 , 45 . The prominent phenotypic differences have therefore been attributed to additional functions of the CSB and CSA proteins outside TC-NER. For instance, CSB has been implicated in regulating transcription during neuronal differentiation 46 and in regulating metabolic and DNA repair responses to oxidative stress 47 – 50 . However, the roles of CSA and UVSSA in several of these processes remain elusive. The progressive nature of many CS symptoms and the fact that hereditary mutations in downstream NER factors TFIIH, ERCC1-XPF and XPG can cause CS-like features as well 51 , strongly suggest that accumulating DNA damage, not repaired in the absence of TC-NER, is the primary factor underlying these severe CS symptoms. We and others hypothesized that not the DNA damage itself, but the persistent DNA damage-induced transcription stress, characterized by prolonged Pol II stalling at accumulating unrepaired DNA lesions, is the major culprit 4 , 30 , 31 , 33 , 52 – 54 . Indeed, CSB and CSA deficient cells are distinguished from UVSSA deficient cells by prolonged chromatin retention of Pol II after DNA damage induction 55 , 56 . Therefore, it is important to understand the biological impact of prolonged DNA damage-induced Pol II stalling, as this will help to understand the difference in pathogenesis between CS and UV s S. During TC-NER, Pol II is likely displaced or even removed so that the downstream repair machinery can gain access to the DNA damage 54 , 57 , 58 . In addition, Pol II is thought to be removed from damaged DNA as a last resort pathway alternative to TC-NER, to allow other DNA repair pathways to detect the DNA damage 36 . Pol II processing involves the poly-ubiquitylation and degradation of its major catalytic RPB1 subunit, but many of the mechanistic details are still not fully understood as both CSB and CRL4 CSA -dependent and -independent mechanisms and multiple additional E3 ubiquitin ligases have been implicated in this processing 33 , 34 , 52 , 59 – 63 . Impaired Pol II removal will likely shield DNA lesions and prevent them from being repaired via other DNA repair pathways. However, it has not been experimentally shown that other DNA repair pathways can indeed repair transcription-blocking DNA damage if lesion-stalled Pol II is removed. Also, it is unclear if indeed the accumulation of persistent DNA repair intermediates, like lesion-stalled Pol II, is more cytotoxic than the DNA lesions themselves. The nematode C. elegans has become a prominent in vivo model organism to investigate diverse aspects of the DNA damage response, including NER, whose mechanism and biological function is highly conserved 64 , 65 . Previously, we showed that GG-NER is mainly active in the C. elegans germ line to preserve the integrity of the entire genome for the next generation. GG-NER deficiency therefore results in meiotic maturation and germ line proliferation defects and embryonic lethality in response to UV irradiation 66 , 67 . TC-NER, on the other hand, is noticeably active in differentiated, post-mitotic somatic cells in which only the functional integrity of active genes needs to be maintained. We and others showed that, as a consequence, loss of TC-NER function results in strong developmental arrest upon UV irradiation 25 , 67 – 70 , making C. elegans excellently suited to study the biological impact of DNA damage-induced transcription stress. Here, we investigated the impact of Pol II stalling and the role of various TC-NER proteins during development of C. elegans upon DNA damage-induced transcription stress. Our results indicate that this transcription stress causes developmental arrest in TC-NER deficient animals due to persistent Pol II stalling, which is prevented if Pol II is removed and DNA repair by the alternative GG-NER pathway is permitted. Results DNA damage-induced developmental and neuromotor failure in TC-NER mutants does not always correlate with TC-NER deficiency To study the biological impact of DNA damage-induced transcription stress in living animals, we determined UV-induced developmental arrest of C. elegans larvae with loss-of-function mutations in various TC-NER genes ( Table 1 ), using an L1 larvae UV survival assay 71 . This assay assesses the effect of UV-induced DNA damage on the animal’s ability to develop from first stage (L1) larvae into adults. Importantly, the vast majority of cells in L1 larvae are terminally differentiated 72 , because of which growth and development depend on accurate and intact transcription. We obtained some C. elegans loss-of-function mutants from the Caenorhabditis Genetics Center and the National Bioresource Project for the nematode, and some were already described by us before (Supplementary Table 1). In line with previous studies 67 , 69 , 71 , 73 , we observed that mutation of the core TC-NER factors csa-1 (allele tm5232 ) and csb-1 (allele ok2335 ) results in UV hypersensitivity ( Fig. 1A ). In comparison, mutation of the core GG-NER factor xpc-1 (allele tm3886 ) did not affect UV survival. Also, mutation of other TC-NER factors, such as elof-1 and math-33 , the C. elegans orthologs of mammalian ELOF1 25 and USP7 74 , respectively, resulted in clear hypersensitivity and developmental arrest upon UV irradiation ( Fig. 1B ). These results confirm that the activity of TC-NER proteins CSB-1, CSA-1, ELOF-1 and MATH-33 is essential in somatic tissues of L1 larvae to overcome the cytotoxic consequences of DNA damage-induced transcription stress. View this table: View inline View popup Download powerpoint Table 1 C. elegans TC-NER genes studied with their mammalian orthologs Download figure Open in new tab Fig. 1 Most but not all TC-NER mutants show developmental and neuromotor failure after DNA damage. ( A-D ) L1 larvae UV survival assays of wild type and ( A ) csa-1(tm5232) , csb-1(ok2335), xpc-1(tm3886); ( B ) elof-1(emc203), math-33(ok2974); ( C ) uvs-1(tm6134), uvs-1(tm6311); ( D ) xpc-1(tm3886); uvs-1(tm6134), xpc-1(tm3886); csb-1(ok2335), and xpc-1(tm3886) animals. ( E ) Schematic depiction of the csb-1 and uvs-1 loci with deletion alleles indicated. ( F ) L1 larvae UV survival assay of csb-1(emc78) and uvs-1(emc80) mutants. ( G ) Trabectedin survival depicting percentage L1 animals that survive beyond the L2 stage of wild type and TC-NER deficient csa-1(tm5232) , csb-1(emc78), uvs-1(tm6134), uvs-1(tm6311), and uvs-1(emc80), and GG-NER deficient xpc-1(tm3886) animals. ( H ) Body bends per 30 s of wild type, csa-1(tm5232), csb-1(emc78), uvs-1(tm6134) , uvs-1(tm6311), and uvs-1(emc80) animals, without or 72 h after 40 J/m 2 UV-B irradiation. Mean with SEM of three independent experiments or ( H ) of two independent experiments. Numbers in the graph represent p-values comparing 120 J/m 2 data points to wild type or as indicated, determined by TWO-WAY ANOVA Šídák’s multiple comparisons test. Subsequently, we tested UV sensitivity of animals with mutations in the core TC-NER factor uvs-1 , the nematode ortholog of mammalian UVSSA 73 . Strikingly, we observed that the two different mutants that we tested, uvs-1(tm6134 ) and uvs-1(tm6311) , showed a distinct developmental arrest upon UV irradiation ( Fig. 1C ). Whereas uvs-1(tm6311) mutants showed a UV hypersensitivity comparable to that of other TC-NER mutants, uvs-1(tm6134) mutants were not UV hypersensitive and showed a UV response comparable to that of wild type animals ( Fig. 1A, B ). This could indicate that uvs-1(tm6134) is not a loss-of-function mutant and therefore not TC-NER deficient, while uvs-1(tm6311) is. To test this, we crossed the non-UV-hypersensitive uvs-1(tm6134) mutant with GG-NER deficient xpc-1(tm3886) animals, as we have previously demonstrated that GG-NER acts as backup pathway to TC-NER in repairing DNA damage in somatic tissue 67 – 69 , 75 . As a result, GG-NER deficiency does not lead to UV hypersensitivity in TC-NER proficient L1 larvae, but only in TC-NER deficient L1 larvae. Indeed, as shown before 67 , xpc-1(tm3886); csb-1(ok2335) double mutant animals showed extreme UV hypersensitivity, even at very low UV doses ( Fig. 1D ). Strikingly, we found that xpc-1(tm3886); uvs-1(tm6134) double mutant animals were similarly extremely UV-hypersensitive ( Fig. 1D ). This strongly suggests that uvs-1(tm6134) animals are TC-NER deficient, despite the lack of clear UV-induced developmental arrest in the single mutant. The csb-1(ok2335) allele is a 1620 bp deletion in exons 4 to 7 that is probably a functional null allele, as it is predicted to encode a truncated CSB-1 protein with most of its catalytic SNF2-like ATPase domain deleted ( Fig. 1E ) 67 . The uvs-1(tm6134) and uvs-1(tm6311) alleles are also deletions in exons ( Fig. 1E ) 73 , that are predicted to encode truncated proteins, as described in more detail below. We therefore tested if the functionality and UV sensitivity of these alleles is comparable to the complete absence of CSB-1 and UVS-1 proteins. To this end, we generated strains with full knock-out alleles of csb-1 and uvs-1 , by completely deleting the genes, respectively called emc78 and emc80 ( Fig. 1E , Supplementary Fig. 1). We observed similar UV-induced developmental arrest for these full knock-out csb-1(emc78) and uvs-1(emc80) alleles ( Fig. 1F ) as for the partial gene deletion csb-1(ok2335) and uvs-1(tm6311) alleles ( Fig. 1A,C ), respectively. To determine whether the different csb-1, csa-1 and uvs-1 mutants are indeed all TC-NER deficient, we tested their resistance to trabectedin by monitoring larval development after exposure to this drug. Trabectedin, also known as ET743, is an alkylating agent that reacts with guanine residues in the minor groove of the DNA, thereby forming bulky DNA adducts that impede transcription and are recognized by TC-NER 76 . Trabectedin exposure, however, results in toxicity in TC-NER proficient cells, due to the TC-NER-mediated processing of trabectedin adducts, which leads to the formation of lethal DNA breaks 77 , 78 . Therefore, TC-NER deficient cells are resistant to trabectedin exposure. Indeed, we observed that csa-1(tm5232) and csb-1(emc78) animals were resistant to trabectedin, while wild type and xpc-1(tm3886) animals were hypersensitive ( Fig. 1G ). Furthermore, uvs-1(tm6311), uvs-1(tm6134) and uvs-1(emc80) mutants were also resistant to trabectedin, which confirms that all three uvs-1 alleles are true loss-of-function alleles and lead to TC-NER deficiency. Neuromotor difficulties and neurodegeneration are profound clinical features in TC-NER deficient CS patients. In C. elegans, developmental arrest, as measured in the L1 larvae UV survival assay, specifically results from DNA damage interfering with transcription in neurons. We previously showed that intact NER in neurons is sufficient to prevent DNA damage-induced developmental arrest in animals that are otherwise completely NER deficient 68 . To demonstrate this neuronal impact in another manner, we assessed how UV-induced DNA damage affects neuromotor function in TC-NER deficient animals, by determining the total number of lateral body movements per time unit 79 before and after UV irradiation ( Fig. 1H ). Similar to what was observed in the L1 larvae UV survival assay, csb-1(emc78) , csa-1(tm5232) , uvs-1(emc80) , and uvs-1(tm6311) were UV hypersensitive, as they displayed significantly impaired motility after UV-induced DNA damage. In contrast, uvs-1(tm6134) mutant animals again did not display any UV hypersensitivity, as their motility after UV-induced DNA damage was comparable to that of wild type animals. Taken together, these findings show that UV-induced DNA damage leads to both developmental arrest and neuromotor difficulties in most TC-NER deficient animals. However, the absence of UV hypersensitivity in TC-NER deficient uvs-1(tm6134) animals suggests that these phenotypes are not primarily due to the TC-NER deficiency per se, but likely due to an alternative cause. Deficient USP7 and TFIIH recruitment cause UV hypersensitivity in uvs-1 mutants To understand the difference in UV sensitivity between the uvs-1(tm6134) and uvs-1(tm6311) alleles, we tested how these alleles affect the expression and protein levels of UVS-1 and CSB-1. The mammalian UVS-1 ortholog UVSSA contains several domains that are important for its function within the TC-NER complex, including a VHS domain that mediates interaction with CSA 29 , 30 , 35 , 80 , a TRAF-binding motif that mediates interaction with USP7 81 , a p62/GTF2H1-binding region 82 , and a DUF2043 domain that plays an important role in its recruitment to DNA damage 80 . We mapped these UVSSA protein domains to the C. elegans UVS-1 protein sequence, showing that UVS-1 also contains these essential TC-NER interaction domains ( Fig. 2A ; Supplementary Fig. 2). Next, we assessed which domains are affected by the tm6134 and tm6311 alleles. As both tm6134 and tm6311 deletions span multiple exons and introns, we first confirmed by RT-PCR that both mutant alleles are expressed ( Fig. 2B ). Subsequently, we sequenced cDNA of both alleles, to determine the ATG start site and how the genomic deletions affect splicing of the mRNA (Supplementary Fig. 3). Based on this sequence, protein prediction according to FGENESH 83 suggested that the non-UV-hypersensitive uvs-1(tm6134) allele encodes a protein in which the VHS domain is partially deleted ( Fig. 2A ; Supplementary Fig. 2). In comparison, the protein encoded by the UV-hypersensitive uvs-1(tm6311) allele still retains the VHS domain, but lacks the TRAF-binding motif and most of the GTF-2H1 binding region, and therefore likely will not be able to bind to the C. elegans USP7 ortholog MATH-33 and the p62/GTF2H1 ortholog GTF-2H1, which is a subunit of TFIIH. Download figure Open in new tab Fig. 2 UVS-1 mutants and expression. ( A ) FGENESH prediction of the UVS-1 protein encoded by wild type uvs-1 , uvs-1(tm6134) , and uvs-1(tm6311) alleles. ( B ) RT-PCR on exons 1-6 of cDNA of wild type, uvs-1(tm6134) , and uvs-1(tm6311) alleles. ( C ) Schematic depiction of AID::GFP knock-in at the uvs-1 locus. ( D ) Representative fluorescence confocal microscopy images of living animals showing no observable UVS-1::AID::GFP expression in head and oocyte nuclei of uvs-1::AG knock-in wild type, uvs-1(tm6134) , and uvs-1(tm6134) animals. Wild type animals, not expressing GFP (lower panel), are included as reference for autofluorescence signals. Arrowheads indicate nuclei. Scale bar: 25 µm. ( E ) Relative mRNA levels as determined by qPCR of uvs-1::AG, uvs-1::AG(tm6134 ) and uvs-1::AG(tm6311) alleles. Numbers in the graph represent p-values compared to wild type. Results are normalized to control household genes pmp-3 or cdc-42 , as indicated, and plotted as mean with SEM of three independent experiments. ( F ) Representative confocal images of animals overexpressing wild type or mutant UVS-1::AG in embryonic nuclei. Right panels show brightfield images. Scale bar: 20 µm To test if the mutant alleles express truncated UVS-1 proteins and whether there are differences in the expression and tissue distribution of wild type and mutant UVS-1, we knocked in GFP fused to an auxin-inducible degradation tag (AID::GFP; abbreviated to ‘AG’ for simplicity) at the C-terminus of wild type uvs-1 and the uvs-1(tm6134) and uvs-1(tm6311) alleles ( Fig. 2C ). Functionality of the tagged UVS-1 proteins was confirmed by L1 larvae UV survival experiments, showing that the UV survival of the wild type and tm6134 mutant knock-in animals expressing AG-tagged UVS-1 was similar as that of wild type animals (Supplementary Fig. 4). This clearly indicates that UVS-1::AG must be normally expressed and biologically active. Nevertheless, using confocal microscopy, we could not detect any expression of UVS-1::AG in nuclei of different tissues, such as in the head and in oocytes ( Fig. 2D ). Note that the fluorescence visible in the images of Fig. 2D is not derived from the GFP tag but from non-specific background autofluorescence, as this was also observed in animals without a GFP tag. In contrast, previously generated similar knock-in strains for other NER factors, i.e. XPF-1 and TFIIH (GTF-2H1 subunit), showed clear nuclear expression and ubiquitous distribution of these proteins 68 , 84 (Supplementary Fig. 5). Also, no UVS-1::AG expression was detected in the uvs-1::AG(tm6134) and uvs-1::AG(tm6311) knock-in strains. We confirmed that all three knock-in alleles are expressed, using RT-qPCR on GFP ( Fig. 2E ). This showed that uvs-1::AG(tm6134) and uvs-1::AG(tm6311) mRNA levels are similar as those of wild type uvs-1::AG , ruling out that the differences observed between UV-induced developmental and neuronal impairment are caused by differences in UVS-1 expression levels. As the expression levels of uvs-1::AG are apparently below the detection limit of our employed confocal microscope, we generated animals in which the same AG-tagged wild type and mutant UVS-1 genes driven by the uvs-1 promoter are overexpressed. In these animals, nuclear expression of both wild type and mutant UVS-1::AG was clearly visible ( Fig. 2F ). To test whether other TC-NER proteins are expressed similarly at low levels, we determined the expression of CSB-1, by generating csb-1::AID::mScarlet3 knock-in animals ( Fig. 3A ). We chose mScarlet3, as this is the brightest red fluorescent protein currently available 85 and red fluorescence imaging generates lower autofluorescence levels than green fluorescence imaging in C. elegans 86 . Normal expression and functionality of the tagged CSB-1 protein was confirmed by the L1 larvae UV survival assay (Supplementary Fig. 4), but again this expression was below the detection limit of our confocal microscope in various somatic tissues of living animals, including in the head ( Fig. 3B ). Strikingly, clear expression of CSB-1::AID::mScarlet3 was observed, but only in nuclei of meiotic cells and oocytes of the germline and in embryos. Even though CSB-1 expression could not be detected in differentiated somatic tissues by microscopy, previous microarray gene expression analyses have shown that CSB-1 is expressed in these tissues 87 , 88 . Moreover, we and others showed that mutation of csb-1 impairs DNA repair, survival and functionality of neurons and muscle cells in C. elegans , clearly indicating that CSB-1 is expressed and active in these tissues 68 , 75 , 87 , 89 – 91 . To confirm this, we generated animals overexpressing FLAG::GFP-tagged CSB-1 from its own promoter, which indeed showed clear expression of CSB-1 in somatic cells ( Fig. 3C ). Download figure Open in new tab Fig. 3 Deficient USP7 and TFIIH recruitment cause UV hypersensitivity in uvs-1 mutants ( A ) Schematic depiction of AID::mScarlet3 knock-in at the csb-1 locus. ( B ) Representative confocal images of fixed animals showing CSB-1::AID::mScarlet3 expression in pachytene (arrow) and oocyte (arrowheads) nuclei in the germline (left panel) and no observable expression in head nuclei (right panel). Lower panel shows brightfield images. Scale bar: 20 µm ( C ) Representative confocal image of animals overexpressing CSB-1::FLAG::GFP in somatic nuclei in the head. Lower panel shows a brightfield image. Scale bar: 20 µm ( D ) Schematic depiction of the first step of the TC-NER reaction. TC-NER is initiated when elongating Pol II, including catalytic subunit AMA-1, is stalled by DNA damage in the transcribed strand of an active gene (Step 1). This leads to the stable binding of TC-NER factors CSB-1 and CRL4 CSA- 1 , including CSA-1, DDB-1, CUL-4A and RBX-1 (not shown), which ubiquitylates CSB-1 and lesion-stalled Pol II (Step 2). Subsequently, UVS-1 and its binding partner MATH-33 are recruited, which leads to deubiquitylation of CSB-1 by MATH-33 and thereby stabilization of the TC-NER complex (Step 3). ( E-F ) Representative fluorescence images ( E ) and quantification ( F ) of CSB-1::AID::mScarlet3 expression in nuclei of oocytes in wild type, uvs-1(tm6134) , and uvs-1(tm6311) mutants. Fluorescence values were normalized to CSB-1::AID::mScarlet3 in wild type animals. Mean with SEM of two independent experiments. ( G ) L1 larvae UV survival assays of uvs-1(tm6311) animals without and with overexpression of CSB-1::FLAG::GFP. Mean with SEM of three independent experiments. ( H ) Genomic and predicted protein sequences of the wild type and S231A and F339-V342 mutant uvs-1 alleles, compared to the mammalian ortholog UVSSA sequences. ( I ) L1 larvae UV survival assays of wild type, uvs-1(tm6311) , uvs-1(F339-V342) and uvs-1(S231A) animals. Mean with SEM of three independent experiments. Numbers in the graph represent p-values comparing the 120 J/m 2 data points to wild type, determined by TWO-WAY ANOVA Šídák’s multiple comparisons test. A major difference between the proteins encoded by both mutant uvs-1 alleles is that UVS-1(tm6311) is predicted to lose its interaction with MATH-33/USP7 due to deletion of the TRAF-binding motif, while UVS-1(tm6134) still retains this interaction. To test the importance of this interaction, we crossed uvs-1(tm6134) mutants with math-33 mutants and observed that uvs-1(tm6134) animals do become UV hypersensitive upon MATH-33/USP7 loss (Supplementary Fig 4B). In humans, the deubiquitylase USP7 is recruited to TC-NER complexes through this interaction with UVSSA to counteract the degradation of CSB after its ubiquitylation by CRL4 CSA , thereby stabilizing the TC-NER complex 27 , 28 , 37 , 92 ( Fig. 3D ). We therefore hypothesized that C. elegans CSB-1 protein levels could be affected by the tm6311 deletion in UVS-1. We crossed both uvs-1 mutants with csb-1::AID::mScarlet3 knock-in animals to study CSB-1 levels. Quantification of mScarlet3 fluorescence levels in oocytes of living animals by confocal microscopy showed no difference in CSB-1 protein levels between wild type and uvs-1(tm6134) animals, in untreated conditions and after UV irradiation ( Fig. 3E, F ). However, CSB-1 levels were strongly reduced in uvs-1(tm6311) mutants, already in untreated conditions and even more so after UV irradiation ( Fig. 3E, F ). These results indicate that CSB-1 is unstable and degraded in uvs-1(tm6311) mutants, likely because it is not deubiquitylated by MATH-33, and that possibly uvs-1(tm6311) mutants are UV hypersensitive due to low CSB-1 levels. We therefore tested if increased CSB-1 levels could rescue the UV hypersensitivity of uvs-1(tm6311) animals, by crossing these animals with animals overexpressing GFP-tagged CSB-1, driven by its own promoter. L1 larvae UV survival assays did not show any difference upon CSB overexpression ( Fig. 3G ), indicating that uvs-1(tm6311) mutants are not UV hypersensitive solely due to low CSB-1 levels. The mutant UVS-1(tm6311) protein is not only predicted to have lost its interaction with MATH-33/USP7, but also with the TFIIH subunit GTF-2H1. To test which of these two lost interactions is responsible for the UV hypersensitivity, we generated two additional uvs-1 mutants ( Fig. 3H ). In one mutant, we mutated serine residue Ser231 in the TRAF-binding motif of UVS-1 into arginine, which in human UVSSA was shown to lead to loss of the interaction with USP7 81 In the other mutant, we deleted residues F51 to V54 of the GTF-2H1 binding region, which in human UVSSA was shown lead to loss of GTF2H1 binding 18 . Interestingly, both mutants were hypersensitive to UV irradiation, similarly as uvs-1(tm6311) mutants ( Fig. 3I ). These results indicate that the interactions of UVSSA both with USP7 and with TFIIH are needed to protect against UV-induced developmental arrest. Persistently lesion-stalled Pol II in TC-NER mutants correlates with developmental arrest In humans, binding of CSB to lesion-stalled Pol II leads to recruitment of the CRL4 CSA E3 ubiquitin ligase complex, and possibly other E3 ubiquitin ligases, which are thought to poly-ubiquitylate, besides CSB, also the major catalytic Pol II subunit RPB1. This leads to the displacement and/or removal of the lesion-stalled Pol II complex to allow repair to take place ( Fig. 3D ) 9 , 10 . Also, the recruitment of TFIIH was hypothesized to lead to Pol II displacement 4 , 93 – 98 . Thus, a key feature of UV hypersensitive csb-1 and uvs-1 strains may be that Pol II is not efficiently removed from damaged DNA. In order to study the DNA binding of Pol II in living worms, we created AID::GFP::3xFLAG::ama-1 (referred to as AGF::ama-1 for simplicity) animals, in which GFP fused to an AID and a triple FLAG tag is knocked in at the N-terminus of the ama-1 locus, which encodes the ortholog of the human Pol II subunit RPB1 ( Fig. 4A ). Importantly, AGF::ama-1 knock-in animals were fully viable and did not show any UV hypersensitivity compared to wild type animals (Supplementary Fig. 4), indicating that the triple tag does not interfere with Pol II function. Expression of AGF::AMA-1 was clearly observed in all nuclei of each cell type throughout development, in line with the need for transcription in every cell ( Fig. 4B ), contrasting with the low expression of UVS-1 and CSB-1. Interestingly, AGF::AMA-1 fluorescence was more than five times higher in intensity compared to TFIIH subunit GTF-2H1 tagged with AID::GFP (Supplementary Fig. 5) 84 , indicating that AMA-1 is expressed at much higher levels than the NER and transcription factor TFIIH. TC-NER factors, despite their importance to DNA repair, are apparently expressed at even lower levels compared to other NER factors. Download figure Open in new tab Fig. 4 Pol II processing in TC-NER mutants facilitates GG-NER of transcription-blocking lesions. ( A ) Schematic depiction of AID::3xFLAG::GFP knock-in at the ama-1 locus ( B ) Representative fluorescence confocal microscopy images of living animals showing AGF::AMA-1 expression in the head, hypodermis, intestine, oocyte, and embryos. Scale bar: 50 µm. ( C ) Representative FRAP images of a hypodermis nucleus with AGF::AMA-1 expression, before photobleaching (top), after photobleaching (middle) and after recovery of fluorescence. ( D-E ) AGF::AMA-1 immobile fractions, calculated from FRAP curves depicted in Supplementary Fig. 6A-B, performed under untreated conditions, directly (0-30 min) or 18 h after UV-B irradiation, in hypodermal ( D ) or intestinal ( E ) nuclei of wild type, csb-1(emc78) , uvs-1(tm6134) , and uvs-1(tm6311) knock-in animals expressing AGF::AMA-1. Mean with SEM of three independent experiments. ( F ) Experimental set-up of an L1 larvae UV survival assay during which Pol II was transiently depleted. L1 larvae were untreated or irradiated (60 J/m 2 UV-B) and left to grow for 4 h (Step 1). Next, animals were cultured in the absence or presence of 5-Ph-IAA for 4 h to transiently deplete AGF::AMA-1 (Step 2). After 40 h, animal development wase scored (Step 3). ( G ) L1 larvae UV survival assay after 5-Ph-IAA-induced Pol II depletion in wild type, csb-1(emc78) , uvs-1(emc80), xpa-1(ok698), xpc-1(tm3886) , and xpc-1(tm3886); csb-1(emc78) animals expressing AGF::AMA-1. Mean with SEM of minimal three independent experiments. Numbers in the graph represent p-values determined by TWO-WAY ANOVA Šídák’s multiple comparisons test. To study how csb-1 and uvs-1 loss-of-function affect Pol II binding to DNA damage, we crossed AGF::ama-1 animals with the UV hypersensitive csb-1(emc-78) and uvs-1(tm6311) and the non-UV hypersensitive uvs-1(tm6134) strains. We assessed Pol II mobility and DNA binding using fluorescence recovery after photo-bleaching (FRAP) 99 , in hypodermal and intestinal nuclei of living AGF::AMA-1-expressing animals immediately and 18 h after induction of DNA damage by UV irradiation ( Fig. 4C ). UV-induced immobilization of Pol II, measured as incomplete fluorescence recovery in FRAP, reflects its stalling at UV-induced DNA lesions and thus its binding to damaged DNA 100 , as previously also shown for human fluorescently-tagged Pol II subunit RPB1 101 . In wild type animals, a significant fraction of AGF::AMA-1 molecules indeed became immobilized within the first 30 min after UV irradiation, in both hypodermal and intestinal cells, as shown by the immobile fraction ( Fig. 4D-E ) calculated based on the FRAP curves (Supplementary Fig. 6A-B). This immobile fraction was not observed anymore 18 h after UV irradiation, indicating that AMA-1 was no longer bound to damaged DNA due to functional TC-NER and thus proper processing of Pol II. Also, in csb-1(emc78) and both uvs-1 mutants a significant fraction of AGF::AMA-1 became immobilized immediately after DNA damage induction, in both hypodermal and intestinal cells. However, in the UV hypersensitive csb-1(emc78) and uvs-1(tm6311) mutants a clear UV-induced immobile fraction was still observed 18 h after UV irradiation. In contrast, in the non-UV hypersensitive uvs-1(tm6134) strain, this immobile fraction was not observed anymore after 18 h, similar as in wild type animals ( Fig. 4D-E ; Supplementary Fig. 6A-B). These observations show that Pol II is effectively processed and removed from damaged DNA in wild type and uvs-1(tm6134) animals, but is persistently stalled at UV-induced DNA lesions in the UV hypersensitive csb-1(emc78) and uvs-1(tm6311) strains. Therefore, these results indicate that persistent DNA damage-induced Pol II stalling correlates with developmental arrest in csb-1(emc78) and uvs-1(tm6311) animals. Transient Pol II depletion rescues UV hypersensitivity of csb-1 and uvs-1 animals in a GG-NER dependent manner Persistent Pol II stalling may cause developmental arrest by shielding the lesion from repair via other DNA repair pathways and thus impeding transcription restart. To investigate if indeed the lesion-stalling of Pol II is responsible for the developmental arrest, we tested if removal of Pol II from damaged DNA rescues the UV hypersensitivity of csb-1(emc78) and uvs-1(emc80) mutants. We therefore made use of the AID degron tag 102 fused to AMA-1 in AGF::ama-1 animals to transiently deplete AMA-1, while performing L1 larvae UV survival assays. To this end, we expressed the improved Arabidopsis E3 ubiquitin ligase mutant TIR1(F79G) 103 , under control of the ubiquitously expressed ribosomal protein promoter rps-28 , in wild type, csb-1(emc78) and uvs-1(emc80) animals. TIR1(F79G) is activated by culturing animals on the auxin derivative 5-Ph-IAA, leading to depletion of AID-tagged AMA-1 (Supplementary Fig. 6C). To avoid too exhaustive depletion of AGF::AMA-1, which would lead to complete loss of transcription and larval arrest by itself, we cultured AGF::AMA-1 L1 larvae for 4 h only on 5-Ph-IAA during the L1 larvae UV survival assay to transiently deplete Pol II ( Fig. 4F ). This transient Pol II depletion only minimally affected the development of unirradiated wild type animals and did not lead to any additional developmental arrest after UV irradiation in wild animals ( Fig. 4G ). Strikingly, however, this transient Pol II depletion significantly rescued the UV hypersensitivity of the TC-NER deficient csb-1(emc78) and uvs-1(emc80) strains, to a level comparable to that of UV-irradiated wild type animals in which Pol II was depleted ( Fig. 4G ). The remarkable reversal in UV hypersensitivity observed in these TC-NER deficient strains suggests that removal of stalled Pol II allows the lesion to become accessible for detection and repair via alternative DNA repair pathways. As the GG-NER pathway is the most likely candidate for the removal of UV-induced lesions, we tested if GG-NER is responsible for the rescued UV hypersensitivity. We crossed the TIR1(F79G)- and AGF::AMA-1-expressing wild type and csb-1(emc78) animals with xpc-1(tm3886) mutants that are deficient in GG-NER. Also, we crossed the TIR1(F79G)- and AGF::AMA-1-expressing wild type strain with an xpa-1(ok698) mutant strain, deficient for the NER factor XPA-1 that is essential for both GG-NER and TC-NER 67 , 70 . GG-NER deficient xpc-1(tm3886) animals showed no hypersensitivity to UV irradiation, irrespective of whether Pol II was depleted, which is as shown before ( Fig. 1A ) 67 and consistent with the proficiency of TC-NER in these animals. However, the rescued UV hypersensitivity observed after transient Pol II depletion in TC-NER deficient csb-1(emc78) animals was completely abolished when in addition also GG-NER was deficient, i.e. in xpc-1(tm3886); csb-1(emc78) double mutants ( Fig. 4G ). GG-NER and TC-NER deficient xpa-1(ok698) mutants similarly showed strong UV hypersensitivity, irrespective of whether Pol II was transiently depleted or not. Together, these findings demonstrate that the shielding and prevention of repair of DNA lesions by persistently stalled Pol II is the primary cause of developmental arrest in UV-irradiated TC-NER deficient C. elegans L1 larvae. Importantly, our data show that this developmental arrest can be averted if Pol II is removed from DNA lesions, allowing GG-NER to repair the UV-induced DNA damage. Multiple E3 ubiquitin ligases promote Pol II processing to prevent DNA damage-induced developmental arrest To confirm that the inability to displace and/or remove lesion-stalled Pol II impairs cell function and consequently development, we investigated which other factors, besides CSB-1 and CSA-1, are involved in this Pol II processing. In mammals, RPB1 is poly-ubiquitylated at residue K1268, which involves the activity of CRL4 CSA and likely also other E3 ubiquitin ligases 24 , 33 , 36 . This ubiquitylation was found to promote both TC-NER and Pol II degradation, as well as transcription recovery in human cells, and to protect against CS-like features, including neurodegeneration, in mice 33 , 34 . Defective K1268 ubiquitylation was therefore proposed to lead to persistent stalling of Pol II at unrepaired lesions, which may impede access of alternative DNA repair pathways. The RPB1 residue K1268 is well conserved among various species and is in C. elegans represented by residue K1260 in ama-1 ( Fig. 5A ). We inactivated this potential ubiquitylation site in C. elegans, by mutating the lysine at position 1260 to arginine, creating a strain referred to as ama-1(K1260R) . Subsequently, we performed L1 larvae UV survival assays, in which we observed similar UV-induced developmental arrest as in the UV hypersensitive TC-NER deficient mutants ( Fig. 5B ; compare to Fig. 1A-C, F ). This finding supports the idea that the UV-induced developmental arrest, as measured in the L1 larvae UV survival assay, is caused by deficient removal of Pol II from DNA damage. Download figure Open in new tab Fig. 5 Multiple E3 ubiquitin ligases promote Pol II processing to prevent developmental arrest. ( A ) Genomic and protein sequences of the wild-type and ubiquitylation-defective K1260R mutant ama-1 allele, compared to its mammalian ortholog RPB1 and corresponding K1286R mutant residue. ( B ) L1 larvae UV survival of wild type and ama-1(K1260R) animals. ( C ) L1 larvae UV survival of animals treated with RNAi against TC-NER genes ( ddb-1, cul-4, csa-1, and csb-1 ), and orthologs of NEDD4 ( wwp-1 ), VCP ( cdc-48.1, and cdc-48.2 ), Elongin-Cullin complexes ( tceb-3, elb-1, elc-1, and vhl-1 ), and the BRCA1/BARD1 complex ( brc-1 and brd-1 ). ( D-G ) L1 larvae UV survival experiments of wild type and single mutants of ( D ) wwp-1(ok1102) , ( E ) cdc-48.1(tm544) , ( F ) brc-1(tm1145) , and ( G ) brd-(ok1623) and of double mutants of each of these genes together with either csb-1(ok2335) (red) or uvs-1(tm6134) (cyan). All graphs depict mean with SEM of three independent experiments. Numbers in the graph represent p-values comparing 80 or 120 J/m 2 data points to wild type, determined by TWO-WAY ANOVA Šídák’s multiple comparisons test. Besides CRL4 CSA , several E3 ubiquitin ligases have been implicated in ubiquitylation and degradation of Pol II stalled at transcription-blocking DNA lesions 36 . These are in humans NEDD4 59 , 60 , Elongin-Cullin complexes CRL5 Elongin 59 , 61 , 104 and CRL2 VHL 62 , 105 , and BRCA1/BARD1 63 , 106 . Also, the ubiquitin-dependent segregase VCP was implicated in removing stalled ubiquitylated Pol II from DNA damage 56 , 107 – 109 . We tested whether each of these factors is important to prevent UV-induced developmental arrest, by performing L1 larvae UV survival assays after knocking down their C. elegans orthologs using RNAi ( Fig. 5C ; Table 1 ) 110 . Knockdown of wwp-1 , the C. elegans ortholog of human NEDD4, previously already implicated in ubiquitylating AMA-1 70 , and two genes encoding orthologs of VCP, cdc-48.1 and cdc-48.2, gave rise to UV hypersensitivity, similarly as knockdown of the CRL4 CSA complex factors ddb-1, cul-4, csa-1, and of csb-1, which were included as control ( Fig. 5C ). Also, knockdown of CRL5 Elongin and CRL2 VHL complex genes, i.e. tceb-3 , elc-2 , elb-1 , and vhl-1 , which are the orthologs of human Elongin A, Elongin B, Elongin C, and VHL, respectively, led to UV hypersensitivity. This was also observed after knockdown of the BRCA1 and BARD1 orthologs brc-1 and brd-1 . These findings corroborate the idea that Pol II processing is necessary to prevent DNA damage-induced developmental arrest and suggest that this is an intricate process involving the activity of multiple E3 ubiquitin ligases. To further confirm these findings, we obtained loss-of-function mutants for several of the tested genes, i.e. wwp-1(ok1102) , cdc-48.1(tm544) , cdc-48.2(tm659) , brc-1(tm1145) , and brd-1(ok1623), from the Caenorhabditis Genetics Center. We found that indeed the deficiency of each of these genes renders animals UV hypersensitive and causes increased developmental arrest upon UV, as shown by L1 larvae UV survival experiments ( Fig. 5D-G , Supplementary Fig. 7). Next, we tested if their activity is epistatic to the TC-NER pathway or if the gene products act in a pathway parallel to TC-NER. Therefore, we crossed wwp-1(ok1102), cdc48.1(tm544), brc-1(tm1145) , and brd-1(ok1625) animals with csb-1(ok2335) animals. Interestingly, we found that each of the double mutants were more UV hypersensitive compared to their respective single mutants ( Fig. 5D-G ), as well as to the csb-1(ok2335) single mutant ( Fig. 1A ). These results suggest that WWP-1, CDC-48.1 and BRCA-1/BRD-1 function at least partially independent of TC-NER. We next crossed these mutants to the TC-NER deficient, but UV non-hypersensitive, uvs-1(tm6134) strain. Based on our FRAP experiments ( Fig. 4D, E ), we had concluded that this mutant is resistant to UV irradiation because Pol II is still effectively processed and removed from damaged DNA. Strikingly, we observed that the uvs-1(tm6134) double mutants with wwp-1(ok1102), cdc48.1(tm544), brc-1(tm1145) or brd-1(ok1625) were strongly hypersensitive to UV irradiation, to the same level as the csb-1(ok2335) double mutants. These results confirm that uvs-1(tm6134) animals are indeed TC-NER deficient but that their resistance to UV irradiation is due to Pol II processing involving the activity of WWP1, BRCA-1/BRD-1 and CDC-48.1. Discussion Here, we use C. elegans to show that DNA damage in transcribed genes of non-dividing, somatic cells causes motoneuronal and developmental failure in TC-NER deficient animals due to the lack of proper Pol II processing and, consequently, the lack of DNA repair. These results are in line with previous observations by us and others showing that specifically TC-NER, but not GG-NER, protects against the severe consequences of DNA damage in somatic tissues, including muscles and neurons, and is therefore crucial to protect transcriptional integrity and normal animal development 67 – 69 , 73 , 75 , 84 . Interestingly, although TC-NER by itself is sufficient to protect developing animals against UV-induced DNA damage, the UV hypersensitivity of TC-NER mutants becomes more pronounced when in addition xpc-1 is mutated ( Fig. 1D ), showing that GG-NER acts as backup in the repair of transcription-blocking DNA damage. Moreover, we found that GG-NER of transcription-blocking lesions in somatic tissues is very efficient but requires access to the DNA damage, which is prevented in most TC-NER deficient animals tested, due to impaired removal of Pol II from damaged DNA ( Fig. 4G ). We also show that this processing of lesion-stalled Pol II involves the activity of multiple E3 ubiquitin ligases, revealing that this is an intricate process that is tightly regulated at multiple levels ( Fig. 5 ). Therefore, our data favor the idea that DNA damage-induced motoneuronal and developmental failure associated with TC-NER deficiency is primarily caused by the lack of lesion removal due to persistently stalled Pol II ( Fig. 6 ), which may have important implications for understanding CS etiology and aging as discussed in more detail below. Download figure Open in new tab Fig. 6 Model of Pol II stalling-induced transcription stress. Left panel: In wild type animals, lesion-stalled Pol II leads to the recruitment of the TC-NER machinery, Pol II is processed and subsequently the core NER machinery removes the lesion, facilitating transcription restart. Middle panel: Non-UV hypersensitive uvs-1(tm6134) mutant animals are TC-NER deficient, but Pol II is still processed, involving its ubiquitylation. This allows GG-NER to recognize and repair the transcription blocking lesion and subsequent transcription restart. Right panel: UV hypersensitive TC-NER deficient mutants, such as csb-1 and uvs-1 mutant animals, are also deficient in Pol II processing. This results in prolonged stalling of Pol II at DNA damage, shielding it from repair by other DNA repair pathways like GG-NER. The failure to process DNA damage-stalled Pol II leads to failure of transcription restart and, consequently, neuronal and developmental impairment in C. elegans . Ub stands for ubiquitin. Transient depletion of persistently lesion-stalled Pol II rescued the UV-induced developmental arrest of TC-NER deficient animals in a GG-NER-dependent manner, confirming that GG-NER, via DNA damage detection by XPC-1, acts as backup to TC-NER in the removal transcription-blocking DNA damage. It is striking to note that C. elegans TC-NER and Pol II processing deficient mutants only exhibit a partial UV hypersensitivity compared to animals fully deficient in both TC-NER and GG-NER, such as xpc-1; uvs-1 and xpc-1; csb-1 double and xpa-1 single mutants ( Fig. 1D ; 4G), and such as gtf-2H5, xpg-1, ercc-1 and xpf-1 mutants that we previously studied 67 , 68 , 84 , 91 . This suggests that even when Pol II is not properly processed, XPC-1 is still able to detect and initiate the removal of a subset of DNA lesions in transcribed genes. UV irradiation predominantly creates two types of DNA-helix-distorting lesions, i.e., cyclobutane-pyrimidine dimers (CPDs) and 6-4 pyrimidine-pyrimidone photoproducts (6-4PPs). 6-4PPs are rapidly removed by both TC-NER and GG-NER in mammalian cells, but CPDs are only rapidly removed by TC-NER and much slower by GG-NER, as XPC is unable to recognize these efficiently 111 , 112 . The partial UV sensitivity of TC-NER C. elegans mutants could therefore be due to inefficient CPD removal by GG-NER. This is, however, unlikely given the observation that transient Pol II depletion completely rescued the UV hypersensitivity of csb-1(emc78) and uvs-1(emc80) animals ( Fig. 4G ). These results suggest that, in C. elegans, XPC-1-mediated GG-NER is very efficient in repairing both 6-4PP and CPDs. Indeed, this is supported by our previous finding showing that CPDs are very rapidly cleared by GG-NER in C. elegans oocytes 67 , 68 . Moreover, it was previously shown that 6-4PPs and CPDs are repaired with equal efficiency in C. elegans, using radioimmunoassays on DNA extracted from whole animals 113 . Therefore, it is likely that in C. elegans somatic tissues, both TC-NER and GG-NER detect and repair UV-induced DNA damage, i.e. CPDs and 6-4PPs, in the template strand of active genes, and that it is a matter of chance whether XPC or Pol II first arrives at the lesion. In GG-NER deficient mutants, TC-NER is therefore sufficient to detect and remove all DNA damage in transcribed genes, explaining why GG-NER mutants are not UV hypersensitive in the L1 UV survival assay. However, in TC-NER deficient mutants, XPC-1 will be able to detect a fraction of the lesions in transcribed DNA, but Pol II will still be stalled by the remainder of lesions, shielding these from repair before XPC-1 has had the chance to detect these. This explains the partial UV hypersensitivity of TC-NER mutants and why these mutants become much more sensitive to UV irradiation in the absence of functional GG-NER. In view of this, it is interesting to note that single TC-NER deficient Csb −/− and Csa −/− mice display only mild CS features, but that additional inactivation of GG-NER by either Xpc or Xpa inactivation dramatically aggravates their CS phenotype, including neurological degeneration, motor dysfunction, and progeroid features 114 – 116 . This has been attributed to increased DNA damage load due to additional XPC or XPA mutation, which in essence shows that also in mice GG-NER acts as backup pathway to TC-NER. Taken together, these results demonstrate that both subpathways of NER, GG- and TC-NER, act in synergy to repair DNA damage in actively transcribed genes in somatic, nondividing tissues such as neurons. Remarkably, we found that TC-NER deficiency does not necessarily lead to developmental arrest after UV irradiation, as observed in the uvs-1(tm6134) animals. These mutant animals are clearly TC-NER deficient, as evidenced by their resistance to trabectedin ( Fig. 1G ), but showed a UV sensitivity ( Fig. 1C ) and UV-dependent Pol II mobility ( Fig. 4D-E ) comparable to wild type animals. In contrast to wild type animals, however, their UV sensitivity was fully dependent on xpc-1 ( Fig. 1D ). This indicates that in these mutants, Pol II does not persistently stall at transcription-blocking lesions and that XPC-1 has full access to initiate repair via GG-NER ( Fig. 6 ). It is therefore likely that the tm6134 mutant UVS-1 protein, together with USP7, is still recruited to the TC-NER complex, despite the fact that in this mutant the VHS domain, which is necessary for interaction with CSA 30 , is partially deleted. Indeed, in human cells also CSA-independent recruitment of UVSSA to DNA damage has been observed 80 . In contrast, the TC-NER deficient uvs-1(tm6311) mutant animals displayed strong motoneuronal and developmental failure upon UV irradiation. As in these mutants specifically the TRAF-binding motif and most of the p62/GTF-2H1-binding region are deleted, their UV hypersensitivity could be caused by the inability to recruit the deubiquitylase enzyme USP7 and/or TFIIH to the TC-NER machinery. In mammalian cells, loss of USP7 recruitment to the TC-NER machinery results in increased CSB degradation, as consequence of its ubiquitylation by the CRL4 CSA complex 27 , 28 , 32 , 37 , 92 . In line with this, we found that CSB-1 protein levels were greatly reduced in C. elegans uvs-1(tm6311) oocytes, but not in uvs-1(tm6134) animals ( Fig. 3D-E ). Still, overexpression of CSB-1 did not rescue the UV-induced developmental arrest of uvs-1(tm6311) mutants, suggesting that also TFIIH recruitment is important. Indeed, animals with a mutation in the p62/GTF-2H1-binding region only were as UV hypersensitive as animals with a mutation in the TRAF-binding motif only. The recruitment of CRL4 CSA by CSB 9 , 10 as well as the helicase/translocase activity of TFIIH 4 , 93 – 98 are likely needed for the processing of stalled Pol II from the lesion, suggesting that the UV-hypersensitivity in uvs-1 mutant animals results from the inability to efficiently process Pol II. Indeed, prolonged Pol II immobilization was observed upon UV-irradiation in uvs-1(tm6311) animals ( Fig. 4D-E ). As our results indicate that not TC-NER deficiency perse, but rather DNA damage-induced persistent Pol II stalling causes developmental arrest, it is evident that processing of lesion-stalled Pol II must be tightly regulated. Indeed, to safeguard transcriptional integrity, several E3 ubiquitin ligases have been implicated in ubiquitylating and regulating Pol II processing 33 , 59 – 63 , 104 – 106 , but their precise function and interplay are still unclear. Here, we show that the loss of subunits of the E3 ubiquitin ligases CRL4 CSA , NEDD4, CRL5 Elongin , CRL2 VHL , and BRCA1/BARD1, as well as of the ubiquitin-dependent segregase VCP, all results in UV-induced developmental arrest in C. elegans, likely in a CSB-dependent 104 , but also CSB-independent manner. Removal of lesion-stalled Pol II by polyubiquitylation and degradation, involving the sequential activities of NEDD4 and CRL5 Elongin , has been proposed to act as an alternative last resort pathway, at least in yeast, to failing TC-NER 57 , 59 , 60 , 117 . However, our observation that RNAi knockdown or mutation of single subunits of these E3 ubiquitin ligases already causes UV hypersensitivity suggests that their activity in Pol II processing is relevant for TC-NER itself as well. Our findings indicate that multiple different E3 ubiquitin ligases, together with CRL4 CSA , coordinate Pol II displacement and/or degradation to enable lesion removal. Further research is needed to mechanistically understand the individual roles of each of these E3 ubiquitin ligases in Pol remodeling and TC-NER, their interplay and how their collective activity is controlled. Also, it will be necessary to study to which extent they act in a CSB-dependent or CSB-independent manner. Hereditary defects in human CSB and CSA can lead to severe CS, while hereditary mutations in human UVSSA lead to the much milder UV s S. We and others have previously put forward the hypothesis that CS features are therefore not caused by mere TC-NER deficiency, but by the failure to properly remove stalled Pol II from DNA damage 4 , 30 , 31 , 33 , 52 – 54 . Indeed, it was shown that CSA and CSB deficient cells differ from UVSSA deficient cells in their ability to remove Pol II from chromatin after DNA damage induction 55 , 56 , 118 . Our results in this manuscript strongly support this model by directly showing that Pol II processing is necessary to facilitate DNA repair and to prevent DNA damage-induced neuronal and developmental failure. We therefore propose that severe CS features in humans are, at least partially, due to persistently stalled Pol II, which shields DNA damage from repair by alternative means and causes transcriptional failure ( Fig. 6 ). This hypothesis implies that CS features are ultimately caused by a failure to repair DNA damage, albeit not only a failure of TC-NER itself but also of other repair mechanisms. Defects in downstream NER factors XPB, XPD, XPF and XPG can also cause CS features, as observed in patients with Xeroderma pigmentosum-Cockayne syndrome (XP-CS) complex 38 , 51 , 119 , 120 . We recently showed that TFIIH persistently binds to DNA damage in XPF- and XPG-deficient cells, which leads to more severe cellular defects after DNA damage induction 91 . This suggests that possibly the accumulation of persistently stalled NER intermediates, preventing repair by other means, is a common underlying cause of CS features. The progeroid nature of these features, which resemble genuine human aging, is one of the reasons why accumulating DNA damage is considered a central driver of aging 6 , 121 . Especially neurons are affected by DNA damage in both in CS and in aging. This is likely because of their postmitotic status, long lifespan and the fact that they express some of the longest genes, which makes them especially susceptible to the accumulation of DNA damage interfering with transcription 7 , 122 , 123 . It is not entirely clear why DNA damage accumulates with age, and to what extent declining DNA repair rates are responsible for this 124 . Interestingly, it was found that a high percentage of Pol II complexes is stalled at DNA damage in aging mice, which depends on gene length and leads to gene expression changes associated with aging 7 . Possibly, this may point to the fact that not only DNA repair itself, but also Pol II processing capacity declines with age, which may lead to more Pol II stalling and stronger inhibition of repair, causing persistent DNA damage-induced transcription stress that leads to aging. For this reason, it will be interesting to study mechanisms and consequences associated with Pol II processing during aging as well. Materials and methods C. elegans strains and culture All C. elegans strains were cultured according to standard methods 125 on nematode growth media (NGM) agar plates seeded with Escherichia coli OP50. Bristol N2 was used as wild type strain. All strains used are listed in Supplementary Table 1. All mutants generated were backcrossed against wild type and genotyped by PCR and sequencing. Double mutants were generated by crossing and checked by genotypic PCR. During all assays, animals were kept at 20°C. Mutant animals were generated by injection of a mixture of Cas9 and gRNA (Integrated DNA technologies (IDT)) and, in case of knock-in and point mutants, a homology directed repair template, or, in case over CSB overexpression, a mixture of the csb-1::FLAG::GFP PCR product and fluorescent marker elt-2::mCherry . All generated knock-out, knock-in, point mutant and transgenic animals were verified by genotyping PCR and sequencing. csb-1(emc78) and uvs-1(emc80) mutants, in which the complete csb-1 or uvs-1 genes were deleted, respectively, were generated using sgRNAs targeting csb-1 (5’-TGAAAAAATACCTAAGTACC-3’ and 5’-AAAAATGAATCAATGAATAA-3’) or uvs-1 (5’-CAAATAAAATGTTGAAAAGA-3’ and 5’-CAGTTTTCTCATTTTTAATA-3’). To generate knock-in animals, wild type animals, unless mentioned otherwise, were injected with gRNA, a homology directed repair template consisting of a heteroduplex DNA fragment that was generated by mixing PCR products 126 , and purified Cas9 protein (IDT). To generate uvs-1::AID::GFP knock-in wild type, uvs-1(tm6134) , and uvs-1(tm6311) animals, a gRNA with targeting sequence 5’-CAGTTTTCTCATTTTTAATA-3’ (IDT) was used. The homology directed repair template was generated using primer combinations 5ʹ-CGTCTAGAAAAAAATTTTGGTCAACAGTTTTCTCATTTTATGCCTAAAGATCCAGCCAAAC-3ʹ/5ʹ-ATATTTACTTTATTTTTCTAAATTTTAACAAAAAACCGTATCATTTGTATAGTTCGTCC-3ʹ and 5ʹ-ATGCCTAAAGATCCAGCCAA-3ʹ/5ʹ-TCATTTGTATAGTTCGTCCATGCC-3ʹ on a gene fragment consisting of AID::GFP sequences flanked by 37 bp left and 33 bp right homology arms from the uvs-1 locus (generated by IDT). To generate csb-1::AID::GFP and csb-1::AID::mScarlet3 knock-in animals, a gRNA with targeting sequence 5’-TTTTACATTCTAGAAGTACT-3’ (IDT) was used. The homology directed repair of AID::GFP was generated using primer combinations 5ʹ-CGGCAGATGTGCTGTCGCCAG-3ʹ/5ʹ-GCAATTTGGGGCTGGGGGATTC-3ʹ and 5ʹ-ATGCCTAAAGATCCAGCCAA-3ʹ /5ʹ-TCATTTGTATAGTTCGTCCATGCC-3ʹ on a gene fragment consisting of AID::GFP sequences flanked by 110 bp left and 93 bp right homology arms from the csb-1 locus (generated by IDT). The homology directed repair of AID::mScarlet3 was generated using primer combinations 5’-GGTCGGATTCATCAGGACCGAG-3’/5’-GCTCCCATTATTCATTGATTCATTTTTCAC-3’ on a gene fragment consisting of AID::mScarlet sequences flanked by 35 bp left and 80 bp right homology arms from the csb-1 locus (generated by IDT). AID::3xFLAG::GFP::ama-1 knock-in animals were generated by injecting in previously generated ama-1(ot1037[GFP::3xFLAG::::ama-1]) 127 animals, using gRNA 5’ TTAAATTTTCAGATGAGTAA 3’ and a template containing AID sequences generated by PCR with primers 5’-CAATTTTTTTAAATCCCATTTTTTAAATTTTCAGATGCCTAAAGATCCAGCCAAAC-3’ and 5’-GACAACTCCAGTGAACAATTCTTCTCCTTTACTCATCTTCACGAACGCCGCCGCCTC-3’. ama-1 ( em216 ) animals were generated using a gRNA with targeting sequence 5’-CGAATCGCCGGAGAGGATAA-3’ and as homology directed repair template ssDNA oligomers with sequence GATCGGATTCACGGAGGCTTCGGCAACGATGTTCACACTATCTACACCGACGATAACGCCGAGAAGCTCGTTT TCCGTCTCAGGATAGCGGGGGAAGACAGAGGGGAAGCTCAGGAGGAGCAGGTGGATAAGATGGAGGACGA CGTGTTCCTACGATGTATCGAGGCAAATATGTTGTCAGATTTGACGCTTCAGGGAATC. Animals overexpressing CSB-1::GFP were generated by injecting a fusion PCR product, combining genomic csb-1 sequence, obtained by PCR using primer combinations AGTGACTGTTGACGAATCCAGC and TCGTCGTCATCCTTGTAGTCCATTCTAGAAGTACTCGGTCCTGATGAA, with FLAG-GFP sequences. Following injection, the extrachromosomal transgene was integrated using ionizing radiation 128 . For overexpression of UVS-1::GFP, a PCR product including the endogenous promoter (1901 bp) was generated from genomic DNA of each respective uvs-1::AG knock-in animals, using primers CTTGGACTCATTTAGCTGCG and CGGGTGCGGGTGGACAACCTC (wild type: 5520bp, tm6134: 5079 bp, tm6311: 4997 bp), and injected into the full knock out uvs-1(emc80) mutant. RT-PCR and RT-qPCR For RT-PCR, animals were lysed in TRIzol (Qiagen) and RNA was purified using RNeasy spin columns (Qiagen). cDNA was generated using Superscript II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions. For RT-qPCR, RNA was isolated and cDNA generated from ten young adult animals per strain and condition using the Power SYBR Green Cells- to-Ct kit (Invitrogen) according to previous described method 129 . qPCR was performed using PowerUp SYBR Green Master Mix (Invitrogen), according to manufacturer’s instructions, with 58 °C as annealing temperature and 1 min elongation time. Primers used for RT-PCR and RT-qPCR are listed in Supplementary Table 2. cdc-42 and pmp-3 were used as reference genes. L1 larvae UV survival assay L1 larvae UV survival experiments were performed as previously described 67 , 71 . In brief, eggs were collected from adult animals by hypochlorite treatment and plated on five 6 cm NGM plates, seeded with HT115(DE3) bacteria, per UV dose. After 16 h, L1 larvae were irradiated at the indicated UV-B doses (Philips TL-12 tubes, 40W). Following a 48 h recovery period, the number of arrested (L1/L2 larvae) and developed (L3/L4/young adult) animals were counted and survival percentage was calculated. For depletion with the auxin derivative 5-Ph-IAA, L1 larvae were irradiated with 60 J/m 2 UV-B. After 4 h recovery, the irradiated L1 larvae were plated for 4 h on 6 cm NGM plates seeded with HT155(DE3) and containing 50 µM 5-Ph-IAA. Next, the animals were transferred to 6 cm NGM plates seeded with HT115(DE3) bacteria. After 40 h recovery, the number of arrested (L1/L2 larvae) and developed (L3/L4/young adult) animals were counted and survival percentage was calculated. Trabectedin survival assay Trabectedin (MCE) survival experiments were performed by collecting eggs from adult animals by hypochlorite treatment and hatching these in M9 buffer containing the indicated trabectedin concentrations, while rotating at room temperature for 16 h. After hatching, L1 larvae were washed twice with M9 buffer, and divided over three 6 cm NGM plates, seeded with HT115(DE3) bacteria, per concentration. After a 48 h recovery period, the number of arrested (L1/L2 larvae) and developed (L3/L4/young adult) animals was counted and survival percentages were calculated. Motility assay To assess neuromotor function, staged first day adult animals were mock treated or UV-irradiated (60 J/m 2 UV-B) and cultured for 72 h ( Fig. 1H ), after which the animals were placed in 5 μl M9 buffer and allowed to acclimatize for 30 s before the number of lateral body movements was counted for 30 s. Real-time imaging and FRAP in C. elegans For microscopy and fluorescence measurements of GFP and mScarlet3 knock-in strains, staged living animals were mounted on 2% agar pads in M9 buffer containing 10 mM NaN 3 (Sigma) and imaged on a Leica TCS SP8 microscope (Leica Microsystems). For measurement of CSB-1::AID::mScarlet3 fluorescence levels, animals were washed three times with M9 buffer and mock treated or irradiated (300 J/m 2 UV-B), after which animals were allowed to recover on NGM plates seeded with OP50 bacteria for 2 h. Fluorescence levels were quantified by determining the mean mScarlet3 intensity minus background levels of individual oocyte nuclei using ImageJ software. CSB-1 levels in the four most proximal oocytes were quantified. For measurement of AGF::AMA-1 mobility by FRAP, staged adult animals were immobilized, using a mixture of M9 buffer, levamisole (10 mM; Sigma) and polystyrene beads (Polyscience Inc.) on 6% agarose pads. For UV irradiation, animals were first washed three times with M9 buffer and irradiated on empty agar plates (80 J/m 2 UV-B) and allowed to recover on NGM plates seeded with OP50 bacteria for the indicated time periods. Animals were imaged using a Leica TCS SP8 microscope (Leica Miscrosystems) for a period of maximum 30 min. For FRAP, intestinal and hypodermal nuclei were imaged at 1400 Hz using a 488 nm laser at low power for 1.88 s. Next, GFP fluorescence in a small square (1.0 × 1.0 μm, zoom 10) was photobleached using high laser power. The photobleaching in the small square was first optimized such that the reduction in the overall nuclear fluorescence signal was only minimal. Fluorescence recovery was measured at low laser power every 18 ms until steady-state levels were reached. Fluorescent signals were normalized to the average fluorescence intensity before photobleaching and plotted as average of at least 2 to 3 cells per animal, for a total of at least 9 animals per condition, obtained in at least three independent experiments. The immobile fractions (F imm ) were determined using the fluorescence intensity measured immediately after UV (I 0 ) and the average steady-state fluorescent signal after complete recovery, from untreated (I final, unt ) and UV-treated cells (I final, UV ), and applying the formula: LAS AF software (Leica) was used for imaging and ImageJ software for quantification. RNAi experiments For RNAi knockdown experiments, RNAi bacteria from the Caenorhabditis elegans RNAi feeding library 110 were used. Control RNAi was vector pPD129.36 (a gift from Andrew Fire). RNAi knockdown was accomplished by growing wild type animals on NGM plates containing HT115(DE3) bacteria expressing gene-specific RNA for three generations before survival experiments were performed. Survival experiments were as described for L1 larvae UV survival assay. Protein prediction and alignments Protein prediction were obtained from FGENESH 83 and corresponding protein alignments were generated through CLUSTAL O (1.2.4) multiple sequence alignment and edited in Jalview 2.11.3.0. Quantification and Statistical Analysis Mean values and error bars indicating S.E.M. are shown for each experiment. Statistical significance was determined by two-way ANOVA followed by Šídák’s multiple comparisons test, as indicated in the legends for each experiment. All analyses were performed using Graph Pad Prism version 9 for Windows (GraphPad Software, La Jolla California USA). Author contributions MvdW and KLT performed all experiments. MS performed experiments that initiated this study. MvdW, KLT and HL designed experiments. JAM, WVM and HL conceptualized ideas and supervised experiments. MvdW and HL wrote the manuscript. All authors reviewed the manuscript. Competing interests The authors declare no competing interests Acknowledgements We thank Dr. G. Jansen for use of his injection microscope, Dr. Andrew Fire for plasmids and the Erasmus MC Optical Imaging Center for microscope support. Some strains were provided by the Caenorhabditis Genetics Center (funded by NIH Office of Research Infrastructure Programs P40 OD010440) and the National Bioresource Project for the nematode. This work was supported by the Netherlands Organization for Scientific Research (711.018.007). References 1. ↵ Mulderrig , L. et al. Aldehyde-driven transcriptional stress triggers an anorexic DNA damage response . Nature 2021 600:7887 600 , 158 – 163 ( 2021 ). OpenUrl CrossRef PubMed 2. Hoeijmakers , J . Genome maintenance mechanisms for preventing cancer . Nature 411 , 366 – 374 ( 2001 ). OpenUrl CrossRef PubMed Web of Science 3. ↵ Lindahl , T . Instability and decay of the primary structure of DNA . Nature 1993 362:6422 362 , 709 – 715 ( 1993 ). OpenUrl CrossRef PubMed Web of Science 4. ↵ Lans , H. , Hoeijmakers , J. H. J. , Vermeulen , W. & Marteijn , J. A . The DNA damage response to transcription stress . Nat Rev Mol Cell Biol 20 , 766 – 784 ( 2019 ). OpenUrl CrossRef PubMed 5. ↵ Milano , L. , Gautam , A. & Caldecott , K. W. DNA damage and transcription stress . Mol Cell 84 , ( 2024 ). 6. ↵ Schumacher , B. , Pothof , J. , Vijg , J. & Hoeijmakers , J. H. J . The central role of DNA damage in the ageing process . Nature 592 , 695 ( 2021 ). OpenUrl CrossRef PubMed 7. ↵ Gyenis , A. et al. Genome-wide RNA polymerase stalling shapes the transcriptome during aging . Nature Genetics 2023 55:2 55 , 268 – 279 ( 2023 ). OpenUrl CrossRef PubMed 8. ↵ Hanawalt , P. C. & Spivak , G . Transcription-coupled DNA repair: two decades of progress and surprises . Nat Rev Mol Cell Biol 9 , 958 – 970 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 9. ↵ Nieto Moreno , N. , Olthof , A. M. & Svejstrup , J. Q. Transcription-Coupled Nucleotide Excision Repair and the Transcriptional Response to UV-Induced DNA Damage . Annu Rev Biochem 92 , 81 – 113 ( 2023 ). OpenUrl CrossRef PubMed 10. ↵ Jia , N. et al. Dealing with transcription-blocking DNA damage: Repair mechanisms, RNA polymerase II processing and human disorders . DNA Repair (Amst) 106 , 103192 ( 2021 ). OpenUrl PubMed 11. ↵ Marteijn , J. A. , Lans , H. , Vermeulen , W. & Hoeijmakers , J. H. J . Understanding nucleotide excision repair and its roles in cancer and ageing . Nat Rev Mol Cell Biol 15 , 465 – 481 ( 2014 ). OpenUrl CrossRef PubMed 12. ↵ Schärer , O. D . Nucleotide Excision Repair in Eukaryotes . Cold Spring Harb Perspect Biol 5 , ( 2013 ). 13. ↵ Sugasawa , K. et al. Xeroderma pigmentosum group C protein complex is the initiator of global genome nucleotide excision repair . Mol Cell 2 , 223 – 232 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 14. ↵ Araki , M. et al. Centrosome protein centrin 2/caltractin 1 is part of the xeroderma pigmentosum group C complex that initiates global genome nucleotide excision repair . J Biol Chem 276 , 18665 – 18672 ( 2001 ). OpenUrl Abstract / FREE Full Text 15. ↵ Puumalainen , M. R. , Rüthemann , P. , Min , J. H. & Naegeli , H . Xeroderma pigmentosum group C sensor: Unprecedented recognition strategy and tight spatiotemporal regulation . Cellular and Molecular Life Sciences 73 , 547 – 566 ( 2016 ). OpenUrl CrossRef PubMed 16. ↵ Hoogstraten , D. et al. Versatile DNA damage detection by the global genome nucleotide excision repair protein XPC . J Cell Sci 121 , 2850 – 2859 ( 2008 ). OpenUrl Abstract / FREE Full Text 17. ↵ Yokoi , M. et al. The Xeroderma Pigmentosum Group C Protein Complex XPC-HR23B Plays an Important Role in the Recruitment of Transcription Factor IIH to Damaged DNA . Journal of Biological Chemistry 275 , 9870 – 9875 ( 2000 ). OpenUrl Abstract / FREE Full Text 18. ↵ Okuda , M. , Nakazawa , Y. , Guo , C. , Ogi , T. & Nishimura , Y . Common TFIIH recruitment mechanism in global genome and transcription-coupled repair subpathways . Nucleic Acids Res 45 , 13043 – 13055 ( 2017 ). OpenUrl CrossRef PubMed 19. ↵ Van Den Boom , V. , et al. DNA damage stabilizes interaction of CSB with the transcription elongation machinery . J Cell Biol 166 , 27 ( 2004 ). OpenUrl Abstract / FREE Full Text 20. ↵ Troelstra , C. et al. ERCC6, a member of a subfamily of putative helicases, is involved in Cockayne’s syndrome and preferential repair of active genes . Cell 71 , 939 – 953 ( 1992 ). OpenUrl CrossRef PubMed Web of Science 21. ↵ Xu , J. et al. Structural basis for the initiation of eukaryotic transcription-coupled DNA repair . Nature 551 , 653 – 657 ( 2017 ). OpenUrl CrossRef PubMed 22. ↵ Fischer , E. S. et al. The molecular basis of CRL4DDB2/CSA ubiquitin ligase architecture, targeting, and activation . Cell 147 , 1024 – 1039 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 23. Groisman , R. et al. The ubiquitin ligase activity in the DDB2 and CSA complexes is differentially regulated by the COP9 signalosome in response to DNA damage . Cell 113 , 357 – 367 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 24. ↵ Llerena Schiffmacher , D. A. , et al. The small CRL4CSA ubiquitin ligase component DDA1 regulates transcription-coupled repair dynamics . Nat Commun 15 , ( 2024 ). 25. ↵ Geijer , M. E. et al. Elongation factor ELOF1 drives transcription-coupled repair and prevents genome instability . Nat Cell Biol 23 , 608 – 619 ( 2021 ). OpenUrl CrossRef PubMed 26. ↵ van der Weegen , Y. et al. ELOF1 is a transcription-coupled DNA repair factor that directs RNA polymerase II ubiquitylation . Nat Cell Biol 23 , 595 – 607 ( 2021 ). OpenUrl CrossRef PubMed 27. ↵ Schwertman , P. et al. UV-sensitive syndrome protein UVSSA recruits USP7 to regulate transcription-coupled repair . Nat Genet 44 , 598 – 602 ( 2012 ). OpenUrl CrossRef PubMed 28. ↵ Zhang , X. et al. Mutations in UVSSA cause UV-sensitive syndrome and destabilize ERCC6 in transcription-coupled DNA repair . Nat Genet 44 , 593 – 597 ( 2012 ). OpenUrl CrossRef PubMed 29. ↵ Fei , J. & Chen , J. KIAA1530 protein is recruited by Cockayne syndrome complementation group protein A (CSA) to participate in transcription-coupled repair (TCR) . J Biol Chem 287 , 35118 – 35126 ( 2012 ). OpenUrl Abstract / FREE Full Text 30. ↵ van der Weegen , Y. et al. The cooperative action of CSB, CSA, and UVSSA target TFIIH to DNA damage-stalled RNA polymerase II . Nat Commun 11 , ( 2020 ). 31. ↵ Nakazawa , Y. et al. Mutations in UVSSA cause UV-sensitive syndrome and impair RNA polymerase IIo processing in transcription-coupled nucleotide-excision repair . Nat Genet 44 , 586 – 592 ( 2012 ). OpenUrl CrossRef PubMed 32. ↵ Groisman , R. et al. CSA-dependent degradation of CSB by the ubiquitin–proteasome pathway establishes a link between complementation factors of the Cockayne syndrome . Genes Dev 20 , 1429 ( 2006 ). OpenUrl Abstract / FREE Full Text 33. ↵ Nakazawa , Y. et al. Ubiquitination of DNA Damage-Stalled RNAPII Promotes Transcription-Coupled Repair . Cell 180 , 1228 – 1244 .e24 ( 2020 ). OpenUrl CrossRef PubMed 34. ↵ Tufegdžić Vidaković , A. , et al. Regulation of the RNAPII Pool Is Integral to the DNA Damage Response . Cell 180 , 1245 – 1261 .e21 ( 2020 ). OpenUrl CrossRef PubMed 35. ↵ Kokic , G. , Wagner , F. R. , Chernev , A. , Urlaub , H. & Cramer , P . Structural basis of human transcription–DNA repair coupling . Nature 598 , 368 ( 2021 ). OpenUrl CrossRef PubMed 36. ↵ Wilson , M. D. , Harreman , M. & Svejstrup , J. Q . Ubiquitylation and degradation of elongating RNA polymerase II: The last resort . Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1829 , 151 – 157 ( 2013 ). OpenUrl PubMed 37. ↵ Zhu , Q. et al. USP7-mediated deubiquitination differentially regulates CSB but not UVSSA upon UV radiation-induced DNA damage . Cell Cycle 19 , 124 – 141 ( 2020 ). OpenUrl PubMed 38. ↵ Theil , A. F. , Häckes , D. & Lans , H . TFIIH central activity in nucleotide excision repair to prevent disease . DNA Repair (Amst) 132 , ( 2023 ). 39. ↵ Laugel , V . Cockayne syndrome: the expanding clinical and mutational spectrum . Mech Ageing Dev 134 , 161 – 170 ( 2013 ). OpenUrl CrossRef PubMed 40. ↵ Nance , M. A. & Berry , S. A . Cockayne syndrome: review of 140 cases . Am J Med Genet 42 , 68 – 84 ( 1992 ). OpenUrl CrossRef PubMed Web of Science 41. ↵ Spivak , G. UV-sensitive syndrome. Mutation Research - Fundamental and Molecular Mechanisms of Mutagenesis 577 , 162 – 169 ( 2005 ). OpenUrl 42. ↵ Itoh , T. , Fujiwara , Y. , Ono , T. & Yamaizumi , M . UVs syndrome, a new general category of photosensitive disorder with defective DNA repair, is distinct from xeroderma pigmentosum variant and rodent complementation group I . Am J Hum Genet 56 , 1267 ( 1995 ). OpenUrl PubMed 43. ↵ Laugel , V. et al. Mutation update for the CSB/ERCC6 and CSA/ERCC8 genes involved in Cockayne syndrome . Hum Mutat 31 , 113 – 126 ( 2010 ). OpenUrl CrossRef PubMed 44. ↵ Horibata , K. et al. Complete absence of Cockayne syndrome group B gene product gives rise to UV-sensitive syndrome but not Cockayne syndrome . Proc Natl Acad Sci U S A 101 , 15410 – 15415 ( 2004 ). OpenUrl Abstract / FREE Full Text 45. ↵ Nardo , T. et al. A UV-sensitive syndrome patient with a specific CSA mutation reveals separable roles for CSA in response to UV and oxidative DNA damage . Proc Natl Acad Sci U S A 106 , 6209 – 6214 ( 2009 ). OpenUrl Abstract / FREE Full Text 46. ↵ Wang , Y. et al. Dysregulation of gene expression as a cause of Cockayne syndrome neurological disease . Proc Natl Acad Sci U S A 111 , 14454 – 14459 ( 2014 ). OpenUrl Abstract / FREE Full Text 47. ↵ Aamann , M. D. et al. Cockayne syndrome group B protein promotes mitochondrial DNA stability by supporting the DNA repair association with the mitochondrial membrane . FASEB J 24 , 2334 – 2346 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 48. Pascucci , B. et al. An altered redox balance mediates the hypersensitivity of Cockayne syndrome primary fibroblasts to oxidative stress . Aging Cell 11 , 520 – 529 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 49. Dianov , G. , Bischoff , C. , Sunesen , M. & Bohr , V. A . Repair of 8-oxoguanine in DNA is deficient in Cockayne syndrome group B cells . Nucleic Acids Res 27 , 1365 – 1368 ( 1999 ). OpenUrl CrossRef PubMed Web of Science 50. ↵ Menoni , H. et al. The transcription-coupled DNA repair-initiating protein CSB promotes XRCC1 recruitment to oxidative DNA damage . Nucleic Acids Res 46 , 7747 – 7756 ( 2018 ). OpenUrl CrossRef PubMed 51. ↵ Natale , V. & Raquer , H . Xeroderma pigmentosum-Cockayne syndrome complex . Orphanet J Rare Dis 12 , ( 2017 ). 52. ↵ Bregman , D. B. et al. UV-induced ubiquitination of RNA polymerase II: a novel modification deficient in Cockayne syndrome cells . Proc Natl Acad Sci U S A 93 , 11586 – 11590 ( 1996 ). OpenUrl Abstract / FREE Full Text 53. Steurer , B. & Marteijn , J. A . Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II . J Mol Biol 429 , 3146 – 3155 ( 2017 ). OpenUrl CrossRef PubMed 54. ↵ Jia , N. et al. Dealing with transcription-blocking DNA damage: Repair mechanisms, RNA polymerase II processing and human disorders . DNA Repair (Amst) 106 , ( 2021 ). 55. ↵ Meer , P. J. van der , Yakoub , G. , Nakazawa , Y. , Ogi , T. & Luijsterburg , M. S. Clearance of DNA damage-arrested RNAPII is selectively impaired in Cockayne syndrome cells . bioRxiv 2024.05.17.594644 ( 2024 ) doi: 10.1101/2024.05.17.594644 . OpenUrl Abstract / FREE Full Text 56. ↵ Gonzalo-Hansen , C. et al. Differential processing of RNA polymerase II at DNA damage correlates with transcription-coupled repair syndrome severity . Nucleic Acids Res 52 , 9596 – 9612 ( 2024 ). OpenUrl PubMed 57. ↵ Nieto Moreno , N. , Olthof , A. M. & Svejstrup , J. Q. Transcription-Coupled Nucleotide Excision Repair and the Transcriptional Response to UV-Induced DNA Damage . Annu Rev Biochem 92 , 81 – 113 ( 2023 ). OpenUrl CrossRef PubMed 58. ↵ Chiou , Y. Y. , Hu , J. , Sancar , A. & Selby , C. P . RNA polymerase II is released from the DNA template during transcription-coupled repair in mammalian cells . J Biol Chem 293 , 2476 – 2486 ( 2018 ). OpenUrl Abstract / FREE Full Text 59. ↵ Harreman , M. et al. Distinct ubiquitin ligases act sequentially for RNA polymerase II polyubiquitylation . Proc Natl Acad Sci U S A 106 , 20705 – 20710 ( 2009 ). OpenUrl Abstract / FREE Full Text 60. ↵ Anindya , R. , Aygün , O. & Svejstrup , J. Q . Damage-induced ubiquitylation of human RNA polymerase II by the ubiquitin ligase Nedd4, but not Cockayne syndrome proteins or BRCA1 . Mol Cell 28 , 386 – 397 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 61. ↵ Yasukawa , T. et al. Mammalian Elongin A complex mediates DNA-damage-induced ubiquitylation and degradation of Rpb1 . EMBO J 27 , 3256 – 3266 ( 2008 ). OpenUrl Abstract / FREE Full Text 62. ↵ Kuznetsova , A. V. et al. Von Hippel-Lindau protein binds hyperphosphorylated large subunit of RNA polymerase II through a proline hydroxylation motif and targets it for ubiquitination . Proc Natl Acad Sci U S A 100 , 2706 – 2711 ( 2003 ). OpenUrl Abstract / FREE Full Text 63. ↵ Starita , L. M. et al. BRCA1/BARD1 ubiquitinate phosphorylated RNA polymerase II . J Biol Chem 280 , 24498 – 24505 ( 2005 ). OpenUrl Abstract / FREE Full Text 64. ↵ Lans , H. & Vermeulen , W . Tissue specific response to DNA damage: C. elegans as role model . DNA Repair (Amst) 32 , 141 – 148 ( 2015 ). OpenUrl CrossRef PubMed 65. ↵ Gartner , A. & Engebrecht , J . DNA repair, recombination, and damage signaling . Genetics 220 , ( 2022 ). 66. ↵ Mueller , M. M. et al. DAF-16/FOXO and EGL-27/GATA promote developmental growth in response to persistent somatic DNA damage . Nat Cell Biol 16 , 1168 – 1179 ( 2014 ). OpenUrl CrossRef PubMed 67. ↵ Lans , H. et al. Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during developm . PLoS Genet 6 , ( 2010 ). 68. ↵ Sabatella , M. , Thijssen , K. L. , Davó-Martínez , C. , Vermeulen , W. & Lans , H . Tissue-Specific DNA Repair Activity of ERCC-1/XPF-1 . Cell Rep 34 , 108608 ( 2021 ). OpenUrl PubMed 69. ↵ Babu , V. , Hofmann , K. & Schumacher , B . A C. elegans homolog of the Cockayne syndrome complementation group A gene . DNA Repair (Amst) 24 , 57 – 62 ( 2014 ). OpenUrl PubMed 70. ↵ Astin , J. W. , O’Neil , N. J. & Kuwabara , P. E . Nucleotide excision repair and the degradation of RNA pol II by the Caenorhabditis elegans XPA and Rsp5 orthologues, RAD-3 and WWP-1 . DNA Repair (Amst) 7 , 267 – 280 ( 2008 ). OpenUrl CrossRef PubMed 71. ↵ van der Woude , M. & Lans , H . C. elegans survival assays to discern global and transcription-coupled nucleotide excision repair . STAR Protoc 2 , 100586 ( 2021 ). 72. ↵ Sulston , J. E. & Horvitz , H. R . Post-embryonic cell lineages of the nematode, Caenorhabditis elegans . Dev Biol 56 , 110 – 156 ( 1977 ). OpenUrl CrossRef PubMed Web of Science 73. ↵ Babu , V. & Schumacher , B . A C. elegans homolog for the UV-hypersensitivity syndrome disease gene UVSSA . DNA Repair (Amst) 41 , ( 2016 ). 74. ↵ Heimbucher , T. & Hunter , T . The C. elegans Ortholog of USP7 controls DAF-16 stability in Insulin/IGF-1-like signaling . Worm 4 , e1103429 ( 2015 ). OpenUrl PubMed 75. ↵ van der Woude , M. , Davó-Martínez , C. , Thijssen , K. L. , Vermeulen , W. & Lans , H . Recovery of protein synthesis to assay DNA repair activity in transcribed genes in living cells and tissues . Nucleic Acids Res 51 , e93 ( 2023 ). OpenUrl PubMed 76. ↵ Gago , F. & Hurley , L. H . Devising a Structural Basis for the Potent Cytotoxic Effects of Ecteinascidin 743 . Small Molecule DNA and RNA Binders 643 – 675 ( 2002 ) doi: 10.1002/3527601783.CH23 . OpenUrl CrossRef 77. ↵ Takebayashi , Y. et al. Antiproliferative activity of ecteinascidin 743 is dependent upon transcription-coupled nucleotide-excision repair . Nat Med 7 , 961 – 966 ( 2001 ). OpenUrl CrossRef PubMed Web of Science 78. ↵ Son , K. et al. Trabectedin derails transcription-coupled nucleotide excision repair to induce DNA breaks in highly transcribed genes . Nat Commun 15 , 1388 ( 2024 ). OpenUrl CrossRef PubMed 79. ↵ Gjorgjieva , J. , Biron , D. & Haspel , G . Neurobiology of Caenorhabditis elegans Locomotion: Where Do We Stand? Bioscience 64 , 476 – 486 ( 2014 ). OpenUrl CrossRef PubMed 80. ↵ Wienholz , F. et al. FACT subunit Spt16 controls UVSSA recruitment to lesion-stalled RNA Pol II and stimulates TC-NER . Nucleic Acids Res 47 , 4011 – 4025 ( 2019 ). OpenUrl CrossRef PubMed 81. ↵ Higa , M. , Zhang , X. , Tanaka , K. & Saijo , M . Stabilization of Ultraviolet (UV)-stimulated Scaffold Protein A by Interaction with Ubiquitin-specific Peptidase 7 Is Essential for Transcription-coupled Nucleotide Excision Repair . J Biol Chem 291 , 13771 – 13779 ( 2016 ). OpenUrl Abstract / FREE Full Text 82. ↵ Okuda , M. , Nakazawa , Y. , Guo , C. , Ogi , T. & Nishimura , Y . Common TFIIH recruitment mechanism in global genome and transcription-coupled repair subpathways . Nucleic Acids Res 45 , 13043 – 13055 ( 2017 ). OpenUrl CrossRef PubMed 83. ↵ Solovyev , V. , Kosarev , P. , Seledsov , I. & Vorobyev , D . Automatic annotation of eukaryotic genes, pseudogenes and promoters . Genome Biol 7 , S10 ( 2006 ). OpenUrl CrossRef PubMed 84. ↵ Thijssen , K. L. , et al. C. elegans TFIIH subunit GTF-2H5/TTDA is a non-essential transcription factor indispensable for DNA repair . Commun Biol 4 , ( 2021 ). 85. ↵ Gadella , T. W. J. et al. mScarlet3: a brilliant and fast-maturing red fluorescent protein . Nature Methods 2023 20:4 20 , 541 – 545 ( 2023 ). OpenUrl PubMed 86. ↵ Heppert , J. K. et al. Comparative assessment of fluorescent proteins for in vivo imaging in an animal model system . Mol Biol Cell 27 , 3385 ( 2016 ). OpenUrl Abstract / FREE Full Text 87. ↵ Meyer , J. N. et al. Decline of nucleotide excision repair capacity in aging Caenorhabditis elegans . Genome Biol 8 , ( 2007 ). 88. ↵ Boyd , W. A. et al. Mutation Research / Fundamental and Molecular Mechanisms of Mutagenesis Nucleotide excision repair genes are expressed at low levels and are not detectably inducible in Caenorhabditis elegans somatic tissues, but their function is required for normal adu . 683 , 57 – 67 ( 2010 ). OpenUrl 89. ↵ Lopes , A. F. C. et al. A C. elegans model for neurodegeneration in Cockayne syndrome . Nucleic Acids Res 48 , 10973 – 10985 ( 2020 ). OpenUrl CrossRef PubMed 90. Boyd , W. A. et al. Nucleotide excision repair genes are expressed at low levels and are not detectably inducible in Caenorhabditis elegans somatic tissues, but their function is required for normal adult life after UVC exposure . Mutation Research - Fundamental and Molecular Mechanisms of Mutagenesis 683 , 57 – 67 ( 2010 ). OpenUrl 91. ↵ Muniesa-Vargas , A. et al. Persistent TFIIH binding to non-excised DNA damage causes cell and developmental failure . Nat Commun 15 , ( 2024 ). 92. ↵ Higa , M. , Zhang , X. , Tanaka , K. & Saijo , M . Stabilization of Ultraviolet (UV)-stimulated Scaffold Protein A by Interaction with Ubiquitin-specific Peptidase 7 Is Essential for Transcription-coupled Nucleotide Excision Repair . Journal of Biological Chemistry 291 , 13771 – 13779 ( 2016 ). OpenUrl Abstract / FREE Full Text 93. ↵ Wang , W. , Walmacq , C. , Chong , J. , Kashlev , M. & Wang , D . Structural basis of transcriptional stalling and bypass of abasic DNA lesion by RNA polymerase II . Proc Natl Acad Sci U S A 115 , E2538 – E2545 ( 2018 ). OpenUrl Abstract / FREE Full Text 94. Mullenders , L . DNA damage mediated transcription arrest: Step back to go forward . DNA Repair (Amst) 36 , 28 – 35 ( 2015 ). OpenUrl CrossRef PubMed 95. Sarker , A. H. et al. Recognition of RNA polymerase II and transcription bubbles by XPG, CSB, and TFIIH: insights for transcription-coupled repair and Cockayne Syndrome . Mol Cell 20 , 187 – 198 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 96. Tan , Y. et al. STK19 is a transcription-coupled repair factor that participates in UVSSA ubiquitination and TFIIH loading . Nucleic Acids Res 52 , 12767 – 12783 ( 2024 ). OpenUrl CrossRef PubMed 97. Ramadhin , A. R. et al. STK19 drives transcription-coupled repair by stimulating repair complex stability, RNA Pol II ubiquitylation, and TFIIH recruitment . Mol Cell 84 , 4740 – 4757 .e12 ( 2024 ). OpenUrl PubMed 98. ↵ van den Heuvel , D. , et al. STK19 facilitates the clearance of lesion-stalled RNAPII during transcription-coupled DNA repair . Cell 187 , 7107 – 7125 .e25 ( 2024 ). OpenUrl PubMed 99. ↵ Houtsmuller , A. B. & Vermeulen , W . Macromolecular dynamics in living cell nuclei revealed by fluorescence redistribution after photobleaching . Histochem Cell Biol 115 , 13 – 21 ( 2001 ). OpenUrl CrossRef PubMed Web of Science 100. ↵ Vermeulen , W . Dynamics of mammalian NER proteins . DNA Repair (Amst) 10 , 760 – 771 ( 2011 ). OpenUrl CrossRef PubMed 101. ↵ Steurer , B. et al. DNA damage-induced transcription stress triggers the genome-wide degradation of promoter-bound Pol II . Nature Communications 2022 13:1 13 , 1 – 18 ( 2022 ). OpenUrl PubMed 102. ↵ Zhang , L. , Ward , J. D. , Cheng , Z. & Dernburg , A. F . The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans . Development (Cambridge) 142 , 4374 – 4384 ( 2015 ). OpenUrl Abstract / FREE Full Text 103. ↵ Hills-Muckey , K. et al. An engineered, orthogonal auxin analog/AtTIR1(F79G) pairing improves both specificity and efficacy of the auxin degradation system in Caenorhabditis elegans . Genetics 220 , ( 2022 ). 104. ↵ Weems , J. C. et al. Cockayne syndrome B protein regulates recruitment of the Elongin A ubiquitin ligase to sites of DNA damage . J Biol Chem 292 , 6431 – 6437 ( 2017 ). OpenUrl Abstract / FREE Full Text 105. ↵ Aune , G. J. et al. Von Hippel-Lindau-coupled and transcription-coupled nucleotide excision repair-dependent degradation of RNA polymerase II in response to trabectedin . Clin Cancer Res 14 , 6449 – 6455 ( 2008 ). OpenUrl Abstract / FREE Full Text 106. ↵ Kleiman , F. E. et al. BRCA1/BARD1 inhibition of mRNA 3’ processing involves targeted degradation of RNA polymerase II . Genes Dev 19 , 1227 – 1237 ( 2005 ). OpenUrl Abstract / FREE Full Text 107. ↵ He , J. , Zhu , Q. , Wani , G. & Wani , A. A . UV-induced proteolysis of RNA polymerase II is mediated by VCP/p97 segregase and timely orchestration by Cockayne syndrome B protein . Oncotarget 8 , 11004 – 11019 ( 2017 ). OpenUrl CrossRef PubMed 108. Verma , R. , Oania , R. , Fang , R. , Smith , G. T. & Deshaies , R. J . Cdc48/p97 mediates UV-dependent turnover of RNA Pol II . Mol Cell 41 , 82 – 92 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 109. ↵ Zhu , Y. et al. Coordination of transcription-coupled repair and repair-independent release of lesion-stalled RNA polymerase II . Nat Commun 15 , ( 2024 ). 110. ↵ Kamath , R. S. et al. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi . Nature 421 , 231 – 237 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 111. ↵ Sugasawa , K. et al. A multistep damage recognition mechanism for global genomic nucleotide excision repair . Genes Dev 15 , 507 ( 2001 ). OpenUrl Abstract / FREE Full Text 112. ↵ Mitchell , D. L. & Nairn , R. S . The biology of the (6-4) photoproduct . Photochem Photobiol 49 , 805 – 819 ( 1989 ). OpenUrl CrossRef PubMed Web of Science 113. ↵ Hartman , P. S. , Hevelone , J. , Dwarakanath , V. & Mitchell , D. L . Excision Repair of Uv Radiation-Induced DNA Damage in Caenorhabditis Elegans . Genetics 122 , 379 ( 1989 ). OpenUrl Abstract / FREE Full Text 114. ↵ Van Der Pluijm , I. et al. Impaired genome maintenance suppresses the growth hormone-insulin-like growth factor 1 axis in mice with cockayne syndrome . PLoS Biol 5 , 0023 – 0038 ( 2007 ). OpenUrl CrossRef 115. Jaarsma , D. et al. Age-Related Neuronal Degeneration: Complementary Roles of Nucleotide Excision Repair and Transcription-Coupled Repair in Preventing Neuropathology . PLoS Genet 7 , e1002405 ( 2011 ). OpenUrl CrossRef PubMed 116. ↵ Van Der Horst , G. T. J. et al. UVB radiation-induced cancer predisposition in Cockayne syndrome group A (Csa) mutant mice . DNA Repair (Amst) 1 , 143 – 157 ( 2002 ). OpenUrl CrossRef PubMed 117. ↵ Woudstra , E. C. et al. A Rad26-Def1 complex coordinates repair and RNA pol II proteolysis in response to DNA damage . Nature 415 , 929 – 933 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 118. ↵ Zhu , Y. et al. Coordination of transcription-coupled repair and repair-independent release of lesion-stalled RNA polymerase II . Nature Communications 2024 15:1 15 , 1 – 15 ( 2024 ). OpenUrl CrossRef PubMed 119. ↵ Muniesa-Vargas , A. , Theil , A. F. , Ribeiro-Silva , C. , Vermeulen , W. & Lans , H . XPG: a multitasking genome caretaker . Cell Mol Life Sci 79 , ( 2022 ). 120. ↵ Kashiyama , K. et al. Malfunction of nuclease ERCC1-XPF results in diverse clinical manifestations and causes Cockayne syndrome, xeroderma pigmentosum, and Fanconi anemia . Am J Hum Genet 92 , 807 – 819 ( 2013 ). OpenUrl CrossRef PubMed 121. ↵ Hoeijmakers , J. H. J . DNA damage, aging, and cancer . N Engl J Med 361 , 1475 – 1485 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 122. ↵ Lopes , I. , Altab , G. , Raina , P. & de Magalhães , J. P . Gene Size Matters: An Analysis of Gene Length in the Human Genome . Front Genet 12 , ( 2021 ). 123. ↵ Soheili-Nezhad , S. , Ibáñez-Solé , O. , Izeta , A. , Hoeijmakers , J. H. J. & Stoeger , T . Time is ticking faster for long genes in aging . Trends in Genetics 40 , 299 – 312 ( 2024 ). OpenUrl CrossRef PubMed 124. ↵ Gorbunova , V. , Seluanov , A. , Mao , Z. & Hine , C . Changes in DNA repair during aging . Nucleic Acids Res 35 , 7466 – 7474 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 125. ↵ Brenner , S . The genetics of Caenorhabditis elegans . Genetics 77 , ( 1974 ). 126. ↵ Dokshin , G. A. , Ghanta , K. S. , Piscopo , K. M. & Mello , C. C . Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in Caenorhabditis elegans . Genetics 210 , 781 – 787 ( 2018 ). OpenUrl Abstract / FREE Full Text 127. ↵ Pham , K. , Masoudi , N. , Leyva-Díaz , E. & Hobert , O . A nervous system-specific subnuclear organelle in Caenorhabditis elegans . Genetics 217 , 1 – 17 ( 2021 ). OpenUrl CrossRef PubMed 128. ↵ Mello , C. C. , Kramer , J. M. , Stinchcomb , D. & Ambros , V . Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences . EMBO J 10 , 3959 – 3970 ( 1991 ). OpenUrl CrossRef PubMed Web of Science 129. ↵ Chauve , L. et al. High-Throughput Quantitative RT-PCR in Single and Bulk C. elegans Samples Using Nanofluidic Technology . J Vis Exp 2020 , 1 – 12 ( 2020 ). OpenUrl CrossRef PubMed 130. Ribeiro-Silva , C. et al. Ubiquitin and TFIIH-stimulated DDB2 dissociation drives DNA damage handover in nucleotide excision repair . Nat Commun 11 , ( 2020 ). View the discussion thread. Back to top Previous Next Posted March 22, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following RNA polymerase II processing facilitates DNA repair and prevents DNA damage-induced neuronal and developmental failure Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share RNA polymerase II processing facilitates DNA repair and prevents DNA damage-induced neuronal and developmental failure Melanie van der Woude , Karen L. Thijssen , Mariangela Sabatella , Jurgen A. Marteijn , Wim Vermeulen , Hannes Lans bioRxiv 2025.03.21.644538; doi: https://doi.org/10.1101/2025.03.21.644538 Share This Article: Copy Citation Tools RNA polymerase II processing facilitates DNA repair and prevents DNA damage-induced neuronal and developmental failure Melanie van der Woude , Karen L. Thijssen , Mariangela Sabatella , Jurgen A. Marteijn , Wim Vermeulen , Hannes Lans bioRxiv 2025.03.21.644538; doi: https://doi.org/10.1101/2025.03.21.644538 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Molecular Biology Subject Areas All Articles Animal Behavior and Cognition (7642) Biochemistry (17715) Bioengineering (13907) Bioinformatics (42003) Biophysics (21470) Cancer Biology (18624) Cell Biology (25533) Clinical Trials (138) Developmental Biology (13390) Ecology (19935) Epidemiology (2067) Evolutionary Biology (24356) Genetics (15617) Genomics (22529) Immunology (17753) Microbiology (40432) Molecular Biology (17200) Neuroscience (88681) Paleontology (667) Pathology (2840) Pharmacology and Toxicology (4828) Physiology (7653) Plant Biology (15171) Scientific Communication and Education (2046) Synthetic Biology (4304) Systems Biology (9826) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.